TECHNICAL FIELD
[0001] The invention relates to development of a novel biotechnologically produced anti-cancer
preparation, namely to a genetically stable oncolytic RNA virus, a method for manufacturing
the oncolytic virus, and use thereof.
BACKGROUND ART
[0004] EP 1537872 discloses the use of an ECHO-7 virus in the active immunotherapy of tumours. Virus
was recovered from the intestinal tract, and isolated in a human primary embryonic
cell culture. Page 2, paragraph 18 states that nonpathogenic serotypes of virus (in
particular ECHO 7), were selected. Virus was cultured in tumour tissue, then in human
embryonic fibroblasts, and the process repeated. The virus obtained was demonstrated
as being able to improve survival in patients with skin melanomas.
[0006] In order to increase the potential of virus so selectively infect cancer cells and
heighten the oncolytic activity, a number of modified viruses have been disclosed.
They are characterised by deletion of specific genes, thus preventing their propagation
in normal cells, or integration of additional genes for improving the oncolytic properties.
[0007] However, the limited knowledge concerning the genetical modifications that provide
for selectivity and efficiency against the tumour cells, results in modified viruses
with lower cytolytic activity, compared to origin, or higher anti-virus response of
human immune system (
S.Meerani, Yang Yao, Oncolytic viruses in cancer therapy. European Journal of Scientific
Research, vol. 40 no.1 (2010), pp.156-171;
Han Hsi Wong, Nicholas R. Lemoine,Yaohe Wang, Viruses 2010, 2, 78-106).
[0009] One of the most serious adverse properties of non-modified ECHO type viruses, including
ECHO 7, is their ability to cause infections that may have a fatal result (
Wreghitt T.G., Gandy G.M., King A., Sutehall G., Fatal neonatal ECHO 7 virus infection,
The Lancet, vol. 324, p.465, 1984). These viruses are known to be responsible for hand, foot and mouth disease in Malaysia
(
http://www.vadscorner.com/echovirus7.html), for myocarditis in leukemic child (
Midula M., Marzetti G., Borra G., Sabatino G., Myocarditis associated with ECHO 7
type infection in leukemic child, Acta Paediatrica Volume 65, Issue 4, pp. 649-651,
July 1976), aseptic meningitis, paralytic disease and fever (
http://virology-online.com/viruses/Enteroviruses6.htm).
[0010] Therefore pathogenicity is one of the major limitations that must be overcome in
using ECHO 7 type viruses in treating cancer patients.
DISCLOSURE OF THE INVENTION
[TECHNICAL PROBLEM]
[0011] Therefore, the problem to solve was the development a highly efficient, selective
oncolytic virus without pathogenicity in normal cells and low immunological response,
and possessing high genetic stability.
[SOLUTION TO PROBLEM]
[0012] This problem was surprisingly solved by a targeted modification of a single-strand
RNA virus by developing a method that utilized the high mutation potential of single
strand RNA virus in combination with a specifically targeted selection of mutants,
providing for fast separation from the pool of mutant species with high and selective
oncolytic activity. Many cancer cells are resistant to the virus (the virus can not
enter the cell and survive there). By careful selection of cell lines where the virus
is modified and by proper pretreatment of the cancer cells it is possible to create
a genetically stable and non-pathogenic virus for cancer treatment.
SHORT DESCRIPTION OF THE INVENTION
[0013] We have developed a method for modifying the native ECHO 7 virus, identified by genome
sequence SeqNo2, the method comprising initially conducting the virus adaptation in
cancer cells, attenuated by an anti-cancer agent such as dacarbazine, passaging the
modified virus in human embryonal fibroblast culture, propagation in human melanoma
cells and passaging in human embryonal fibroblast culture, optionally treated by ribavirin,
isolation of the virus and purification of the virus. The virus can be isolated and
purified by known methods.
[0014] More than one type of cell lines can be used during conducting the virus adaptation.
[0015] The invention is as set out in claims 1-12.
BRIEF DESCRIPTION OF THE APPENDICES CONTAINING THE SEQUENCES (which appendices are
part of the description)
[0016]
Appendix 1: Nucleotide sequence of the modified virus(Seq ID No 1)
Appendix 2: Nucleotide sequence of the unmodified (native) virus (Seq ID No 2)
Appendix 3. Nucleotide sequence of the modified virus after propagation for 12 months
(Seq ID No 3)
Appendix 4. Comparison of genomes of the modified virus and unmodified (native) virus
(Seq ID No 4)
Appendix 5. Comparison of amino acid sequences of the modified virus and unmodified
(native) virus (Seq ID No 5).
DETAILED DESCRIPTION OF THE INVENTION
[0017] We have unexpectedly discovered the suitability for this purpose of a known Echo
7 type
Picornaviridae enterovirus, isolated from a human intestine. The original nucleotide sequence, determined
by a standard method, was found to be rather similar to that of Wallace type
Picornaviridae Enterovirus.
[0018] Checking the oncolytic activity of isolated native enteroviruses in tissue of angiosarcoma
demonstrated that neither individual viruses nor their combinations in a dose 3x10
5 TCID
50/0.03 ml possessed substantial oncolytic activity with exception of ECHO 7 type that
showed more promising activity (Table 1).

[0019] The instability of the genome of the RNA single strand viruses is a well-known fact;
therefore, such viruses usually are not selected for constructing oncolytic viral
agents.
[0020] The modification of the isolated native virus was realised in several consecutive
steps.
