Background
[0001] The present invention relates to use of mice that are engineered to contain exogenous
human immunoglobulin gene DNA for producing immunoglobulin (Ig) light chains.
[0002] In order to get around the problems of humanizing antibodies a number of companies
set out to generate mice with human immune systems. The strategy used was to knockout
the heavy and light chain loci in ES cells and complement these genetic lesions with
transgenes designed to express the human heavy and light chain genes. Although fully
human antibodies could be generated, these models have several major limitations:
- (i) The size of the heavy and light chain loci (each several Mb) made it impossible
to introduce the entire loci into these models. As a result the transgenic lines recovered
had a very limited repertoire of V-regions, most of the constant regions were missing
and important distant enhancer regions were not included in the transgenes.
- (ii) The very low efficiency of generating the large insert transgenic lines and the
complexity and time required to cross each of these into the heavy and light chain
knockout strains and make them homozygous again, restricted the number of transgenic
lines which could be analysed for optimal expression.
- (iii) Individual antibody affinities rarely reached those which could be obtained
from intact (non-transgenic) animals.
[0003] WO2007117410 discloses chimaeric constructs for expressing chimaeric antibodies.
[0004] WO2010039900 discloses knock in cells and mammals having a genome encoding chimaeric antibodies.
WO2011/158009,
US2003/217373 and
WO2011163314 also relate to transgenic mice for producing human antibodies. The present disclosure
provides, inter alia, a process for the generation in non-human mammals of antibodies
that comprise a human Ig variable region, and further provides non-human animal models
for the generation of such antibodies.
Summary of the Invention
[0005] All nucleotide co-ordinates for the mouse are those corresponding to NCBI m37 for
the mouse C57BL/6J strain, e.g. April 2007 ENSEMBL Release 55.37h, e.g. NCBI37 July
2007 (NCBI build 37) (e.g. UCSC version mm9 see World Wide Web (
www) genome.ucsc.edu and World Wide Web (
www) genome.ucsc.edu/FAQ/FAQreleases.html) unless otherwise specified. Human nucleotides
coordinates are those corresponding to GRCh37 (e.g. UCSC version hg 19, World Wide
Web (
www) genome.ucsc.edu/FAQ/FAQreleases.html), Feb 2009 ENSEMBL Release 55.37, or are those
corresponding to NCBI36, Ensemble release 54 unless otherwise specified. Rat nucleotides
are those corresponding to RGSC 3.4 Dec 2004 ENSEMBL release 55.34w, or Baylor College
of Medicine HGSC v3.4 Nov 2004 (e.g., UCSC rn4, see World Wide Web (
www) genome.ucsc.edu and World Wide Web (
www) genome.ucsc.edu/FAQ/FAQreleases.html) unless otherwise specified.
[0006] The invention is set out in the claims.
[0007] In the present disclosure, methods are disclosed for constructing a chimaeric human
heavy and light chain loci in a non-human mammal, for example a mouse. Reference to
work in mice herein is by way of example only, and reference to mice is taken to include
reference to all non-human mammals unless otherwise apparent from the disclosure,
with mice being preferred as the non-human mammal.
[0008] In one aspect the disclosure relates to a non-human mammal whose genome comprises:
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) optionally one or more human Ig light chain kappa V regions and one or more human
Ig light chain kappa J regions upstream of the host non-human mammal kappa constant
region and/or one or more human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies,
or chimaeric light or heavy chains, having a non-human mammal constant region and
a human variable region.
[0009] In one aspect the disclosure relates to non-human mammal whose genome comprises
- (a) a plurality of human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions upstream of the host non-human mammal kappa constant region
and/or a plurality of human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region; and
- (b) optionally one or more human IgH V regions, one or more human D regions and one
or more human J regions upstream of the host non-human mammal constant region;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies,
or chimaeric light or heavy chains, having a non-human mammal constant region and
a human variable region.
[0010] In one aspect the disclosure relates to non-human mammalian cell whose genome comprises
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region and
- (b) optionally one or more human Ig light chain kappa V regions and one or more human
Ig light chain kappa J regions upstream of the host non-human mammal kappa constant
region and/or one or more human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region.
[0011] In one aspect the disclosure relates to a non-human mammalian cell whose genome comprises
- (a) a plurality of human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions upstream of the host non-human mammal kappa constant region
and/or a plurality of human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region; and
- (b) optionally one or more human IgH V regions, one or more human D regions and one
or more human J regions upstream of the host non-human mammal constant region;
[0012] In a further aspect the disclosure relates to a method for producing a non-human
cell or mammal comprising inserting into a non-human mammal cell genome, such as an
ES cell genome;
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) optionally one or more human Ig light chain kappa V regions and one or more human
Ig light chain kappa J regions upstream of the host non-human mammal kappa constant
region and/or one or more human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region; respectively, the insertion being such that the non-human cell or mammal is
able to produce a repertoire of chimaeric antibodies having a non-human mammal constant
region and a human variable region, wherein steps (a) and (b) can be carried out in
either order and each of steps (a) and (b) can be carried out in a stepwise manner
or as a single step. Insertion may be by homologous recombination.
[0013] In a further aspect the disclosure relates to a method for producing an antibody
or antibody chain specific to a desired antigen the method comprising immunizing a
transgenic non-human mammal as disclosed herein with the desired antigen and recovering
the antibody or antibody chain.
[0014] In a further aspect the disclosure relates to a method for producing a fully humanised
antibody comprising immunizing a transgenic non-human mammal as disclosed herein with
the desired antigen, recovering the antibody or cells producing the antibody and then
replacing the non-human mammal constant region with a human constant region, for example
by protein or DNA engineering.
[0015] In a further aspect the disclosure relates to humanised antibodies and antibody chains
produced according to the present disclosure, both in chimaeric (for example, mouse-human)
and fully humanised form, as well as fragments and derivatives of said antibodies
and chains, and use of said antibodies, chains and fragments in medicine, including
diagnosis.
[0016] In a further aspect the disclosure relates to use of a non-human mammal as described
herein as a model for the testing of drugs and vaccines.
[0017] In one aspect the disclosure relates to a non-human mammal whose genome comprises:
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) optionally one or more human Ig light chain kappa V regions and one or more human
Ig light chain kappa J regions upstream of the host non-human mammal kappa constant
region and/or one or more human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies
or antibody chains having a non-human mammal constant region and a human variable
region.
[0018] In a further aspect the disclosure relates to a non-human mammal whose genome comprises:
- (a) a plurality of human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions upstream of the host non-human mammal kappa constant region
and/or a plurality of human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region; and
- (b) optionally one or more human IgH V regions, one or more human D regions and one
or more human J regions upstream of the host non-human mammal constant;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies
having a non-human mammal constant region and a human variable region.
[0019] Optionally the non-human mammal genome is modified to prevent expression of fully
host-species specific antibodies.
[0020] In one aspect the inserted human DNA comprises at least 50% of the human heavy chain
variable (V) genes, such as at least 60%, at least 70%, at least 80%, at least 90%,
and in one aspect all of the human V genes.
[0021] In one aspect the inserted human DNA comprises at least 50% of the human heavy chain
diversity (D) genes, such as at least 60%, at least 70%, at least 80%, at least 90%,
and in one aspect all of the human D genes.
[0022] In one aspect the inserted human DNA comprises at least 50% of the human heavy chain
joining (J) genes, such as at least 60%, at least 70%, at least 80%, at least 90%,
and in one aspect all of the human J genes.
[0023] In one aspect the inserted human DNA comprises at least 50% of the human light chain
Variable (V) genes, such as at least 60%, at least 70%, at least 80%, at least 90%,
and in one aspect all of the human light chain V genes.
[0024] In one aspect the inserted human DNA comprises at least 50% of the human light chain
joining (J) genes, such as at least 60%, at least 70%, at least 80%, at least 90%,
and in one aspect all of the human light chain J genes.
[0025] The inserted human genes may be derived from the same individual or different individuals,
or be synthetic or represent human consensus sequences.
[0026] Although the number of V D and J regions is variable between human individuals, in
one aspect there are considered to be 51 human V genes, 27 D and 6 J genes on the
heavy chain, 40 human V genes and 5 J genes on the kappa light chain and 29 human
V genes and 4 J genes on the lambda light chain (
Janeway and Travers, Immunobiology, Third edition)
[0027] In one aspect the human heavy chain locus inserted into the non-human mammal contains
the full repertoire of human V, D and J regions, which in the genome is in functional
arrangement with the non-human mammal constant regions such that functional chimaeric
antibodies can be produced between the human variable and non-human mammal constant
regions. This total inserted human heavy chain genetic material is referred to herein
as the human IgH VDJ region, and comprises DNA from a human genome that encodes all
the exons encoding human V,D and J portions and suitably also the associated introns.
Similarly, reference to the human Ig light chain kappa V and J regions herein refers
to human DNA comprising all the exons encoding V and J regions and suitably also the
associated introns of the human genome. Reference to the human Ig light chain lambda
V and J regions herein refers to human DNA comprising all the exons encoding V and
J regions and suitably also the associated introns of the human genome.
[0028] Human variable regions are suitably inserted upstream of a non-human mammal constant
region, the latter comprising all of the DNA required to encode the full constant
region or a sufficient portion of the constant region to allow the formation of an
effective chimaeric antibody capable of specifically recognising an antigen.
[0029] In one aspect the chimaeric antibodies or antibody chains have a part of a host constant
region sufficient to provide one or more effector functions seen in antibodies occurring
naturally in a host mammal, for example that they are able interact with Fc receptors,
and/or bind to complement.
[0030] Reference to a chimaeric antibody or antibody chain having a host non mammal constant
region herein therefore is not limited to the complete constant region but also includes
chimaeric antibodies or chains which have all of the host constant region, or a part
thereof sufficient to provide one or more effector functions. This also applies to
non-human mammals and cells and methods of the disclosure in which human variable
region DNA may be inserted into the host genome such that it forms a chimaeric antibody
chain with all or part of a host constant region. In one aspect the whole of a host
constant region is operably linked to human variable region DNA.
[0031] The host non-human mammal constant region herein is preferably the endogenous host
wild-type constant region located at the wild type locus, as appropriate for the heavy
or light chain. For example, the human heavy chain DNA is suitably inserted on mouse
chromosome 12, suitably adjacent the mouse heavy chain constant region.
[0032] In one aspect the insertion of the human DNA, such as the human VDJ region is targeted
to the region between the J4 exon and the Cµ locus in the mouse genome IgH locus,
and in one aspect is inserted between co-ordinates 114,667,090 and 114,665,190, or
at co-ordinate 114,667,091, after 114,667,090. In one aspect the insertion of the
human DNA, such as the human light chain kappa VJ is targeted into mouse chromosome
6 between co-ordinates 70,673,899 and 70,675,515, suitably at position 70,674,734,
or an equivalent position in the lambda mouse locus on chromosome 16.
[0033] In one aspect the host non-human mammal constant region for forming the chimaeric
antibody may be at a different (non endogenous) chromosomal locus. In this case the
inserted human DNA, such as the human variable VDJ or VJ region(s) may then be inserted
into the non-human genome at a site which is distinct from that of the naturally occurring
heavy or light constant region. The native constant region may be inserted into the
genome, or duplicated within the genome, at a different chromosomal locus to the native
position, such that it is in a functional arrangement with the human variable region
such that chimaeric antibodies of the disclosure can still be produced.
[0034] In one aspect the human DNA is inserted at the endogenous host wild-type constant
region located at the wild type locus between the host constant region and the host
VDJ region.
[0035] Reference to location of the variable region upstream of the non-human mammal constant
region means that there is a suitable relative location of the two antibody portions,
variable and constant, to allow the variable and constant regions to form a chimaeric
antibody or antibody chain
in vivo in the mammal. Thus, the inserted human DNA and host constant region are in functional
arrangement with one another for antibody or antibody chain production.
[0036] In one aspect the inserted human DNA is capable of being expressed with different
host constant regions through isotype switching. In one aspect isotype switching does
not require or involve trans switching. Insertion of the human variable region DNA
on the same chromosome as the relevant host constant region means that there is no
need for trans-switching to produce isotype switching.
[0037] As explained above, the transgenic loci used for the prior art models were of human
origin, thus even in those cases when the transgenes were able to complement the mouse
locus so that the mice produced B-cells producing fully human antibodies, individual
antibody affinities rarely reached those which could be obtained from intact (non-transgenic)
animals. The principal reason for this (in addition to repertoire and expression levels
described above) is the fact that the control elements of the locus are human. Thus,
the signalling components, for instance to activate hyper-mutation and selection of
high affinity antibodies are compromised.
[0038] In contrast, in the present disclosure, host non-human mammal constant regions are
maintained and it is preferred that at least one non-human mammal enhancer or other
control sequence, such as a switch region, is maintained in functional arrangement
with the non-human mammal constant region, such that the effect of the enhancer or
other control sequence, as seen in the host mammal, is exerted in whole or in part
in the transgenic animal. This approach above is designed to allow the full diversity
of the human locus to be sampled, to allow the same high expression levels that would
be achieved by non-human mammal control sequences such as enhancers, and is such that
signalling in the B-cell, for example isotype switching using switch recombination
sites, would still use non-human mammal sequences.
A mammal having such a genome would produce chimaeric antibodies with human variable
and non-human mammal constant regions, but these could be readily humanized, for example
in a cloning step. Moreover the
in vivo efficacy of these chimaeric antibodies could be assessed in these same animals.
In one aspect the inserted human IgH VDJ region comprises, in germline configuration,
all of the V, D and J regions and intervening sequences from a human.
In one aspect 800-1000kb of the human IgH VDJ region is inserted into the non-human
mammal IgH locus, and in one aspect a 940, 950 or 960 kb fragment is inserted. Suitably
this includes bases 105,400,051 to 106,368,585 from human chromosome 14.
In one aspect the inserted IgH human fragment consists of bases 105,400,051 to 106,368,585
from chromosome 14. In one aspect the inserted human heavy chain DNA, such as DNA
consisting of bases 105,400,051 to 106,368,585 from chromosome 14, is inserted into
mouse chromosome 12 between the end of the mouse J4 region and the Eµ region, suitably
between co-ordinates 114,667,090 and 114,665,190, or at co-ordinate 114,667,091, after
114,667,090 . In one aspect the insertion is between co-ordinates 114,667,089 and
114,667,090 (co-ordinates refer to NCBI m37, for the mouse C57BL/6J strain), or at
equivalent position in another non-human mammal genome.
[0039] In one aspect the inserted human kappa VJ region comprises, in germline configuration,
all of the V and J regions and intervening sequences from a human. Suitably this includes
bases 88,940,356 to 89,857,000 from human chromosome 2, suitably approximately 917kb.
In a further aspect the light chain VJ insert may comprise only the proximal clusters
of V segments and J segments. Such an insert would be of approximately 473 kb. In
one aspect the human light chain kappa DNA, such as the human IgK fragment of bases
88,940,356 to 89,857,000 from human chromosome 2, is suitably inserted into mouse
chromosome 6 between co-ordinates 70,673,899 and 70,675,515, suitably at position
70,674,734. These co-ordinates refer to NCBI36 for the human genome, ENSEMBL Release
54 and NCBIM37 for the mouse genome, relating to mouse strain C57BL/6J.
[0040] In one aspect the human lambda VJ region comprises, in germline configuration, all
of the V and J regions and intervening sequences from a human.
[0041] Suitably this includes analogous bases to those selected for the kappa fragment,
from human chromosome 2.
[0042] A cell or non-human mammal of the disclosure, in one embodiment, comprises an insertion
of human heavy chain variable region DNA between co-ordinates 114, 666, 183 and 114,
666, 725, such as between 114 666 283 and 114 666 625, optionally between co-ordinates
114,666,335 and 114,666,536, optionally between 114,666,385 and 114,666,486, or between
114,666,425 and 114,666,446, or between 114,666,435 and 114,666,436 of mouse chromosome
12 with reference to NCBIM37 for the mouse genome, relating to mouse strain C57BL/6J
or an equivalent position of mouse chromosome 12 from a different mouse strain or
an equivalent position in the genome of another non-human vertebrate, e.g., a rat.
The insertion between co-ordinates 114,666,435 and 114,666,436 relating to mouse strain
C57BL/6J is equivalent to an insertion between co-ordinates 1207826 and 1207827 on
chromosome 12 with reference to the 129/SvJ genomic sequence of the GenBank® access
number NT114985.2. An insertion may be made at equivalent position in another genome,
such as another mouse genome. In an example of this embodiment, the cell or mammal
of the disclosure comprises a human IgH VDJ region which comprises or consists of
nucleotides 106,328,851-107,268,544, such as nucleotides 106,328,901-107,268,494,
such as nucleotides 106,328,941-107,268,454, such as nucleotides 106,328,951-107,268,444
of human Chromosome 14, with reference to the GRCH37/hg19 sequence database, or insertion
of equivalent nucleotides relating to chromosome 14 from a different human sequence
or database. The human insertion may be made between the regions indicated above.
[0043] A cell or mammal of the disclosure, in one aspect, comprises an insertion of the
human kappa VJ region, suitably comprising or consisting of, in germline configuration,
all of the V and J regions and intervening sequences from a human, the insertion of
the human DNA being made between co-ordinates 70,673,918 - 70,675,517, such as between
co-ordinates 70, 674,418 and 70 675, 017, such as between co-ordinates 70,674, 655
- 70,674,856, such as between co-ordinates 70,674, 705 - 70,674,906, such as between
co-ordinates 70,674, 745 - 70,674,766, such as between co-ordinates 70,674,755 and
70,674,756 of mouse chromosome 6, numbering with reference to NCBIM37 for the mouse
genome, relating to mouse strain C57BL/6J, or an insertion at an equivalent position
in another genome, such as another mouse genome. In an example of this aspect,
a cell or mammal of the disclosure comprises an insertion of nucleotides 89,159,079-89,630,437
and/or 89,941,714-90,266,976 of human chromosome 2 with reference to the GRCH37/hg19
sequence database (or equivalent nucleotides relating to chromosome 2 from a different
human sequence or database), such as an insertion of these 2 discrete fragments without
the intervening sequence, or an insertion of the complete 89,159,079-90,266,976 region.
The insertion may comprise, or consist, of:
- (i) nucleotides 89,158,979 - 89,630,537, such as 89,159,029-89,630,487, such as 89,159,069-89,630,447,
such as 89,159,079 - 89,630,437, optionally in addition to fragment (ii) below
- (ii) nucleotides 89,941,614 - 90,267,076, such as 89,941,664 - 90,267,026, such as
89, 941,704-90,266,986, such as 89,941,714 - 90,266,976; optionally in addition to
fragment (i)
- (iii) nucleotides 89,158,979 - 90,267,076, such as nucleotides 89,159,079 - 90,266,976.
The human insertion may be made between the regions indicated above.
[0044] In an aspect, a cell or mammal of the disclosure comprises an insertion of a human
lambda region which comprises at least one human Jλ region (eg, a germline region)
and at least one human Cλ region (eg, a germline region), optionally C
λ6 and/or C
λ7. For example, the cell or mammal comprises a plurality of human Jλ regions, optionally
two or more of J
λ1, J
λ2, J
λ6 and J
λ7, optionally all of J
λ1, J
λ2, J
λ6 and J
λ7. In an example, the cell or mammal comprises at least one human J
λ-C
λ cluster, optionally at least J
λ7-C
λ7.
In one aspect the human JC cluster is inserted 3' of the last endogenous J lambda
or is inserted 3' of the last endogenous J kappa region, suitably immediately 3' of
these sequences, or substantially immediately 3' of these sequences.
In one aspect the insertion into the mouse lambda locus is made downstream of the
endogenous C1 gene segment, for example where there is a 3' J1 C1 cluster, suitably
immediately 3' of the C1 segment, or substantially immediately 3' of the segment.
In one aspect (e.g. cell or non-human mammal) a human JC cluster is inserted into
a kappa locus and any resulting cell or animal is heterozygous at that locus, such
that the cell has one chromosome with human lambda DNA inserted into the kappa locus,
and another chromosome with human kappa DNA at the endogenous kappa locus.
[0045] In an aspect, a cell or mammal of the disclosure comprises a human Eλ enhancer. A
cell or mammal may of the disclosure comprise an inserted human lambda VJ region,
suitably comprising or consisting of, in germline configuration, all of the V and
J regions and intervening sequences from a human, the inserted region comprises or
consisting of nucleotides 22,375,509 - 23,327,984, such as nucleotides 22,375,559
- 23,327,934, such as nucleotides 22,375,599 - 23,327,894, such as nucleotides 22,375,609
- 23,327,884 from human Chromosome 22, with reference to the GRCH37/hg19 sequence
database, or equivalent DNA from another human sequence or database. The insertion
into the mouse genome may be made between co-ordinates 19,027,763 and 19,061,845,
such as between co-ordinates 19, 037, 763 and 19, 051, 845, such as between co-ordinates
19,047,451 and 19,047,652, such as between co-ordinates 19,047,491 and 19,047,602,
such as between co-ordinates 19,047,541 and 19,047,562, such as between co-ordinates
19,047,551 and 19,047,552 of mouse Chromosome 16 (with reference to NCBIM37 for the
mouse genome, relating to mouse strain C57BL/6J, equivalent to co-ordinates 1,293,646
- 1,293,647 of the 129 SvJ genomic sequence in the sequence file of NT_039630.4),
or may be an insertion at an equivalent position in other genome, such as another
mouse genome. The insertion of the human lambda nucleic acid into the mouse genome
may alternatively be made between co-ordinates 70,673,918 and 70,675,517, such as
between co-ordinates 70, 674,418 and 70 675, 017, such as between co-ordinates 70,674,655
and 70,674,856, such as between co-ordinates 70,674,705 and 70,674,806, such as between
co-ordinates 70,674,745 and 70,674,766, such as between co-ordinates 70,674,755 and
70,674,756 of mouse Chromosome 6 (with reference to NCBIM37 for the mouse genome,
relating to mouse strain C57BL/6J) or equivalent in another genome. The human insertion
may be made between the regions indicated above.
[0046] All specific human fragments described above may vary in length, and may for example
be longer or shorter than defined as above, such as 500 bases, 1 KB, 2K, 3K, 4K, 5KB,
10 KB, 20KB, 30KB, 40KB or 50KB or more, which suitably comprise all or part of the
human V(D)J region, whilst preferably retaining the requirement for the final insert
to comprise human genetic material encoding the complete heavy chain region and light
chain region, as appropriate, as described above.
[0047] In one aspect the 5' end of the human insert described above is increased in length.
Where the insert is generated in a stepwise fashion then the increase in length is
generally in respect of the upstream (5') clone.
[0048] In one aspect the 3' end of the last inserted human gene, generally the last human
J gene to be inserted is less than 2kb, preferably less than 1 KB from the human-mouse
join region.
[0049] In one aspect the non-human mammal comprises some or all of the human light chain
kappa VJ region as disclosed herein but not the human light chain lambda VJ region.
[0050] In one aspect the cell or non-human mammal comprises a fully human lambda locus (lambda
VJC regions from a human), a chimaeric kappa locus (human kappa VJ regions operatively
linked to a host kappa constant region) and a chimaeric heavy chain locus, having
a human VDJ region operatively linked to a host heavy chain constant region.
[0051] In a further aspect the genome comprises an insertion of V, D (heavy chain only)
and J genes as described herein at the heavy chain locus and one light chain locus,
or at the heavy chain locus and both light chain loci. Preferably the genome is homozygous
at one, or both, or all three loci.
In another aspect the genome may be heterozygous at one or more of the loci, such
as heterozygous for DNA encoding a chimaeric antibody chain and native (host cell)
antibody chain. In one aspect the genome may be heterozygous for DNA capable of encoding
2 different antibody chains of the disclosure, for example, comprising 2 different
chimaeric heavy chains or 2 different chimaeric light chains.
In one aspect the disclosure relates to a non-human mammal or cell, and methods for
producing said mammal or cell, as described herein, wherein the inserted human DNA,
such as the human IgH VDJ region and/or light chain V, J regions are found on only
one allele and not both alleles in the mammal or cell. In this aspect a mammal or
cell has the potential to express both an endogenous host antibody heavy or light
chain and a chimaeric heavy or light chain.
[0052] In a further aspect of the disclosure the human VDJ region, or light chain VJ region,
is not used in its entirety, but parts of the equivalent human VDJ or VJ region, such
as the exons, from other species may be used, such as one or more V, D, or J exons
from other species, or regulatory sequences from other species. In one aspect the
sequences used in place of the human sequences are not human or mouse. In one aspect
the sequences used may be from rodent, or, primate such as chimp. For example, 1,
2, 3, 4, or more, or all of the J regions from a primate other than a human may be
used to replace, one, 2, 3, 4, or more or all of the human J exons in the VDJ/VJ region
of the cells and animals of the disclosure.
In a further aspect the inserted human DNA, such as the human IgH VDJ region, and/or
light chain VJ regions, may be inserted such that they are operably linked in the
genome with a mu constant region from a non-human, non-mouse species, such as a rodent
or primate sequence, such as a rat sequence.
Other non-human, non-mouse species from which DNA elements may be used in the present
disclosure include rabbits, lamas, dromedary, alpacas, camels and sharks.
In one aspect the inserted human DNA, such as the human VDJ or VJ region, is not operably
linked to the endogenous host mu sequence but rather to a non-host mu sequence.
[0053] Operable linkage suitably allows production of an antibody heavy or light chain comprising
the human variable region.
[0054] In one aspect the inserted human DNA, such as the human IgH VDJ region (and/or light
chain VJ regions) may be inserted into the host chromosome together with mu constant
region nucleic acid which is not host mu constant region nucleic acid, and preferably
is a mu constant region from a non-mouse, non-human species. Suitably the inserted
human DNA, such as the human VDJ region (and/or light chain VJ regions) is operably
linked to a non-human, non-mouse mu, and is able to form a chimaeric antibody heavy
or light chain. In another aspect a non-mouse, non-human mu may be inserted into the
host chromosome on a separate genetic element to that of the human variable region,
or at a different location in the genome, suitably operably linked to the variable
region such that a chimaeric antibody heavy or light can be formed.
[0055] In an additional aspect the disclosure relates to a non-human mammal or a cell whose
genome comprises a plurality of human IgH V regions, one or more human D regions and
one or more human J regions upstream of a host non-human mammal light chain constant
region, arranged such that the cell or mammal is able to express a chimaeric antibody
chain. The disclosure also relates to a non-human mammal or a cell whose genome additionally
or alternatively comprises a plurality of human Ig light chain V regions, and one
or more human J regions upstream of a host non-human mammal heavy chain constant region,
such that the cell or mammal is able to express a chimaeric antibody chain. The cell
or mammal may be able to express an antibody having both heavy and light chains, including
at least one chimaeric antibody chain, as disclosed above.
[0056] The inserted human heavy chain variable regions may be any of those described herein,
and may be inserted at the positions described above for insertion 5' of the lambda
and kappa constant regions. Likewise the inserted human light chain variable regions
may be those described above, and may be inserted at the positions described above
for insertion 5' of the heavy chain constant region.
[0057] For example, the genome or the cell or non-human mammal of the disclosure may encode
an antibody comprising an antibody chain having a human heavy chain variable region
upstream of a mouse light chain constant region, or an antibody chain having a human
light chain variable region upstream of a mouse heavy chain constant region, in combination
with one of:
a fully human antibody light chain;
a fully human antibody heavy chain;
a non-human vertebrate (e.g., mouse or rat) antibody light chain;
a non-human vertebrate (e.g., mouse or rat) antibody heavy chain;
a chimaeric non-human vertebrate (e.g., mouse or rat) - human antibody chain;
an antibody chain having a human heavy chain variable region upstream of a non-human
vertebrate (e.g., mouse or rat) light chain constant region;
an antibody chain having a human light chain variable region upstream of a non-human
vertebrate (e.g., mouse or rat) heavy chain constant region.
[0058] The disclosure also relates to a transgene encoding a plurality of human IgH V regions,
one or more human D regions and one or more human J regions upstream of a host non-human
mammal light chain constant region, optionally comprised within a vector.
[0059] The disclosure also relates to a transgene encoding a plurality of human Ig light
chain V regions, and one or more human light chain J regions upstream of a host non-human
mammal heavy chain constant region, optionally comprised within a vector.
[0060] In one aspect the disclosure relates to a cell, or non-human mammal, the genome of
which comprises: one or more human Ig light chain kappa V regions and one or more
human Ig light chain kappa J regions upstream of all or part of the human kappa constant
region.
[0061] In another aspect the disclosure relates to a cell, or non-human mammal, the genome
of which comprises: one or more human Ig light chain lambda V regions and one or more
human Ig light chain lambda J regions upstream of all or part of the human lambda
constant region.
[0062] Suitably the light chain VJ and C regions are able to form antibody chains in vivo
capable of specifically reacting with an antigen.
[0063] In one aspect of the disclosure there is no non-human coding sequence in the inserted
light chain region.
[0064] In such aspects a human kappa and/or lambda region is inserted into the genome, in
combination with insertion of the heavy chain VDJ region or part thereof, upstream
of the host heavy chain constant region as disclosed herein.
[0065] The cell or non-human mammal of the disclosure may comprise:
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) one or more human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions upstream of all or part of the non-human kappa constant region,
wherein the non-human mammal is able to produce a repertoire of antibodies having
an antibody chain comprising non-human mammal constant region and a human variable
region.
[0066] The cell or non-human mammal of the disclosure may comprise
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
one or more human Ig light chain lambda V regions and one or more human Ig light chain
lambda J regions upstream of the host non-human mammal lambda constant region; wherein
the non-human mammal is able to produce a repertoire of antibodies having an antibody
chain comprising a non-human mammal constant region and a human variable region.
[0067] Suitably the insertion of the human VJC light chain DNA, or part thereof as disclosed
above, is made at the equivalent mouse locus. In one aspect the human light chain
kappa VJC DNA, or part thereof, is inserted immediately upstream or downstream of
the mouse kappa VJC region. In one aspect, the human light chain lambda VJC region
or part thereof is inserted immediately upstream or downstream of the mouse lambda
VJC region. In one aspect only the human kappa VJC locus is inserted and not the human
lambda VJC locus. In one aspect only the human lambda VJC locus is inserted and not
the human kappa VJC locus. Insertions may be made using the techniques disclosed herein,
and suitably do not remove the host sequences from the genome. In one aspect the non-human
mammal host VJC sequences may be inactivated in some way, by mutation, or inversion,
or by insertion of the human variable region DNA, or by any other means. In one aspect
the cell or non-human mammal of the disclosure may comprise an insertion of the complete
VJC human region.
[0068] The human kappa variable region DNA might be inserted into the genome in functional
arrangement with a lambda constant region, for example inserted upstream of a lambda
constant region. Alternatively human lambda region variable DNA might be inserted
in functional arrangement with a kappa constant region, for example inserted upstream
of a kappa constant region.
[0069] In one aspect one or more non-human mammal control sequences such as the enhancer
sequence(s) is maintained upstream of the nonhuman mammal Mu constant region, suitably
in its native position with respect to the distance from the constant region.
[0070] In one aspect one or more non-human mammal control sequences such as an enhancer
sequence(s) are maintained downstream of the nonhuman mammal Mu constant region, suitably
in its native position with respect to the distance from the constant region.
[0071] In one aspect a non-human mammal switch sequence, suitably the endogenous switch
sequence, is maintained upstream of the non-human mammal Mu constant region, suitably
in its native position with respect to distance from the constant region.
[0072] In such location the host enhancer or switch sequences are operative in vivo with
the host constant region sequence(s).
[0073] In one aspect a switch sequence is neither human, nor native in the non-human mammal,
for example in one aspect a non-human mammal switch sequence is not a mouse or human
switch sequence. The switch sequence may be, for example, a rodent or primate sequence,
or a synthetic sequence. In particular the switch sequence may be a rat sequence where
the non-human mammal is a mouse. By way of example, a mouse or human constant mu sequence
may be placed under the control of a switch sequence from a rat, or chimp, or other
switch sequence, suitably capable of allowing isotype switching to occur in vivo.
In one aspect the switch sequence of the disclosure is a switch sequence comprising
3, 4, 5, 6 or more (up to 82) contiguous repeats of the repeat sequence GGGCT (SEQ
ID no 46 - 50), such as a rat switch sequence. By "rat switch" herein it is meant
that the switch is a wild-type switch corresponding to a switch from a rat genome
or derived from such a switch. In one aspect the switch sequence of the disclosure
is a rat switch sequence comprising the following repeats: GAGCT (296 repeats; SEQ
ID No 18), GGGGT (50 repeats; SEQ ID No 19), and GGGCT (83 repeats; SEQ ID No 20).
In one example the rat switch sequence comprises or consists of the sequence of SEQ
ID no 1.
[0074] In these aspects, and where the non-human mammal is a mouse or the cell is a mouse
cell, the switch is optionally a rat switch as described herein.
Alternatively, the switch sequence present in cells or mammal of the disclosure is
a mouse switch, eg, is from a mouse such as a mouse 129 strain or mouse C57 strain,
or from a strain derived therefrom, optionally comprising or consisting of the sequence
of SEQ ID no 4 or 5. By "mouse switch" herein it is meant that the switch is a wild-type
switch corresponding to a switch from a mouse genome or derived from such a switch.
In this aspect, and where the non-human mammal is a mouse or the cell is a mouse cell,
the mouse switch sequence is optionally the endogenous switch or is a mouse switch
from another mouse strain.
The cell or mammal of the disclosure may therefore comprise a human or non-human mammal
switch sequence and a human or non-human mammal enhancer region or regions. They may
be upstream of a human or non-human mammal constant region. Preferably the control
sequences are able to direct expression or otherwise control the production of antibodies
comprising a constant region with which they are associated. One combination envisaged
is a rat switch with mouse enhancer sequences and mouse constant regions in a mouse
cell.
[0075] In one aspect the disclosure relates to a cell, preferably a non-human cell, or non-human
mammal comprising an immunoglobulin heavy chain or light chain locus having DNA from
3 or more species. For example, the cell or animal may comprise host cell constant
region DNA, one or more human V, D or J coding sequences and one or more non-human,
non-host DNA regions that are able to control a region of the immunoglobulin locus,
such as a switch sequence, promoter or enhancer which are able to control expression
or isotype switching in vivo of the Ig DNA. In one aspect the cell or animal is a
mouse and comprises additionally human DNA from the human Ig locus and additionally
a non-mouse DNA sequence, such as a rat DNA sequence, capable of regulation of the
mouse or human DNA.
[0076] In another aspect the disclosure relates to a cell, preferably non-human cell, or
non-human mammal comprising an immunoglobulin heavy chain or light chain locus having
DNA from 2 or more different human genomes. For example, it could comprise heavy chain
V(D)J sequences from more than one human genome within a heavy or light chain, or
heavy chain VDJ DNA from one genome and light chain VJ sequences from a different
genome.
[0077] In one aspect the disclosure relates to a DNA fragment or cell or non-human mammal
comprising an immunoglobulin heavy chain or light chain locus, or part thereof, having
DNA from 2 or more species, where one species contributes a non-coding region such
as a regulatory region, and the other species coding regions such as V, D, J or constant
regions.
[0078] In one aspect the human promoter and/or other control elements that are associated
with the different human V, D or J regions are maintained after insertion of the human
VDJ into the mouse genome.
[0079] In a further aspect one or more of the promoter elements, or other control elements,
of the human regions, such as the human V regions, are optimised to interact with
the transcriptional machinery of a non-human mammal.
[0080] Suitably a human coding sequence may be placed under the control of an appropriate
non-human mammal promoter, which allows the human DNA to be transcribed efficiently
in the appropriate non-human animal cell. In one aspect the human region is a human
V region coding sequence, and a human V region is placed under the control of a non-human
mammal promoter.
[0081] The functional replacement of human promoter or other control regions by non-human
mammal promoter or control regions may be carried out by use of recombineering, or
other recombinant DNA technologies, to insert a part of the human Ig region (such
as a human V region) into a vector (such as a BAC) containing a non-human Ig region.
The recombineering/recombinant technique suitably replaces a portion of the non-human
(e.g. mouse) DNA with the human Ig region, and thus places the human Ig region under
control of the non-human mammal promoter or other control region. Suitably the human
coding region for a human V region replaces a mouse V region coding sequence. Suitably
the human coding region for a human D region replaces a mouse D region coding sequence.
Suitably the human coding region for a human J region replaces a mouse J region coding
sequence. In this way human V, D or J regions may be placed under the control of a
non-human mammal promoter, such as a mouse promoter.
[0082] In one aspect the only human DNA inserted into the non-human mammalian cell or animal
are V, D or J coding regions, and these are placed under control of the host regulatory
sequences or other (non-human, non-host) sequences, In one aspect reference to human
coding regions includes both human introns and exons, or in another aspect simply
exons and no introns, which may be in the form of cDNA.
[0083] It is also possible to use recombineering, or other recombinant DNA technologies,
to insert a non-human-mammal (e.g. mouse) promoter or other control region, such as
a promoter for a V region, into a BAC containing a human Ig region. A recombineering
step then places a portion of human DNA under control of the mouse promoter or other
control region.
[0084] The approaches described herein may also be used to insert some or all of the V,
D and J regions from the human heavy chain upstream of a light chain constant region,
rather than upstream of the heavy chain constant region. Likewise some or all of the
human light chain V and J regions may be inserted upstream of the heavy chain constant
region. Insertion may be at the endogenous constant region locus, for example between
the endogenous constant and J region, and may be of some, or all, of the V, D or J
genes alone, excluding promoter or enhancer sequences, or may be of some, or all,
of the V, D or J genes with one or more or all respective promoter or enhancer sequences.
In one aspect the full repertoire of V, D or J fragments in germline orientation may
be inserted upstream and in functional arrangement with a host constant region.
[0085] Thus the present disclosure allows V and/or D and/or J regions from a human, or any
species, to be inserted into a chromosome of a cell from a different species that
comprises a constant region, allowing a chimaeric antibody chain to be expressed.
[0086] In one aspect the disclosure requires only that some human variable region DNA is
inserted into the genome of a non-human mammal in operable arrangement with some,
or all, of the human heavy chain constant region at the region of the endogenous heavy
chain constant region locus such that an antibody chain can be produced. In this aspect
of the disclosure and where human light chain DNA is additionally inserted, the light
chain DNA insertion can be in the form of a completely human construct, having both
human variable DNA and human constant region DNA, or have human variable region DNA
and constant region DNA from a non-human, non-host species. Other variations are also
possible, such as insertion of both of the light chain human variable region and host
genome constant region. In addition the insertion of said light chain transgenes need
not be at the equivalent endogenous locus, but may be anywhere in the genome. In such
a scenario the cell or mammal may produce chimaeric heavy chains (comprising human
variable region DNA and mouse constant region DNA) and light chains comprising human
variable and human constant region DNA. Thus in one aspect of the disclosure the lambda
and or kappa human variable region DNA can be inserted upstream of the endogenous
locus, or downstream, or indeed on a different chromosome to the endogenous locus,
and inserted with or without constant region DNA.
[0087] As well insertion of human light chain DNA upstream of the host non-human mammal
constant region, a further aspect of the disclosure relates to insertion of one or
both light chain human variable regions downstream of the equivalent endogenous locus
constant region, or elsewhere in the genome.
[0088] Generally, insertion of human variable region DNA at or close to the equivalent endogenous
locus in the recipient genome is preferred, for example within 1, 2, 3, 4, 5, 6, 7,
8, 9, or 10kb of the boundary (upstream or downstream) of a host immunoglobulin locus.
[0089] Thus in one aspect the disclosure can relate to a cell or non-human mammal whose
genome comprises:
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) one or more human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions, and/or, one or more human Ig light chain lambda V regions and
one or more human Ig light chain lambda J regions;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies,
or chimaeric light or heavy chains, having a non-human mammal constant region and
a human variable region.
[0090] In one particular aspect the genome of the cell or non-human mammal comprises:
a plurality of human IgH V regions, one or more human D regions and one or more human
J regions upstream of the host non-human mammal constant region;
one or more human Ig light chain kappa V regions and one or more human Ig light chain
kappa J regions upstream of the host non-human mammal kappa constant region, and
one or more human Ig light chain lambda V regions and one or more human Ig light chain
lambda J regions downstream of the host non-human mammal lambda constant region,
optionally in which the human lambda variable region may be inserted upstream or downstream
of the endogenous host lambda locus in operable linkage with a human lambda constant
region, such that the non-human mammal or cell can produce fully human antibody light
chains and chimaeric heavy chains.
[0091] In a further, different, aspect of the disclosure, the use of the methods of the
disclosure allows a locus to be built up in a stepwise manner by sequential insertions,
and thus allows for the insertion of human variable DNA together with human or non-human
constant region DNA at any suitable location in the genome of a non-human host cell.
For example, methods of the disclosure can be used to insert human immunoglobulin
variable region DNA together with constant region DNA from the host genome anywhere
in the genome of a non-human host cell, allowing a chimaeric antibody chain to be
produced from a site other than the endogenous heavy region. Any human heavy chain
or light chain DNA construct contemplated above can be inserted into any desired position
into the genome of a non-human host cell using the techniques described herein. The
present disclosure thus also relates to cells and mammals having genomes comprising
such insertions.
[0092] The disclosure also relates to a vector, such as a BAC, comprising a human V, D or
J region in a functional arrangement with a non-human mammal promoter, or other control
sequence, such that the expression of the human V, D or J region is under the control
of the non-human mammal promoter in a cell of the non-human mammal, such as an ES
cell, in particular once inserted into the genome of that cell.
[0093] The disclosure also relates to cells and non-human mammals containing said cells,
which cells or mammals have a human V, D or J region in a functional arrangement with
a non-human mammal promoter, or other control sequence, such that the expression of
the human V, D or J region is under the control of the non-human mammal promoter in
the cells or mammal.
[0094] Generally, one aspect of the disclosure thus relates to a non-human mammal host cell
capable of expression of a human V, D or J coding sequence under the control of a
host promoter or control region, the expression capable of producing a humanised antibody
having a human variable domain and non-human mammal constant region.
[0095] In one aspect the disclosure relates to a cell, such as a non mammalian cell, such
as an ES cell, the genome of which comprises
- (a) a plurality of human IgH V regions, one or more human D regions and one or more
human J regions upstream of the host non-human mammal constant region; and
- (b) optionally one or more human Ig light chain kappa V regions and one or more human
Ig light chain kappa J regions upstream of the host non-human mammal kappa constant
region and/or one or more human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region;
[0096] In another aspect the disclosure relates to a cell, such as a non-human mammal cells,
such as ES cells whose genome comprises
- (a) a plurality of human Ig light chain kappa V regions and one or more human Ig light
chain kappa J regions upstream of the host non-human mammal kappa constant region
and/or a plurality of human Ig light chain lambda V regions and one or more human
Ig light chain lambda J regions upstream of the host non-human mammal lambda constant
region; and
- (b) optionally one or more human IgH V regions, one or more human D regions and one
or more human J regions upstream of the host non-human mammal constant region
[0097] In one aspect the cell is an ES cell is capable of developing into a non-human mammal
able to produce a repertoire of antibodies which are chimaeric, said chimaeric antibodies
having a non-human mammal constant region and a human variable region. Optionally
the genome of the cell is modified to prevent expression of fully host-species specific
antibodies.
[0098] In one aspect the cell is an induced pluripotent stem cell (iPS cell).
[0099] In one aspect cells are isolated non-human mammalian cells.
[0100] In one aspect a cell as disclosed herein is preferably a non-human mammalian cell.
[0101] In one aspect the cell is a cell from a mouse strain selected from C57BL/6, M129
such as 129/SV, BALB/c, and any hybrid of C57BL/6, M129 such as 129/SV, or BALB/c.
[0102] The disclosure also relates to a cell line which is grown from or otherwise derived
from cells as described herein, including an immortalised cell line. The cell line
may comprise inserted human V, D or J genes as described herein, either in germline
configuration or after rearrangement following in vivo maturation. The cell may be
immortalised by fusion (eg, electrofusion or using PEG according to standard procedures.)
to a tumour cell (eg, P3X63-Ag8.653 (obtainable from LGC Standards; CRL-1580), SP2/0-Ag14
(obtainable from ECACC), NSI or NS0), to provide an antibody producing cell and cell
line, or be made by direct cellular immortalisation.
[0103] The present disclosure also relates to vectors for use in the disclosure. In one
aspect such vectors are BACs (bacterial artificial chromosomes). It will be appreciated
that other cloning vectors may be used in the disclosure, and therefore reference
to BACs herein may be taken to refer generally to any suitable vector.
[0104] In one aspect BACs used for generation of human DNA to be inserted, such as the VDJ
or VJ regions are trimmed so that in the final human VDJ or VJ region or part thereof
in the non-human mammal, no sequence is duplicated or lost when compared to the original
human genomic sequence.
[0105] In one aspect the disclosure relates to a vector comprising an insert, preferably
comprising a region of human DNA from some of the human VDJ or VJ locus, flanked by
DNA which is not from that locus. The flanking DNA may comprise one or more selectable
markers or one or more site specific recombination sites. In one aspect the vector
comprises 2 or more, such as 3, heterospecific and incompatible site specific recombination
sites. In one aspect the site specific recombination sites may be IoxP sites, or variants
thereof, or FRT sites or variants thereof. In one aspect the vector comprises one
or more transposon ITR (inverted terminal repeat) sequences.
[0106] In one aspect the non-human animals of the disclosure suitably do not produce any
fully humanised antibodies. In one aspect this is because there is no DNA inserted
from the human constant region. Alternatively there is no human constant region DNA
in the genome capable of forming an antibody in conjunction with the inserted human
variable region DNA component, for example due to mutation within any human constant
region DNA or distance from any constant region human DNA and human variable region
DNA.
[0107] In one aspect human light chain constant region DNA may be included in the cell genome,
such that a fully human lambda or kappa human antibody chain might be generated, but
this would only be able to form an antibody with a chimaeric heavy chain, and not
produce a fully human antibody having human variable and constant regions.
[0108] In one aspect the non-human mammal genome is modified to prevent expression of fully
host-species specific antibodies. Fully host species specific antibodies are antibodies
that have both variable and constant regions from the host organism. In this context
the term 'specific' is not intended to relate to the binding of the antibodies produced
by the cells or animals of the disclosure but rather to the origin of the DNA which
encodes those antibodies.
[0109] In one aspect the non-human mammal genome is modified to prevent expression of the
native (fully host species specific) antibodies in the mammal by inactivation of all
or a part of the host non-human mammal Ig loci. In this context, inactivation or prevention
of endogenous antibody or gene segment usage (using any inactivation technique described
herein) is, for example, substantially complete inactivation or prevention (substantially
100%, ie, essentially none (eg, less than 10, 5, 4, 3, 2, 1 or 0.5%) of the endogenous
antibody chain (eg, no endogenous heavy chains) is expressed). This can be determined,
for example, at the antibody chain (protein) level by assessing the antibody repertoire
produced by the non-human vertebrate, mammal or at the nucleotide level by assessing
mRNA transcripts of antibody chain loci, eg, using RACE. In an aspect, inactivation
is more than 50% (ie, 50% or less of the antibodies or transcripts are of an endogenous
antibody chain), 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%. For example,
in an aspect, endogenous heavy chain expression is substantially inactivated such
that no more than 85%, 90%, 95%, 96%, 97%, 98% or 99% of the heavy chain repertoire
of the vertebrate (mammal) is provided by endogenous heavy chains. For example, endogenous
heavy chain expression is substantially inactivated such that substantially none of
the heavy chain repertoire of the vertebrate (mammal) is provided by endogenous heavy
chains. For example, in an embodiment, endogenous heavy chain expression is substantially
inactivated such that no more than 85%, 90%, 95%, 96%, 97%, 98% or 99% of the kappa
chain repertoire of the vertebrate (mammal) is provided by endogenous kappa chains.
For example, endogenous kappa chain expression is substantially inactivated such that
substantially none of the kappa chain repertoire of the vertebrate (mammal) is provided
by endogenous kappa chains. For example, in an aspect, endogenous heavy chain expression
is substantially inactivated such that no more than 85%, 90%, 95%, 96%, 97%, 98% or
99% of the lambda chain repertoire of the vertebrate (mammal) is provided by endogenous
lambda chains. For example, endogenous lambda chain expression is substantially inactivated
such that substantially none of the lambda chain repertoire of the vertebrate (mammal)
is provided by endogenous lambda chains.
In one aspect this is achieved by inversion of all or part of the non-human mammal
VDJ region, or VJ region, optionally by insertion of one or more site specific recombinase
sites into the genome and then use of these sites in recombinase-mediated excision
or inversion of all or a part of the non-human mammal Ig locus. In one aspect a double
inversion, may be employed, the first to move the V(D)Js away from the endogenous
locus and then a more local inversion which puts them in the correct orientation.
In one aspect a single
loxP site is used to invert the non-human mammal VDJ region to a centromeric locus or
telomeric locus.
[0110] In one example, a mouse or mouse cell of the disclosure comprises inverted endogenous
heavy chain gene segments (eg, VH, D and JH, such as the entire endogenous heavy chain
VDJ region) that are immediately 3' of position 119753123, 119659458 or 120918606
on an endogenous mouse chromosome 12. Optionally, the genome of the mouse or cell
is homozygous for said chromosome 12.
[0111] The disclosure also provides:-
[0112] A cassette for inversion and inactivation of endogenous non-human vertebrate (eg,
mouse or rat) antibody chain gene segments, the segments being part of an antibody
chain locus sequence on a chromosome of a non-human vertebrate (eg, mouse or rat)
cell (eg, ES cell) wherein the sequence is flanked at its 3' end by a site-specific
recombination site (eg, lox, rox or frt), the cassette comprising a nucleotide sequence
encoding an expressible label or selectable marker and a compatible site-specific
recombination site (eg, lox, rox or frt) flanked by a 5' and a 3' homology arm, wherein
the homology arms correspond to or are homologous to adjacent stretches of sequence
in the cell genome on a different chromosome or on said chromosome at least 10, 15,
20, 25, 30, 35, 40, 45 or 50 mb away from the endogenous gene segments.
[0113] The disclosure also provides:-
[0114] A cassette for inversion and inactivation of endogenous mouse antibody heavy chain
gene segments, the segments being part of a heavy chain locus sequence on chromosome
12 of a mouse cell (eg, ES cell) wherein the sequence is flanked at its 3' end by
a site-specific recombination site (eg, lox, rox or frt), the cassette comprising
a nucleotide sequence encoding an expressible label or selectable marker and a compatible
site-specific recombination site (eg, lox, rox or frt) flanked by a 5' and a 3' homology
arm, wherein the homology arms correspond to or are homologous to adjacent stretches
of sequence in the mouse cell genome on a different chromosome or on chromosome 12
at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 mb away from the endogenous gene segments.
[0115] The disclosure provides:-
[0116] A cassette for inversion and inactivation of endogenous mouse antibody heavy chain
gene segments, the segments being part of a heavy chain locus sequence on chromosome
12 of a mouse cell (eg, ES cell) wherein the sequence is flanked at its 3' end by
a site-specific recombination site (eg, lox, rox or frt), the cassette comprising
a nucleotide sequence encoding an expressible label or selectable marker and a compatible
site-specific recombination site (eg, lox, rox or frt) flanked by a 5' and a 3' homology
arm, wherein (i) the 5' homology arm is mouse chromosome 12 DNA from coordinate 119753124
to coordinate 119757104 and the 3' homology arm is mouse chromosome 12 DNA from coordinate
119749288 to 119753123; or (ii) the 5' homology arm is mouse chromosome 12 DNA from
coordinate 119659459 to coordinate 119663126 and the 3' homology arm is mouse chromosome
12 DNA from coordinate 119656536 to 119659458; or (iii) the 5' homology arm is mouse
chromosome 12 DNA from coordinate 120918607 to coordinate 120921930 and the 3' homology
arm is mouse chromosome 12 DNA from coordinate 120915475 to 120918606. Aspect (i)
results in an inversion of mouse chromosome 12 from coordinate 119753123 to coordinate
114666436. Aspect (ii) results in an inversion of mouse chromosome 12 from coordinate
119659458 to coordinate 114666436 Aspect (iii) results in an inversion of mouse chromosome
12 from coordinate 12091806 to coordinate 114666436.
Thus, the disclosure provides a mouse or mouse cell whose genome comprises an inversion
of a chromosome 12, wherein the inversion comprises inverted endogenous heavy chain
gene segments (eg, VH, D and JH, such as the entire endogenous heavy chain VDJ region);
wherein the mouse comprises a transgenic heavy chain locus comprising a plurality
of human VH gene segments, a plurality of human D segments and a plurality of human
JH segments operably connected upstream of an endogenous constant region (eg, C mu)
so that the mouse or cell (optionally following differentiation into a B-cell) is
capable of expressing an antibody comprising a variable region comprising sequences
derived from the human gene segments; and wherein the inversion is (i) an inversion
of mouse chromosome 12 from coordinate 119753123 to coordinate 114666436; (ii) an
inversion of mouse chromosome 12 from coordinate 119659458 to coordinate 114666436;
or (iii) an inversion of mouse chromosome 12 from coordinate 12091806 to coordinate
114666436.
[0117] In one aspect, the endogenous gene segments are from a 129-derived mouse cell (eg,
segments from an AB2.1 cell) and the homology arms are isogenic DNA (ie, identical
to 129-derived endogenous sequences demarcated by the respective coordinates stated
in (i) to (iii) above). Thus, no new sequence is created by homologous recombination
using these homology arms. In another aspect, the arms are from a mouse strain that
is different from the endogenous strain. The site-specific recombination sites are
mutually compatible and mutually inverted such that, on expression of an associated
recombinase enzyme (eg, Cre, Dre or Flp), recombination between the site in the inserted
inversion cassette and the site flanking the endogenous gene segments is carried out,
thereby inverting and moving the endogenous gene segments far upstream (5') of their
original location in the heavy chain locus. This inactivates endogenous heavy chain
expression. Similarly, light chain inactivation can be performed by choosing the homology
arms of the inversion cassette with reference to a chromosomal region spaced at least
10, 15, 20, 25, 30, 35, 40, 45 or 50 mb away from the endogenous light chain locus,
the latter comprising a site-specific recombination site that is compatible with the
site in the inversion cassette.
[0118] In one aspect, the expressible label is a fluorescent label, eg, GFP or a variant
thereof (eg, YFP, CFP or RFP). Thus, a label is used instead of a selection marker,
such as one that confers resistance to allow for selection of transformants.
The disclosure provides a method of inactivating gene segments of an endogenous antibody
locus, the method comprising
- (i) Providing a non-human vertebrate cell (eg, an ES cell, eg, a mouse ES cell) whose
genome comprises an antibody chain locus comprising endogenous variable region gene
segments;
- (ii) Targeting a site-specific recombination site to flank the 3' of the 3'-most of
said endogenous gene segments;
- (iii) Targeting a second site-specific recombination site at least 10mb away from
said endogenous gene segments, the second site being compatible with the first site
inverted with respect to the first site;
- (iv) Expressing a recombinase compatible with said sites to effect site-specific recombination
between said sites, thereby inverting and moving said gene segments away from said
locus, wherein the endogenous gene segments are inactivated; and
- (v) Optionally developing the cell into a progeny cell or vertebrate (eg, mouse or
rat) whose genome is homozygous for the inversion.
[0119] The genome of the progeny cell or vertebrate can comprise transgenic heavy and/or
light chain loci, each capable of expressing antibody chains comprising human variable
regions. Optionally, endogenous heavy and kappa light chain expression is inactivated
by inverting endogenous heavy and kappa variable region gene segments according to
the method of the disclosure. Optionally, endogenous lambda chain expression is also
inactivated in this way.
[0120] In an alternative to the method and inversion cassettes of the disclosure, instead
of inverting and moving variable region gene segments only, other parts of the endogenous
locus can alternatively or additionally be inverted and moved to effect inactivation.
For example, one or more endogenous regulatory elements (eg, Smu and/or Emu) and/or
one or more endogenous constant regions (eg, Cmu and/or Cgamma) can be inverted and
moved.
[0121] Sites that "flank" in the above contexts of the disclosure can be provided such that
a site-specific recombination site immediately flanks the endogenous sequence or is
spaced therefrom, eg, by no more than 250, 200, 250, 100, 50 or 20 kb in the 3' direction.
[0122] In one aspect the non-human mammal genome into which human DNA is inserted comprises
endogenous V, (D) and J regions, and the endogenous sequences have not been deleted.
[0123] The disclosure comprises a method for insertion of multiple DNA fragments into a
DNA target, suitably to form a contiguous insertion in which the inserted fragments
are joined together directly without intervening sequences. The method is especially
applicable to the insertion of a large DNA fragment into a host chromosome which can
be carried out in a stepwise fashion.
[0124] In one aspect the method comprises insertion of a first DNA sequence into a target,
the sequence having a DNA vector portion and a first sequence of interest (X1); insertion
of a second DNA sequence into the vector portion of the first sequence, the second
DNA sequence having a second sequence of interest (X2) and a second vector portion;
and then excising any vector sequence DNA separating X1 and X2 to provide a contiguous
X1X2, or X2X1 sequence within the target. There is optionally insertion of a further
one or more DNA sequences, each DNA sequence having a further sequence of interest
(X3,...) and a further vector portion, into the vector portion of the preceding DNA
sequence, to build up a contiguous DNA fragment in the target.
[0125] The DNA target for insertion of the first DNA sequence may be a specific site or
any point in the genome of a particular cell.
[0126] The general method is described herein in relation to the insertion of elements of
the human VDJ region, but is applicable to insertion of any DNA region, from any organism,
and in particular insertion of large DNA fragments of > 100kB, such as 100 - 250kb,
or even larger, such as that of the TCR or HLA. Features and approaches described
herein in respect of the VDJ insertion may be equally applied to the any of the methods
disclosed
[0127] In one aspect the inserted DNA is human DNA, such as the human VDJ or VJ region,
is built up in the genome of a cell, such as an ES cell, in a stepwise manner using
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more separate insertions for
each heavy chain or light chain region. Fragments are suitably inserted at the same
or substantially the same cell locus, e.g. ES cell locus, one after another, to form
the complete VDJ or VJ region, or part thereof. The present disclosure also relates
to cells and non-human animals comprising intermediates in the process whose genomes
may comprise only a partial VDJ region, such as only human variable region DNA.
[0128] In a further aspect the method for producing a transgenic non-human mammal comprises
the insertion of human VDJ or VJ regions upstream of the host non-human mammal constant
region by step-wise insertion of multiple fragments by homologous recombination, preferably
using an iterative process. Suitably fragments of approximately 100KB from the human
VDJ and VJ locus are inserted, suitably to form part of, or a complete, VDJ or VJ
region after the final iteration of the insertion process, as disclosed herein.
[0129] In one aspect the insertion process commences at a site where an initiation cassette
has been inserted into the genome of a cell, such as an ES cell, providing a unique
targeting region. In one aspect the initiation cassette is inserted in the non-human
mammal heavy chain locus, for use in insertion of human heavy chain DNA. Similarly
an initiation cassette may be inserted in the non-human mammal light chain locus,
for use in insertion of human light chain VJ DNA The initiation cassette suitably
comprises a vector backbone sequence with which a vector having a human DNA fragment
in the same backbone sequence can recombine to insert the human DNA into the cell
(e.g. ES) cell genome, and suitably a selection marker, such as a negative selection
marker. Suitably the vector backbone sequence is that of a BAC library, to allow BACs
to be used in the construction of the ES cells and mammals. The vector backbone sequence
may however be any sequence which serves as a target site into which a homologous
sequence can insert, for example by homologous recombination, for example RMCE, and
is preferably not DNA encoding any of the VDJ or constant region.
[0130] In one aspect the insertion of the first DNA fragment into an initiation cassette
is followed by insertion of a second DNA fragment into a portion of the first DNA
fragment, suitably a part of the vector backbone of the second DNA fragment. In one
aspect an inserted DNA fragment comprises a part of the human VDJ region flanked by
5' and/or 3' sequences that are not from the human VDJ region. In one aspect the 5'
and/or 3' flanking sequences may each contain one or more selectable markers, or be
capable of creating a selectable system once inserted into the genome. In one aspect
one or both flanking sequences may be removed from the genome in vitro, or in vivo,
following insertion. In one aspect the method comprises insertion of a DNA fragment
followed by selection of both 5' and 3' ends of the inserted fragment flanking the
human VDJ DNA. In one aspect the iterative insertion is made by insertion of DNA fragments
at the 5' end of the previous inserted fragment, and in this aspect there may be deletion
in vivo of the vector DNA which separates the inserted human DNA sequences, to provide
a contiguous human DNA sequence.
[0131] In one aspect insertion of human VDJ DNA into a genome may be achieved without leaving
any flanking DNA in the genome, for example by transposase mediate DNA excision. One
suitable transposase is the Piggybac transposase.
[0132] In one aspect the first human variable region fragment is inserted by homologous
recombination at the initiation cassette backbone sequence and then the DNA of any
negative selection marker and initiation cassette are subsequently removed by recombination
between recombinase target sequences, such as FRT using in this example, FLPase expression.
Generally repeated targeted insertions at the (e.g. BAC) backbone initiation sequence
and subsequent removal by rearrangement between recombinase target sequences are repeated
to build up the entire human VDJ region upstream of the host non-mammal constant region.