[0021] The first step takes advantage of the high mutation potential of RNA viruses (on
average one mutation on each replication) to develop a cytopathic mutant by replicating
the virus in trypsinized monolayer of human embryonic fibroblast culture in presence
of calf serum.
[0022] Cells were incubated for 10 days, carrying out the passage each time when the cells
in culture had degenerated for 50%.
[0023] Testing the selected virus in RD cell culture a pronounced cytopathic effect was
observed already in 24 hours after infection. The titer of the developed virus, determined
by last dilution method was TCID
50=1 x 10
-8.
[0024] This strain was propagated, isolated and stored at -70 °C for further use in producing
selective and genetically stable oncolytic strain.
[0025] The virus so obtained was modified, using specially developed method comprising three
steps.
1st modification step in a first tumour cell line
[0026] In the first modification step, the virus was propagated in tumour cell lines attenuated
by anticancer agent. Human breast adenocarcinoma cell line (MCF-7) was used in this
step.
[0027] A monolayer of these cells was treated with dacarbazine DTIC in sub toxic dose (20
µM). After treating with dacarbazine, the cells were transferred to fresh culture
medium and contacted with the virus, and the propagation continued without adding
serum. After 24 hours from contacting with the virus, the cells were removed and the
virus was isolated from the media.
[0028] The virus was repeatedly propagated (passaged) in human embryonic fibroblast cell
culture and again used for infecting the MCF-7 cell line. This procedure was repeated
10 times. Thus, this modification step comprises alternately propagating the virus
in human breast adenocarcinoma cells and human embryonic fibroblast cells.
2nd modification step in a second tumour cell line
[0029] In the next modification step, the virus as described above, was contacted with gastric
adenocarcinoma cell culture. A monolayer of these cells was treated with dacarbazine
DTIC in sub toxic dose (20 µM).
[0030] The monolayer of these cells was infected by the virus, which was isolated after
the modification in the first step, and the propagation continued in a culture medium
without serum.
[0031] After 24 hours from contacting with the virus, the cells were removed and virus isolated
from the media. The virus was repeatedly propagated (passaged) in human embryonic
fibroblast cell culture, and thereafter again used for infecting the gastric adenocarcinoma
cell line. This procedure was repeated 10 times. Thus, this second modification step
comprises alternately propagating the virus in gastric adenocarcinoma cells and in
human embryonic fibroblast cells.
[0032] In the first modification step and in the second modification step, the propagation
procedure was always finished by propagating the virus last in the human embryonic
fibroblast culture.
3rd modification step in human melanoma cells
[0033] The virus produced in the second step was used for infecting human tumours, obtained
in surgery.
[0034] Melanoma cancer tissues were obtained in surgery from 23 patients previously treated
by chemotherapy.
[0035] Tissues were infected by the modified virus and incubated at 37 °C in the absence
of carbon dioxide. Before being used for infecting a new tissue material (fresh melanoma
tissue from another patient), the modified virus was repeatedly propagated in human
embryonic fibroblast culture to titer 7 lg TCID
50/1 ml.
[0036] The modified virus was propagated in human embryonic fibroblast cell culture that
was treated by 5 mM ribavirin 7 hours before infection and cultivated for 24 hours.
The virus was isolated from the culture, and the procedure of propagating the virus
in the fibroblast culture was repeated 10 times.
[0037] Finally, the virus was isolated, purified and propagated in human embryonic fibroblast
culture without addition of ribavirin.
[0038] The propagated virus was used for sequence determination. The genome of the modified
virus differs from that of frozen unmodified native virus (Echo 7 type Wallace strain
from NCBI database) for about 10%, the coat part for about 12%.
[0039] The virus modified by the described method was found to be surprisingly stable. Its
genome changed for only 0.7% after continuous passaging for 12 months (propagation
for 12 months in human embryonal lung culture MRC 5).
[0040] Especially important is the fact that the modified virus (further on MV) is characterised
by exceptionally high cytopathic effect on malignant cells and low cytotoxicity on
normal cell lines as well as no toxicity
in vivo in mice.
[0041] In experiments with cell lines MV was found to be cytotoxic for melanoma cell lines
FM9, FM55, FM94 and SK-Mel26, gastric carcinoma cells, human oral squamous cell carcinoma
SCC25 cells, human epithelial cell line derived from a lung carcinoma (A549), acute
monocyte leukemia THP-1 cells, rabdomyosarcoma RD cells, human pancreatic adenocarcinoma
HPAF-II cells, human breast adenocarcinoma cells (MCF-7) as well as on primary cell
cultures of gastric adenocarcinoma GC1 and thyroid cancer line HA007.
[0042] In animal experiments, MV caused regression of murine sarcoma M-1, mice fibrosarcoma
MX-17 as well as transplantable tumours - Moloney sarcoma (SM) and KRS-321 sarcoma.
[0043] In a clinical pilot study, a group of 46 melanoma stage I patients no progress of
melanoma was observed for 50 months in 43 patients, treated with MV. In the control
group, melanoma progressed for 10 of 31 patients undergoing standard therapy.
[0044] In a 50 months study of 44 stage II melanoma patients the progress of melanoma was
stopped in 38 patients, compared to control group of 36 patients undergoing standard
therapy, where melanoma did not progress in 15 patients, but did progress in 21 patient.
No serious adverse effects were observed for patients treated with MV.