[0133] In one aspect a selectable marker or system may be used in the method. The marker
may be generated upon insertion of a DNA fragment into a genome, for example forming
a selectable marker in conjunction with a DNA element already present in the genome.
[0134] In one aspect the cell (e.g. ES) cell genome does not contain 2 identical selectable
markers at the same time during the process. It can be seen that the iterative process
of insertion and selection can be carried out using only 2 different selection markers,
as disclosed in the examples herein, and for example the third selectable marker may
be identical to the first marker, as by the time of insertion of the third vector
fragment the first vector fragment and the first marker has been removed.
[0135] In one aspect a correct insertion event, is confirmed before moving to the next step
of any multistep cloning process, for example by confirmation of BAC structure using
high density genomic arrays to screen ES cells to identify those with intact BAC insertions,
sequencing and PCR verification.
[0136] Initiation cassette (also called a "landing pad")
[0137] The disclosure also relates to a polynucleotide 'landing pad' sequence, the polynucleotide
comprising nucleic acid regions homologous to regions of a target chromosome to allow
for insertion by homologous recombination into the target chromosome, and comprising
a nucleic acid site which permits recombinase-driven insertion of nucleic acid into
the landing pad. The disclosure also relates to vectors, cells and mammals of the
disclosure comprising a landing pad as disclosed herein inserted into the genome of
the cell.
[0138] The landing pad optionally comprises a non-endogenous S-mu, e.g. a rat S-mu switch
[0139] The landing pad optionally comprises (in 5' to 3' orientation) a mouse Eµ sequence,
a non-human, non-mouse (e.g. rat) Switch µ and at least a portion of a mouse Cµ or
the entire mouse Cµ.
[0140] The rat switch sequence optionally comprises or consists of SEQ ID NO 1.
The landing pad optionally comprises the 5' homology arm of SEQ ID NO 6.
The landing pad optionally has the sequence of SEQ ID 2 or SEQ ID NO 3.
[0141] In one aspect, the landing pad comprises an expressible label. For example the label
is a fluorescent label, eg, GFP or a variant thereof (eg, YFP, CFP or RFP). Thus,
a label is used instead of a selection marker (such as one that confers resistance
to allow for selection of transformants).
[0142] In an aspect, the landing pad comprises 5' and 3' homology arms for insertion into
the cell genome using homologous recombination. The homology arms can be isogenic
DNA (eg, identical to 129-derived endogenous sequences of when a 129-derived ES cell
is used). Thus, no new sequence is created by homologous recombination using these
homology arms. In another aspect, the arms are from a mouse strain that is different
from the endogenous strain (ES cell strain).
The methods of the disclosure include methods wherein the landing pad sequence comprises
any of the configurations or sequences as disclosed herein.
Another method of the disclosure comprises the step of insertion of the landing pad
into a mouse chromosome by homologous recombination between mouse J1-4 and mouse C
mu sequences.
Another method of the disclosure comprises the step of insertion of the landing pad
into the mouse chromosome 12 by homologous recombination between mouse J1-4 and E
mu.
In one aspect the method uses site specific recombination for insertion of one or
more vectors into the genome of a cell, such as an ES cell. Site specific recombinase
systems are well known in the art and may include Cre-lox, and FLP/FRT or combinations
thereof, in which recombination occurs between 2 sites having sequence homology.
Additionally or alternatively to any particular Cre/Lox or FLP/FRT system described
herein, other recombinases and sites that may be used in the present disclosure include
Dre recombinase, rox sites, and PhiC31 recombinase.
[0143] Suitable BACs are available from the Sanger centre, see "
A genome-wide, end-sequenced 129Sv BAC library resource for targeting vector construction".
Adams DJ, Quail MA, Cox T, van der Weyden L, Gorick BD, Su Q, Chan WI, Davies R, Bonfield
JK, Law F, Humphray S, Plumb B, Liu P, Rogers J, Bradley A. Genomics. 2005 Dec;86(6):753-8. Epub 2005 Oct 27. The Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire CB10
1 SA, UK. BACs containing human DNA are also available from, for example, Invitrogen™.
A suitable library is described in
Osoegawa K et al, Genome Research 2001. 11: 483-496.
[0144] In one aspect a method of the disclosure specifically comprises:
- (1) insertion of a first DNA fragment into a non-human ES cell, the fragment containing
a first portion of human VDJ or VJ region DNA and a first vector portion containing
a first selectable marker;
- (2) optionally deletion of the a part of the first vector portion;
- (3) insertion of a second DNA fragment into a non-human ES cell containing the first
DNA fragment, the insertion occurring within the first vector portion, the second
DNA fragment containing a second portion of the human VDJ or VJ region and a second
vector portion containing a second selectable marker,
- (4) deletion of the first selectable marker and first vector portion, preferably by
a recombinase enzyme action;
- (5) insertion of a third DNA fragment into a non-human ES cell containing the second
DNA fragment, the insertion occurring within the second vector portion, the third
DNA fragment containing a third portion of the human VDJ or VJ region and a third
vector portion containing third selectable marker,
- (6) deletion of the second selectable marker and second vector portion; and
- (7) iteration of the steps of insertion and deletion, as necessary, for fourth and
further fragments of the human VDJ or VJ human regions, as necessary, to produce an
ES cell with a part or all of the human VDJ or VJ region inserted as disclosed herein,
and suitably to remove all the vector portions within the ES cell genome.
[0145] In another aspect the disclosure comprises
- (1) insertion of DNA forming an initiation cassette into the genome of a cell;
- (2) insertion of a first DNA fragment into the initiation cassette, the first DNA
fragment comprising a first portion of a human DNA and a first vector portion containing
a first selectable marker or generating a selectable marker upon insertion;
- (3) optionally removal of part of the vector DNA
- (4) insertion of a second DNA fragment into the vector portion of the first DNA fragment,
the second DNA fragment containing a second portion of human DNA and a second vector
portion, the second vector portion containing a second selectable marker, or generating
a second selectable marker upon insertion;
- (5) optionally, removal of any vector DNA to allow the first and second human DNA
fragments to form a contiguous sequence; and
- (6) iteration of the steps of insertion of human VDJ DNA and vector DNA removal, as
necessary, to produce a cell with all or part of the human VDJ or VJ region sufficient
to be capable of generating a chimaeric antibody in conjunction with a host constant
region,
wherein the insertion of one, or more, or all of the DNA fragments uses site specific
recombination.
[0146] In one aspect the non-human mammal is able to generate a diversity of at least 1
X 10
6 different functional chimaeric immunoglobulin sequence combinations.
[0147] In one aspect the targeting is carried out in ES cells derived from the mouse C57BL/6N,
C57BL/6J, 129S5 or 129Sv strain.
[0148] In one aspect non-human animals, such as mice, are generated in a RAG-1-deficient
or a RAG-2-deficient background, or other suitable genetic background which prevents
the production of mature host B and T lymphocytes.
[0149] In one aspect the non-human mammal is a rodent, suitably a mouse, and cells of the
disclosure, are rodent cells or ES cells, suitably mouse ES cells.
[0150] The ES cells of the present disclosure can be used to generate animals using techniques
well known in the art, which comprise injection of the ES cell into a blastocyst followed
by implantation of chimaeric blastocystys into females to produce offspring which
can be bred and selected for homozygous recombinants having the required insertion.
In one aspect the disclosure relates to a chimeric animal comprised of ES cell-derived
tissue and host embryo derived tissue. In one aspect the disclosure relates to genetically-altered
subsequent generation animals, which include animals having a homozygous recombinants
for the VDJ and/or VJ regions.
[0153] In a further aspect the disclosure relates to humanised antibodies and antibody chains
produced according to the present disclosure, both in chimaeric and fully humanised
form, and use of said antibodies in medicine. The disclosure also relates to a pharmaceutical
composition comprising such an antibodies and a pharmaceutically acceptable carrier
or other excipient.
[0154] Antibody chains containing human sequences, such as chimaeric human-non-human antibody
chains, are considered humanised herein by virtue of the presence of the human protein
coding regions region. Fully humanised antibodies may be produced starting from DNA
encoding a chimaeric antibody chain of the disclosure using standard techniques.
[0155] Methods for the generation of both monoclonal and polyclonal antibodies are well
known in the art, and the present disclosure relates to both polyclonal and monoclonal
antibodies of chimaeric or fully humanised antibodies produced in response to antigen
challenge in non-human mammals of the present disclosure.
[0156] In a yet further aspect, chimaeric antibodies or antibody chains generated in the
present disclosure may be manipulated, suitably at the DNA level, to generate molecules
with antibody-like properties or structure, such as a human variable region from a
heavy or light chain absent a constant region, for example a domain antibody; or a
human variable region with any constant region from either heavy or light chain from
the same or different species; or a human variable region with a non-naturally occurring
constant region; or human variable region together with any other fusion partner.
The disclosure relates to all such chimaeric antibody derivatives derived from chimaeric
antibodies identified according to the present disclosure.
[0157] In a further aspect, the disclosure relates to use of animals of the present disclosure
in the analysis of the likely effects of drugs and vaccines in the context of a quasi-human
antibody repertoire.
[0158] The disclosure also relates to a method for identification or validation of a drug
or vaccine, the method comprising delivering the vaccine or drug to a mammal of the
disclosure and monitoring one or more of: the immune response, the safety profile;
the effect on disease.
[0159] The disclosure also relates to a kit comprising an antibody or antibody derivative
as disclosed herein and either instructions for use of such antibody or a suitable
laboratory reagent, such as a buffer, antibody detection reagent.
[0160] The disclosure also relates to a method for making an antibody, or part thereof,
the method comprising providing:
- (i) a nucleic acid encoding an antibody, or a part thereof, obtained according to
the present disclosure; or
- (ii) sequence information from which a nucleic acid encoding an antibody obtained
according to the present disclosure, or part thereof, can be expressed to allow an
antibody to be produced.
[0161] The present disclosure also relates to a chimaeric antibody comprising a human variable
region and a non-human vertebrate or mammal (optionally a rat or mouse) constant region
(optionally a C gamma or C mu), wherein the antibody is encoded by a nucleotide sequence
corresponding to the nucleotide sequence of a chimaeric heavy chain locus of a cell
(optionally a B-cell, ES cell or hybridoma), the locus comprising a non-human vertebrate
constant region nucleotide sequence and a rearranged VDJ nucleotide sequence produced
by the
in vivo rearrangement of a human V region, a human D region and a human J region, the V region
being selected from one of a V1-3 region, V2-5 region, V4-4 region, V1-2 region or
V6-1 region, and optionally a V1-3 or V6-1 segment. Optionally, the J region is any
of JH1, JH2, JH3, JH4, JH5 or JH6, and in one aspect is JH4 or JH6. The D region is,
in one aspect, any D3-9, D3-10, D6-13 or D6-19. In one example, rearranged VDJ nucleotide
sequence is produced by the
in vivo rearrangement of human V1-3 and JH4 (optionally with D3-9, D3-10, D6-13 or D-19);
or V1-3 and JH6 (optionally with D3-9, D3-10, D6-13 or D-19); or V6-1 and JH4 (optionally
with D3-9, D3-10, D6-13 or D-19); or V6-1 and JH6 (optionally with D3-9, D3-10, D6-13
or D-19). In one example the rearranged VDJ nucleotide sequence is produced by the
in vivo rearrangement of human V6-1 DH3-10, V1-3 DH3-10, V1-3 DH6-19, V1-3 Dh3-9 or V6-1
DH6- 19. In one aspect the antibody comprises any combination exemplified in the Examples
and Figures herein. Optionally, the
in vivo rearrangement is in a cell (eg, B cell or ES cell) derived from the same non-human
vertebrate species as the constant region sequence (eg, a mouse B cell or ES cell).
The disclosure also relates to a non-human vertebrate or mammal cell (eg, a B-cell
or ES cell or hybridoma) whose genome comprises a chimaeric heavy chain locus as described
above in this paragraph. The disclosure also relates to a non-human vertebrate or
mammal (eg, a mouse or rat) whose genome comprises a chimaeric heavy chain locus as
described above in this paragraph.
[0162] The present disclosure also relates to a non-human vertebrate or mammal having a
genome encoding a chimaeric antibody, the chimaeric antibody comprising a human variable
region and a non-human vertebrate or mammal (optionally a rat or mouse) constant region
(optionally a C gamma or C mu), the mammal:
expressing more V1-3 antibodies than V2-5, V4-4, V1-2 or V6-1 antibodies; and/or
expressing more V1-3 JH4 or V1-3 JH6 antibodies than any of, individually, V1-3 JH1,
V1-3 JH2, V1-3 JH3 or V1-3 JH5 antibodies, and/or
expressing more V6-1 JH4 or V6-1 JH6 antibodies than any of, individually, V6-1 JH1,
V6-1 JH2, V6-1 JH3 or V6-1 JH5 antibodies and/or
expressing a greater number of V1-3 DH3-10 antibodies than antibodies V1-3 with any
other D region. Expression of antibodies can be assessed by methods readily available
to the skilled person and as conventional in the art. For example, expression can
be assessed at the mRNA level as shown in the examples below.
[0163] The disclosure also relates to a chimaeric antibody comprising a human variable region
and a non-human vertebrate or mammal (optionally a rat or mouse) constant region (optionally
a light chain constant region), wherein the antibody is obtainable from a mammal (optionally
a rat or mouse) whose genome comprises an antibody chain locus comprising a germline
human kappa V1-8 and germline human kappa J1 sequence, and wherein the antibody is
obtainable by
in vivo recombination in said mammal of the V1-8 and J1 sequences and wherein the antibody
has a variable region sequence which is different from that which is encoded by germline
human kappa V1-8 and germline human kappa J1 sequences. Thus, in this aspect of the
disclosure the human germline sequences are able to undergo productive rearrangement
to form a coding sequence which, in conjunction with the non-human constant region
sequence, can be expressed as a chimaeric antibody chain having at least a complete
human variable region and a non-human constant region. This is in contrast (as the
examples show below) to the combination of the germline human kappa V1-8 and germline
human kappa J1sequendces
per se, which do not provide for an antibody coding sequence (due to the inclusion of stop
codons). In one aspect the rearranged sequence of the chimaeric antibody is a result
of somatic hypermutation. In one aspect the antibody is a kappa antibody; in another
aspect the antibody comprises a non-human heavy chain constant region (eg, a rat or
mouse C gamma or C mu). The antibody sequence optionally comprises a X
1X
2 T F G Q, where X
1X
2= PR, RT, or PW (SEQ ID No 21); optionally a X
1X
2 T F G Q G T K V E I K R A D A (SEQ ID No 22) motif. Such motifs are not found in
the equivalent position in the germline sequence as shown in the examples. The disclosure
also relates to a non-human vertebrate or mammal cell (eg, a B-cell or ES cell or
hybridoma) whose genome comprises a chimaeric antibody chain locus as described above
in this paragraph. The disclosure also relates to a non-human vertebrate or mammal
(eg, a mouse or rat) whose genome comprises a chimaeric antibody chain locus as described
above in this paragraph.
[0164] The disclosure also relates to a chimaeric antibody comprising a human variable region
and a non-human vertebrate or mammal (optionally a rat or mouse) constant region (optionally
a light chain constant region), wherein the antibody is obtainable from a mammal (optionally
a rat or mouse) whose genome comprises an antibody chain locus comprising a germline
human kappa V1-6 and germline human kappa J1 sequence, and wherein the antibody is
obtainable by
in vivo recombination in said mammal of the V1-6 and J1 sequences and wherein the antibody
has a variable region sequence which is different from that which is encoded by germline
human kappa V1-6 and germline human kappa J1 sequences. Thus, in this aspect of the
disclosure the human germline sequences are able to undergo productive rearrangement
to form a coding sequence which, in conjunction with the non-human constant region
sequence, can be expressed as a chimaeric antibody chain having at least a complete
human variable region and a non-human constant region. This is in contrast (as the
examples show below) to the combination of the germline human kappa V1-6 and germline
human kappa J1sequendces
per se, which do not provide for an antibody coding sequence (due to the inclusion of stop
codons). In one aspect the rearranged sequence of the chimaeric antibody is a result
of somatic hypermutation. In one aspect the antibody is a kappa antibody; in another
aspect the antibody comprises a non-human heavy chain constant region (eg, a rat or
mouse C gamma or C mu). The antibody sequence optionally comprises a X
3X
4 T F G Q, where X
3X
4= PR or PW (SEQ ID No 23); optionally a X
3X
4 T F G Q G T K V E I K R A D A (SEQ ID No 24) motif. Such motifs are not found in
the equivalent position in the germline sequence as shown in the examples. The disclosure
also relates to a non-human vertebrate or mammal cell (eg, a B-cell or ES cell or
hybridoma) whose genome comprises a chimaeric antibody chain locus as described above
in this paragraph. The disclosure also relates to a non-human vertebrate or mammal
(eg, a mouse or rat) whose genome comprises a chimaeric antibody chain locus as described
above in this paragraph.
[0165] The disclosure also relates to a chimaeric antibody comprising a human variable region
and a non-human (optionally a rat or mouse) constant region (optionally a C gamma
or C mu or a C kappa), wherein the antibody is obtainable from a mammal (optionally
a rat or mouse) whose genome comprises an antibody chain locus comprising a germline
human kappa V1-5 and germline human kappa J1 sequence, and wherein the antibody is
obtainable by
in vivo recombination in said mammal of the V1-5 and J1 sequences. The disclosure also relates
to a non-human vertebrate or mammal cell (eg, a B-cell or ES cell or hybridoma) whose
genome comprises a chimaeric antibody chain locus as described above in this paragraph.
The disclosure also relates to a non-human vertebrate or mammal (eg, a mouse or rat)
whose genome comprises a chimaeric antibody chain locus as described above in this
paragraph.
[0166] The disclosure also relates to a chimaeric antibody comprising a human variable region
and a non-human (optionally a rat or mouse) constant region (optionally a C gamma
or C mu or a C kappa), wherein the antibody is obtainable from a mammal (optionally
a rat or mouse) whose genome comprises an antibody chain locus comprising a germline
human kappa V1-5 and germline human kappa J4 sequence, and wherein the antibody is
obtainable by
in vivo recombination in said mammal of the V1-5 and J4 sequences. The disclosure also relates
to a non-human vertebrate or mammal cell (eg, a B-cell or ES cell or hybridoma) whose
genome comprises a chimaeric antibody chain locus as described above in this paragraph.
The disclosure also relates to a non-human vertebrate or mammal (eg, a mouse or rat)
whose genome comprises a chimaeric antibody chain locus as described above in this
paragraph.
[0167] Antibodies of the disclosure may be isolated, in one aspect being isolated from the
cell or organism in which they are expressed.
[0168] A non-human mammal whose genome comprises:
- (a) the human IgH VDJ region upstream of the host non-human mammal constant region;
and
- (b) the human Ig light chain kappa V and J regions upstream of the host non-human
mammal kappa constant region and/or the human Ig light chain lambda V and J regions
upstream of the host non-human mammal lambda constant region;
wherein the non-human mammal is able to produce a repertoire of chimaeric antibodies
having a non-human mammal constant region and a human variable region,
and optionally wherein the non-human mammal genome is modified to prevent expression
of fully host-species specific antibodies.
[0169] A non-human mammal ES cell whose genome comprises:
- (a) the human IgH V, D and J region upstream of a non-human mammal constant region;
and
- (b) the human Ig locus light chain kappa V and J regions upstream of the host non-human
mammal kappa constant region, and /or the human Ig locus light chain lambda V and
J regions upstream of the host non-human mammal lambda constant region
wherein the ES cell is capable of developing into a non-human mammal, being able to
produce a repertoire of antibodies which are chimaeric, having a non-human mammal
constant region and a human variable region.
[0170] A method for producing a transgenic non-human mammal able to produce a repertoire
of chimaeric antibodies, the antibodies having a non-human mammal constant region
and a human variable region, the method comprising inserting by homologous recombination
into a non-human mammal ES cell genome
- (a) the human IgH VDJ region upstream of the host non-human mammal heavy chain constant
region, and
- (b) the human IgL VJ region for lambda or kappa chains upstream of the host non-human
mammal lambda or kappa chain constant region, respectively
such that the non-human mammal is able to produce a repertoire of chimaeric antibodies
having a non-human mammal constant region and a human variable region, wherein steps
(a) and (b) can be carried out in either order and each of steps (a) and (b) can be
carried out in a stepwise manner or as a single step.
[0171] In one aspect the insertion of human VDJ or VJ regions upstream of the host non-human
mammal constant region is accomplished by step-wise insertion of multiple fragments
by homologous recombination.
[0172] In one aspect the step-wise insertions commence at a site where an initiation cassette
has been inserted into the genome of an ES cell providing a unique targeting region
consisting of a BAC backbone sequence and a negative selection marker.
[0173] In one aspect the first human variable region fragment is inserted by homologous
recombination at the initiation cassette BAC backbone sequence and said negative selection
marker and initiation cassette are subsequently removed by recombination between recombinase
target sequences.
[0174] In one aspect repeated targeted insertions at the BAC backbone initiation sequence
and subsequent removal of the backbone by rearrangement between recombinase target
sequences is repeated to build up the entire human VDJ region upstream of the host
non-mammal constant region.
[0175] Insertion of human variable region gene segments precisely within the endogenous
mouse JH4-Cmu intron
[0176] There is further provided a cell or non human mammal according to the disclosure
wherein the mammal is a mouse or the cell is a mouse cell and wherein the insertion
of the human heavy chain DNA is made in a mouse genome between coordinates 114,667,091
and 114,665,190 of mouse chromosome 12.
[0177] There is further provided a cell or non human mammal according to the disclosure
wherein the insertion of the human heavy chain DNA is made at coordinate 114,667,091.
[0178] There is further provided a cell or non human mammal according to the disclosure
wherein the human IgH VDJ region comprises nucleotides 105,400,051 to 106,368,585
from human chromosome 14 (coordinates refer to NCBI36 for the human genome).
[0179] There is further provided a method, cell or non human mammal according to the disclosure
wherein a human coding region DNA sequence is in a functional arrangement with a non-human
mammal control sequence, such that transcription of the human DNA is controlled by
the non-human mammal control sequence. In one example, the initiation cassette is
inserted between the mouse J4 and C alpha exons. There is further provided an initiation
cassette suitable for use in the method comprising a vector backbone sequence and
a selection marker.
The disclosure provides the following aspects (starting at aspect number 103):-
103. A cell or non human mammal according to any one of the above configurations,
examples or aspects, wherein the mammal is a mouse or the cell is a mouse cell and
wherein the insertion of the human heavy chain DNA is made in a mouse genome between
coordinates 114,667,091 and 114,665,190 of mouse chromosome 12.
104. A cell or non human mammal according to any one of the above configurations,
examples or aspects, wherein the insertion of the human heavy chain DNA is made at
coordinate 114,667,091.
105. A cell or mammal according to any one of the above configurations, examples or
aspects, wherein the human IgH VDJ region comprises nucleotides 105,400,051 to 106,368,585
from human chromosome 14 (coordinates refer to NCBI36 for the human genome).
106. A method, cell or mammal according to any one of the above configurations, examples
or aspects, wherein a human coding region DNA sequence is in a functional arrangement
with a non-human mammal control sequence, such that transcription of the human DNA
is controlled by the non-human mammal control sequence.
107. A method according to aspect 106 wherein the initiation cassette is inserted
between the mouse J4 and C alpha exons.
108. An initiation cassette suitable for use in the method of aspect 107 comprising
a vector backbone sequence and a selection marker.
Inactivation of endogenous antibody chain expression by insertion of human antibody
variable region gene segments
109. A non-human vertebrate (optionally a mouse or rat) or non-human vertebrate cell
(optionally a mouse or rat cell) having a genome that
- (i) comprises a transgenic antibody chain locus capable of expressing an antibody
chain comprising a human variable region (optionally following antibody gene rearrangement);
and
- (ii) is inactivated for endogenous non-human vertebrate antibody chain expression;
wherein the transgenic locus comprises
- (iii) a DNA sequence comprising a plurality of human antibody variable region gene
segments inserted between endogenous antibody variable region gene segments and an
endogenous antibody constant region, whereby endogenous antibody chain expression
is inactivated.
The transgenic locus is a heavy chain or light chain locus.
Inactivation of endogenous heavy chain expression in non-human vertebrates such as
mice and rats has involved the deletion of all or part of the endogenous heavy chain
VDJ region (including sequences between gene segments). The ADAM6 genes are present
in the endogenous mouse VDJ region. In mouse, there are two copies of ADAM6 (ADAM6a,
ADAM6b) located between the VH and D gene segments in the IgH locus of chromosome
12 (in the intervening region between mouse VH5-1 and D1-1 gene segments). These two
adjacent intronless ADAM6 genes have 95% nucleotide sequence identity and 90% amino
acid identity. In human and rat, there is only one ADAM6 gene. Expression pattern
analysis of mouse ADAM6 shows that it is exclusively expressed in testis [1]. Although
ADAM6 transcripts can be detected in lymphocytes, it is restricted to the nucleus,
suggesting that the transcription of ADAM6 gene in particular was due to transcriptional
read-through from the D region rather than active messenger RNA production [2]. In
rat, ADAM6 is on chromosome 6.
Mature ADAM6 protein is located on the acrosome and the posterior regions of sperm
head. Notably, ADAM6 forms a complex with ADAM2 and ADAM3, which is required for fertilization
in mice [3]. Reference [4] implicates ADAM6 in a model where this protein interacts
with ADAM3 after ADAM6 is sulphated by TPST2, sulphation of ADAM6 being critical for
stability and/or complex formation involving ADAM6 and ADAM3, and thus ADAM6 and ADAM3
are lost from Tpst2-null sperm. The study observes that Tpst2-deficient mice have
male infertility, sperm mobility defects and possible abnormalities in sperm-egg membrane
interactions.
Thus, the maintenance of ADAM6 expression in sperm is crucial for fertility. Thus,
it is thought that transgenic male mice and rats in which ADAM6 genes have been deleted
are not viably fertile. This hampers breeding of colonies and hampers the utility
of such mice as transgenic antibody-generating platforms. It would be desirable to
provide improved non-human transgenic antibody-generating vertebrates that are fertile.
- [1]. Choi I, et. al., Characterization and comparative genomic analysis of intronless Adams
with testicular gene expression. Genomics. 2004 Apr;83(4):636-46.
- [2]. Featherstone K, Wood AL, Bowen AJ, Corcoran AE. The mouse immunoglobulin heavy chain
V-D intergenic sequence contains insulators that may regulate ordered V(D)J recombination.
J Biol Chem. 2010 Mar 26;285(13):9327-38. Epub 2010 Jan 25.
- [3]. Han C, et. al., Comprehensive analysis of reproductive ADAMs: relationship of ADAM4
and ADAM6 with an ADAM complex required for fertilization in mice. Biol Reprod. 2009
May;80(5):1001-8. Epub 2009 Jan 7.
- [4]. Marcello et al, Lack of tyrosylprotein sulfotransferase-2 activity results in altered
sperm-egg interactions and loss of ADAM3 and ADAM6 in epididymal sperm, J Biol Chem.
2011 Apr 15;286(15):13060-70. Epub 2011 Feb 21.
According to aspect 109 of the disclosure, inactivation does not involve deletion
of the VDJ region or part thereof including endogenous ADAM6, but instead inactivation
by insertion allows for the preservation of endogenous ADAM6 and thus does not risk
infertility problems.
The final mouse resulting from the method (or a mouse derived from a cell produced
by the method) is in one aspect a male, so that the disclosure improves upon the prior
art male transgenic mice that are infertile as a result of genomic manipulation. Fertile
mice produce sperm that can fertilise eggs from a female mouse. Fertility is readily
determined, for example, by successfully breeding to produce an embryo or child mouse.
In another aspect, the method of the disclosure makes a final female mouse. Such females
are, of course, useful for breeding to create male progeny carrying ADAM6 and which
are fertile.
In one example of aspect 109, the genome is homozygous for the transgenic locus. For
example, the genome is homozygous for endogenous ADAM6 genes.
In one example of the vertebrate of aspect 109, the genome is inactivated for expression
of endogenous heavy and kappa (and optionally also lambda) chains.
In one example, in part (iii) of aspect 109 said DNA comprises human VH, D and JH
gene segments or human VL and JL gene segments (eg, Vκ and Jκ gene segments). In an
example, the DNA comprises a landing pad having a selectable marker, eg, a HPRT gene,
neomycin resistance gene or a puromycin resistance gene; and/or a promoter.
In one example, in part (iii) of aspect 109 the endogenous gene segments are the entire
endogenous VDJ region of a heavy chain locus and/or the endogenous constant region
is a Cmu or Cgamma.
In one example, in part (iii) of aspect 109 the endogenous gene segments are the entire
endogenous VJ region of a kappa chain locus and/or the endogenous constant region
is a Ckappa
In one example, in part (iii) of aspect 109 the endogenous gene segments are the entire
endogenous VJ region of a lambda chain locus and/or the endogenous constant region
is a Clambda.
The non-human vertebrate cell can be a hybridoma, B-cell, ES cell or an IPS cell.
When the cell is an ES cell or IPS cell, the endogenous antibody chain expression
is inactivated following differentiation of the cell into a progeny B-cell (eg, in
a B-cell in a non-human vertebrate).
The disclosure further provides:-
110. The vertebrate or cell according to aspect 109, wherein said plurality of human
antibody gene segments comprises at least 11 human V segments and/or at least 6 human
J segments, eg at least 11 human VH gene segments and at least 6 human JH segments
and optionally also at least 27 human D segments; optionally with the human inter-gene
segment intervening sequences. In an aspect, the human antibody gene segments are
provided by a stretch of DNA sequence of human chromosome 14, comprising the gene
segments and intervening sequences in germline configuration.
111. The vertebrate or cell according to aspect 109 or 110, wherein said inserted
DNA sequence comprises a human nucleotide sequence comprising said antibody gene segments,
wherein the nucleotide sequence is at least 110, 130, 150, 170, 190, 210, 230, 250,
270 or 290 kb. In an aspect, the nucleotide sequence corresponds to a stretch of DNA
sequence of human chromosome 14, comprising the gene segments and intervening sequences
in germline configuration, eg, at least a sequence corresponding to the nucleotide
sequence from coordinate 106328951 to coordinate 106601551 of a human chromosome 14,
eg, a sequence in the GRCH37/hg19 sequence database.
112. The vertebrate or cell according to aspect 109, wherein the transgenic locus
is a light chain kappa locus and the human antibody gene segments are between the
3'-most endogenous Jk gene segment and endogenous Ck; optionally wherein the human
antibody gene segments comprise five functional human Jλ-Cλ clusters and at least
one human Vλ gene segment, eg, at least a sequence corresponding to the nucleotide
sequence from coordinate 23217291 to 23327884 of a lambda locus found on a human chromosome
22.