INDUSTRIAL APPLICABILITY
[0045] We have developed a novel virus strain (MV) with original genome sequence, stable
against genetic drift, possessing cytopathic activity against various types of tumours,
characterized by low incidence of adverse effects and low toxicity that can be used
with advantage in cancer virotherapy. Thus, we have unexpectedly solved the main obstacle
in wider use of RNA viruses in medicine - obtained genetically stable strain that
can be used in standardized continuous manufacturing of oncolytic viral preparation.
The viral preparation can be used in anticancer therapy against a variety of tumour
cells.
EXAMPLES
[0046] The present invention is described in Examples in more detail. However, the invention
is not construed as being limited to the examples.
Virus
[0047] The virus modified according to the invention is ECHO-7 virus (Picornaviridae family,
Enterovirus genus, ECHO (Enteric Cytopathic Human Orphan) type 7, group IV, positive-sense
single stranded RNA virus).
Example 1. The isolation and characterization of the original virus strain
[0048] A known method for isolation (
A.C. Rentz, J.E. Libbey, R.S. Fujinami, F.G. Whitby, and C.L. Byington. Investigation
of Treatment Failure in Neonatal Echovirus 7 Infection. The Pediatric Infectious Disease
Journal, Volume 25, Number 3, March 2006, 259) and propagation in BS-C-1 cell line (CCL 26; ATCC) was used (
Libbey JE, McCright IJ, Tsunoda I, et al. Peripheral nerve protein, P0, as a potential
receptor for Theiler's murine encephalomyelitis virus. J Neurovirol. 2001;7:97-104.
Pevear DC, Tull TM, Seipel ME, et al. Activity of pleconaril against enteroviruses.
Antimicrob Agents Chemother. 1999;43:2109-2115). Virus propagation and determination of titer was conducted in concordance with
the published method (
Zurbriggen A, Fujinami RS. A neutralization-resistant Theiler's virus variant produces
an altered disease pattern in the mouse central nervous system. J Virol. 1989;63:1505-1513).
Example 2. Virus modification
[0049] In the first modification step, the virus was propagated in tumour cell lines attenuated
by an anticancer agent. Initially, for propagation was used the human breast adenocarcinoma
cell culture (MCF-7), cultivated in DME medium (Sigma-Aldrich) with 10% serum (Gibco)
and antibiotics (100 IU/ml penicillin, 100 IU/ml streptomycin) at 37 °C under atmosphere,
containing 5% CO
2 untill developing of the monolayer.
[0050] The obtained monolayer of these cells was treated with dacarbazine DTIC in sub toxic
dose (20 µM). After treating with dacarbazine cells were transferred to fresh culture
medium without added serum, the cells contacted with virus and the propagation continued.
[0051] After 24 hours from contacting with the virus the cells were removed and virus isolated
from the media. The virus was repeatedly propagated in human embryonal fibroblast
cell culture and again used for infecting the MCF-7 cell line. This procedure was
repeated 10 times.
[0052] In the next, second step, the virus as described above, was contacted with gastric
adenocarcinoma cell culture. The cell culture for propagation was cultivated in DME
medium (Sigma-Aldrich) with 10% serum (Gibco) and antibiotics (100 IU/ml penicillin,
100 IU/ml streptomycin) at 37 °C under atmosphere, containing 5% CO
2 untill developing of the monolayer.
[0053] The obtained monolayer of these cells was treated with dacarbazine DTIC in sub toxic
dose (20 µM). After treating with dacarbazine cells were transferred to fresh culture
medium without added serum, the cells contacted with virus and the propagation continued.
[0054] After 24 hours from contacting with the virus the cells were removed and virus isolated
from the media. The virus was repeatedly propagated in human embryonal fibroblast
cell culture and again used for infecting the gastric adenocarcinoma cell line. This
procedure was repeated 10 times.
[0055] In the third step, the virus produced in the second step was used for infecting human
tumours, obtained in surgery. Melanoma cancer tissues were obtained in surgery from
23 patients previously treated by chemotherapy.
[0056] The tumour cells were separated from fat cells, necrotic tissue and blood, kept at
0 °C for 24 hours, fragmented and as approximately 0.1 cm
3 large tissue pieces immersed in Eagle medium (4 ml of medium for 10 mg of tissue),
infected with the prepared virus and incubated in the absence of carbon dioxide at
37 °C.
[0057] The medium was replaced by a fresh portion every day until the destruction of tumour,
determined morphologically and visually by the oxidation level of medium.
[0058] The virus titer was determined every day in tumor tissue fee medium sample. The reproduction
rate of virus was determined from the virus titer at the conclusion of an experiment
in comparison with that on Day 0. Such modification of virus was performed in tissues
obtained from 23 patients.
[0059] Before being used for infecting a new tissue material, the modified virus was each
time repeatedly propagated in human embryonal fibroblast culture to titer 7 Ig TCID
50/1
-ml.
[0060] The modified virus was propagated in human embryonal fibroblast cell culture that
was treated by 5 mM ribavirin 7 hours before infection and cultivated for 24 hours.
Virus was isolated from culture medium, and the procedure repeated 10 times.
[0061] Finally, the virus was isolated, purified and propagated in human embryonal fibroblast
culture without addition of ribavirin.
[0062] The propagated virus sample was used for determination of genome sequence, anticancer
activity and replicative stability by passaging it for 12 months in human embryonal
fibroblast culture with repeated determination of genome sequence (Appendix 1).
Example 3. Determination of virus genome sequence
[0064] For this purpose, 96 enteroviruses with complete genome sequence were selected from
the NCBI Gene bank. The complete genome sequences for these viruses were downloaded
and compared by Vector NTI program.