113. The vertebrate or cell according to any one of aspects 109 to 112, wherein the
transgenic locus is a heavy chain locus and the human antibody gene segments are between
the 3'-most endogenous JH gene segment (eg, JH4 in a mouse genome) and endogenous
Cmu.
114. The vertebrate or cell according to any one of aspects 109 to 113, wherein the
genome is homozygous for said transgenic locus.
115. A mouse or mouse cell or a rat or rat cell according to any one of aspects 109
to 114.
116. A method of making a non-human vertebrate cell (optionally a mouse or rat cell),
the method comprising
- (a) providing a non-human ES cell whose genome comprises an endogenous antibody chain
locus comprising endogenous antibody variable region gene segments and an endogenous
antibody constant region; and
- (b) making a transgenic antibody chain locus by inserting into said endogenous locus
a DNA sequences comprising a plurality of human antibody variable region gene segments
between said endogenous antibody variable region gene segments and said endogenous
constant region, so that the human antibody variable region gene segments are operably
connected upstream of the endogenous constant region,
whereby a non-human vertebrate ES cell is produced that is capable of giving rise
to a progeny cell in which endogenous antibody expression is inactivated and wherein
the progeny is capable of expressing antibodies comprising human variable regions;
and
- (c) optionally differentiating said ES cell into said progeny cell or a non-human
vertebrate (eg, mouse or rat) comprising said progeny cell.
117. The method according to aspect 116, wherein said plurality of human antibody
gene segments comprises at least 11 human V segments.
118. The method according to aspect 116 or 117, wherein said plurality of human antibody
gene segments comprises at least 6 human J segments.
119. The method according to aspect 116, 117 or 118, wherein a human nucleotide sequence
is inserted in step (b), the nucleotide sequence comprising said antibody gene segments,
wherein the nucleotide sequence is at least 110kb.
120. The method according to any one of aspects 110 to 113, wherein the endogenous
locus is a heavy chain locus and the human antibody gene segments are between the
3'-most endogenous JH gene segment and endogenous Cmu.
121. The method according to any one of aspects 116 to 120, wherein the progeny cell
is homozygous for said transgenic locus.
In one example of the method of aspect 116, the method comprises inactivating the
genome for expression of endogenous heavy and kappa (and optionally also lambda) chains.
In one example of the method of aspect 116, in part (b) said DNA sequence comprises
human VH, D and JH gene segments or human VL and JL gene segments (eg, Vκ and Jκ gene
segments). In an example, the DNA comprises a landing pad having a selectable marker,
eg, a HPRT gene, neomycin resistance gene or a puromycin resistance gene; and/or a
promoter.
In one example, in part (b) of aspect 116 the endogenous gene segments are the entire
endogenous VDJ region of a heavy chain locus and/or the endogenous constant region
is a Cmu or Cgamma.
In one example, in part (b) of aspect 116 the endogenous gene segments are the entire
endogenous VJ region of a kappa chain locus and/or the endogenous constant region
is a Ckappa
In one example in part (b) of aspect 116 the endogenous gene segments are the entire
endogenous VJ region of a lambda chain locus and/or the endogenous constant region
is a Clambda.
The non-human vertebrate cell can be a hybridoma, B-cell, ES cell or an IPS cell.
When the cell is an ES cell or IPS cell, the endogenous antibody chain expression
is inactivated following differentiation of the cell into a progeny B-cell (eg, in
a B-cell in a non-human vertebrate).
The disclosure further provides:-
The method according to aspect 116, wherein said inserted DNA sequence comprises a
human nucleotide sequence comprising said human antibody gene segments, wherein the
nucleotide sequence is at least 110, 130, 150, 170, 190, 210, 230, 250, 270 or 290
kb. In an aspect, the nucleotide sequence corresponds to a stretch of DNA sequence
of human chromosome 14, comprising the gene segments and intervening sequences in
germline configuration, eg, at least a sequence corresponding to the nucleotide sequence
from coordinate 106328951 to coordinate 106601551 of a human chromosome 14, eg, a
sequence in the GRCH37/hg19 sequence database.
The method according to aspect 116, wherein the transgenic locus is a light chain
kappa locus and the human antibody gene segments are between the 3'-most endogenous
Jk gene segment and endogenous Ck; optionally wherein the human antibody gene segments
comprise five functional human Jλ-Cλ clusters and at least one human Vλ gene segment,
eg, at least a sequence corresponding to the nucleotide sequence from coordinate 23217291
to 23327884 of a lambda locus found on a human chromosome 22.
The method according to aspect 116, wherein, wherein the transgenic locus is a heavy
chain locus and the human antibody gene segments are inserted between the 3'-most
endogenous JH gene segment (eg, JH4 in a mouse genome) and endogenous Cmu.
122. The method according to any one of aspects 116 to 121, comprising making the
genome of the progeny homozygous for said transgenic locus. Isolating antibodies from
transgenic non-human vertebrates of the disclosure & useful antigen-specific antibodies
of therapeutically-relevant affinities
123. A method of isolating an antibody that binds a predetermined antigen, the method
comprising
- (a) providing a vertebrate (optionally a mammal; optionally a mouse or rat according
to any one of the above configurations, examples or aspects;
- (b) immunising said vertebrate with said antigen (optionally wherein the antigen is
an antigen of an infectious disease pathogen);
- (c) removing B lymphocytes from the vertebrate and selecting one or more B lymphocytes
expressing antibodies that bind to the antigen;
- (d) optionally immortalising said selected B lymphocytes or progeny thereof, optionally
by producing hybridomas therefrom; and
- (e) isolating an antibody (eg, and IgG-type antibody) expressed by the B lymphocytes.
124. The method of aspect 123, comprising the step of isolating from said B lymphocytes
nucleic acid encoding said antibody that binds said antigen; optionally exchanging
the heavy chain constant region nucleotide sequence of the antibody with a nucleotide
sequence encoding a human or humanised heavy chain constant region and optionally
affinity maturing the variable region of said antibody; and optionally inserting said
nucleic acid into an expression vector and optionally a host.
125. The method of aspect 123 or 124, further comprising making a mutant or derivative
of the antibody produced by the method of aspect 122 or 123. As demonstrated by the
examples below, the non-human vertebrates of the disclosure are able to produce antigen-specific
antibodies of sub-50nM affinity with human sequences in their CDR3 regions. Thus,
the disclosure further provides:-
126. An antibody or fragment (eg, a Fab or Fab2) thereof comprising variable regions that specifically bind a predetermined antigen
with a sub-50nM affinity (optionally sub-40, 30, 20, 10, 1, 0.1 or 0.01 nM) as determined
by surface plasmon resonance, wherein the antibody is isolated from a non-human vertebrate
(optionally a mammal; optionally a mouse or rat) according to any one of the above
configurations, examples or aspects and comprises heavy chain CDR3s (as defined by
Kabat) encoded by a rearranged VDJ of said vertebrate, wherein the VDJ is the product
of rearrangement in vivo of a human JH gene segment of a heavy chain locus of said vertebrate with D (optionally
a human D gene segment of said locus) and VH gene segments.
In one aspect, the surface plasmon resonance (SPR) is carried out at 25°C. In another
embodiment, the SPR is carried out at 37°C.
In one aspect, the SPR is carried out at physiological pH, such as about pH7 or at
pH7.6 (eg, using Hepes buffered saline at pH7.6 (also referred to as HBS-EP)).
In one aspect, the SPR is carried out at a physiological salt level, eg, 150mM NaCl.
In one aspect, the SPR is carried out at a detergent level of no greater than 0.05%
by volume, eg, in the presence of P20 (polysorbate 20; eg, Tween-20™) at 0.05% and
EDTA at 3mM.
In one example, the SPR is carried out at 25°C or 37°C in a buffer at pH7.6, 150mM
NaCl, 0.05% detergent (eg, P20) and 3mM EDTA. The buffer can contain 10mM Hepes. In
one example, the SPR is carried out at 25°C or 37°C in HBS-EP. HBS-EP is available
from Teknova Inc (California; catalogue number H8022).
In an example, the affinity of the antibody is determined using SPR by
- 1. Coupling anti-mouse (or other relevant non-human vertebrate) IgG (eg, Biacore BR-1008-38)
to a biosensor chip (eg, GLM chip) such as by primary amine coupling;
- 2. Exposing the anti-mouse IgG (non-human vertebrate antibody) to a test IgG antibody
to capture test antibody on the chip;
- 3. Passing the test antigen over the chip's capture surface at 1024nM, 256nM, 64nM,
16nM, 4nM with a 0nM (i.e. buffer alone); and
- 4. And determining the affinity of binding of test antibody to test antigen using
surface plasmon resonance, eg, under an SPR condition discussed above (eg, at 25°C
in physiological buffer). SPR can be carried out using any standard SPR apparatus,
such as by Biacore™ or using the ProteOn XPR36™ (Bio-Rad®).
Regeneration of the capture surface can be carried out with 10mM glycine at pH1.7.
This removes the captured antibody and allows the surface to be used for another interaction.
The binding data can be fitted to 1:1 model inherent using standard techniques, eg,
using a model inherent to the ProteOn XPR36™ analysis software.
The disclosure also relates to an scFv, diabody or other antibody fragment comprising
a VH and VL domain from an antibody or fragment of aspect 126 (optionally following
affinity maturation, eg, by phage display).
In one aspect, the antigen is a serpin, eg, ovalbumin, antithrombin or antitrypsin.
Serpins are a group of proteins with similar structures that were first identified
as a set of proteins able to inhibit proteases. The acronym serpin was originally
coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease
inhibitors). The first members of the serpin superfamily to be extensively studied
were the human plasma proteins antithrombin and antitrypsin, which play key roles
in controlling blood coagulation and inflammation, respectively. Initially, research
focused upon their role in human disease: antithrombin deficiency results in thrombosis
and antitrypsin deficiency causes emphysema. In 1980 Hunt and Dayhoff made the surprising
discovery that both these molecules share significant amino acid sequence similarity
to the major protein in chicken egg white, ovalbumin, and they proposed a new protein
superfamily.
127. An antibody or fragment that is identical to an antibody of aspect 126 or a derivative
thereof (optionally a derivative whose constant regions are human and/or an affinity
matured derivative) that specifically binds said antigen with a sub-50 nM affinity
as determined by surface plasmon resonance.
128. A pharmaceutical composition comprising an antibody or fragment of aspect 126
or 127 and a pharmaceutically-acceptable diluent, excipient or carrier.
129. A nucleotide sequence encoding a heavy chain variable region of an antibody or
fragment of aspect 126 or 127, optionally as part of a vector (eg, an expression vector).
130. The nucleotide sequence of aspect 129, wherein the sequence is a cDNA derived
from a B-cell of the vertebrate from which the antibody of aspect 126 is isolated,
or is identical to such a cDNA.
131. An isolated host cell (eg, a hybridoma or a CHO cell or a HEK293 cell) comprising
a nucleotide sequence according to aspect 129 or 130.
132. A method of isolating an antibody that binds a predetermined antigen, the method
comprising
- (a) providing a vertebrate (optionally a mammal; optionally a mouse or rat according
to any one of the above configurations, examples or aspects;
- (b) immunising said vertebrate with said antigen;
- (c) removing B lymphocytes from the vertebrate and selecting a B lymphocyte expressing
an antibody that binds to the antigen with sub-nM affinity, wherein the antibody is
according to aspect 126;
- (d) optionally immortalising said selected B lymphocyte or progeny thereof, optionally
by producing hybridomas therefrom; and
- (e) isolating an antibody (eg, and IgG-type antibody) expressed by the B lymphocyte.
133. The method of aspect 132, comprising the step of isolating from said B lymphocyte
nucleic acid encoding said antibody that binds said antigen; optionally exchanging
the heavy chain constant region nucleotide sequence of the antibody with a nucleotide
sequence encoding a human or humanised heavy chain constant region and optionally
affinity maturing the variable region of said antibody; and optionally inserting said
nucleic acid into an expression vector and optionally a host.
134. The method of aspect 132 or 133, further comprising making a mutant or derivative
of the antibody produced by the method of aspect 132 or 133.
Inactivation by inversion of endogenous VDJ to genome desert regions
135. A mouse or mouse cell comprising inverted endogenous heavy chain gene segments
(eg, VH, D and JH, such as the entire endogenous heavy chain VDJ region) that are
immediately 3' of position 119753123, 119659458 or 120918606 on an endogenous mouse
chromosome 12, wherein the mouse comprises a transgenic heavy chain locus comprising
a plurality of human VH gene segments, a plurality of human D segments and a plurality
of human JH segments operably connected upstream of an endogenous constant region
(eg, C mu) so that the mouse or cell (optionally following differentiation into a
B-cell) is capable of expressing an antibody comprising a variable region comprising
sequences derived from the human gene segments.
136. The mouse or cell of aspect 135, wherein the genome of the mouse or cell is homozygous
for said chromosome 12.
137. A cassette for inversion and inactivation of endogenous non-human vertebrate
(eg, mouse or rat) antibody chain gene segments, the segments being part of an antibody
chain locus sequence on a chromosome of a non-human vertebrate (eg, mouse or rat)
cell (eg, ES cell) wherein the sequence is flanked at its 3' end by a site-specific
recombination site (eg, lox, rox or frt), the cassette comprising a nucleotide sequence
encoding an expressible label or selectable marker and a compatible site-specific
recombination site (eg, lox, rox or frt) flanked by a 5' and a 3' homology arm, wherein
the homology arms correspond to or are homologous to adjacent stretches of sequence
in the cell genome on a different chromosome or on said chromosome at least 10mb away
from the endogenous gene segments.
138. A cassette for inversion and inactivation of endogenous mouse antibody heavy
chain gene segments, the segments being part of a heavy chain locus sequence on chromosome
12 of a mouse cell (eg, ES cell) wherein the sequence is flanked at its 3' end by
a site-specific recombination site (eg, lox, rox or frt), the cassette comprising
a nucleotide sequence encoding an expressible label or selectable marker and a compatible
site-specific recombination site (eg, lox, rox or frt) flanked by a 5' and a 3' homology
arm, wherein (i) the 5' homology arm is mouse chromosome 12 DNA from coordinate 119753124
to coordinate 119757104 and the 3' homology arm is mouse chromosome 12 DNA from coordinate
119749288 to 119753123; (ii) the 5' homology arm is mouse chromosome 12 DNA from coordinate
119659459 to coordinate 119663126 and the 3' homology arm is mouse chromosome 12 DNA
from coordinate 119656536 to 119659458; or (iii) the 5' homology arm is mouse chromosome
12 DNA from coordinate 120918607 to coordinate 120921930 and the 3' homology arm is
mouse chromosome 12 DNA from coordinate 120915475 to 120918606.
139. A method of inactivating gene segments of an endogenous antibody locus, the method
comprising
- (i) Providing a non-human vertebrate cell (eg, an ES cell, eg, a mouse ES cell) whose
genome comprises an antibody chain locus comprising endogenous variable region gene
segments;
- (ii) Targeting a site-specific recombination site to flank the 3' of the 3'-most of
said endogenous gene segments;
- (iii) Targeting a second site-specific recombination site at least 10mb away from
said endogenous gene segments, the second site being compatible with the first site
inverted with respect to the first site;
- (iv) Expressing a recombinase compatible with said sites to effect site-specific recombination
between said sites, thereby inverting and moving said gene segments away from said
locus, wherein the endogenous gene segments are inactivated; and
- (v) Optionally developing the cell into a progeny cell or vertebrate (eg, mouse or
rat) whose genome is homozygous for the inversion.
140. A mouse or mouse cell whose genome comprises an inversion of a chromosome 12,
wherein the inversion comprises inverted endogenous heavy chain gene segments (eg,
VH, D and JH, such as the entire endogenous heavy chain VDJ region); wherein the mouse
comprises a transgenic heavy chain locus comprising a plurality of human VH gene segments,
a plurality of human D segments and a plurality of human JH segments operably connected
upstream of an endogenous constant region (eg, C mu) so that the mouse or cell (optionally
following differentiation into a B-cell) is capable of expressing an antibody comprising
a variable region comprising sequences derived from the human gene segments; and wherein
the inversion is (i) an inversion of mouse chromosome 12 from coordinate 119753123
to coordinate 114666436; (ii) an inversion of mouse chromosome 12 from coordinate
119659458 to coordinate 114666436; or (iii) an inversion of mouse chromosome 12 from
coordinate 12091806 to coordinate 114666436.
Other aspects include:
[0180] A method for producing an antibody specific to a desired antigen the method comprising
immunizing a non-human mammal as disclosed herein with the desired antigen and recovering
the antibody or a cell producing the antibody.
[0181] A method for producing a fully humanised antibody comprising immunizing a non-human
mammal as disclosed herein and then replacing the non-human mammal constant region
of an antibody specifically reactive with the antigen with a human constant region,
suitably by engineering of the nucleic acid encoding the antibody.
[0182] A method, cell or mammal as disclosed herein wherein a human coding region DNA sequence
is in a functional arrangement with a non-human mammal control sequence, such that
transcription of the DNA is controlled by the non-human mammal control sequence. In
one aspect the human coding region V, D or J region is in a functional arrangement
with a mouse promoter sequence.
[0183] The disclosure also relates to a humanised antibody produced according to any methods
disclosed herein and use of a humanised antibody so produced in medicine.
Endogenous Light Chain Inactivation & High Expression of Human Lambda Variable Regions
in Transgenic Non-Human Vertebrates & Cells
[0184] As explained further in the examples below, the inventors have surprisingly observed
very high expression levels of light chains comprising human lambda variable regions
(at least 70 or 80% human V lambda) from transgenic light chain loci produced by targeted
insertion of human lambda gene segments into endogenous non-human vertebrate light
chain loci. This is possible even in the presence of endogenous non-human vertebrate
V and J gene segments in the vertebrate genome. Also, the surprisingly high levels
of expression are achieved when insertion of human lambda gene segments are in the
endogenous kappa or lambda locus. Such high levels by targeted insertion has not hitherto
been published in the art.
[0185] The inventors also surprisingly observed that endogenous kappa chain expression can
be completely inactivated by targeted insertion of human lambda gene sequence into
the endogenous kappa locus, as explained further in the examples.
[0186] The targeted insertion of human gene segments into endogenous Ig loci is advantageous
because it enables the operable location of inserted human Ig sequences with respect
to endogenous Ig constant regions and endogenous control regions, such as enhancers
and other locus control regions for example. Thus, targeted insertion allows one to
harness endogenous control important in one or more of Ig gene segment recombination,
allelic exclusion, affinity maturation, class switching, levels of Ig expression and
desirable development of the B-cell compartment. As such, targeted insertion is superior
to early attempts in the art to produce transgenic Ig loci and expression, which attempts
relied on the introduction into non-human vertebrate cells of vectors such as YACs
bearing human Ig gene segments. YACs are randomly integrated into the vertebrate cell
genome, so that it is difficult to achieve the control provided by targeted insertion
and the concomitant benefits that are brought in terms of harnessing endogenous control
mechanisms. In addition, random insertion often results in the inserted human Ig gene
segments coming under the control of heterologous control elements and/or epigenetic
chromosomal modifications such as methylation and chromatin confirmations, either
of which can be detrimental to proper Ig gene segment recombination, allelic exclusion,
affinity maturation, class switching, levels of Ig expression and desirable development
of the B-cell compartment. Random insertion typically results in 2 or more copies
of the introduced transgene which can cause chromosomal instability and therefore
result in poor breeding performance of the animals in addition to detrimental effects
on proper Ig gene segment recombination, allelic exclusion, affinity maturation, class
switching, levels of Ig expression and desirable development of the B-cell compartment.
Thus, prior art attempts using random insertion have tended to lead to poor B-cell
development, relatively small B-cell compartments and inferior Ig expression and a
concomitant difficulty in isolating an antibody with a desired characteristic.
[0187] The disclosure therefore provides the following aspects:-
Expression of human lambda variable regions
[0188]
- 1. A non-human vertebrate (eg, a mouse or rat) whose genome comprises an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments upstream of
a constant region, wherein the human Vλ and Jλ gene segments have been provided by
insertion into an endogenous light chain locus of the vertebrate, wherein the vertebrate
expresses immunoglobulin light chains comprising lambda variable regions (lambda light
chains), wherein the lambda light chains comprise immunoglobulin light chains comprising
lambda variable regions derived from recombination of human Vλ and Jλ gene segments.
A non-human vertebrate (eg, a mouse or rat) whose genome comprises an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments upstream of
a constant region, wherein the human Vλ and Jλ gene segments have been provided by
insertion into an endogenous light chain locus of the vertebrate, wherein the vertebrate
expresses immunoglobulin light chains comprising lambda variable regions (lambda light
chains), and wherein at least 70 or 80% of the variable regions of the lambda light
chains expressed by the vertebrate are derived from recombination of human Vλ and
Jλ gene segments. This is demonstrated in the examples below.
For example, at least 70, 75, 80, 84, 85, 90, 95, 96, 97, 98 or 99%, or 100% of the
variable regions of the lambda light chains expressed by the vertebrate are derived
from recombination of human Vλ and Jλ gene segments. This is demonstrated in the examples
below.
In aspects, there is provided. A non-human vertebrate ES cell (eg, a mouse ES cell
or rat ES cell) whose genome comprises an Ig gene segment repertoire produced by targeted
insertion of human Ig gene segments into one or more endogenous Ig loci, the genome
comprising human Vλ and Jλ gene segments upstream of a constant region, wherein the
human Vλ and Jλ gene segments have been provided by insertion into an endogenous light
chain locus of the vertebrate cell, wherein the cell can develop into a vertebrate
that expresses immunoglobulin light chains comprising lambda variable regions (lambda
light chains), wherein the lambda light chains comprise immunoglobulin light chains
comprising lambda variable regions derived from recombination of human Vλ and Jλ gene
segments.
A non-human vertebrate ES cell (eg, a mouse ES cell or rat ES cell) whose genome comprises
an Ig gene segment repertoire produced by targeted insertion of human Ig gene segments
into one or more endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments
upstream of a constant region, wherein the human Vλ and Jλ gene segments have been
provided by insertion into an endogenous light chain locus of the vertebrate cell,
wherein the cell can develop into a vertebrate that expresses immunoglobulin light
chains comprising lambda variable regions (lambda light chains), and wherein at least
70 or 80% (for example, at least 70, 75, 80, 84, 85, 90, 95, 96, 97, 98 or 99%, or
100%) of the variable regions of the lambda light chains expressed by the vertebrate
are derived from recombination of human Vλ and Jλ gene segments.
In an example, surprisingly expression of immunoglobulin light chains comprising lambda
variable regions derived from recombination of human Vλ and Jλ gene segments is achieved
even when the genome comprises endogenous non-human vertebrate lambda variable region
gene segments (eg, endogenous Vλ and/or Jλ gene segments, optionally a complete endogenous
repertoire of Vλ and Jλ gene segments). Thus, in an example, the genome comprises
endogenous non-human vertebrate lambda variable region gene segments (eg, endogenous
Vλ and/or Jλ gene segments, optionally a complete endogenous repertoire of Vλ and
Jλ gene segments). In another example, such endogenous gene segments are absent from
the genome.
- 2. The vertebrate or cell of aspect 1, optionally wherein the human Vλ and Jλ insertion
comprises at least the functional human V and J gene segments (optionally also human
Cλ) comprised by a human lambda chain Ig locus from Vλ2-18 to Cλ7. In one example,
the insertion also comprises lambda inter-gene segment sequences. These are human
sequences or they can be sequences of the non-human vertebrate species (eg, where
the vertebrate is a mouse, sequences between corresponding mouse lambda gene segments
can be used).
- 3. The vertebrate or cell of aspect 1 or 2, optionally wherein the genome is homozygous
for the human Vλ and Jλ gene segment insertion and endogenous kappa chain expression
in said vertebrate is substantially or completely inactive. In one example, less than
10, 5, 4, 3, 2, 1 or 0.5% of light chains are provided by endogenous kappa chains
(ie, kappa chains whose variable regions are derived from recombination of non-human
vertebrate V and J gene segments).
- 4. The vertebrate or cell of any preceding aspect, optionally wherein the endogenous
locus is an endogenous kappa locus.
- 5. The vertebrate or cell of any preceding aspect, optionally wherein the endogenous
locus is an endogenous lambda locus.
≥60% of all light chains have human lambda V regions
- 6. A non-human vertebrate (eg, a mouse or rat) whose genome comprises an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising (i) human Vλ and Jλ gene segments upstream
of a constant region, wherein the human Vλ and Jλ gene segments have been provided
by insertion into an endogenous light chain locus of the vertebrate and (ii) kappa
V gene segments upstream of a constant region, wherein the vertebrate expresses immunoglobulin
light chains comprising human lambda variable regions (human lambda light chains),
and wherein at least 60% of the light chains expressed by the vertebrate are provided
by said human lambda light chains. This is demonstrated in the examples below. For
example, at least 65, 70, 80, 84, 85, 90, 95, 96, 97, 98 or 99%, or 100% of the light
chains expressed by the vertebrate are provided by said human lambda light chains.
For example, at least 84% of the light chains expressed by the vertebrate are provided
by said human lambda light chains. For example, at least 95% of the light chains expressed
by the vertebrate are provided by said human lambda light chains. This is demonstrated
in the examples below.
In one aspect, there is provided a non-human vertebrate ES cell (eg, a mouse ES cell
or rat ES cell) whose genome comprises an Ig gene segment repertoire produced by targeted
insertion of human Ig gene segments into one or more endogenous Ig loci, the genome
comprising (i) human Vλ and Jλ gene segments upstream of a constant region, wherein
the human Vλ and Jλ gene segments have been provided by insertion into an endogenous
light chain locus of the vertebrate and (ii) kappa V gene segments upstream of a constant
region, wherein the cell can develop into a vertebrate that expresses immunoglobulin
light chains comprising human lambda variable regions (human lambda light chains),
and wherein at least 60% of the light chains expressed by the vertebrate are provided
by said human lambda light chains.
- 7. A non-human vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse
cell or a rat cell) whose genome comprises an Ig gene segment repertoire produced
by targeted insertion of human Ig gene segments into one or more endogenous Ig loci,
the genome comprising a targeted insertion of human immunoglobulin Vλ and Jλ gene
segments into an endogenous non-human vertebrate light kappa or lambda chain locus
downstream of endogenous VL and JL gene segments for expression of light chains comprising
human lambda variable regions; wherein the human Vλ and Jλ insertion comprises at
least the functional human V and J (and optionally also functional human Cλ) gene
segments comprised by a human lambda chain Ig locus from Vλ2-18 to Cλ7.
[0189] As demonstrated in the examples, endogenous light chain expression from said locus
is inactivated and also human lambda variable region expression dominates over endogenous
lambda variable region expression.
[0190] By "downstream" is meant 3' of the gene segments on the same chromosome. In one example,
the endogenous V and J gene segments are inverted with respect to the human gene segments
and optionally moved out of the endogenous light chain locus. In one example, the
human gene segments are downstream of all of the endogenous V and J segments of said
kappa or lambda locus. The possibility of retaining the endogenous V-J sequences and
intergenic sequences is advantageous since embedded control regions and/or genes are
retained that may be desirable in the vertebrate.
[0191] Optionally the insertion also comprises lambda inter-gene segment sequences. These
are human sequences or they can be sequences of the non-human vertebrate species (eg,
where the vertebrate is a mouse, sequences between corresponding mouse lambda gene
segments can be used).
Expression of VJCλ Lambda Chains
[0192]
8. A non-human vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse
cell or a rat cell) whose genome comprises an Ig gene segment repertoire produced
by targeted insertion of human Ig gene segments into one or more endogenous Ig loci,
the genome comprising a targeted insertion of human immunoglobulin Vλ, Jλ and Cλ genes
into an endogenous non-human vertebrate kappa or lambda light chain locus upstream
of an endogenous non-human vertebrate kappa or lambda constant region for expression
of a human VJC light chain; optionally wherein the human VJC insertion comprises at
least the functional human V, J and C gene segments comprised by a human lambda chain
Ig locus from Vλ3-1 to Cλ7 (eg, comprised by a human lambda chain Ig locus from 2-18
to Cλ7).
As demonstrated in the examples, human lambda variable region expression dominates
over endogenous kappa variable region expression. Endogenous kappa chain expression
from the endogenous locus can be inactivated.
Optionally the insertion also comprises lambda inter-gene segment sequences. These
are human sequences or they can be sequences of the non-human vertebrate species (eg,
where the vertebrate is a mouse, sequences between corresponding mouse lambda gene
segments can be used).
9. A non-human vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse
cell or a rat cell) whose genome comprises an Ig gene segment repertoire produced
by targeted insertion of human Ig gene segments into one or more endogenous Ig loci,
the genome comprising a targeted insertion of at least the functional human Vλ and
Jλ (and optionally human functional Cλ) gene segments comprised by a human lambda
chain Ig locus from Vλ3-1 to Cλ7 (optionally from Vλ2-18 to Cλ7) into an endogenous
non-human vertebrate kappa light chain locus downstream of the mouse Vκ and Jκ gene
segments for expression of a light chain comprising a human lambda variable region,
whereby in the presence of said insertion expression of endogenous kappa light chains
derived from said mouse Vκ and Jκ gene segments is substantially or completely inactivated.
In one example, less than 10, 5, 4, 3, 2, 1 or 0.5% of light chains are provided by
endogenous kappa chains (ie, kappa chains whose variable regions are derived from
recombination of non-human vertebrate Vκ and Jκ gene segments).
Optionally the insertion also comprises lambda inter-gene segment sequences. These
are human sequences or they can be sequences of the non-human vertebrate species (eg,
where the vertebrate is a mouse, sequences between corresponding mouse lambda gene
segments can be used).
10. A non-human vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse
cell or a rat cell), wherein in the genome of which the mouse IgK-VJ has been moved
away from the mouse Eκ enhancer, thereby inactivating endogenous IgK-VJ regions. This
is demonstrated in the examples.
11. The vertebrate of cell of aspect 10, optionally wherein the IgK-VJ has been moved
away from the mouse Eκ enhancer by insertion of human VL and JL gene segments between
the mouse IgK-VJ and the Eκ enhancer; optionally wherein the insertion is an insertion
as recited in any preceding aspect 1-9 or an insertion of human Vκ and Jκ gene segments.
12. The vertebrate or cell of any preceding aspect, optionally wherein the human Vλ
and Jλ gene segments have been inserted within 100, 75, 50, 40, 30, 20, 15, 10 or
5kb of an endogenous non-human vertebrate light chain enhancer. In one example, the
enhancer is a lambda enhancer (eg, mouse Eλ2-4, Eλ4-10 or Eλ3-1) when the insertion
is into an endogenous lambda locus. In one example, the enhancer is a kappa enhancer
(eg, iEκ or 3'Eκ) when the insertion is into an endogenous kappa locus.
13. The vertebrate or cell of any preceding aspect, optionally wherein the human Vλ
and Jλ gene segments are provided in the genome by the targeted insertion of at least
10 human Vλ gene segments with human Jλ gene segments upstream of an endogenous non-human
vertebrate light chain constant region of said light chain locus. For example, the
human gene segments are provided by insertion of at least a portion of a human Ig
lambda chain locus from Vλ2-18 to Vλ3-1; or at least a portion of a human Ig lambda
chain locus from Vλ2-18 to Vλ3-1 inserted with Jλ1, Jλ2, Jλ3, Jλ6 and Jλ7; or at least
a portion of a human Ig lambda chain locus from Vλ2-18 to Cλ7 (optionally excluding
Jλ4Cλ4 and/or Jλ5Cλ5).
Optionally at least 2, 3, 4 or 5 human Jλ are inserted. In one aspect, the inserted
Jλs are different from each other. For example, human Jλ1, Jλ2, Jλ3, Jλ6 and Jλ7 are
inserted, optionally as part of respective human JλCλ clusters.
Optionally a human light chain enhancer, eg Eλ, is inserted. For example, insertion
of human Eλ between the human Jλ segments and the endogenous constant region; or between
human Cλ gene segments (when these are inserted) and the endogenous constant region.
14. The vertebrate or cell of any preceding aspect, optionally wherein the lambda
light chains provide a repertoire of human lambda variable regions derived from human
Vλ gene segments Vλ3-1 and optionally one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12,
Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8 and Vλ4-3 that have been provided in the genome by targeted
insertion into said light chain locus.
This is useful because Vλ3-1 is a highly-used lambda gene segment in humans (Fig 59;
Ignatovich et al 1997) and thus it is desirable that cells and vertebrates of the disclosure provide
for the inclusion of lambda variable regions based on this gene segment for selection
against antigen, particulary for the development of antibody therapeutics for human
use.
15. The vertebrate or cell of any preceding aspect, optionally wherein the lambda
light chains provide a repertoire of human lambda variable regions derived from human
Vλ gene segments Vλ2-14 and one or more of Vλ2-18, Vλ3-16, Vλ3-12, Vλ2-11, Vλ3-10,
Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1 that have been provided in the genome by targeted insertion
into said light chain locus.
This is useful because Vλ2-14 is a highly-used lambda gene segment in humans and thus
it is desirable that cells and vertebrates of the disclosure provide for the inclusion
of lambda variable regions based on this gene segment for selection against antigen,
particulary for the development of antibody therapeutics for human use.
The vertebrate or cell of any preceding aspect, optionally wherein the lambda light
chains provide a repertoire of human lambda variable regions derived from human Vλ
gene segments Vλ2-8 and one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10,
Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1 that have been provided in the genome by targeted insertion
into said light chain locus.
This is useful because Vλ2-8 is a highly-used lambda gene segment in humans and thus
it is desirable that cells and vertebrates of the disclosure provide for the inclusion
of lambda variable regions based on this gene segment for selection against antigen,
particulary for the development of antibody therapeutics for human use.
The vertebrate or cell of any preceding aspect, optionally wherein the lambda light
chains provide a repertoire of human lambda variable regions derived from human Vλ
gene segments Vλ3-10 and one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ2-14,
Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1 that have been provided in the genome by targeted insertion
into said light chain locus.
This is useful because Vλ3-10 is a highly-used lambda gene segment in humans and thus
it is desirable that cells and vertebrates of the disclosure provide for the inclusion
of lambda variable regions based on this gene segment for selection against antigen,
particulary for the development of antibody therapeutics for human use.
16. The vertebrate or cell of any preceding aspect, optionally wherein the human Vλ
gene segments comprise the functional Vλ comprised by a human lambda chain Ig locus
from Vλ2-18 to Vλ3-1.
For example, the human Vλ gene segments comprise at least human V gene segment Vλ3-1
or at least segments Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8,
Vλ4-3 and Vλ3-1.
17. The vertebrate of any preceding aspect, optionally wherein the vertebrate expresses
more lambda chains than kappa chains. Lambda chains comprise variable regions derived
from recombination of Vλ and Jλ gene segments - for example, expressed with a lambda
constant region. Kappa chains comprise variable regions derived from recombination
of Vκ and Jκ gene segments - for example, expressed with a kappa constant region.
18. The vertebrate of any preceding aspect, optionally wherein the vertebrate expresses
no endogenous kappa chains. For example, endogenous kappa chain expression can be
inactivated by any of the means described herein, such as by inversion of all or part
of the endogenous kappa VJ region or by insertion of a marker (eg, neo) or other interfering
sequence in an endogenous kappa locus (a locus not comprising human lambda gene segments
according to the disclosure).
19. The vertebrate of any preceding aspect, optionally wherein kappa chain expression
is substantially or completely inactive in said vertebrate. In one example, less than
10, 5, 4, 3, 2, 1 or 0.5% of light chains are provided by kappa chains.
20. The vertebrate or cell of any preceding aspect, optionally wherein a human Eλ
enhancer is inserted in said endogenous non-human vertebrate locus. For example, there
is inserted a human 5' MAR and human Eλ (and optionally the human 3' MAR) in germline
configuration. For example, there is inserted a sequence corresponding to the human
lambda intronic region immediately 3' of human Jλ7-Cλ7 to, and including, at least
the human Eλ (and optionally also the human 3' MAR) - optionally including at least
30kb of intronic region 3' of the human Eλ.
21. The vertebrate or cell of any preceding aspect, wherein optionally at least human
JC gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 are inserted in addition
to the other human gene segments.
22. The vertebrate or cell of any preceding aspect, wherein optionally the inserted
human gene segments are in germline configuration; optionally with the human inter-gene
segment sequences or the corresponding endogenous non-human vertebrate inter-gene
segment sequences.
23. The vertebrate or cell of any preceding aspect, wherein optionally an endogenous
non-human vertebrate light chain enhancer is maintained in the endogenous locus; optionally
in germline configuration. For example, when the endogenous locus is a kappa locus,
an endogenous kappa enhancer is maintained. This can be the iEk and/or the 3'Ek, optionally
in germline configuration with respect to an endogenous light chain constant region.
This may be useful to help control of light chain expression in the non-human vertebrate
or cell.
24. The vertebrate or cell of any preceding aspect, optionally wherein the genome
is heterozygous for the human lamabda insertion at the endogenous locus. For example,
heterozygous for the human VJ or VJC insertion at an endogenous kappa (eg, mouse or
rat kappa) locus. This aids and simplifies breeding of the vertebrates since the other
endogenous locus (eg, the other kappa locus) can be used to provide a different transgenic
Ig locus, such as a transgenic kappa locus comprising human kappa V and J gene segments
either upstream of the endogenous mouse kappa constant region or upstream of a human
kappa constant region. In this case, the kappa enhancers (iEk and/or the 3'Ek) can
be maintained in that kappa locus to aid expression in the vertebrate by using endogenous
control mechanisms.
In another aspect, there is provided a non-human vertebrate or cell according to any
preceding aspect, wherein
- (a) the endogenous locus is an endogenous lambda locus (eg, in a mouse), the genome
being heterozygous for the insertion at the lambda locus, thus one allele of the lambda
locus comprising the human Vλ and Jλ gene segment insertion (optionally with the human
Cλ gene segment insertion; optionally with the human Eλ insertion) as described above;
- (b) the other endogenous lambda allele comprises a plurality of human Vκ gene segments
and one or more human Jκ gene segments upstream of a constant region (eg, a kappa
constant region of said non-human vertebrate species; a human kappa constant region;
the endogenous lambda constant region; or a human lambda constant region); optionally
with one or more kappa enhancers (eg, iEk and/or the 3'Ek, eg, of said non-human vertebrate
species); and
- (c) endogenous lambda and kappa chain expression has been inactivated.
Thus, there is no expression of light chains comprising variable regions derived from
recombination of endogenous V and J regions, but there is expression of human lambda
and human kappa light chains from the alleles at the endogenous lambda locus. This
is beneficial, since the design greatly aids construction and breeding of vertebrates
by avoiding need to provide transgenic loci at both the endogenous lambda and kappa
loci.
The endogenous kappa locus (and thus endogenous kappa chain expression) can be inactivated
by inversion, deletion of kappa gene segments (eg, endogenous V and/or J and/or C
kappa) and/or by insertion of an interrupting sequence such as a marker (eg, neo)
into the endogenous kappa locus.
The human kappa segment insertion into the endogenous lambda can be carried out, for
example, by inserting a sequence corresponding to a portion of a human kappa locus
comprising in germline configuration all functional human Vκ and Jκ (ie, optionally
excluding pseudogenes and ORFs; see the IMGT database); and optionally also a human
iEκ.
25. The vertebrate or cell of aspect 24, optionally wherein the genome comprises said
human lambda gene segment insertion at one endogenous non-human vertebrate kappa locus
allele, and wherein the other endogenous kappa locus allele comprises an insertion
of human kappa immunoglobulin V and J genes upstream of an endogenous non-human vertebrate
kappa constant region; optionally wherein an endogenous kappa light chain enhancer
is maintained in one or both kappa locus; optionally in germline configuration.
The vertebrate or cell of aspect 24, optionally wherein the genome comprises said
human lambda gene segment insertion at one endogenous non-human vertebrate lambda
locus allele, and wherein the other endogenous lambda locus allele comprises an insertion
of human kappa immunoglobulin V and J genes upstream of an endogenous non-human vertebrate
kappa constant region; optionally wherein an endogenous lambda light chain enhancer
is maintained in one or both lambda locus; optionally in germline configuration.
26. The vertebrate or cell of claim 24, optionally wherein the genome comprises said
human lambda gene segment insertion at one endogenous non-human vertebrate lambda
locus allele, and wherein the other endogenous lambda locus allele comprises an insertion
of human kappa immunoglobulin V and J genes upstream of an endogenous non-human vertebrate
kappa constant region; optionally wherein an endogenous lambda light chain enhancer
is maintained in one or both kappa locus; optionally in germline configuration.
27. The vertebrate or cell of any one of aspects 1 to 23, optionally wherein the genome
is homozygous for the human lambda insertion at the endogenous non-human vertebrate
locus.
28. The vertebrate or cell of any one of aspects 1 to 23, optionally wherein the genome
is homozygous for a human lambda gene segment insertion at the endogenous non-human
vertebrate kappa and lambda loci.
29. The vertebrate or cell of any one of aspects 1 to 23 and 28, optionally wherein
the genome is homozygous for a human lambda gene segment insertion at the endogenous
non-human vertebrate lambda loci, one endogenous kappa locus allele comprising a human
lambda gene segment insertion and the other endogenous kappa locus allele comprising
an insertion of a plurality of human Vκ and Jκ gene segments upstream of a Cκ region
for the expression of kappa light chains comprising human kappa variable regions.
Human kappa variable regions are those derived from the recombination of human Vκ
and Jκ.
30. The vertebrate or cell of aspect 27 or 28, optionally wherein the human lambda
gene segment insertions at the kappa and lambda loci are insertions of the same repertoire
of human lambda gene segments.
31. The vertebrate or cell of aspect 27 or 28, optionally wherein the human lambda
gene segment insertions at the kappa loci are different from the human lambda gene
segment insertions at the lambda loci. This is useful for expanding the potential
repertoire of variable regions for subsequent selection against antigen.
32. A non-human vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse
cell or a rat cell) whose genome comprises an Ig gene segment repertoire produced
by targeted insertion of human Ig gene segments into one or more endogenous Ig loci,
the genome comprising the following light chain loci arrangement
- (a) L at one endogenous kappa chain allele and K at the other endogenous kappa chain
allele; or
- (b) L at one endogenous lambda chain allele and K at the other endogenous lambda chain
allele; or
- (c) L at both endogenous kappa chain alleles;
- (d) L at both endogenous lambda chain alleles;
- (e) L at one endogenous kappa chain allele and the other endogenous kappa chain allele
has been inactivated; or
- (f) L at one endogenous lambda chain allele and the other endogenous lambda chain
allele has been inactivated;
Wherein
L reperesents a human lambda gene segment insertion of at least the functional human
Vλ and Jλ (optionally also Cλ gene segments) comprised by a human lambda chain Ig
locus from Vλ3-1 to Cλ7 (eg, comprised by a human lambda chain Ig locus from 2-18
to Cλ7); and
K represents a human Vκ and Jκ insertion;
Wherein in the genome the human gene segments are inserted upstream of a constant
region for expression of light chains comprising variable regions derived from the
recombination of human V and J gene segments.
33. The vertebrate or cell according to aspect 32, optionally wherein the genome comprises
arrangement
(a) and L at one or both endogenous lambda chain alleles; or
(a) and K at one or both endogenous lambda chain alleles; or
(a) and L at one endogenous lambda chain allele and K at the other endogenous lambda
chain allele; or
(b) and L at one or both endogenous kappa chain alleles; or
(b) and K at one or both endogenous kappa chain alleles; or
(b) and L at one endogenous kappa chain allele and K at the other endogenous kappa
chain allele; or
(c) and K at one or both endogenous lambda chain alleles; or
(c) and L at one or both endogenous lambda chain alleles; or
(c) and L at one endogenous lambda chain allele and K at the other endogenous lambda
chain allele; or
(c) and both endogenous lambda chain alleles have been inactivated; or
(d) and L at one or both endogenous kappa chain alleles; or
(d) and K at one or both endogenous kappa chain alleles; or
(d) and L at one endogenous kappa chain allele and K at the other endogenous kappa
chain allele; or
(d) and both endogenous kappa chain alleles have been inactivated.
34. The vertebrate or cell of aspect 32 or 33, optionally wherein endogenous kappa
chain expression is substantially or completely inactivated. Endogenous kappa chains
are kappa light chains comprising variable regions derived from the recombination
of endogenous (non-human vertebrate) Vκ and Jκ gene segments.
35. The vertebrate or cell of aspect 32, 33 or 34, optionally wherein endogenous lambda
chain expression is substantially or completely inactive. Endogenous lambda chains
are lambda light chains comprising variable regions derived from the recombination
of endogenous (non-human vertebrate) Vλ and Jλ gene segments.
36. The vertebrate or cell of any one of aspects 32 to 35, optionally wherein each
L insertion is upsteam of an endogenous lambda or kappa constant region.
37. The vertebrate or cell of any one of aspects 32 to 36, optionally wherein each
L insertion into a lambda locus is upsteam of an endogenous lambda constant region.
38. The vertebrate or cell of any one of aspects 32 to 36, optionally wherein each
L insertion into a kappa locus is upsteam of an endogenous kappa constant region.
39. The vertebrate or cell of any one of aspects 32 to 35, optionally wherein each
L insertion into a lambda locus is upsteam of a human lambda constant region.
40. The vertebrate or cell of any one of aspects 32 to 35, optionally wherein each
L insertion into a kappa locus is upsteam of a human kappa constant region.
41. The vertebrate or cell of any one of aspects 32 to 40, optionally wherein each
K insertion is upsteam of an endogenous lambda or kappa constant region.
42. The vertebrate or cell of any one of aspects 32 to 41, optionally wherein each
K insertion into a lambda locus is upsteam of an endogenous lambda constant region.
43. The vertebrate or cell of any one of aspects 32 to 42, optionally wherein each
K insertion into a kappa locus is upsteam of an endogenous kappa constant region.
44. The vertebrate or cell of any one of aspects 32 to 40, optionally wherein each
K insertion into a lambda locus is upsteam of a human lambda constant region.
45. The vertebrate or cell of any one of aspects 32 to 40 and 44, optionally wherein
each K insertion into a kappa locus is upsteam of a human kappa constant region.
46. The vertebrate or cell of any one of aspects 32 to 45, optionally wherein the
insertions are according to any one of aspects 1 to 9, 11 to 16 and 20 to 31.
47. The vertebrate or cell of any one of aspects 32 to 46, optionally wherein each
human lambda insertion is according to any one of aspects 1 to 9, 11 to 16 and 20
to 31.
48. The vertebrate or cell of any one of aspects 32 to 47, optionally wherein each
human kappa insertion is according to any one of aspects 1 to 9, 11 to 16 and 20 to
31.
49. The vertebrate or cell of any one of aspects 32 to 48, optionally wherein each
human lambda insertion comprises the repertoire of human Vλ and Jλ (and optionally
Cλ) gene segments.
50. The vertebrate or cell of any one of aspects 32 to 48, optionally wherein first
and second (and optionally third) human lambda insertions are made and the insertions
comprise different repertoires of human Vλ and Jλ (and optionally Cλ) gene segments.
51. The vertebrate or cell of any one of aspects 32 to 50, optionally wherein each
human kappa insertion comprises the repertoire of human Vκ and Jκ (and optionally
Cκ) gene segments.
52. The vertebrate or cell of any one of aspects 32 to 50, optionally wherein first
and second (and optionally third) human kappa insertions are made and the insertions
comprise different repertoires of human Vκ and Jκ (and optionally Cκ) gene segments.
53. The vertebrate or cell of any preceding aspect, optionally wherein the genome
comprises an immunoglobulin heavy chain locus comprising human VH gene segments, eg,
a heavy chain locus as herein described which comprises human V, D and J gene segments..
54. A method for producing an antibody or light chain comprising a lambda variable
region specific to a desired antigen, the method comprising immunizing a vertebrate
according to any preceding aspect with the desired antigen and recovering the antibody
or light chain or recovering a cell producing the antibody or light chain.
55. A method for producing a fully humanised antibody or antibody light chain comprising
carrying out the method of aspect 54 to obtain an antibody or light chain comprising
a lambda chain non-human vertebrate constant region, and replacing the non-human vertebrate
constant region with a human constant region, optionally by engineering of the nucleic
acid encoding the antibody or light chain.
56. A humanised antibody or antibody light chain produced according to aspect 54 or
a derivative thereof; optionally for use in medicine.
57. Use of a humanised antibody or chain produced according to aspect 54 or a derivative
thereof in medicine.
58. A method of inactivating endogenous Ig-VJ regions in the genome of a non-human
vertebrate or a non-human vertebrate cell (eg, a mouse, rat, mouse cell or a rat cell),
wherein the method comprises inserting human immunoglobulin gene segments (eg, V and
J gene segments) in the genome between the endogenous Ig-VJ and an endogenous enhancer
or endogenous constant region to move the endogenous Ig-VJ away from the enhancer
or constant region, thereby inactivating endogenous Ig-VJ regions.
In one aspect, the endogenous Ig-VJ are heavy chain gene segments, the enhancer is
an endogenous heavy chain enhancer, the constant region is an endogenous heavy chain
constant region and the human Ig gene segments comprise human VH, DH and JH gene segments.
In one aspect, the endogenous Ig-VJ are lambda light chain gene segments, the enhancer
is an endogenous lambda chain enhancer, the constant region is an endogenous lambda
chain constant region and the human Ig gene segments comprise human Vλ and Jλ gene
segments.
In one aspect, the endogenous Ig-VJ are kappa light chain gene segments, the enhancer
is an endogenous kappa chain enhancer, the constant region is an endogenous kappa
chain constant region and the human Ig gene segments comprise human Vκ and Jκ gene
segments.
A method of inactivating endogenous IgK-VJ regions in the genome of a non-human vertebrate
or a non-human vertebrate cell (eg, a mouse, rat, mouse cell or a rat cell), wherein
the method comprises inserting human immunoglobulin gene segments in the genome between
the endogenous IgK-VJ and Eκ enhancer to move the IgK-VJ away from the Eκ enhancer,
thereby inactivating endogenous IgK-VJ regions.
59. The method of aspect 58, wherein optionally the human gene segments comprise human
VL and JL gene segments; optionally wherein the insertion is an insertion as recited
in any one of aspects 1 to 9, 11 to 16 and 20 to 31 or an insertion of human Vκ and
Jκ gene segments.
60. A method of expressing immunoglobulin light chains in a non-human vertebrate (eg,
a mouse or rat), the light chains comprising lambda variable regions (lambda light
chains), wherein at least 70 or 80% (for example, at least 70, 75, 80, 84, 85, 90,
95, 96, 97, 98 or 99%) of the variable regions of the lambda light chains expressed
by the vertebrate are derived from recombination of human Vλ and Jλ gene segments,
the method comprising providing in the genome of the vertebrate an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments upstream of
a constant region, wherein the method comprises inserting at least the functional
human Vλ and Jλ (optionally also human Cλ) gene segments (and optionally inter-gene
segment sequences) comprised by a human lambda chain Ig locus from Vλ2-18 to Cλ7 into
an endogenous light chain locus of the vertebrate, wherein at least 70 or 80% (for
example, at least 70, 75, 80, 84, 85, 90, 95, 96, 97, 98 or 99%) of the variable regions
of the lambda light chains expressed by the vertebrate are derived from recombination
of human Vλ and Jλ gene segments; the method comprising expressing said light chains
in the vertebrate and optionally isolating one or more of said light chains (eg, as
part of a 4-chain antibody).
In one aspect, the method further comprises isolating from the vertebrate a lambda
light chain comprising a variable region derived from recombination of human Vλ and
Jλ gene segments. In an example, the method comprises immunising the mouse with an
antigen (eg, a human antigen) prior to isolating the lambda light chain. In an example,
the light chain is part of an antibody, eg, an antibody that specifically binds the
antigen.
In one aspect, the use further comprises isolating splenic tissue (eg, the spleen)
from the mouse; optionally followed by isolating at least one antigen-specific B-cell
from the tissue, wherein the B-cell(s) expresses said lambda light chain. For example,
said lambda light chain is provided by an antibody that specifically binds a predetermined
antigen (eg, a human antigen). In one example, the use comprises immunising the mouse
with the antigen (eg, a human antigen) prior to isolating the splenic tissue or lambda
light chain. In an example, the use comprises isolating the lambda light chain produced
by the B-cell (or by a hybridoma produced by fusion of the B-cell with a myeloma cell).
In an example, the use comprises making a hybridoma from a B-cell isolated from the
splenic tissue, wherein the hybridoma expresses said lambda light chain or a derivative
thereof. Optionally, the use comprises making a derivative of the isolated antibody
or lambda light chain. Examples of derivative antibodies (according to any aspect
herein) are antibodies that have one or more mutations compared to the isolated antibody
(eg, to improve antigen-binding affinity and/or to enhance or inactivate Fc function)
Such mutants specifically bind the antigen. Mutation or adaptation to produce a derivative
includes, eg, mutation to produce Fc enhancement or inactivation. A derivative can
be an antibody following conjugation to a toxic payload or reporter or label or other
active moiety. In another example, a chimaeric antibody chain or antibody isolated
from a cell of vertebrate of the disclosure is modified by replacing one or all human
constant regions thereof by a corresponding human constant region. For example, all
constant regions of an antibody isolated from such a cell or vertebrate are replaced
with human constant regions to produce a fully human antibody (ie, comprising human
variable and constant regions). Such an antibody is useful for administration to human
patients to reduce anti-antibody reaction by the patient.
61. A method of expressing immunoglobulin light chains in a non-human vertebrate (eg,
a mouse or rat), wherein at least 60% (for example, at least 65, 70, 80, 84, 85, 90,
95, 96, 97, 98 or 99%) of the light chains expressed by the vertebrate are provided
by human lambda light chains, the method comprising providing in the genome of the
vertebrate an Ig gene segment repertoire produced by targeted insertion of human Ig
gene segments into one or more endogenous Ig loci, the genome comprising (i) human
Vλ and Jλ gene segments upstream of a constant region, wherein the human Vλ and Jλ
gene segments are provided by inserting at least the functional human Vλ and Jλ (optionally
also human Cλ) gene segments (and optionally inter-gene segment sequences) comprised
by a human lambda chain Ig locus from Vλ2-18 to Cλ7 into an endogenous light chain
locus of the vertebrate and (ii) kappa V gene segments upstream of a constant region,
wherein the vertebrate expresses immunoglobulin light chains comprising human lambda
variable regions (human lambda light chains) and at least 60% (for example, greater
than 65, 70, 80, 84, 85, 90, 95, 96, 97, 98 or 99%) of the light chains expressed
by the vertebrate are provided by said human lambda light chains; the method comprising
expressing said light chains in the vertebrate and optionally isolating one or more
of said light chains (eg, as part of a 4-chain antibody).
In one aspect, the method further comprises isolating from the vertebrate a lambda
light chain comprising a variable region derived from recombination of human Vλ and
Jλ gene segments. In an example, the method comprises immunising the mouse with an
antigen (eg, a human antigen) prior to isolating the lambda light chain. In an example,
the light chain is part of an antibody, eg, an antibody that specifically binds the
antigen.
In one aspect, the use further comprises isolating splenic tissue (eg, the spleen)
from the mouse; optionally followed by isolating at least one antigen-specific B-cell
from the tissue, wherein the B-cell(s) expresses said lambda light chain. For example,
said lambda light chain is provided by an antibody that specifically binds a predetermined
antigen (eg, a human antigen). In one example, the use comprises immunising the mouse
with the antigen (eg, a human antigen) prior to isolating the splenic tissue or lambda
light chain. In an example, the use comprises isolating the lambda light chain produced
by the B-cell (or by a hybridoma produced by fusion of the B-cell with a myeloma cell).
In an example, the use comprises making a hybridoma from a B-cell isolated from the
splenic tissue, wherein the hybridoma expresses said lambda light chain or a derivative
thereof. Optionally, the use comprises making a derivative of the isolated antibody
or lambda light chain. Examples of derivative antibodies (according to any aspect
herein) are antibodies that have one or more mutations compared to the isolated antibody
(eg, to improve antigen-binding affinity and/or to enhance or inactivate Fc function)
Such mutants specifically bind the antigen.
62. A method of expressing human immunoglobulin VJC light chains in a non-human vertebrate
(eg, a mouse or rat), the method comprising providing in the genome of the vertebrate
an Ig gene segment repertoire produced by targeted insertion of human Ig gene segments
into one or more endogenous Ig loci, wherein the method comprises inserting at least
the functional human Vλ, Jλ and Cλ gene segments (and optionally inter-gene segment
sequences) comprised by a human lambda chain Ig locus from Vλ3-1 to Cλ7 (eg, comprised
by a human lambda chain Ig locus from 2-18 to Cλ7) into an endogenous non-human vertebrate
kappa light chain locus upstream of an endogenous non-human vertebrate kappa constant
region for expression of a human VJC light chain; the method comprising expressing
said light chains in the vertebrate and optionally isolating one or more of said light
chains (eg, as part of a 4-chain antibody).
In one aspect, the method further comprises isolating from the vertebrate a lambda
light chain comprising a variable region derived from recombination of human Vλ and
Jλ gene segments. In an example, the method comprises immunising the mouse with an
antigen (eg, a human antigen) prior to isolating the lambda light chain. In an example,
the light chain is part of an antibody, eg, an antibody that specifically binds the
antigen.
In one aspect, the use further comprises isolating splenic tissue (eg, the spleen)
from the mouse; optionally followed by isolating at least one antigen-specific B-cell
from the tissue, wherein the B-cell(s) expresses said lambda light chain. For example,
said lambda light chain is provided by an antibody that specifically binds a predetermined
antigen (eg, a human antigen). In one example, the use comprises immunising the mouse
with the antigen (eg, a human antigen) prior to isolating the splenic tissue or lambda
light chain. In an example, the use comprises isolating the lambda light chain produced
by the B-cell (or by a hybridoma produced by fusion of the B-cell with a myeloma cell).
In an example, the use comprises making a hybridoma from a B-cell isolated from the
splenic tissue, wherein the hybridoma expresses said lambda light chain or a derivative
thereof. Optionally, the use comprises making a derivative of the isolated antibody
or lambda light chain. Examples of derivative antibodies (according to any aspect
herein) are antibodies that have one or more mutations compared to the isolated antibody
(eg, to improve antigen-binding affinity and/or to enhance or inactivate Fc function)
Such mutants specifically bind the antigen.
63. The method of any one of aspects 38 to 40, optionally wherein the vertebrate is
according to any one of the other aspects.
64. An antibody light chain isolated according to the method of any one of aspects
58 to 63 or a derivative thereof, or an antibody comprising such a light chain or
derivative; optionally for use in medicine.
65. Use of an antibody light chain isolated according to the method of any one of
aspects 58 to 63 or a derivative thereof (or an antibody comprising such a light chain
or derivative) in medicine.
66. A non-human vertebrate (eg, a mouse or rat) according to any one of aspects 1
to 53 for expressing light chains comprising lambda variable regions (lambda light
chains), wherein at least 70 or 80% (for example, at least 70, 75, 80, 84, 85, 90,
95, 96, 97, 98 or 99% or 100%) of the variable regions of the lambda light chains
expressed by the vertebrate are derived from recombination of human Vλ and Jλ gene
segments.
A non-human vertebrate (eg, a mouse or rat) according to any one of aspects 1 to 53
expressing light chains comprising lambda variable regions (lambda light chains),
wherein at least 70 or 80% (for example, at least 70, 75, 80, 84, 85, 90, 95, 96,
97, 98 or 99% or 100%) of the variable regions of the lambda light chains expressed
by the vertebrate are derived from recombination of human Vλ and Jλ gene segments.
67. A non-human vertebrate (eg, a mouse or rat) according to any one of aspects 1
to 53 for expressing light chains, wherein at least 60% (for example, greater than
65, 70, 80, 84, 85, 90, 95, 96, 97, 98 or 99% or 100%) of the light chains expressed
by the vertebrate are provided by human lambda light chains.
A non-human vertebrate (eg, a mouse or rat) according to any one of aspects 1 to 53
expressing light chains, wherein at least 60% (for example, greater than 65, 70, 80,
84, 85, 90, 95, 96, 97, 98 or 99% or 100%) of the light chains expressed by the vertebrate
are provided by human lambda light chains.
68. A non-human vertebrate (eg, a mouse or rat) according to aspect 7 for expressing
light chains comprising lambda variable regions (lambda light chains), wherein expression
of lambda light chains comprising human lambda variable regions dominates over expression
of lambda light chains comprising endogenous non-human vertebrate lambda variable
regions: and optionally for inactivating expression of endogenous non-human vertebrate
lambda variable regions from the endogenous light chain locus.
A non-human vertebrate (eg, a mouse or rat) according to aspect 7 expressing light
chains comprising lambda variable regions (lambda light chains), wherein expression
of lambda light chains comprising human lambda variable regions dominates over expression
of lambda light chains comprising endogenous non-human vertebrate lambda variable
regions: and optionally for inactivating expression of endogenous non-human vertebrate
lambda variable regions from the endogenous light chain locus.
69. A non-human vertebrate (eg, a mouse or rat) according to aspect 7, 8, 9 or 10
for inactivating expression of endogenous non-human vertebrate lambda variable regions
from the endogenous light chain locus.
[0193] The percentage expression or level of expression of antibody chains can be determined
at the level of light chain mRNA transcripts in B-cells (eg, peripheral blood lymphocytes).