[0065] Based on the results of comparing the most conservative regions of virus genomes
were determined and 13 degenerated oligonucleotide pairs selected in these regions,
covering the length of the potential enteroviruses genome. After the synthesis of
the first 13 fragments, another 13 nucleotide pairs were produced. These oligonucleotide
pairs were virus-specific and designed so as to produce overlaying fragments. After
the building of the full genome sequence the virus genome was repeatedly sequenced
with the virus-specific primers.
Example 3.1. The genome sequence of the unmodified (native) virus
[0066] The sequence of the native virus was produced from 26 separate overlapping PCR fragments,
synthesized from the primers listed in Table 2.
Table 2. Primers used to sequence the complete genome of viruses.
| Primer |
Sequence (5'- 3') |
Length (bp) |
Position |
Target region |
| Eo7-1F |
TTAAAACAGCCTGTGGGTTG |
20 |
1-20 |
5'UTR |
| Eo7-1R |
GAAACACGGACACCCAAAGTAG |
22 |
545-566 |
5'UTR |
| Eo7-2F |
CCATGGGACGCTTCAATACT |
20 |
391-410 |
5'UTR |
| Eo7-2R |
GCACCAGTCTTTTGTGTCGA |
20 |
758-777 |
VP4 |
| Eo7-3F |
CGACTACTTTGGGTGTCCGTGTTTC |
25 |
542-566 |
5' UTR |
| Eo7-3R |
TCDGGRAAYTTCCACCACCACCC |
23 |
1178-1200 |
VP2 |
| Eo7-4F |
CGACAGGGTGAGATCCCTAA |
20 |
979-998 |
VP2 |
| Eo7-4R |
TTTCACCCTTCGTGAGGTTC |
20 |
1381-1400 |
VP2 |
| Eo7-5F |
GCATCYAARTTYCAYCARGG |
20 |
1289-1308 |
VP2 |
| Eo7-5R |
CACATKGGKGCAATSGTGAC |
20 |
1676-1695 |
VP2 |
| Eo7-6F |
GTGGATCAACTTGCGCACTA |
20 |
1513-1532 |
VP2 |
| Eo7-6R |
AAATTGTGGCATAGCCGAAG |
20 |
1797-1816 |
VP3 |
| Eo7-7F |
GTCACSATTGCMCCMATGTG |
20 |
1676-1695 |
VP2 |
| Eo7-7R |
CTTNATRCTYCCTGACCAGTGTG |
23 |
2055-2077 |
VP3 |
| Eo7-8F |
AAGCATGGACGCATATCACA |
20 |
1921-1940 |
VP3 |
| Eo7-8R |
GATATGGGTTCCCACATTGC |
20 |
2174-2194 |
VP3 |
| Eo7-9F |
CACACTGGTCAGGRAGYATNAAG |
23 |
2055-2077 |
VP3 |
| Eo7-10F |
CAAGTGTGTCGTCCTGTGCT |
20 |
2350-2369 |
VP3 |
| Eo7-9R |
CCTATTGGCGCTGTCTTGAT |
20 |
2694-2713 |
VP1 |
| Eo7-11F |
ACCAAAGATCAAGACAGCGC |
20 |
2687-2706 |
VP1 |
| Eo7-11R |
TTGGCACCCACACTCTGATA |
20 |
3178-3197 |
VP1 |
| Eo7-12F |
ACCAGTCCGGTGCTGTTTAC |
20 |
3336-3355 |
VP1-2A |
| Eo7-12R |
TCCCAYACACARTTYTGCCAGTC |
23 |
3401-3423 |
2A |
| Eo7-13F |
CARAAYTGTGTGTGGGAAGACTA |
23 |
3407-3429 |
2A |
| Eo7-13R |
CCCTGYTCCATKGCTTCATCYTCYARC |
27 |
3748-3774 |
2A-2B |
| Eo7-14F |
TTACCCAGTCACCTTCGAGG |
20 |
3535-3554 |
2A |
| Eo7-14R |
TGTTTTTCCTTCACTTCCGG |
20 |
4181-4200 |
2C |
| Eo7-15F |
GTTRGARGATGATGCNATGGARCARGG |
27 |
3748-3774 |
2A-2B |
| Eo7-15R |
TCAATACGGYRTTTGSWCTTGAA |
23 |
4409-4431 |
2C |
| Eo7-16F |
CCTYTRTAYGCVGCYGARGC |
20 |
4343-4362 |
2C |
| Eo7-17F |
TTCAAGWSCAAAYRCCGTATTGA |
23 |
4409-4431 |
2C |
| Eo7-16R |
AAYTGAATGGCCTTHCCACACAC |
23 |
4922-4944 |
2C |
| Eo7-18F |
CTDGTGTGTGGRAAGGCYATNCA |
23 |
4919-4941 |
2C |
| Eo7-18R |
TATGCTCCYTGRAARCCTGCAAA |
23 |
5309-5330 |
3A-3B |
| Eo7-19F |
CAAGCCCTAACCACGTTTGT |
20 |
5252-5271 |
3A |
| Eo7-19R |
ACCCGTAGTCAGTCACCTGG |
20 |
5740-5759 |
3C |
| Eo7-20F |
TTTGCAGGMTTYCARGGWGCATA |
23 |
5309-5330 |
3A-3B |
| Eo7-20R |
GCYCTWGTGGGRAAGTTRTACAT |
23 |
5723-5745 |
3C |
| Eo7-21F |
GTGTTGGATGCCAAGGAACT |
20 |
5555-5574 |
3C |
| Eo7-21R |
ATGGGCTCCGATCTGATGTC |
20 |
6203-6222 |
3D |
| Eo7-22F |
TTCCCCACWAGRGCAGGCCARTGYGG |
26 |
5907-5832 |
3C |
| Eo7-22R |
CTCCAAAABASRTCYGGGTCRCA |
23 |
6572-6594 |
3D |
| Eo7-23F |
TGAAGGAATGCATGGACAAA |
20 |
6360-6379 |
3D |
| Eo7-23R |
ATGGGTATTGCTCATCTGCC |
20 |
7078-7097 |
3D |
| Eo7-24F |
TGYGACCCRGAYSTVTTTTGGAG |
23 |
6572-6594 |
3D |
| Eo7-24R |
TCRTGDATDTCYTTCATGGGCA |
22 |
7116-7137 |
3D |
| Eo7-25F |
CCTGGACGAATGTGACCTTT |
20 |
7041-7060 |
3D |
| Eo7-25R |
CCCTACCGCACTTTTATCCA |
20 |
7384-7403 |
3'UTR |
| Eo7-26F |
ATCCAYGARTCHATYAGRTGGAC |
23 |
7130-7152 |
3D |
| Eo7-26R |
CCGCACCGAATGCGGAGAATTTAC |
24 |
7404-7427 |
3'UTR |
| UTR - untranslated region. |
[0067] The 5'-terminal and the 3'-terminal sequences were obtained, using 5'-RACE and 3'-RACE
methods, correspondingly.