Alternatively or additionally, the percentage expression is determined at the level
of antibody light chains in serum or blood of the vertebrates. Additionally or alternatively,
the expression can be determined by FACS (fluorescence activated cell sorting) analysis
of B cells. For example, by assessing mouse C kappa or human C lambda expression on
cell surface when the human lambda variable regions are expressed with mouse C kappa
or human C lambda regions respectively.
[0194] The term a "lambda light chain" in these aspects refers to a light chain comprising
a variable region sequence (at RNA or amino acid level) derived from the recombination
of Vλ and Jλ gene segments. Thus a "human lambda variable region", for example, is
a variable region derived from the recombination of human Vλ and Jλ gene segments.
The constant region can be a kappa or lambda constant region, eg, a human or mouse
constant region.
[0195] The vertebrate in these aspects is, for example naïve (ie, not immunised with a predetermined
antigen, as the term is understood in the art; for example, such a vertebrate that
has been kept in a relatively sterile environment as provided by an animal house used
for R&D). In another example, the vertebrate has been immunised with a predetermined
antigen, eg, an antigen bearing a human epitope.
Reference to "functional" human gene segments acknowledges that in a human Ig lambda
locus some V gene segments are non-functional pseudogenes (eg, Vλ3-17, Vλ3-15, Vλ3-13,
Vλ3-7, Vλ3-6, Vλ2-5, Vλ3-4, Vλ3-2; see the IMGT database: at World Wide Web (
www) imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human
&group=IGL. Also, Jλ4-Cλ4 and Jλ5-Cλ5 are not functional in humans. The term "functional"
when referring to gene segments excludes pseudogenes. An example of functional human
Vλ gene segments is the group Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9,
Vλ2-8, Vλ4-3 and Vλ3-1. An example of functional human Jλ gene segments is the group
Jλ1, Jλ2 and Jλ3; or Jλ1, Jλ2 and Jλ7; or Jλ2, Jλ3 and Jλ7; or Jλ1, Jλ2, Jλ3 and Jλ7.
An example of functional human Cλ gene segments is the group Cλ1, Cλ2 and Cλ3; or
Cλ1, Cλ2 and Cλ7; or Cλ2, Cλ3 and Cλ7; or Cλ1, Cλ2, Cλ3 and Cλ7.
[0196] In one aspect, the lambda light chains, together with heavy chains expressed in the
cells or vertebrates of the disclosure, form antibodies. The heavy chains can be expressed
from a transgenic heavy chain locus as herein described. For example the genome of
the cell or vertebrate comprises a heavy chain locus in which is a chimaeric immunoglobulin
heavy chain locus comprising one or more human V gene segments, one or more human
D gene segments and one or more human J gene segments upstream of a mu constant region
of said non-human species; endogenous heavy chain expression has been substantially
inactivated; and the heavy chain locus comprises an Eµ enhancer of said non-human
vertebrate species.
[0197] In one example of the vertebrate or cell, all endogenous enhancers are deleted from
the endogenous locus in which the human gene segments are inserted. Thus, when a human
enhancer (eg, Eλ) is inserted, this controls the transgenic locus in the absence of
the effect of other, endogenous, enhancers (for example, kappa enhancers if the locus
is an endogenous kappa enhancer). This may be useful to avoid non-human vertebrate-like
kappa:lambda expression ratios (eg, to steer expression to a higher ratio of lambda:
kappa in mice).
[0198] When endogenous light chain (eg, kappa or lambda) expression is substantially inactive
or inactivated as described herein, less than 10, 5, 4, 3, 2, 1 or 0.5% of such endogenous
light chains are expressed or expressible. In one example, there is complete inactivation
so no such light chains are expressed or expressible.
Optionally the vertebrate of the disclosure is naïve. Thus, the vertebrate has not
been immunised with a predetermined antigen.
Where, for example, a cell of the disclosure is an ES cell or other IPS stem cell
or other pluripotent stem cell, the cell can develop into a vertebrate of the disclosure.
For example, the cell can be implanted into a blastocyst from a foster mother and
developed into an embryo and animal according to standard techniques.
[0199] In one aspect, where human kappa gene segments are inserted, each insertion comprises
human kappa gene segments
- (i) Vκ1-5, Vκ1-6, Vκ1-8 and Vκ1-9 (and optionally Vκ5-2 and Vκ4-1); or
- (ii) Vκ1-5, Vκ1-6, Vκ1-8, Vκ1-9, Vκ3-11, Vκ1-12, Vκ3-15, Vκ1-16, Vκ1-17, Vκ3-20 (and
optionally Vκ 2-24 and/or Vκ1-13); or
- (iii) Vκ1-5, Vκ1-6, Vκ1-8, Vκ1-9, Vκ3-11, Vκ1-12, Vκ3-15, Vκ1-16, Vκ1-17, Vκ3-20,
Vκ 2-24, , Vκ1-27, Vκ2-28, Vκ2-30 and Vκ1-33 (and optionally Vκ 2-29 and/or Vκ2-40
and/or Vκ1-39);
and optionally
- (iv) Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
[0200] In one aspect, the human kappa insertion also comprises a human iEκ and/or human
3'Eκ downstream of the human J gene segments in the locus.
Transgenic Mice of the Disclosure Expressing Essentially Exclusively Human Heavy Chain
Variable Regions Develop Normal Splenic and BM Compartments & Normal Ig Expression
In Which the Ig Comprise Human Heavy Chain Variable Regions
[0201] The present inventors surprisingly observed normal Ig subtype expression & B-cell
development in transgenic mice of the disclosure expressing antibodies with human
heavy chain variable regions substantially in the absence of endogenous heavy and
kappa chain expression. See Example 16 below.
[0202] The inventors observed that surprisingly the inactivation of endogenous heavy chain
variable region expression in the presence of human variable region expression does
not change the ratio of B-cells in the splenic compartment (Fig. 66) or bone marrow
B progenitor compartment (Fig. 67) and the immunoglobulin levels in serum are normal
and the correct Ig subtypes are expressed (Fig. 68). These data demonstrate that inserted
human heavy chain gene segments according to the disclosure (eg, an insertion of at
least human V
H gene segments V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and J
H gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16,
4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6)
are fully functional for VDJ gene segment rearrangement from the transgenic heavy
chain locus, B-cell receptor (BCR) signalling and proper B-cell maturation
[0203] The disclosure therefore provides the following aspects (numbering starting at aspect
70):-
70. A mouse that expresses or for expressing immunoglobulin heavy chains comprising
human variable regions, wherein the heavy chains expressed by the mouse are essentially
exclusively said heavy chains comprising human variable regions; and said heavy chains
comprising human variable regions are expressed as part of serum IgG1,IgG2b and IgM
(and optionally IgG2a) antibodies in the mouse;
the mouse comprising an immunoglobulin heavy chain locus comprising human VH, DH and
JH gene segments upstream of a mouse constant region (eg, C-mu and/or C-delta and/or
C-gamma; such as (in a 5' to 3' orientation) mouse C-mu and mouse C-delta and mouse
C-gamma), wherein
- (a) the mouse is capable of expressing immunoglobulin heavy chains comprising human
variable regions and the heavy chains expressed by the mouse are essentially exclusively
said heavy chains comprising human variable regions; and
- (b) the mouse expresses serum IgG1,IgG2b and IgM (and optionally IgG2a) antibodies
comprising said heavy chains.
Ig isotypes can be determined, for example, using isotype-matched tool antibodies
as will be readily familiar to the skilled person (and as illustrated in Example 16).
In an aspect, the mouse is naïve.
71. The mouse of aspect 70 for expressing a normal relative proportion of serum IgG1,
IgG2a, IgG2b and IgM antibodies.
By "normal" is meant comparable to expression in a mouse (eg, a naïve mouse) expressing
only mouse antibody chains, eg, a mouse whose genome comprises only wild-type functional
Ig heavy and light chain loci, eg, a wild-type mouse.
72. The mouse of aspect 70 or 71, wherein the mouse expresses a normal relative proportion
of serum IgG1, IgG2a, IgG2b and IgM antibodies.
By "normal" is meant comparable to expression in a mouse (eg, a naive mouse) expressing
only mouse antibody chains, eg, a mouse whose genome comprises only wild-type functional
Ig heavy and light chain loci, eg, a wild-type mouse.
73. The mouse of any one of aspects 70 to 72, for expressing in the mouse
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
For example, the mouse of any one of aspects 70 to 72, for expressing in the mouse
- (i) serum IgG1 at a concentration of about 25-150 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-300 µg/ml; and
- (iv) serum IgM at a concentration of about 50-200 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-200 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-400 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
The mouse of any one of aspects 70 to 72, for expressing in the mouse Ig in the relative
proportions of
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
For example, the mouse of any one of aspects 70 to 72, for expressing in the mouse
Ig in the relative proportions of
- (i) serum IgG1 at a concentration of about 25-150 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-300 µg/ml; and
- (iv) serum IgM at a concentration of about 50-200 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-200 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-400 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
74. The mouse of any one of aspects 70 to 73, wherein the mouse expresses
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
For example, the mouse of any one of aspects 70 to 72, the mouse expresses
- (i) serum IgG1 at a concentration of about 25-150 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-300 µg/ml; and
- (iv) serum IgM at a concentration of about 50-200 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-200 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-400 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
The mouse of any one of aspects 70 to 73, wherein the mouse expresses Ig in the relative
proportions of
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
For example, the mouse of any one of aspects 70 to 72, the mouse expresses Ig in the
relative proportions of
- (i) serum IgG1 at a concentration of about 25-150 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-300 µg/ml; and
- (iv) serum IgM at a concentration of about 50-200 µg/ml;
or
- (i) serum IgG1 at a concentration of about 10-200 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-400 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by Ig capture on a plate followed by incubation (eg, for one hour at
RT, eg, for one hour at 20°C) with anti-mouse isotype-specific labelled antibodies
and quantification of Ig using the label (eg, using anti-mouse Ig isotype specific
antibodies each conjugated to horseradish peroxidase conjugated at a ratio of 1/10000
in PBS with 0.1% Tween™, followed by development of the label with tetramethylbenzidine
substrate (TMB) for 4-5 minutes in the dark at room temperature (eg, 20°C), adding
sulfuric acid to stop development of the label and reading of the label at 450 nm).
75. The mouse of any one of aspects 70 to 74 for expressing said heavy chains from
splenic B-cells in a mouse that produces a normal proportion or percentage of mature
splenic B-cells, eg as determined by FACS.
By "normal" is meant comparable to mature splenic B-cell production in a mouse (eg,
a naïve mouse) expressing only mouse antibody chains, eg, a mouse whose genome comprises
only wild-type functional Ig heavy and light chain loci, eg, a wild-type mouse. For
example, at least 40, 50, 60 or 70 % of total splenic B-cells produced by the mouse
of the disclosure are mature B-cells. Splenic B-cells are B220+ and express B220 at relatively high levels as the skilled person will know. Mature
splenic B-cells express B220 and IgD, both at relatively high levels as will be known
by the skilled person. IgM expression is relatively low in mature splenic B-cells,
again as is known in the art. For example, see J Exp Med. 1999 Jul 5;190(1):75-89; "B cell development in the spleen takes place in discrete steps and is determined
by the quality of B cell receptor-derived signals"; Loder F et al.
Optionally the mouse produces a normal ratio of T1, T2 and mature splenic B-cells,
eg, as determined by FACS. For example, the mouse of the disclosure produces about
40-70% mature splenic B-cells, 15-35% splenic T1 cells; and 5-10% splenic T2 cells
(percentage with reference to the total splenic B220-positive (high) population).
For example, about 40-60% mature splenic B-cells, 15-30% splenic T1 cells; and 5-10%
splenic T2 cells. By "normal" is meant comparable to a T1/T2/mature splenic B-cell
proportion in a mouse (eg, a naïve mouse) expressing only mouse antibody chains, eg,
a mouse whose genome comprises only wild-type functional Ig heavy and light chain
loci, eg, a wild-type mouse.
76. The mouse of any one of aspects 70 to 75, wherein the mouse produces a normal
proportion or percentage of mature splenic B-cells, eg as determined by FACS.
77. A mouse that expresses or for expressing immunoglobulin heavy chains comprising
human variable regions, wherein the heavy chains expressed by the mouse are essentially
exclusively said heavy chains comprising human variable regions and are expressed
in a mouse that produces a normal proportion or percentage of mature splenic B-cells
(eg, as determined by FACS); the mouse comprising an immunoglobulin heavy chain locus
comprising human VH, DH and JH gene segments upstream of a mouse constant region (eg,
C-mu and/or C-delta and/or C-gamma; such as (in a 5' to 3' orientation) and wherein
the mouse produces a normal proportion or percentage of mature splenic B-cells. By
"normal" is meant comparable to mature splenic B-cell production in a mouse (eg, a
naïve mouse) expressing only mouse antibody chains, eg, a mouse whose genome comprises
only wild-type functional Ig heavy and light chain loci, eg, a wild-type mouse.
For example, at least 40, 50, 60 or 70 % of total splenic B-cells produced by the
mouse of the disclosure are mature B-cells. Splenic B-cells are B220+ and express B220 at relatively high levels as the skilled person will know. Mature
splenic B-cells express B220 and IgD, both at relatively high levels as will be known
by the skilled person. IgM expression is relatively low in mature splenic B-cells,
again as is known in the art. For example, see J Exp Med. 1999 Jul 5;190(1):75-89; "B cell development in the spleen takes place in discrete steps and is determined
by the quality of B cell receptor-derived signals"; Loder F et al.
Optionally the mouse produces a normal ratio of T1, T2 and mature splenic B-cells,
eg, as determined by FACS. For example, the mouse of the disclosure produces about
40-70% mature splenic B-cells, 15-35% splenic T1 cells; and 5-10% splenic T2 cells
(percentage with reference to the total splenic B220-positive (high) population).
For example, about 40-60% mature splenic B-cells, 15-30% splenic T1 cells; and 5-10%
splenic T2 cells. By "normal" is meant comparable to a T1/T2/mature splenic B-cell
proportion in a mouse (eg, a naïve mouse) expressing only mouse antibody chains, eg,
a mouse whose genome comprises only wild-type functional Ig heavy and light chain
loci, eg, a wild-type mouse.
78. The mouse of any one of aspects 70 to 77 for expressing said heavy chains in a
mouse that produces a normal proportion or percentage of bone marrow B-cell progenitor
cells (eg as determined by FACS).
In one aspect, the mouse is for expressing said heavy chains in a mouse that produces
a normal proportion or percentage of bone marrow pre-, pro and prepro- B-cells (eg
as determined by FACS). See J Exp Med. 1991 May 1 ;173(5):1213-25; "Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse
bone marrow"; Hardy RR et al for more discussion on progenitor cells.
By "normal" is meant comparable to bone marrow B-cell production in a mouse (eg, a
naïve mouse) expressing only mouse antibody chains, eg, a mouse whose genome comprises
only wild-type functional Ig heavy and light chain loci, eg, a wild-type mouse.
79. The mouse of any one of aspects 70 to 78, wherein the mouse produces a normal
proportion or percentage of bone marrow B-cell progenitor cells (eg, as determined
by FACS).
In one aspect, the mouse produces a normal proportion or percentage of bone marrow
pre-, pro and prepro- B-cells (eg as determined by FACS). By "normal" is meant comparable
to bone marrow B-cell production in a mouse (eg, a naïve mouse) expressing only mouse
antibody chains, eg, a mouse whose genome comprises only wild-type functional Ig heavy
and light chain loci, eg, a wild-type mouse.
80. A mouse that expresses or for expressing immunoglobulin heavy chains comprising
human variable regions, wherein the heavy chains expressed by the mouse are essentially
exclusively said heavy chains comprising human variable regions and are expressed
in a mouse that produces a normal proportion or percentage of bone marrow B-cell progenitor
cells (eg, as determined by FACS), the mouse comprising an immunoglobulin heavy chain
locus comprising human VH, DH and JH gene segments upstream of a mouse constant region
(eg, C-mu and/or C-delta and/or C-gamma; such as (in a 5' to 3' orientation) and wherein
the mouse produces a normal proportion or percentage of bone marrow B-cell progenitor
cells.
In one aspect, the mouse is for expressing said heavy chains in a mouse that produces
a normal proportion or percentage of bone marrow pre-, pro and prepro- B-cells (eg
as determined by FACS).
By "normal" is meant comparable to bone marrow B-cell production in a mouse (eg, a
naïve mouse) expressing only mouse antibody chains, eg, a mouse whose genome comprises
only wild-type functional Ig heavy and light chain loci, eg, a wild-type mouse.
81. The mouse of any one of aspects 70 to 80, wherein at least 90% of the heavy chains
are heavy chains comprising human variable regions.
For example, at least 90, 95, 96, 97, 98, 99 or 99.5% or 100% of the heavy chains
comprise human variable regions, ie, variable regions derived from the recombination
of human VH with human D and JH gene segments.
82. The mouse of any one of aspects 70 to 81, wherein the mouse constant region comprises
a mouse C-mu region, a C-delta region and a C-gamma region.
In one aspect, each of the C regions is an endogenous, mouse C-region. In one aspect
at least the C-mu and the C-delta regions are mouse C regions. This is useful for
harnessing the endogenous control mechanisms involved in the development of the various
B-cell types and progenitors in the spleen and bone marrow.
In one aspect, the C-gamma region is a human C-gamma region. This is beneficial for
producing class-switched gamma-type heavy chains in the mouse in which essentially
all of the expressed heavy chains have human variable regions and human constant regions.
83. The mouse of any one of aspects 70 to 82, wherein there is a mouse heavy chain
enhancer between the human gene segments and the mouse constant region. This is useful
for harnessing the endogenous mouse antibody- and B-cell development control mechanisms.
84. The mouse of any one of aspects 70 to 83, wherein there is a mouse S-mu switch
between the human gene segments and the mouse constant region.
85. The mouse of any one of aspects 70 to 84, wherein the genome of the mouse comprises
endogenous mouse heavy chain locus V, D and J gene segments upstream of the human
gene segments.
86. The mouse of aspect 85, wherein the mouse V, D and J gene segments are present
together with the endogenous inter-gene segment sequences.
87. The mouse of aspect 85 or 86, wherein the mouse gene segments are in inverted
orientation. Thus, they are inverted with respect to the wild-type orientation in
a mouse genome. They are thus inverted relative to the orientation of the mouse constant
region.
88. The mouse of any one of aspects 70 to 87, wherein the mouse expresses light chains
comprising human variable regions (eg, kappa light chains comprising human kappa variable
regions). Thus, the human variable regions are derived from the recombination of human
VL and JL gene segments, eg, human Vκ and human Jκ.
89. The mouse of aspect 88, comprising human Vκ and Jκ gene segments upstream of a
mouse CL (eg, endogenous Cκ); optionally wherein the human Vκ and Jκ gene segments
comprise Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8,
Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1, Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
90. The mouse of any one of aspects 70 to 89, wherein the human VH, DH and JH gene
segments comprise human VH gene segments VH2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and JH gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16,
4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6.
For example, the human VH, DH and JH gene segments comprise human VH gene segments VH2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and JH gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 3-10, 4-11, 5-12, 6-13,
1-14, 2-15, 3-16, 4-17, 5-18, 6-19, 1-20, 2-21, 3-22, 4-23, 5-24, 6-25, 1-26 and 7-27;
and J1, J2, J3, J4, J5 and J6.
91. Use of the mouse of any one of aspects 70 to 90 for expressing immunoglobulin
heavy chains comprising human variable regions, wherein the heavy chains expressed
by the mouse are essentially exclusively said heavy chains comprising human variable
regions; and said heavy chains comprising human variable regions are expressed as
part of serum IgG1,IgG2b and IgM (and optionally IgG2a) antibodies in the mouse. The
use is non-therapeutic, non-diagnostic and non-surgical use.
In one aspect, the use comprises immunising the mouse with an antigen (eg, a human
antigen) and isolating an IgG1 antibody that specifically binds the antigen.
In one aspect, the use comprises immunising the mouse with an antigen (eg, a human
antigen) and isolating an IgG2a antibody that specifically binds the antigen.
In one aspect, the use comprises immunising the mouse with an antigen (eg, a human
antigen) and isolating an IgG2b antibody that specifically binds the antigen. Optionally,
the use comprises making a derivative of the isolated antibody. Examples of derivative
antibodies (according to any aspect herein) are antibodies that have one or more mutations
compared to the isolated antibody (eg, to improve antigen-binding affinity and/or
to enhance or inactivate Fc function) Such mutants specifically bind the antigen.
92. Use of the mouse of any one of aspects 70 to 90 for expressing immunoglobulin
heavy chains comprising human variable regions, wherein the heavy chains expressed
by the mouse are essentially exclusively said heavy chains comprising human variable
regions and are expressed in a mouse that produces a normal proportion or percentage
of mature splenic B-cells. The use is non-therapeutic, non-diagnostic and non-surgical
use.
In one aspect, the use further comprises isolating splenic tissue (eg, the spleen)
from the mouse; optionally followed by isolating at least one antigen-specific B-cell
from the tissue, wherein the B-cell(s) expresses an antibody that specifically binds
a predetermined antigen. In one example, the use comprises immunising the mouse with
the antigen prior to isolating the splenic tissue. In an example, the use comprises
isolating an antibody produced by the B-cell (or by a hybridoma produced by fusion
of the B-cell with a myeloma cell). Optionally, the use comprises making a derivative
of the isolated antibody. Examples of derivative antibodies (according to any aspect
herein) are antibodies that have one or more mutations compared to the isolated antibody
(eg, to improve antigen-binding affinity and/or to enhance or inactivate Fc function)
Such mutants specifically bind the antigen.
93. Use of the mouse of any one of aspects 70 to 90 for expressing immunoglobulin
heavy chains comprising human variable regions, wherein the heavy chains expressed
by the mouse are essentially exclusively said heavy chains comprising human variable
regions and are expressed in a mouse that produces a normal proportion or percentage
of bone marrow B-cell progenitor cells. The use is non-therapeutic, non-diagnostic
and non-surgical use.
94. Use of the mouse of any one of aspects 70 to 90 for the purpose stated in one
or more of aspects 70, 71, 73, 75 and 78.
The expression (eg,percentage expression or expression proportion or level) of Ig
can be determined at the level of antibody chain mRNA transcripts in B-cells (eg,
peripheral blood lymphocytes). Alternatively or additionally, the percentage expression
is determined at the level of antibody in serum or blood of the vertebrates. Additionally
or alternatively, the expression can be determined by FACS analysis of B cells.
In these aspects, "heavy chains comprising human variable regions" means variable
regions derived from the recombination of human VH, D and JH gene segments. "Essentially
exclusively" the expressed heavy chains comprise human variable regions, ie, there
is only a relatively very low or even no endogenous mouse heavy chain variable region
expression. For example, at least 90, 95, 96, 97, 98, 99 or 99.5% or 100% of the heavy
chains are heavy chains comprising human variable regions. In one aspect, at least
90% of the heavy chains are heavy chains comprising human variable regions. The percentage
expression can be determined at the level of heavy chain mRNA transcripts in B-cells
(eg, peripheral blood lymphocytes). Alternatively or additionally, the percentage
expression is determined at the level of heavy chains or antibodies in serum or blood
of the mice. Additionally or alternatively, the expression can be determined by FACS
analysis of B-cells.
The mouse can comprise any endogenous heavy chain locus in which human V, D and J
gene segments are present, as described herein. In one example, the mouse genome comprises
a mouse heavy chain locus in which at least human V
H gene segments V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and J
H gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16,
4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6 are
upstream of the mouse constant region. The vertebrate in these aspects is, for example
naïve (ie, not immunised with a predetermined antigen, as the term is understood in
the art; for example, such a vertebrate that has been kept in a relatively sterile
environment as provided by an animal house used for R&D). In another example, the
vertebrate has been immunised with a predetermined antigen, eg, an antigen bearing
a human epitope.
[0204] In one aspect, the heavy chains, together with light chains expressed in the mice
of the disclosure, form antibodies (Ig). The light chains can be expressed from any
transgenic light chain locus as herein described. For example the genome of the mouse
comprises a heavy chain locus in which is a chimaeric immunoglobulin heavy chain locus
comprising one or more human V gene segments, one or more human D gene segments and
one or more human J gene segments upstream of a mu constant region of said non-human
species; endogenous heavy chain expression has been substantially inactivated; and
the heavy chain locus comprises an Eµ enhancer of said non-human vertebrate species.
[0205] In one example
of any aspect, endogenous light chain (eg, kappa and/or lambda) expression is substantially
inactive or inactivated, for example using method as described herein. In this case,
less than 10, 5, 4, 3, 2, 1 or 0.5% of such endogenous lambda light chains are expressed
or expressible. Additionally or alternatively, less than 10, 5, 4, 3, 2, 1 or 0.5%
of such endogenous kappa light chains are expressed or expressible. In one example,
there is complete inactivation of endogenous kappa and/or lambda expression so no
such light chains are expressed or expressible.
[0206] In one aspect, the genome of the mouse comprises human kappa gene segments
- (i) Vκ1-5, Vκ1-6, Vκ1-8 and Vκ1-9 (and optionally Vκ5-2 and Vκ4-1); or
- (ii) Vκ1-5, Vκ1-6, Vκ1-8, Vκ1-9, Vκ3-11, Vκ1-12, Vκ3-15, Vκ1-16, Vκ1-17, Vκ3-20 (and
optionally Vκ 2-24 and/or Vκ1-13); or
- (iii) Vκ1-5, Vκ1-6, Vκ1-8, Vκ1-9, Vκ3-11, Vκ1-12, Vκ3-15, Vκ1-16, Vκ1-17, Vκ3-20,
Vκ 2-24, , Vκ1-27, Vκ2-28, Vκ2-30 and Vκ1-33 (and optionally Vκ 2-29 and/or Vκ2-40
and/or Vκ1-39);
and optionally
- (iv) Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
[0207] In one aspect, the genome also comprises (i) at least human V
H gene segments V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and J
H gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16,
4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6 and
(ii) at least human gene segments Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13,
Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1, Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
As demonstrated in Example 16, such mice are fully functional in the aspect of rearrangement,
BCR signalling and B cell maturation. Greater than 90% of the antibodies expressed
by the mice comprised human heavy chain variable regions and human kappa light chain
variable regions. These mice are, therefore, very useful for the selection of antibodies
having human variable regions that specifically bind human antigen following immunisation
of the mice with such antigen. Following isolation of such an antibody, the skilled
person can replace the mouse constant regions with human constant regions using conventional
techniques to arrive at totally human antibodies which are useful as drug candidates
for administration to humans (optionally following mutation or adaptation to produce
a further derivative, eg, with Fc enhancement or inactivation or following conjugation
to a toxic payload or reporter or label or other active moiety).
[0208] In one aspect, the genome also comprises a human iEκ and/or human 3'Eκ downstream
of the human J gene segments in the locus.
[0209] The disclosure also includes the following clauses:
Clause 1. A mouse that expresses immunoglobulin heavy chains containing human variable
regions,
wherein the mouse comprises a genome that includes an immunoglobulin heavy chain locus
comprising human VH, DH, and JH gene segments positioned upstream to a mouse constant
region;
wherein the mouse expresses immunoglobulin heavy chains, characterized in that at
least 90% of the immunoglobulin heavy chains expressed by the mouse comprise a human
variable region; and
wherein the mouse expresses serum IgG1, IgG2b, and IgM antibodies comprising said
heavy chains containing a human variable region.
Clause 2. A mouse that expresses immunoglobulin heavy chains containing human variable
regions,
wherein the mouse comprises a genome that includes an immunoglobulin heavy chain locus
comprising human VH, DH, and JH gene segments which are positioned upstream to a mouse
constant region;
wherein the mouse expresses immunoglobulin heavy chains, characterized in that at
least 90% of the immunoglobulin heavy chains expressed by the mouse comprise a human
variable region; and
wherein the mouse produces a normal proportion of mature splenic B-cells;
wherein said normal proportion is a proportion of mature splenic B-cellsproduced by
a mouse that expresses immunoglobulin heavy chains containing mouse variable regions
and does not express immunoglobulin heavy chains containing human variable regions.
Clause 3. A mouse that expresses immunoglobulin heavy chains containing human variable
regions,
wherein the mouse comprises a genome that includes an immunoglobulin heavy chain locus
comprising human VH, DH, and JH gene segments which are positioned upstream to a mouse
constant region;
wherein the mouse expresses immunoglobulin heavy chains, characterized in that it
at least 90% of the immunoglobulin heavy chains expressed by the mouse comprise a
human variable region; and
wherein the mouse produces a normal proportion of bone marrow B-cell progenitor cells;
wherein the normal proportion is a proportion of bone marrow B-cell progenitor cells
produced by a mouse that expresses immunoglobulin heavy chains containing mouse variable
regions and does not expresses immunoglobulin heavy chains containing human variable
regions.
Clause 4. The mouse of any of the preceding clauses, wherein the mouse expresses a
normal proportion of IgG1, IgG2b, and IgM in a sample of serum obtained from the mouse;
wherein the normal proportion is as produced by a mouse that expresses immunoglobulin
heavy chains containing mouse variable regions and does not expresses immunoglobulin
heavy chains containing human variable regions.
Clause 5. The mouse of any of the preceding clauses, wherein the mouse constant region
is C-mu , C-delta, and/or C-gamma.
Clause 6. The mouse of clause 5, wherein the mouse constant region is at least C-mu,C-delta
and C-gamma.
Clause 7. The mouse of any of the preceding clauses, wherein the mouse constant region
is an endogenous mouse C-region.
Clause 8. The mouse of any of the preceding clauses, wherein the mouse expresses a
human C-gamma region.
Clause 9. The mouse of any of the preceding clauses, wherein the mouse is a naïve
mouse.
Clause 10. The mouse of clause 1, wherein the mouse expresses serum IgG2a comprising
said heavy chains containing a human variable region.
Clause 11. The mouse of any of the preceding clauses, wherein the mouse expresses
Ig subtypes in a relative proportion of
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
Or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by immunoglobulin capture on a plate followed by incubation with an
anti-mouse isotype-specific antibodies each comprising a label and quantification
of each immunoglobulin based on the level of each label.
Clause 12. The mouse of any of the preceding clauses, wherein the mouse expresses
Ig subtypes in a relative proportion of
- (i) total serum IgG and IgM at a concentration of about 200-2500 µg/ml; and
- (ii) serum IgM at a concentration of about 100-800 µg/ml;
as determined by immunoglobulin capture on a plate followed by incubation with an
anti-mouse isotype-specific antibodies each comprising a label and quantification
of each immunoglobulin based on the level of each label.
Clause 13. The mouse of any of the preceding clauses, wherein the mouse expresses
said immunoglobulin heavy chains from splenic B-cells and wherein the mouse produces
a normal proportion of mature splenic B-cells in total spleen cells comprising mature
B-cells, and splenic T1 and T2 cells.