[0068] As a result, the full genome sequence of the unmodified virus was found to consist
of 7434 nucleotides, excluding the poly A sequence (Appendix 2; Seq ID No 2).
[0069] The untranslatable 5'-terminal (5'NTR) contains 742 nucleotides, followed by coding
part starting with start codon (AUG) at position 743, containing codons for 2196 amino
acids and ending with stop codon (UAA) at position 7331 (Appendix 2). The untranslatable
3'-terminal (3'NTR) of this strain contains 100 nucleotides, followed by poly A sequence.
Example 3.2. The sequence of the modified virus (MV)
[0070] The sequence of the starting virus was produced from 26 separate overlapping PCR
fragments, synthesized using the primers listed in Table 2.
[0071] The 5'-terminal and the 3'-terminal sequences were obtained, using 5'-RACE and 3'-RACE
methods, correspondingly.
[0072] As a result, the full genome sequence of the modified virus was found to consist
of 7427 nucleotides, excluding the poly A sequence (Appendix 1; Seq ID No 1).
[0073] The untranslatable 5'-terminal (5'NTR) of this strain contains 742 nucleotides, followed
by the coding sequence. The coding part that contains information about the virus
polyprotein, begins with the start codon (AUG) at position 743, contains codons for
2194 amino acids and ends with stop codon (UAA) at position 7325 (Appendix 1). The
untranslatable 3'-terminal (3'NTR) of this strain contains 100 nucleotides, followed
by poly A sequence.
Example 3.3. The genome sequence of the modified virus after propagation for 12 months
[0074] The sequence of the modified virus was produced from 26 separate overlapping PCR
fragments, synthesized the primers listed in Table 2.
[0075] The 5'-terminal and the 3'-terminal sequences of this strain were obtained, using
5'-RACE and 3'-RACE methods, correspondingly.
[0076] As a result, the full genome sequence of the modified virus was found to consist
of 7427 nucleotides, excluding the poly a sequence (Appendix 3). The untranslatable
5'-terminal (5'NTR) contains 742 nucleotides, followed by coding part, starting with
start codon (AUG) at position 743, containing codons for 2194 amino acids and ending
with stop codon (UAA) at position 7325 (Appendix 3). The untranslatable 3'-terminal
(3'NTR) of this strain contains 100 nucleotides, followed by poly A sequence.
Example 3.4. Comparison of genomes of modified virus (MV) and native strain
[0077] Comparison of genomes of modified virus (MV) and starting strain is provided in Appendix
4.
[0078] The difference in nucleotide sequence, calculated by programme Vector NTI is substantial,
10% for the complete genome and 12% for the part coding the virus coat proteins. The
amino acid sequences for the modified and starting strains are listed in Appendix
5.
Example 3.5. The genome sequence of the modified virus after propagation for 12 months
[0079] The changes in the sequence of modified virus (MV) genome after continuous passaging
for 12 months did not exceed 0.7% of the initial sequence.
[0080] All found changes were one nucleotide replacements, partially the mute mutations
(without change of amino acid). If the amino acid was changed, its position was in
the genome polymorphic part, evidently without relevant influence on virus activity.
Example 4. Virus passaging
[0081] Virus MV was passaged by known methods and propagated for 12 months in human embryonal
lung culture MRC 5 (Instituto Zooprofilattico Sperimentale della Lombardia e dell
Emilia, Brescia - Laboratorio Centro Substrati Cellulari, Catalogue No. BS CL 68 (origin:
American Type Culture centre Collection, Rockville, Md, USA), free of bacteria, viruses,
fungi or mycoplasmas, and later stored frozen at -70 °C.
Example 5. Determination of anti-cancer activity of the modified virus (MV)
[0082] In experiments with cell lines, MV was found to cytotoxic for melanoma cell lines
FM9, FM55, FM94 and SK-Mel26, gastric carcinoma cells, human oral squamous cell carcinoma
SCC25 cells, human epithelial cell line derived from a lung carcinoma (A549), acute
monocyte leukemia THP-1 cells, rabdomiosarcoma RD cells, human pancreatic adenocarcinoma
HPAF-II cells, human breast adenocarcinoma cells (MCF-7) as well as on primary cell
cultures of gastric adenocarcinoma GC1 and thyroid cancer line HA007.
[0083] Thus, for example, MV injections for 3 days caused reducing of sarcoma M-1 mass in
55% (in 11 of 22) of animals, compared with 6% (in 1 of 18) spontaneous regression
in the control group.
[0084] Transplanting sarcoma KRS-321 on Day 5 after the injecting MV in a dose 15x10
6 TCID
50 on Wistar rats in 44% of animals (11/25) the regression of tumour was observed, while
in the control group there were no cases of regression.
[0085] Testing the anti-cancer activity of the virus sample after the 12 months passaging
on the same cancer cell lines and transplanted tumours no statistically significant
difference from the original MV was observed.
[0086] Neither MV nor the virus passaged for 12 months caused any toxic reactions in intact
mice.
Example 6. Anti-cancer activity of modified virus in treating patients
[0087] Treating of melanoma patients by the modified virus (MV) was conducted according
to the following scheme: therapy was commenced 2-3 weeks after the excision of the
tumour by intramuscular administration of 2 ml of solution with titer 2×10
6 TCID
50/ml - 2×10
8 TCID
50/ml for 3 days consecutively with supporting injections at monthly intervals according
to the same 3 day schedule. After the fourth month, the virus preparation was administered
once monthly for the next 8 months. In the next 2 years the supporting therapy was
continued with the same dose, gradually increasing the interval between administrations
to 6, 8 and 12 weeks.
[0088] In a clinical pilot study, a group of 46 melanoma stage I patients no progress of
melanoma was observed for 50 months in 43 patients, treated with MV. In the control
group, melanoma progressed for 10 of 31 patients undergoing standard therapy.
[0089] In a 50 months study of 44 stage II melanoma patients the progress of melanoma was
stopped in 38 patients, compared to control group of 36 patients undergoing standard
therapy, where melanoma did not progress in 15 patients, but did progress in 21 patients.
[0090] The efficiency of treatment is characterized by the following examples:
Case 1. Female, age 76 , Melanoma cutis dorsi
Op. 11.09.2009. Excisio tu cutis dorsi
pT4b N0 M0
SN biopsy was not performed
Ex consilio: follow-up
Op. 07.04.2010. LAE axillaris sin.
Mts I/n axillaris sin
Ex consilio: Roferon
Roferon 6 mil 3x per week from 24.06.2010 till 30.08.2010.
The treatment was discontinued due to the side effects.
From October 2010 the therapy with virus preparation in 2 ml dose with titer 2×106 TCID50/ml - 2×108 TCID50/ml was commenced. The treatment was well tolerated, and no progression of the disease
was documented until 01.02.2012.
Case 2. Female, age 42 , Melanoma cutis dorsi
Op. 25.05.2008. Excisio tu cutis dorsi
pT4a N0 M0, Clark V, Breslow 9 mm
SN biopsy was not performed
Virus preparation (2 ml with titer 2×106 TCID50/ml - 2×108 TCID50/ml was administered from 27.06.2008 till 27.06.2011.
21.01.2011. US examination: recurrence in the scar
Op. 02.02.2011. Excisio. Histological examination: granuloma.
Virus preparation (2 ml with titer 2×106 TCID50/ml - 2×108 TCID50/ml was continued till 27.06.2011.
During the observation period (till December 2011) no evidence of the disease progression
was documented.
Case 3. Female, age 57 , Melanoma cutis dorsi
Op.19.08.2007. Excisio tu cutis dorsi
P T3b N0 M0
SN biopsy was not performed
Recommendations: follow-up
Op. 10.12.2009. LAE colli dx. Histological examination: mts l/n colli dx Progression of the disease - US examination on 22.02.2010: mts l/n colli 22.02.2010. Ex consilio: no surgery was recommended due to bulky disease Virus preparation (2 ml with titer
2×106 TCID50/ml - 2×108 TCID50/ml was administered from 22.02.2010 and still is in progress.
Last visit at clinic on 22.11.2011 - the disease has stabilized.
Case 4. Female, age 58 , Melanoma cutis dorsi
Op. April 2004. Excisio tu cutis dorsi, LAE axillaris sin.
pT4b, N2c, M0 (Breslow 15 mm)
Reexcisio January 2006, September 2006 (local recurrence)
Therapy with IFN from October 2006 till May 2007.
Reexcisio cum dermoplasticum February 2007, May 2007, September 2007. Virus preparation (2 ml with titer 2×106 TCID50/ml - 2×108 TCID50/ml was administrated from February 2008 till April 2011.
Visceral metastasis February 2011.
Exitus letalis October 2011.
Dose form and administration
[0091] The viral preparation for therapeutic treatment can be in the form of injectable
aqueous solution containing the modified virus having the stable genome sequence as
explained above, for example in the titer of 2×10
6 TCID
50/ml - 2×10
8 TCID
50/ml. The solution carrying the virus can be any physiologically acceptable sterile
solution, especially sodium chloride solution. The preparation is stored and transported
in frozen condition and defrozen at room temperature before the use. The preparation
can be in vials or other container units in volumes that correspond a single dose
injected at a time to the patient.