Clause 14. The mouse of any one of clauses 1-3, wherein, at least 95, 96, 97, 98,
99, or 99.5% of the immunoglobulin heavy chains expressed by the mouse are immunoglobulin
heavy chains comprising human variable regions.
Clause 15. The mouse of any of the preceding clauses, wherein a mouse immunoglobulin
heavy chain enhancer is positioned in said mouse heavy chain immunoglobulin locus
between the human VH, DH, and JH gene segments and the mouse constant region.
Clause 16. The mouse of any of the preceding clauses, wherein a mouse S-mu switch
is positioned in said mouse heavy chain immunoglobulin locus between the human VH,
DH, and JH gene segments and the mouse constant region.
Clause 17. The mouse of any of the preceding clauses, wherein endogenous mouse immunoglobulin
heavy chain V, D and J gene segments are positioned in said mouse heavy chain immunoglobulin
locus upstream to the human VH, DH, and JH gene segments.
Clause 18. The mouse of clause 17, wherein the mouse immunoglobulin heavy chain V,
D and J gene segments are present in said mouse heavy chain immunoglobulin locus with
endogenous inter-gene segment sequences.
Clause 19. The mouse of clause 17 or 18, wherein the mouse immunoglobulin heavy chain
V, D and J gene segments are positioned in said mouse heavy chain immunoglobulin locus
in an orientation that is inverted relative to its natural endogenous orientation.
Clause 20. The mouse of any of the preceding clauses, wherein the mouse expresses
light chains containing human kappa variable regions.
Clause 21. The mouse of clause 20, wherein the mouse expresses immunoglobulin light
chains derived from recombination of Vκ with human Jκ.
Clause 22. The mouse of any of the preceding clauses, wherein the mouse expresses
light chains containing human lambda variable regions.
Clause 23. The mouse of clause 22, wherein the mouse expresses immunoglobulin light
chains derived from recombination of Vλ with human Jλ.
Clause 24. The mouse of clause 21, comprising a genome that includes human Vκ and
Jκ gene segments positioned in said mouse heavy chain immunoglobulin locus upstream
to a mouse CL.
Clause 25. The mouse of clause 24, wherein the mouse CL is an endogenous Cκ.
Clause 26. The mouse of clauses 24 or 25, wherein the human Vκ and Jκ gene segments
comprise Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8,
Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1, Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
Clause 27. The mouse of any the preceding clauses, wherein the human VH, DH and JH
gene segments contain
human VH gene segments: VH2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1;
human DH gene segments: D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13,
2-15, 3-16, 4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and
human JH gene segments: J1, J2, J3, J4, J5 and J6.
Clause 28. A method for obtaining one or more immunoglobulin heavy chains containing
human variable regions, comprising providing the mouse of any of the preceding clauses
and
isolating one or more immunoglobulin heavy chains.
Clause 29. The method of clause 28, wherein each immunoglobulin heavy chain is included
in an antibody.
Clause 30. The method of clause 29, wherein said heavy chain and/or said antibody
containing said heavy chain is modified after said isolating.
Clause 31. The method of clause 28, wherein a step of immunizing the mouse with an
antigen is performed before the step of isolating the immunoglobulin heavy chains.
Clause 31a. The method of clause 30, wherein the antigen is a human antigen.
Clause 32. The method of clause 30, 31, or 31a, wherein the immunoglobulin heavy chains
are included in an IgG1 antibody, antibody fragment, or antibody derivative that specifically
binds the antigen.
Clause 33. The method of clause 30, 31, or 31a, wherein the immunoglobulin heavy chains
are included in an IgG2a antibody, antibody fragment, or antibody derivative that
specifically binds the antigen.
Clause 34. The method of clause 30, 31, or 31a , wherein the immunoglobulin heavy
chains are included in an IgG2b antibody, antibody fragment, or antibody derivative
that specifically binds the antigen.
Clause 35. The method of clause 30, 31, or 31a , wherein the immunoglobulin heavy
chains are included in an IgM antibody, antibody fragment, or antibody derivative
that specifically binds the antigen.
Clause 36. An antibody or immunoglobulin heavy chain isolated in the method of any
one of clauses 28 to 35, or a antigen-binding fragment or derivative of the antibody
or heavy chain.
Clause 37. A pharmaceutical composition comprising the antibody, antibody fragment,
or antibody derivative of clause 36 and a pharmaceutically acceptable carrier, excipient,
or diluent.
Clause 38. A method for isolating splenic tissue comprising providing the mouse of
1 to 27,
collecting a spleen or portion thereof from the mouse, and
obtaining tissue from the spleen or portion.
Clause 39. The method of clause 38, further comprising isolating at least one antigen-specific
B-cell from the splenic tissue, wherein the B-cell expresses a heavy chain containing
a human variable region.
Clause 40. The method of clause 38 or 39, wherein a step of immunizing the mouse with
an antigen is performed before the step of collecting a spleen from the mouse.
Clause 41. The method of clause 40, wherein the antigen is a human antigen.
Clause 42. The method of clause 40 or 41 wherein the at least one antigen-specific
B-cell produces an IgG1, IgG2a, IgG2b or IgM antibody comprising said heavy chain,
wherein the antibody specifically binds the antigen.
Clause 43. The method of clauses 38 to 42, wherein the at least one antigen-specific
B-cell that produces said heavy chain is fused with an immortal myeloma cell to produce
a hybridoma cell.
Clause 44. The method of clauses 38 to 43, further comprising a step of isolating
an immunoglobulin heavy chain from the B-cell or the hybridoma cell.
Clause 45. An antibody or immunoglobulin heavy chain isolated in the method of clause
44, or a antigen-binding fragment or derivative of the antibody or heavy chain.
Clause 46. A pharmaceutical composition comprising the antibody, antibody fragment,
or antibody derivative of clause 45 and a pharmaceutically acceptable carrier, excipient,
or diluent.
Clause 47. A method for obtaining a humanised antibody, comprising
selecting a mouse that expresses immunoglobulin heavy chains containing human variable
regions,
wherein the mouse comprises a genome that includes an immunoglobulin heavy chain locus
comprising human VH, DH, and JH gene segments positioned upstream to a mouse constant
region,
wherein the mouse expresses immunoglobulin heavy chains, characterized in that at
least 90% of the immunoglobulin heavy chains expressed by the mouse are immunoglobulin
heavy chains containing a human variable region,
wherein the mouse expresses serum IgG1, IgG2b, and IgM antibodies comprising said
heavy chains containing a human variable region,
wherein the mouse produces a normal proportion of mature splenic B-cells,
wherein the mouse produces a normal proportion of bone marrow B-cell progenitor cells,
and
wherein the mouse expresses a normal proportion of IgG1, IgG2a, IgG2b, and IgM in
a sample of serum obtained from the mouse, and
wherein each said normal proportion is a proportion produced by a mouse that expresses
immunoglobulin heavy chains containing mouse variable regions and does not expresses
immunoglobulin heavy chains containing human variable regions;
collecting serum from said mouse; and
obtaining a pool of humanised antibodies comprising IgG1, IgG2b, and IgM antibodies
from the serum.
Clause 48. The method of clause 47, comprising a step of immunizing the mouse with
an antigen before the step of collecting serum from said mouse.
Clause 49. The method of clause 48, further comprising steps of
contacting said pool of humanised antibodies with said antigen;
binding said antigen with a humanised antibody in said pool of humanised antibodies;
and
isolating the humanised antibody that binds to said antigen.
Clause 50. The method of clause 49, further comprising steps of
contacting the humanised antibody that binds to said antigen with an isotype-specific
antibody, wherein the isotype-specific antibody recognizes IgG1, IgG2a, IgG2b, or
IgM; and
isolating the humanised antibody that binds to said isotype-specific antibody.
Clause 51. The method of clause 48, further comprising the steps of
collecting the spleen or tissue thereof from said mouse,
isolating B-cells from splenic tissue,
fusing said B-cells with immortal myeloma cells to produce hybridoma cells expressing
a pool of humanised antibodies comprising IgG antibodies from the serum, wherein the
pool of antibodies is used in the method of clause 48.
Clause 52. The method of any of clauses 47-51, wherein said selected mouse comprises
mouse immunoglobulin heavy chain V, D and J gene segments which are positioned in
said mouse heavy chain immunoglobulin locus in an orientation that is inverted relative
to its natural endogenous orientation.
Clause 53. The method of any of clauses 47-52 wherein the mouse expresses Ig subtypes
in a relative proportion of
- (i) serum IgG1 at a concentration of about 25-350 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-200 µg/ml;
- (iii) serum IgG2b at a concentration of about 30-800 µg/ml; and
- (iv) serum IgM at a concentration of about 50-300 µg/ml;
Or
- (i) serum IgG1 at a concentration of about 10-600 µg/ml;
- (ii) serum IgG2a at a concentration of about 0-500 µg/ml;
- (iii) serum IgG2b at a concentration of about 20-700 µg/ml; and
- (iv) serum IgM at a concentration of about 50-700 µg/ml;
as determined by immunoglobulin capture on a plate followed by incubation with an
anti-mouse isotype-specific antibodies each comprising a label and quantification
of each immunoglobulin based on the level of each label.
Clause 54. The method of any one of clauses 47 to 53, wherein, at least 95, 96, 97,
98, 99, or 99.5% of the immunoglobulin heavy chains expressed by the mouse are immunoglobulin
heavy chains comprising human variable regions.
Clause 55. The method of any clauses 47-54, wherein a mouse immunoglobulin heavy chain
enhancer is positioned in said mouse heavy chain immunoglobulin locus between the
human VH, DH, and JH gene segments and the mouse constant region.
Clause 56. The method of any of clauses 47-55, wherein a mouse S-mu switch is positioned
in said mouse heavy chain immunoglobulin locus between the human VH, DH, and JH gene
segments and the mouse constant region.
Clause 57. The method of any of clauses 47-56, wherein endogenous mouse immunoglobulin
heavy chain V, D and J gene segments are positioned in said mouse heavy chain immunoglobulin
locus upstream to the human VH, DH, and JH gene segments.
Clause 58. The method of clause 57, wherein the mouse immunoglobulin heavy chain V,
D and J gene segments are present in said mouse heavy chain immunoglobulin locus with
endogenous inter-gene segment sequences.
Clause 59. The method of clause 57 or 58, wherein the mouse immunoglobulin heavy chain
V, D and J gene segments are positioned in said mouse heavy chain immunoglobulin locus
in an orientation that is inverted relative to its natural endogenous orientation.
Clause 60. The method of any of clauses 47-59, wherein the mouse expresses light chains
containing human kappa variable regions.
Clause 61. The method of clause 60, wherein the mouse expresses immunoglobulin light
chains containing human Jκ.
Clause 62. The method of any of clauses 47-51, wherein the mouse expresses light chains
containing human lambda variable regions.
Clause 63. The method of clause 62, wherein the mouse expresses immunoglobulin light
chains containing human Jλ.
Clause 64. The method of clause 61, comprising a genome that includes human Vκ and
Jκ gene segments positioned in said mouse heavy chain immunoglobulin locus upstream
to a mouse CL.
Clause 65. The mouse of clause 64, wherein the mouse CL is an endogenous Cκ.
Clause 66. The mouse of clauses 64 or 65, wherein the human Vκ and Jκ gene segments
comprise Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8,
Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1, Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
Clause 67. The method of any of clauses 47-51, wherein the human VH, DH and JH gene
segments contain
human VH gene segments: VH2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1;
human DH gene segments: D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13,
2-15, 3-16, 4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and
human JH gene segments: J1, J2, J3, J4, J5 and J6.
[0210] The disclosure also includes the following Attributes:
Attribute 1. An isolated non-human vertebrate, optionally a mammal, cell whose genome
comprises an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence, and a C region, wherein
the C region is not a rat C region.
Attribute 1a. An isolated non-human vertebrate, optionally a mammal, cell whose genome
comprises an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence,
wherein the locus comprises a human-rat and/or a mouse-rat sequence junction, and
wherein the rat sequence is provided by the rat switch sequence.
Attribute 2. An isolated non-human vertebrate, optionally a mammal, cell whose genome
comprises an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence, and a C region, wherein
the rat switch sequence is a rat S-mu sequence that comprises at least 3 contiguous
repeats of the repeat sequence GGGCT (SEQ ID No. 46 - 50).
Attribute 3. An isolated non-human vertebrate, optionally a mammal, cell whose genome
comprises an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence and a C region, wherein
the rat switch is a rat S-mu sequence that comprises GAGCT (296 repeats), GGGGT (50
repeats), and/or GGGCT (83 repeats).
Attribute 4. A non-human vertebrate organism, optionally a mammal, whose genome comprises
an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence, and a C region, wherein
the C region is not a rat C region.
Attribute 4a. An non-human vertebrate organism, optionally a mammal, whose genome
comprises an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence,
wherein the locus comprises a human-rat and/or a mouse-rat sequence junction, and
wherein the rat sequence is provided by the rat switch sequence.
Attribute 5. A non-human vertebrate organism, optionally a mammal, whose genome comprises
an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence and a C region, wherein
the rat switch sequence is a rat S-mu sequence that comprises at least 3 contiguous
repeats of the repeat sequence GGGCT (SEQ ID NO. 46 - 50).
Attribute 6. A non-human vertebrate organism, optionally a mammal, whose genome comprises
an Ig H chain locus, the locus comprising, in 5' to 3' transcriptional orientation,
a V region, a J region, a D region, a rat switch sequence and a C region, wherein
the rat switch sequence is a rat S-mu sequence that comprises GAGCT (296 repeats),
GGGGT (50 repeats), and/or GGGCT (83 repeats).
Attribute 7. An isolated non-human vertebrate cell or organism, optionally a mammal,
whose genome comprises an Ig H chain locus comprising DNA sequences from three or
more vertebrate species, the Ig H chain locus comprising in 5' to 3' transcriptional
orientation at least a V region, a D region, a J region, an enhancer, a rat switch
sequence, and a C region.
Attribute 8. The non-human vertebrate cell or organism of any of attributes 1 to 7,
wherein the genome of the cell or organism further comprises an Ig L chain locus comprising
DNA sequences from three or more vertebrate species and wherein the Ig L chain locus
comprises in 5' to 3' transcriptional orientation at least a human V region, a human
J region, and a C region.
Attribute 9. The non-human vertebrate cell or organism of attribute 7 or 8, wherein
said three or more vertebrate species are mouse, human and rat.
Attribute 10. The non-human vertebrate cell or organism of any of attributes 1 to
9, wherein said C region is endogenous to the cell or organism, and said V, D and/or
J regions are human.
Attribute 11. The non-human vertebrate cell or organism of any of attributes 1-10,
wherein the Ig H chain locus comprises a plurality of V regions, one or more D regions,
and one or more J regions and/or wherein the Ig L chain locus comprises a plurality
of V regions and one or more J regions.
Attribute 12. The non-human vertebrate cell or organism of any of attributes 1-11,
wherein said V region is or said plurality of V regions are human.
Attribute 13. The non-human vertebrate cell or organism of any of attributes 1-11,
wherein said D region is or said one or more D regions are human.
Attribute 14. The non-human vertebrate cell or organism of any of attributes 1-11,
wherein said J region is or said one or more J regions are human.
Attribute 15. The non-human vertebrate cell or organism of any of attributes 11-14,
wherein said V region is or said plurality of V regions are human, said D region is
or said one or more D regions are human, and said J region is or said one or more
J regions are human.
Attribute 16. The non-human vertebrate cell or organism of any of attributes 1, 1a,
4a, 4, 7-11 and 15, wherein said rat switch sequence is rat S-mu.
Attribute 17. The non-human vertebrate cell or organism of any of attributes 1, 4,
7-11, and 15 further comprising a mouse enhancer sequence positioned upstream of and
operatively associated with said rat switch sequence.
Attribute 18. The non-human vertebrate cell or organism of attribute 16, further comprising
a mouse enhancer sequence positioned upstream of and operatively associated with said
rat S-mu sequence.
Attribute 19. The non-human vertebrate cell or organism of any of attributes 1-4,
7-15, wherein the C region is one of a mouse C region or a human C region.
Attribute 20. The non-human vertebrate cell or organism of attribute 19, wherein the
C region is CH1.
Attribute 21. The non-human vertebrate cell or organism of attribute 19, wherein the
mouse C region is one or more of a C-mu or a C-gamma.
Attribute 22. The non-human vertebrate cell or organism of attribute 21, wherein the
mouse C region is a C-mu and a C-gamma.
Attribute 23. The non-human vertebrate cell or organism of attribute 7, wherein the
cell is a mouse cell or the vertebrate is a mouse and wherein the mouse C region is
the endogenous mouse C region.
Attribute 24. The non-human vertebrate cell or organism of any of attributes 1, 1a,
4, 4a, and 7, wherein the rat S-mu sequence comprises at least 3 and up to 83 contiguous
repeats of the repeat sequence GGGCT (SEQ ID NO. 46 - 50).
Attribute 25. The non-human vertebrate cell or organism of any of attributes 1, 1a,
2, 4, 4a, 5 and 7, comprising a rat S-mu sequence which comprises 296 repeats of the
motif GAGCT.
Attribute 26. The non-human vertebrate cell or organism of any of attributes 1, 1a,
2, 4, 4a, 5 and 7, comprising a rat S-mu sequence which comprises 50 repeats of the
motif GGGGT.
Attribute 27. The non-human vertebrate cell or organism of any of attributes 1, 1a,
2, 4, 4a, 5 and 7, comprising a rat S-mu sequence which comprises 83 repeats of the
motif GGGCT.
Attribute 28. The non-human vertebrate cell or organism of any preceding attributes
wherein the rat S-mu sequence comprises SEQ ID NO 1.
Attribute 29. The non-human vertebrate cell of any preceding attribute, wherein the
cell is an ES cell, hematopoietic stem cell or hybridoma.
Attribute 30. The non-human vertebrate cell or organism of any preceding attribute,
wherein the cell or organism is a mouse ES cell or a mouse, respectively.
Attribute 31. The non-human vertebrate cell or organism of any of attributes 1-10,
wherein said Ig H chain locus comprises a human JH, a human DH, and human VH2-5 operatively
associated with a rat S-mu sequence
Attribute 32. The non-human vertebrate cell or organism of any of attributes 1-10,
wherein said Ig H chain locus comprises human JH1-5, a human DH, and a human operatively
associated with a rat S-mu sequence.
Attribute 33. The non-human vertebrate cell or organism of any of attributes 1-10,
wherein said cell is a mouse cell or said organism is a mouse;
wherein said Ig H chain locus comprises a mouse enhancer positioned upstream of and
operatively associated with a rat switch sequence which is rat S-mu and
wherein said C region is a mouse constant region.
Attribute 34. The non-human vertebrate cell or organism of attribute 33, wherein said
Ig H chain V, D and J regions are human and/or said Ig L chain V and J regions are
human.
Attribute 35. The non-human vertebrate cell or organism of attributes 1-10, wherein
said Ig H chain locus comprises a rearranged VDJ region.
Attribute 36. The non-human vertebrate cell or organism of attribute 35, wherein said
rearranged VDJ region is human.
Attribute 37. The non-human vertebrate cell or organism of any of attributes 1-10,
wherein the cell or organism comprises a genome comprises human DNA comprising a plurality
of human IgH V regions, one or more human D regions and one or more human J regions
upstream of the host non-human mammal constant region and wherein the human IgH VDJ
region comprises nucleotides 105,400,051 to 106,368,585 from human chromosome 14 (co-ordinates
refer to NCBI36 for the human genome, ENSEMBL Release 54), or an equivalent human
region from another human.
Attribute 38. The non-human vertebrate cell or organism of attribute 37, wherein human
DNA is positioned between a non-human mammalian constant region and a non-human mammal
J region positioned 3' distal to any other non-human J region.
Attribute 39. The non-human vertebrate cell or organism according to attribute 37,
when the cell is a mouse cell or the organism is a mouse said V, D and J regions are
human and positioned between coordinates 114,667,091 and 114,665,190 of mouse chromosome
12 (coordinates refer to NCBI m37, for the mouse C57BL/6J strain), or at an equivalent
position in another non-human mammal genome.
Attribute 40. The non-human vertebrate cell or organism of attribute 39, when the
cell is a mouse cell or the organism is a mouse said V, D and J regions are human
and positioned between coordinates 114,667,089 and 114,667,090 (co-ordinates refer
to NCBI m37, for the mouse C57BL/6J strain), or at an equivalent position in another
non-human mammal genome.
Attribute 41. The non-human vertebrate cell or organism of attribute 37, wherein the
cell is a mouse cell or the organism is a mouse, and wherein said V, D and J regions
are human and positioned between coordinates 114,666,183 and 114,666,725, such as
between coordinates 114,666,283 and 114,666,625, optionally between coordinates 114,666,335
and 114,666,536, optionally between coordinates 114,666,385 and 114,666,486, optionally
between coordinates 114,666,425 and 114,666,446, such as between coordinates 114,666,435
and 114,666,436 of mouse chromosome 12, with reference to NCBI m37 for the mouse genome
relating to mouse strain C57BL/6J or an equivalent position of mouse chromosome 12
from a different mouse strain or an equivalent position in the genome of another non-human
vertebrate.
Attribute 42. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein the cell is a mouse cell or the organism is a mouse and wherein said
Ig H chain V, D and J regions or said Ig L chain V and J regions are human.
Attribute 43. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein said V, D and J regions are human and comprise or consist of nucleotides
106,328,851-107,268,544, such as nucleotides 106,328,901-107,268,494, such as nucleotides
106,328,941-107,268,454, such as nucleotides 106,328,951-107,268,444 of human Chromosome
14, with reference to the GRCH37/hg19 sequence database, or equivalent nucleotides
relating to chromosome 14 from a different human sequence or database.
Attribute 44. The non-human vertebrate cell or organism according to any of attributes
1 - 10, comprising a human kappa VJ region DNA comprising, in germline configuration,
all of the V and J regions and intervening sequences from a human.
Attribute 45. The non-human vertebrate cell or organism according to attribute 44,
wherein the human kappa VJ region DNA is positioned between coordinates 70,673,918
- 70,675,517, such as between coordinates 70,674,418 - 70675,017, such as between
coordinates 70,674, 655 70,674,856, such as between coordinates 70,674, 705 - 70,674,906,
such as between coordinates 70,674, 745 - 70,674,766, such as between coordinates
70,674,755 and 70,674,756 of mouse chromosome 6 (with reference to NCBI m37 for the
mouse genome, relating to mouse strain C57BL/6J), or at an equivalent position in
another genome.
Attribute 46. The non-human vertebrate cell or organism according to attribute 45,
wherein the human kappa VJ region DNA comprises or consists of a fragment from human
chromosome 2, numbered with reference to the GRCH37/hg19 sequence database, or equivalent
nucleotides relating to chromosome 2 from a different human sequence or database,
the fragment selected from 1 or more of: (i) nucleotides 89,158,979 - 89,630,537,
such as 89,159,029-89,630,487, such as 89,159,069-89,630,447, such as 89,159,079 -
89,630,437, optionally in addition to fragment (ii); (ii) nucleotides 89,941,614 -
90,267,076, such as 89,941,664 - 90,267,026, such as 89, 941,704-90,266,986, such
as 89,941,714 - 90,266,976; optionally in addition to fragment (i); and (iii) nucleotides
89,158,979 - 90,267, 076, such as nucleotides 89,159,079 - 90,266,976.
Attribute 47. The non-human vertebrate cell or organism according to any of attributes
1 - 10, comprising human lambda region DNA which comprises at least one human Jλ region
and at least one human Cλ region, optionally Cλ6 and/or Cλ7.
Attribute 48. The non-human vertebrate cell or organism according to attribute 47,
comprising a plurality of human Jλ regions, optionally two or more of Jλ1, Jλ2, Jλ6
and Jλ7, optionally all of Jλ1, Jλ2, Jλ6 and Jλ7.
Attribute 49. The non-human vertebrate cell or organism according to attribute 47,
comprising at least one human Jλ-Cλ cluster, optionally at least Jλ7-Cλ7.
Attribute 50. The non-human vertebrate cell or organism according to any of attributes
1 - 10, comprising a human Eλ enhancer.
Attribute 51. The non-human vertebrate cell or organism according to any of attributes
1 - 10, comprising human lambda VJ region DNA which comprises, in germline configuration,
all of the V and J regions and intervening sequences from a human.
Attribute 52. The non-human vertebrate cell or organism according to attribute 51,
wherein the human lambda VJ region DNA comprises or consists of nucleotides 22,375,509
- 23,327,984, such as nucleotides 22,375,559-23,327,934, such as nucleotides 22,375,599
- 23,327,894, such as nucleotides 22,375,609 - 23,327,884 from human chromosome 22,
with reference to the GRCH37/hg19 sequence database, or equivalent nucleotides relating
to human chromosome 22 from a different human sequence or database.
Attribute 53. The non-human vertebrate cell or organism according to any of attributes
1-10, wherein non-mouse DNA is positioned in the mouse genome between co-ordinates
19,027,763 and 19,061,845, such as between co-ordinates 19,037,763 and 19,051,845,
such as between co-ordinates 19,047,451 and 19,047,652, such as between co-ordinates
19,047,491 and 19,047,602, such as between co-ordinates 19,047,541 and 19,047,562,
such as between co-ordinates 19,047,551 and 19,047,552 of mouse chromosome 16, with
reference to NCBI m37 for the mouse genome, or at an equivalent position in other
genome.
Attribute 54. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein non-human DNA is positioned in the mouse genome between co-ordinates
70,673,918 and 70,675,517 such as between co-ordinates 70,674,418 and 70,675,017,
such as between co-ordinates 70,674,655 and 70,674,856, such as between co-ordinates
70,674,705 and 70,674,806, such as between co-ordinates 70,674,745 and 70,674,766,
such as between co-ordinates 70,674,755 and 70,674,756 of mouse chromosome 6, with
reference to NCBI m37 for the mouse genome, relating to mouse strain C57BL/6J) or
at an equivalent position in another genome.
Attribute 55. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein said V, D and J regions are human and human light chain kappa VJC
DNA, or part thereof, is inserted immediately upstream of the mouse kappa VJC region.
Attribute 56. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein the genome of the cell or organism is modified to prevent or reduce
expression of fully host-species specific antibodies.
Attribute 57. The non-human vertebrate cell or organism according to attribute 56,
wherein the genome of the cell or organism is modified by inversion of all or part
of the non-human mammal VDJ region, or VJ region.
Attribute 58. The non-human vertebrate cell or organism according to attribute 56,
wherein the genome of the cell or organism comprises human DNA and non-human DNA,
and said non-human DNA comprises endogenous V and J regions or V, D, and J regions
which have not been deleted.
Attribute 59. The non-human vertebrate organism according to any of attributes 1-10
generated in a genetic background which prevents the production of mature host B and
T lymphocytes.
Attribute 60. The non-human vertebrate organism according to attribute 59 generated
in a Rag-1 or Rag-2 deficient background.
Attribute 61. The non-human vertebrate cell according to attribute 29 which is an
ES cell or hematopoietic stem cell capable of developing into a non-human mammal able
to produce a repertoire of antibodies or antibody chains which are chimaeric, said
chimaeric antibodies or chains having a non-human mammal constant region and a human
variable region.
Attribute 62. The non-human vertebrate cell according to attribute 29 which is an
ES cell or hematopoietic stem cell capable of contributing to tissues and organs of
a non-human mammal which is able to produce a repertoire of antibodies or antibody
chains which are chimaeric, said chimaeric antibodies or chains having a non-human
mammal constant region and a human variable region.
Attribute 63. The non-human vertebrate cell or organism according to any of attributes
1 - 10, comprising human variable region DNA from at least a human heavy and human
light chain.
Attribute 64. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein the cell or organism is homozygous at one, two or all three immunoglobulin
loci for DNA encoding a chimaeric antibody chain.
Attribute 65. The non-human vertebrate cell or organism according to any of attributes
1 - 10, wherein the cell or organism is heterozygous at one, two or all three immunoglobulin
loci for DNA encoding a chimaeric heavy or light chain.
Attribute 66. The non-human vertebrate cell or organism according to attributes 1-10,
wherein the genome of the cell or organism does not comprise constant region DNA from
another cell or organism.
Attribute 67. The non-human vertebrate cell according to attribute 29 which is immortalised.
Attribute 68. The non-human vertebrate cell according to attribute 67 which is an
ES cell line AB2.1, or a cell from a mouse strain selected from C57BL/6, M129, 129/SV,
BALB/c, and any hybrid of C57BL/6, M129, 129/SV or BALB/c.
Attribute 69. A method for obtaining immunoglobulin heavy chain comprising human immunoglobulin
variable region,
comprising providing the mouse of any of attributes attribute 1a, 4, 4a, 5 - 28, 30-60,
and 63-66 and
isolating polypeptide comprising immunoglobulin heavy chain comprising said human
variable region.
Attribute 69a. The method of attribute 69, wherein said immunoglobulin heavy chain
is a heavy chain of two chain or four chain antibody.
Attribute 69b. An antibody isolated according to the method of attribute 69.
Attribute 69c. A pharmaceutical composition comprising the antibody of attribute 69b
and a pharmaceutically acceptable carrier, excipient, or diluent.
Attribute 69d. The method of attribute 69 or 69a, wherein a step of immunizing the
mouse with an antigen is performed before the step of isolating the immunoglobulin
heavy chains.
Attribute 69e. The method of attribute 69d, wherein the antigen is a human antigen.
Attribute 69f. The method of attribute 69 or 69a, wherein said immunoglobulin heavy
chain is one of isotype IgG1, IgG2, IgG3, and IgM said human variable region specifically
binds said antigen.
Attribute 69g. The method of attribute 69f, wherein said immunoglobulin heavy chain
is a heavy chain of a two chain or four chain antibody and said antibody specifically
binds said antigen.
Attribute 70. A polynucleotide landing pad sequence, the polynucleotide comprising
nucleic acid regions homologous to regions of a target chromosome to allow for insertion
by homologous recombination into the target chromosome, and comprising a nucleic acid
site which permits recombinase-driven insertion of a nucleic acid into the landing
pad, wherein the polynucleotide sequence comprises one or more of: (i) a rat switch
sequence, optionally a rat S-mu switch, which is optionally the sequence of SEQ ID
NO 1; (ii) in a 5' to 3' direction, a mouse Eµ sequence, a rat switch sequence, and
mouse Cµ; and/or (iii) a 3' homology arm having the sequence of SEQ ID NO 6.
Attribute 71. The non-human vertebrate organism, optionally a mammal, comprising a
landing pad sequence according to attribute 70 which has been inserted into the genome
of the cell.