[0092] The preparation can be administered by injecting it intramuscularly (
i.m.) to the patient after the excision of the tumour in question, when the wouknd has
healed. The dosage can be 2 ml of the above-mentioned solution at a time The intramuscular
administration by injection is repeated according to the planned therapy schedule
Appendix 1: Seq ID No 1
Sequence of the modified virus
Appendix 2: Seq ID No 2
Sequence of the unmodified (native) virus
Appendix 3: Seq ID No 3
Sequence of the modified virus after propagation for 12 months
Appendix 4: Seq ID No 4
Comparison of genomes of the unmodified (native) virus and modified virus
Appendix 5: Seq ID No 5
Comparison of amino acid sequences of the unmodified (native) virus and modified virus
[0097]
N: Unmodified (native) virus
M: Modified virus

Sequence identity: 91%
1. Modified enterovirus of ECHO 7 type characterized by a genome sequence that has at least 85%, preferably at least 95%, still more preferably
at least 99% of sequence identical to Seq ID No 1 ; and
wherein changes in the sequence of the genome of the modified enterovirus are not
larger than 0.7% after continuous propagation of the modified enterovirus in cell
cultures for 12 months.
2. Modified enterovirus of ECHO 7 type, characterized by the genome sequence of Seq ID No 1.
3. Method for manufacturing a modified enterovirus of ECHO 7 type by modification of
native ECHO 7 virus, identified by genome sequence Seq ID No 2, wherein the modification
comprises conducting the virus adaptation in cancer cells, attenuated by an anti-cancer
agent, subsequently passaging the modified virus in human embryonal fibroblast culture,
propagating the modified virus in human melanoma cells, and subsequently passaging
the modified virus in human embryonal fibroblast culture, optionally treated by ribavirin,
and isolation and purification of the virus.
4. Method of claim 3, wherein the procedure of propagating the virus in cancer cells
and subsequently passaging the modified virus in human embryonal fibroblast culture
is repeated several times.
5. Method of claim 3 or 4, wherein the procedure of propagating the modified virus in
human melanoma cells, and subsequently passaging the modified virus in human embryonal
fibroblast culture is repeated several times.
6. Method of claim 3, 4 or 5, wherein the virus adaptation is conducted in cancer cells
of at least two different cancers, such as human breast adenocarcinoma cells and gastric
adenocarcinoma cells.
7. Method of any of claims 3-6, wherein the modification gives a modified enterovirus
of ECHO 7 type, which is characterized by a genome sequence that has at least 85%, preferably at least 95%, still more preferably
at least 99% of sequence identical to Seq ID No 1; and wherein in the modified enterovirus
changes in the sequence of the genome are not larger than 0.7% after continuous propagation
of the modified enterovirus in cell cultures for 12 months
8. Method of claim 7, wherein the modification gives a modified enterovirus of ECHO 7
type, which is characterized by a genome sequence of Seq ID No 1.
9. Method of claim 7 or 8, wherein the changes are one nucleotide replacements, which
consist partly of mute mutations without change of corresponding amino acid.
10. The virus of claim 1 or 2 for use in treating oncological diseases.
11. The virus for use of claim 10, wherein the oncological disease is selected from the
group consisting of: melanoma, gastric cancer, intestinal cancer, human breast cancer,
prostate cancer, pancreatic cancer, lung cancer, kidney cancer, bladder cancer, lymphosarcoma,
uterine cancer, angiosarcoma, rhabdomyosarcoma.
12. The virus for use of claim 10 wherein the oncological disease is melanoma.
1. Modifiziertes Enterovirus vom Typ ECHO 7, gekennzeichnet durch eine Genomsequenz, die mindestens 85%, vorzugsweise mindestens 95%, noch mehr bevorzugt
mindestens 99% sequenzidentisch mit Seq ID Nr. 1 ist; und
worin Änderungen in der Genomsequenz des modifizierten Enterovirus nach kontinuierlicher
Vermehrung des modifizierten Enterovirus in Zellkulturen über 12 Monate nicht größer
als 0,7% sind.
2. Modifiziertes Enterovirus vom Typ ECHO 7, gekennzeichnet durch die Genomsequenz Seq ID Nr. 1.
3. Verfahren zur Herstellung eines modifizierten Enterovirus vom Typ ECHO 7 durch Modifikation
eines nativen ECHO-7-Virus, identifiziert durch Genomsequenz Seq ID Nr. 2, worin die
Modifikation die Durchführung der Virusadaption in durch ein Anti-Krebsmittel abgeschwächten
Krebszellen umfasst, anschließendes Passagieren des modifizierten Virus in humaner
embryonaler Fibroblastenkultur, Vermehren des modifizierten Virus in humanen Melanomzellen
und anschließendes Passagieren des modifizierten Virus in humaner embryonaler Fibroblastenkultur,
gegebenenfalls behandelt mit Ribavirin und Isolierung und Reinigung des Virus.
4. Verfahren nach Anspruch 3, worin die Maßnahme zur Vermehrung des Virus in Krebszellen
und anschließendes Passagieren des modifizierten Virus in humaner embryonaler Fibroblastenkultur
mehrfach wiederholt werden.
5. Verfahren nach Anspruch 3 oder 4, worin die Maßnahme zur Vermehrung des modifizierten
Virus in humanen Melanomzellen und anschließendes Passagieren des modifizierten Virus
in humaner embryonaler Fibroblastenkultur mehrfach wiederholt werden.
6. Verfahren nach Anspruch 3,4 oder 5, worin die Adaption des Virus in den Krebszellen
von mindestens zwei verschiedenen Krebsarten durchgeführt wird, wie z.B. humanen Mamma-Adenokarzinom-
und gastrischen Adenokarzinomzellen.
7. Verfahren nach einem der Ansprüche 3-6, worin die Modifikation ein modifiziertes Enterovirus
vom Typ ECHO 7 ergibt, welches durch eine Genomsequenz gekennzeichnet ist, die mindestens
85%, vorzugsweise mindestens 95%, noch mehr bevorzugt mindestens 99% sequenzidentisch
mit Seq ID Nr. 1 ist; und worin Änderungen in der Genomsequenz des modifizierten Enterovirus
nach kontinuierlicher Vermehrung des modifizierten Enterovirus in Zellkulturen über
12 Monate nicht größer als 0,7% sind.
8. Verfahren nach Anspruch 7, worin die Modifikation ein modifiziertes Enterovirus vom
Typ ECHO 7 ergibt, welches durch die Genomsequenz Seq ID Nr. 1 gekennzeichnet ist.
9. Verfahren nach Anspruch 7 oder 8, worin die Änderungen Ein-Nukleotid-Austausche sind,
die teilweise aus stummen Mutationen ohne Änderung der entsprechenden Aminosäure bestehen.
10. Das Virus nach Anspruch 1 oder 2 zur Verwendung in der Behandlung von onkologischen
Erkrankungen.
11. Das Virus zur Verwendung nach Anspruch 10, worin die onkologische Erkrankung aus der
Gruppe ausgewählt ist, bestehend aus: Melanom, Magenkrebs, Darmkrebs, humanem Brustkrebs,
Prostatakrebs, Bauchspeicheldrüsenkrebs, Lungenkrebs, Nierenkrebs, Blasenkrebs, Lymphosarkom,
Gebärmutterkrebs, Angiosarkom, Rhabdomyosarkom.
12. Das Virus zur Verwendung nach Anspruch 10, worin die onkologische Erkrankung ein Melanom
ist.
1. Entérovirus modifié de type ECHO 7 caractérisé par une séquence du génome qui présente au moins 85 %, préférentiellement au moins 95
%, plus préférentiellement encore au moins 99 % de séquence identique à SEQ ID NO
: 1 ; et
les changements dans la séquence du génome de l'entérovirus modifié n'étant pas de
plus de 0,7 % après la propagation continue de l'entérovirus modifié dans des cultures
cellulaires pendant 12 mois.
2. Entérovirus modifié de type ECHO 7, caractérisé par la séquence du génome de SEQ ID NO : 1.
3. Procédé de fabrication d'un entérovirus modifié de type ECHO 7 par modification du
virus ECHO 7 natif, identifié par la séquence du génome SEQ ID NO : 2, la modification
comprenant la conduction d'une adaptation du virus dans des cellules cancéreuses,
atténuées par un agent anticancéreux, repiquage subséquent du virus modifié dans une
culture de fibroblastes embryonnaires humains, propagation du virus modifié dans des
cellules de mélanome humain, et repiquage subséquent du virus modifié dans une culture
de fibroblastes embryonnaires humains, optionnellement traitée par de la ribavirine,
et isolement et purification du virus.
4. Procédé selon la revendication 3, dans lequel la procédure de propagation du virus
dans des cellules cancéreuses et de repiquage subséquent du virus modifié dans une
culture de fibroblastes embryonnaires humains est répétée plusieurs fois.
5. Procédé selon la revendication 3 ou 4, dans lequel la procédure de propagation du
virus modifié dans des cellules de mélanome humain, et de repiquage subséquent du
virus modifié dans une culture de fibroblastes embryonnaires humains est répétée plusieurs
fois.
6. Procédé selon la revendication 3, 4 ou 5, dans lequel l'adaptation du virus est conduite
dans des cellules cancéreuses d'au moins deux cancers différents, telles que des cellules
d'adénocarcinome du sein humain et des cellules d'adénocarcinome gastrique.
7. Procédé selon l'une quelconque des revendications 3 à 6, dans lequel la modification
donne un entérovirus modifié de type ECHO 7, qui est caractérisé par une séquence du génome qui présente au moins 85 %, de préférence au moins 95 %, de
façon encore davantage préférée au moins 99 % d'identité avec SEQ ID NO : 1; et dans
lequel dans l'entérovirus modifié les changements dans la séquence du génome ne sont
pas de plus de 0,7 % après la propagation en continu de l'entérovirus modifié dans
des cultures cellulaires pendant 12 mois.
8. Procédé selon la revendication 7, dans lequel la modification donne un entérovirus
modifié de type ECHO 7, qui est caractérisé par une séquence du génome de SEQ ID NO : 1.
9. Procédé selon la revendication 7 ou 8, dans lequel les changements sont des remplacements
d'un nucléotide, qui consistent partiellement en des mutations muettes sans changement
de l'acide aminé correspondant.
10. Virus selon la revendication 1 ou 2 pour une utilisation dans le traitement de maladies
oncologiques.
11. Virus pour une utilisation selon la revendication 10, la maladie oncologique étant
choisie dans le groupe constitué de : mélanome, cancer gastrique, cancer intestinal,
cancer du sein humain, cancer de la prostate, cancer pancréatique, cancer du poumon,
cancer du rein, cancer de la vessie, lymphosarcome, cancer utérin, angiosarcome, rhabdomyosarcome.
12. Virus pour une utilisation selon la revendication 10, la maladie oncologique étant
un mélanome.