Attribute 72. The non-human vertebrate cell or organism, optionally a mammal, or landing
pad according to attribute 70 or 71, wherein the rat switch sequence comprises 3,
4, 5, 6 or more contiguous repeats of the sequence GGGCT, optionally being SEQ ID
NO 1.
Attribute 73. The non-human vertebrate cell or organism, optionally a mammal, or landing
pad according to any of attributes 70 to 72, wherein the landing pad sequence comprises
the sequence of SEQ ID NO 2.
Attribute 74. The non-human vertebrate cell or organism, optionally a mammal, or landing
pad according to any of attributes 70 to 73, wherein the landing pad sequence comprises
the sequence of SEQ ID NO 3.
Attribute 75. A method for producing an isolated non-human vertebrate, optionally
a mammal, cell comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a cell whose genome includes an Ig H chain locus having a V region,
a J region, a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional
orientation, wherein the C region is not a rat C region.
Attribute 76. A method for producing an isolated non-human vertebrate, optionally
a mammal, cell comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a cell whose genome includes an Ig H chain locus having a V region,
a J region, a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional
orientation, wherein the rat switch sequence is a rat S-mu sequence that comprises
at least 3 contiguous repeats of the repeat sequence GGGCT (SEQ ID NO. 46 - 50).
Attribute 77. A method for producing a non-human vertebrate, optionally a mammal,
cell comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a cell whose genome includes an Ig H chain locus having a V region,
a J region, a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional
orientation, wherein the rat switch is a rat S-mu sequence that comprises GAGCT (296
repeats), GGGGT (50 repeats), and/or GGGCT (83 repeats).
Attribute 78. A method for producing a non-human vertebrate organism, optionally a
mammal, comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a genome including an Ig H chain locus having a V region, a J region,
a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional orientation,
wherein the C region is not a rat C region.
Attribute 79. A method for producing a non-human vertebrate organism, optionally a
mammal, comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a genome including an Ig H chain locus having a V region, a J region,
a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional orientation,
wherein the rat switch is a rat S-mu sequence that comprises at least 3 contiguous
repeats of the repeat sequence GGGCT (SEQ ID NO. 46 - 50).
Attribute 80. A method for producing a non-human vertebrate organism, optionally a
mammal, comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a genome including an Ig H chain locus having a V region, a J region,
a D region, a rat switch sequence, and a C region in a 5' to 3' transcriptional orientation
wherein the rat switch is a rat S-mu sequence that comprises GAGCT (296 repeats),
GGGGT (50 repeats), and/or GGGCT (83 repeats).
Attribute 81. A method for producing an isolated non-human vertebrate cell or organism,
optionally a mammal, comprising:
inserting one or more non-native DNA constructs into a non-human mammal cell genome,
thereby producing a genome including an Ig H chain locus having DNA from three or
more mammalian species, wherein the Ig H chain locus includes, in a 5' to 3' transcriptional
orientation, at least a V region, a D region, a J region, an enhancer, a rat switch
sequence, and a C region.
Attribute 82. The method of any of attributes 75 to 81, further comprising:
inserting one or more non-native DNA constructs into the non-human mammal cell genome,
thereby producing a genome including an Ig L chain locus comprising in 5' to 3' transcriptional
orientation at least a human VL region, a human JL region, and a CL region.
Attribute 83. The method attribute 81 or 82, wherein said constant region (CL) is
a mouse or human constant region.
Attribute 84. The method of attribute 81 or 82, wherein the enhancer is a mouse enhancer
sequence.
Attribute 85. The method of any of attributes 75, 78, or 81-84, wherein said rat switch
sequence is rat S-mu.
Attribute 86. The method of any of attributes 75 to 85, wherein said V, D and/or J
region is human or V and/or J region is human.
Attribute 87. The method of any of attributes 75 to 86, wherein the IgH locus C region
is one of a mouse C region or a human C region.
Attribute 88. The method according to any of attributes 75 to 87, wherein the non-human
mammal cell genome is then modified to prevent expression of native (fully host species
specific) antibodies in the cell or vertebrate organism, optionally by inversion of
all or part of host non-human mammal Ig locus, optionally by insertion of one or more
site specific recombinase sites into the genome and then use of these sites in recombinase-mediated
excision or inversion of all or a part of the host non-human mammal Ig locus.
Attribute 89. The method according to any of attributes 75 to 88, wherein the cell
is an ES cell.
Attribute 90. The method according to any of attributes 75 to 89, wherein the step
of inserting DNA is accomplished by step-wise insertion of multiple constructs by
homologous recombination and wherein said DNA is inserted upstream of the host non-human
mammal constant region.
Attribute 91. The method according to any of attributes 75 to 90, wherein the step
of inserting DNA occurs at a site where an initiation cassette has been inserted into
the genome of an ES cell, thereby providing a unique targeting region.
Attribute 92. The method according to any of attributes 75 to 91, wherein one or more
insertion events utilises site specific recombination.
Attribute 93. The method according to attribute 92, wherein said one or more insertion
events is mediated by, or involves, one or more of Frt sites, Flp recombinase, Dre
recombinase, Rox sites, or PhiC31 recombinase.
Attribute 94. The method according to any of attributes 75 to 93, wherein inserting
one or more non-native DNA constructs into a non-human mammal cell genome comprises
the steps of:
- 1 insertion of DNA forming an initiation cassette (also called a landing pad herein)
into the genome of a cell;
- 2 insertion of a first DNA fragment into the insertion site, the first DNA fragment
comprising a first portion of a human DNA and a first vector portion containing a
first selectable marker or generating a selectable marker upon insertion;
- 3 optionally removal of part of the vector DNA;
- 4 insertion of a second DNA fragment into the vector portion of the first DNA fragment,
the second DNA fragment containing a second portion of human DNA and a second vector
portion, the second vector portion containing a second selectable marker, or generating
a second selectable marker upon insertion;
- 5 removal of any vector DNA to allow the first and second human DNA fragments to form
a contiguous sequence; and
- 6 iteration of the steps of insertion of a part of the human V(D)J DNA and vector
DNA removal, as necessary, to produce a cell with all or part of the human VDJ or
VJ region sufficient to be capable of generating a chimaeric antibody in conjunction
with a host constant region,
wherein the insertion of at least one DNA fragment uses site specific recombination.
Attribute 95. The method according to any of attributes 75 to 94, wherein the landing
pad sequence comprises SEQ ID NO 6, SEQ ID NO. 2, or SEQ ID NO. 3.
Attribute 96. The method according to any of attributes 75 to 95, wherein the landing
pad is inserted into the mouse cell genome by homologous recombination between mouse
J1-4 and mouse C mu sequences.
Attribute 97. The method according to any of attributes 75 to 96, wherein the landing
pad is recombined into the mouse cell genome by homologous recombination between mouse
J1-4 and E mu sequences.
Attribute 98. The method according to any of attributes 75 to 97, wherein the landing
pad comprises a non-host S-mu, such as a rat S-mu switch.
Attribute 99. The method, cell or mammal as attributed in any of attributes 1 to 98,
wherein a human coding region DNA sequence is in a functional arrangement with a non-human
mammal control sequence, such that transcription of the human DNA is controlled by
the non-human mammal control sequence.
Attribute 100. A method for producing an antibody or antibody heavy or light chain
specific to a desired antigen, the method comprising immunizing the non-human vertebrate
as attributed in attribute 4 - 28, 30-60, 63-66, or 71-74 with the desired antigen
and recovering the antibody or antibody chain or recovering a cell producing the antibody
or heavy or light chain.
Attribute 101. The method for producing a fully humanised antibody or antibody chain
comprising carrying out the method according to attribute 100 and then replacing the
non-human mammal constant region of the recovered antibody or antibody chain with
a human constant region, suitably by engineering of the nucleic acid encoding the
antibody or antibody chain.
Attribute 102. A humanised antibody or antibody chain produced according to attribute
100 or 101 or a derivative thereof that binds the desired antigen.
Attribute 103. Use of the humanised antibody or chain produced according to attribute
100 or 101 or a derivative thereof that binds the desired antigen in medicine.
Attribute 104. The humanised antibody or antibody chain produced according to attribute
100 or 101 or a derivative thereof that binds the desired antigen for use in medicine.
Attribute 105. A pharmaceutical composition comprising an antibody or antibody chain
according to attribute 100 or 101 or a derivative thereof that binds the desired antigen
and a pharmaceutically acceptable carrier or other excipient.
Attribute 106. A chimaeric antibody derivative of a chimaeric antibody produced according
to attribute 100, wherein the derivative binds the desired antigen.
Attribute 107. A mouse whose genome comprises an insertion of human IgH VDJ DNA between
co-ordinates 114,667,090 and 114,665,190 of mouse chromosome 12, such as between co-ordinates
114,667,089 and 114,667,090, the insert comprising nucleotides 105,400,051 to 106,368,585
from human chromosome 14 (co-ordinates refer to NCBI36 for the human genome and NCBI
m37, for the mouse C57BL/6J strain, or equivalent coordinates in another human chromosome
14 sequence or in another mouse genome respectively), the insertion being upstream
of the host non-human mammal constant region such that the mouse is able to produce
a repertoire of chimaeric heavy chains having a non-human mammal constant region and
a human variable region, wherein the mammal also comprises an insertion of the complete
VJC human light chain region such that a fully human lambda or kappa human antibody
chain may be generated which is able to form an antibody with a chimaeric heavy chain.
Attribute 108. A mouse whose genome comprises an insertion of human IgH VDJ DNA between
co-ordinates 114,667,090 and 114,667,091 of mouse chromosome 12, the insert comprising
or consisting of nucleotides 105,400,051 to 106,368,585 from human chromosome 14 (co-ordinates
refer to NCBI36 for the human genome and NCBI m37 for the mouse C57BL/6J strain, or
equivalent coordinates in another human chromosome 14 sequence or in another mouse
genome respectively), the insertion being upstream of the mouse constant region such
that the mouse is able to produce a repertoire of chimaeric heavy chains having a
mouse constant region and a human variable region, wherein the mouse also comprises
an insertion of the complete VJC human light chain region such that a fully human
lambda or kappa human antibody chain may be generated which is able to form an antibody
with a chimaeric heavy chain.
Attribute 109. A mouse whose genome comprises an insertion of human IgH VDJ DNA between
co-ordinates 114,667,090 and 114,665,190 of mouse chromosome 12, where co-ordinates
refer to NCBI m37, for the mouse C57BL/6J strain, or an insertion at an equivalent
position in another mouse strain, the insert comprising or consisting of nucleotides
106,328,951-107,268,444 from human chromosome 14, where co-ordinates refer to the
GRCH37/hg19 sequence database for humans, or the same nucleotides from an equivalent
position in another human chromosome 14 sequence, the insertion being upstream of
the host mouse constant region such that the mouse is able to produce a repertoire
of chimaeric heavy chains having a mouse constant region and a human variable region,
wherein the mouse also comprises an insertion of the complete VJC human light chain
region which is functional to generate a fully human lambda or kappa human antibody
chain which forms an antibody with a chimaeric heavy chain.
Attribute 110. A mouse according to attribute 109, wherein the insertion is between
co-ordinates 114,666,435 and 114,666,436 of mouse chromosome 12.
Attribute 116. A method of making a non-human vertebrate cell, optionally a mouse
or rat, the method comprising:
- (a) providing the non-human ES cell of attribute 29, 61, 62, or 68 and whereby the
non-human ES cell is capable of giving rise to a progeny cell in which endogenous
antibody expression is inactivated and wherein the progeny cell is capable of expressing
antibodies comprising human variable regions; and
- (b) optionally differentiating said non-human ES cell into said progeny cell or a
non-human vertebrate organism comprising said progeny cell.
Attribute 117. The method according to attribute 116, wherein said plurality of human
antibody gene segments comprises at least eleven human V segments.
Attribute 118. The method according to attribute 116 or 117, wherein said plurality
of human antibody gene segments comprises at least six human J segments.
Attribute 119. The method according to any one of attributes 116 to 118, wherein a
human nucleotide sequence is inserted in step (b), the nucleotide sequence comprising
said antibody gene segments, wherein the nucleotide sequence is at least 110kb.
Attribute 120. The method according to any one of attributes 116 to 119, wherein the
endogenous locus is a heavy chain locus and the human antibody gene segments are between
the 3'-most endogenous JH gene segment and endogenous C-mu.
Attribute 121. The method according to any one of attributes 116 to 120, wherein the
progeny cell is homozygous for said transgenic locus.
Attribute 122. A method of isolating an antibody that binds a predetermined antigen,
the method comprising
- (a) providing a vertebrate organism, mouse, or mammal, optionally a rat, according
to any one of attributes 1a, 4, 4a, 5 - 28, 30-60, 63-66, or 71-74, and 107-110;
- (b) immunising said vertebrate organism, mouse, or mammal with said antigen (optionally
wherein the antigen is an antigen of an infectious disease pathogen);
- (c) removing B lymphocytes from the vertebrate organism, mouse, or mammal and selecting
one or more B lymphocytes expressing antibodies that bind to the antigen;
- (d) optionally immortalising said selected B lymphocytes or progeny thereof, optionally
by producing hybridomas therefrom; and
- (e) isolating an antibody (e.g., and IgG-type antibody) expressed by the B lymphocytes.
Attribute 123. The method of attribute 122, comprising the step of isolating from
said B lymphocytes nucleic acid encoding said antibody that binds said antigen; optionally
exchanging the heavy chain constant region nucleotide sequence of the antibody with
a nucleotide sequence encoding a human or humanised heavy chain constant region and
optionally affinity maturing the variable region of said antibody; and optionally
inserting said nucleic acid into an expression vector and optionally a host.
Attribute 124. The method of attribute 122 or 123, further comprising making a mutant
or derivative of the antibody produced by the method of attribute 122 or 123.
Attribute 125. An antibody or fragment thereof comprising variable regions that specifically
bind a predetermined antigen with a sub-50nM affinity as determined by surface plasmon
resonance, wherein the antibody is isolated from a non-human vertebrate organism,
mouse, or mammal, optionally a rat, according to any one of attributes 1a, 4, 4a,
5 - 28, 30-60, 63-66, or 71-74, and 107-110 and comprises heavy chain CDR3s (as defined
by Kabat) encoded by a rearranged VDJ of said vertebrate organism, mouse, or mammal,
wherein the VDJ is the product of rearrangement in vivo of a human JH gene segment
of a heavy chain locus of said vertebrate with D (optionally a human D gene segment
of said locus) and VH gene segments.
Attribute 126. An antibody or fragment that is identical to an antibody of attribute
125 or a derivative thereof, optionally a derivative whose constant regions are human
and/or an affinity matured derivative, that specifically binds said antigen with a
sub-50 nM affinity as determined by surface plasmon resonance.
Attribute 127. A pharmaceutical composition comprising an antibody or fragment of
attribute 125 or 126 and a pharmaceutically-acceptable diluent, excipient or carrier.
Attribute 128. A nucleotide sequence encoding a heavy chain variable region of an
antibody or fragment of attribute 125 or 126, optionally as part of a vector (e.g.,
an expression vector).
Attribute 129. The nucleotide sequence of attribute 128, wherein the sequence is a
cDNA derived from a B-cell of the vertebrate from which the antibody of attribute
125 is isolated, or is identical to such a cDNA.
Attribute 130. An isolated host cell (e.g., a hybridoma or a CHO cell or a HEK293
cell) comprising a nucleotide sequence according to attribute 128 or 129.
Attribute 131. A method of isolating an antibody that binds a predetermined antigen,
the method comprising
- (a) providing a vertebrate organism, mouse, or mammal, optionally a rat, according
to any one of attributes 1a, 4, 4a, 5 - 28, 30-60, 63-66, or 71-74, and 107-110;
- (b) immunising said vertebrate organism, mouse, or mammal with said antigen;
- (c) removing B lymphocytes from the vertebrate organism, mouse, or mammal and selecting
a B lymphocyte expressing an antibody that binds to the antigen with sub-nM affinity,
wherein the antibody is according to attribute 125;
- (d) optionally immortalising said selected B lymphocyte or progeny thereof, optionally
by producing hybridomas therefrom; and
- (e) isolating an antibody (e.g., and IgG-type antibody) expressed by the B lymphocyte.
Attribute 132. The method of attribute 131, comprising the step of isolating from
said B lymphocyte nucleic acid encoding said antibody that binds said antigen; optionally
exchanging the heavy chain constant region nucleotide sequence of the antibody with
a nucleotide sequence encoding a human or humanised heavy chain constant region and
optionally affinity maturing the variable region of said antibody; and optionally
inserting said nucleic acid into an expression vector and optionally a host.
Attribute 133. The method of attribute 131 or 132, further comprising making a mutant
or derivative of the antibody produced by the method of attribute 131 or 132.
Attribute 137. A cassette for inversion and inactivation of endogenous mouse antibody
heavy chain gene segments, the segments being part of a heavy chain locus sequence
on chromosome 12 of a mouse cell (e.g., ES cell) wherein the sequence is flanked at
its 3' end by a site-specific recombination site (e.g., lox, rox or frt), the cassette
comprising a nucleotide sequence encoding an expressible label or selectable marker
and a compatible site-specific recombination site (e.g., lox, rox or frt) flanked
by a 5' and a 3' homology arm, wherein (i) the 5' homology arm is mouse chromosome
12 DNA from coordinate 119,753,124 to coordinate 119,757,104 and the 3' homology arm
is mouse chromosome 12 DNA from coordinate 119,749,288 to 119,753,123; (ii) the 5'
homology arm is mouse chromosome 12 DNA from coordinate 119,659,459 to coordinate
119,663,126 and the 3' homology arm is mouse chromosome 12 DNA from coordinate 119,656,536
to 119,659,458; or (iii) the 5' homology arm is mouse chromosome 12 DNA from coordinate
120,918,607 to coordinate 120,921,930 and the 3' homology arm is mouse chromosome
12 DNA from coordinate 120,915,475 to 120,918,606.
Attribute 138. A mouse or mouse cell whose genome comprises an inversion of a chromosome
12, wherein the inversion comprises inverted endogenous heavy chain gene segments
(e.g., VH, D and JH, such as the entire endogenous heavy chain VDJ region); wherein
the genome of the mouse or mouse cell comprises a transgenic heavy chain locus comprising
a plurality of human VH gene segments, a plurality of human D segments and a plurality
of human JH segments upstream of and operatively associated with an endogenous constant
region (e.g., C mu) so that the mouse or mouse cell (optionally following differentiation
into a B-cell) is capable of expressing an antibody comprising a variable region comprising
sequences derived from the human gene segments; and wherein the inversion is (i) an
inversion of mouse chromosome 12 from coordinate 119,753,123 to coordinate 114,666,436;
(ii) an inversion of mouse chromosome 12 from coordinate 119,659,458 to coordinate
114,666,436; or (iii) an inversion of mouse chromosome 12 from coordinate 120,918,606
to coordinate 114,666,436.
[0211] The disclosure also includes the following provisions:
≥70 or 80% of all LIGHT chain are human Vλ
[0212] Provision 1. A non-human vertebrate having a genome comprising a recombinant immunoglobulin
light chain locus, said locus comprising a targeted insert positioned in an endogenous
light chain locus,
wherein the targeted insert comprises human lambda light chain locus DNA and is positioned
upstream to a lambda light chain constant region,
wherein said targeted insert includes a repertoire of human Vλ and Jλ gene segments,
wherein the vertebrate expresses immunoglobulin light chains comprising human lambda
variable regions, and
wherein at least 70 or 80% of the immunoglobulin light chains expressed in said vertebrate
comprises human lambda variable regions.
[0213] Provision 2. The vertebrate of provision 1, wherein the repertoire of human Vλ and
Jλ insertion comprises at least the functional human V and J gene segments comprised
by a human lambda chain immunoglobulin locus from Vλ2-18 to Cλ7.
[0214] Provision 3. The vertebrate of provision 1, wherein the endogenous light chain locus
is the endogenous kappa locus.
[0215] Provision 4. The vertebrate of provision 3, wherein the genome is homozygous for
the repertoire of human Vλ and Jλ gene segments and wherein the endogenous kappa chain
expression is substantially inactive.
[0216] Provision 5. The vertebrate of provision 4, wherein the endogenous kappa chain expression
is completely inactive.
[0217] Provision 6. The vertebrate of provision 1, wherein the endogenous light chain locus
is the endogenous lambda locus.
[0218] Provision 7. The vertebrate of provision 6, wherein the genome is homozygous for
the repertoire of human Vλ and Jλ gene segments and wherein expression of the endogenous
lambda chain is substantially inactive.
[0219] Provision 8. The vertebrate of provision 7, wherein expression of the endogenous
lambda chain is completely inactive.
[0220] Provision 9. The vertebrate of provision 1, wherein the targeted insert is positioned
downstream of endogenous V and J light chain gene segments.
[0221] Provision 10. The vertebrate of provision 1, wherein the targeted insert includes
a constant region of a human lambda light chain locus.
[0222] Provision 11. The vertebrate of provision 10, wherein said light chains expressed
by said vertebrate comprise V-C regions derived from recombination of human Vλ, Jλ,
and Cλ gene segments.
[0223] Provision 12. The vertebrate of provision 1, wherein the vertebrate is derived from
a mouse ES cell or a rat ES cell.
[0224] Provision 13. The vertebrate of provision 1, wherein the vertebrate is a mouse or
a rat.
[0225] Provision 14. The vertebrate of provision 1, wherein the targeted insert comprises
inter-gene segment intervening sequences being human lambda light chain locus DNA
which is between functional human V and J light chain gene segments in a human locus
or comprises inter-gene segment intervening sequences being lambda light chain locus
DNA which is between corresponding lambda light chain gene segments in an endogenous
non-human vertebrate genome.
[0226] Provision 15. The vertebrate of provision 14, wherein the targeted insert includes
a human lambda immunoglobulin gene segment pseudogene.
[0227] Provision 16. The vertebrate of provision 14, wherein the targeted insert lacks a
human lambda immunoglobulin gene segment pseudogene.
[0228] Provision 17. The vertebrate of provision 1, wherein at least 70, 75 or 80, 84, 85,
90, 95, 96, 97, 98, or 99%, or 100% of immunoglobulin light chains expressed by said
vertebrate comprise human V regions derived from recombination of human Vλ and Jλ
gene segments.
[0229] Provision 18. The vertebrate of provision 17, wherein at least 90% of immunoglobulin
light chains expressed by said vertebrate comprise human V regions derived from recombination
of human Vλ and Jλ gene segments.
≥60% of all LIGHT chains have human Vλ regions
[0230] Provision 19. A non-human vertebrate having a genome comprising a recombinant immunoglobulin
light chain locus, said locus comprising a targeted insert positioned in an endogenous
light chain locus,
wherein the targeted insert comprises human lambda light chain locus DNA which is
positioned upstream to a lambda light chain constant region and includes a repertoire
of human Vλ and Jλ gene segments,
wherein said genome comprises kappa V gene segments positioned upstream to a light
chain constant region,
wherein the vertebrate expresses immunoglobulin light chains comprising lambda variable
regions, and
wherein at least 60% of immunoglobulin light chains expressed by said vertebrate comprises
human lambda variable regions.
[0231] Provision 20. The vertebrate provision 19, wherein at least 65, 70, 80, 84, 85, 90,
95, 96, 97, 98, or 99%, or 100% of immunoglobulin light chains expressed by said vertebrate
comprises human variable regions derived from recombination of human Vλ and Jλ gene
segments.
[0232] Provision 21. The vertebrate of provision 20, wherein at least 84% of immunoglobulin
light chains expressed by said vertebrate comprises human variable regions derived
from recombination of human Vλ and Jλ gene segments.
[0233] Provision 22. The vertebrate of provision 21, wherein at least 95% of immunoglobulin
light chains expressed by said vertebrate comprises human variable regions derived
from recombination of human Vλ and Jλ gene segments.
[0234] Provision 23. The vertebrate of provision 19, wherein the vertebrate is derived from
a mouse ES cell or a rat ES cell.
[0235] Provision 24. The vertebrate of provision 19, wherein the vertebrate is a mouse or
a rat.
[0236] Provision 25. The vertebrate or cell of provision 19, wherein the targeted insert
is positioned downstream of endogenous V and J light chain gene segments.
[0237] Provision 25a. The vertebrate of provisions 19, wherein the kappa V gene segments
positioned upstream to a light chain constant region are endogenous kappa V gene segments.
Vλ Jλ into kappa or lambda locus
[0238] Provision 26. A non-human vertebrate or cell having a genome comprising a recombinant
immunoglobulin light chain locus, said locus comprising a targeted insert positioned
downstream to endogenous V and J light chain gene segments,
wherein the targeted insert comprises human immunoglobulin Vλ and Jλ gene segments,
wherein said human Vλ and Jλ gene segments are positioned upstream to a light chain
constant region,
wherein said human Vλ and Jλ gene segments comprise at least the functional V and
J gene segments from Vλ2-18 to Cλ7 of a human lambda light chain locus, and
wherein said vertebrate or cell expresses immunoglobulin light chains comprising human
lambda variable regions.
[0239] Provision 27. The vertebrate or cell of provision 26, wherein the targeted insert
includes a constant region of a human lambda light chain locus.
[0240] Provision 28. The vertebrate or cell of provision 27, wherein said light chains expressed
by said vertebrate or cell comprise human V-C regions derived from recombination of
human Vλ, Jλ, and Cλ gene segments.
[0241] Provision 29. The vertebrate or cell of provision 26, wherein the endogenous V and
J light chain gene segments are V kappa and J kappa gene segments.
[0242] Provision 30. The vertebrate or cell of provision 26, wherein endogenous kappa chain
expression is substantially inactive.
[0243] Provision 31. The vertebrate or cell of provision 30, wherein the endogenous kappa
chain expression is completely inactive.
[0244] Provision 32. The vertebrate or cell of provision 26, wherein the endogenous V and
J light chain gene segments are V lambda and J lambda gene segments.
[0245] Provision 33. The vertebrate or cell of provision 26, wherein endogenous lambda chain
expression is substantially inactive.
[0246] Provision 34. The vertebrate or cell of provision 30, wherein the endogenous lambda
chain expression is completely inactive.
[0247] Provision 35. The vertebrate or cell of provision 25, wherein the targeted insert
comprises inter-gene segment intervening sequences being human lambda light chain
locus DNA which is between functional human V and J light chain gene segments in a
human locus or comprises inter-gene segment intervening sequences being lambda light
chain locus DNA which is between corresponding lambda light chain gene segments in
an endogenous genome.
[0248] Provision 36. The vertebrate or cell of provision 35, wherein the targeted insert
includes a pseudogene.
[0249] Provision 37. The vertebrate of provision 25, wherein the vertebrate is derived from
a mouse ES cell or a rat ES cell.
[0250] Provision 38. The vertebrate of provision 25, wherein the vertebrate is a mouse or
a rat.
[0251] Provision 38a. The vertebrate of provisions 25, wherein said human Vλ and Jλ gene
segments are positioned upstream to an endogenous light chain constant region.
VJCλ into kappa locus
[0252] Provision 39. A non-human vertebrate or cell having a genome comprising a recombinant
immunoglobulin kappa light chain locus, said locus comprising a targeted insert of
human Vλ, Jλ and Cλ gene segments positioned upstream to an endogenous kappa constant
region,
wherein said vertebrate or cell expresses immunoglobulin light chains comprising human
V-C regions derived from recombination of human Vλ, Jλ, and Cλ gene segments, and
wherein said targeted insert comprises at least the functional V, J and C gene segments
from Vλ3-1 to Cλ7 of a human lambda chain immunoglobulin locus.
[0253] Provision 40. The vertebrate or cell of provision 39, wherein said targeted insert
comprises at least the functional V, J and C gene segments from Vλ2-18 to Cλ7 of a
human lambda light chain immunoglobulin locus.
[0254] Provision 41. The vertebrate or cell of provision 39, wherein the targeted insert
comprises inter-gene segment intervening sequences being human lambda light chain
locus DNA which is between functional human V and J or J and C light chain gene segments
in a human locus or comprises inter-gene segment intervening sequences being lambda
light chain locus DNA which is between corresponding lambda light chain gene segments
in an endogenous non-human vertebrate genome.
[0255] Provision 42. The vertebrate or cell of provision 41, wherein the targeted insert
includes a pseudogene.
[0256] Provision 43. The vertebrate of provision 39, wherein the vertebrate is derived from
a mouse ES cell or a rat ES cell.
[0257] Provision 44. The vertebrate of provision 39, wherein the vertebrate is a mouse or
a rat.
[0258] Provision 45. The vertebrate or cell of provision 39, wherein the endogenous kappa
chain expression is substantially inactive.
[0259] Provision 46. The vertebrate or cell of provision 45, wherein the endogenous kappa
chain expression is completely inactive.
[0260] Provision 47. The vertebrate or cell of provision 39, wherein the targeted insert
is positioned downstream of endogenous V and J light chain gene segments.
VJλ into kappa locus
[0261] Provision 48. A non-human vertebrate or cell having a genome comprising a recombinant
immunoglobulin kappa light chain locus, said locus comprising endogenous Vκ and Jκ
gene segments upstream to a targeted insert,
wherein the targeted insert comprises at least the functional Vλ and Jλ gene segments
from Vλ3-1 to Cλ7 of a human lambda light chain immunoglobulin locus,
wherein said vertebrate or cell expresses an immunoglobulin light chain comprising
a human lambda variable region, and
wherein expression of light chains comprising endogenous kappa variable regions derived
from recombination of endogenous Vκ and Jκ gene segments is substantially inactive.
[0262] Provision 49. The vertebrate of provision 48, wherein the vertebrate is derived from
a mouse ES cell or a rat ES cell.
[0263] Provision 50. The vertebrate of provision 48, wherein the vertebrate is a mouse or
a rat.
[0264] Provision 51. The vertebrate or cell of provision 48, wherein said targeted insert
comprises at least the functional Vλ and Jλ gene segments from Vλ2-18 to Cλ7 of a
human lambda light chain immunoglobulin locus.
[0265] Provision 52. The vertebrate or cell of provision 48, wherein endogenous Vκ and Jκ
light chain expression is completely inactive.
[0266] Provision 53. The vertebrate or cell of provision 48, wherein less than 10, 5, 4,
3, 2, 1, or 0.5% of immunoglobulin light chains expressed by said vertebrate or cell
comprise endogenous kappa variable regions.
[0267] Provision 54. The vertebrate or cell of provision 48, wherein the targeted insert
comprises inter-gene segment intervening sequences being human lambda light chain
locus DNA which is between functional human V and J gene segments in a human locus
or comprises inter-gene segment intervening sequences being lambda light chain locus
DNA which is between corresponding lambda light chain gene segments in an endogenous
genome.
[0268] Provision 55. A non-human vertebrate or cell, having a recombinant genome comprising
endogenous immunoglobulin kappa light chain locus sequences comprising at least one
endogenous kappa enhancer (Eκ) sequence, at least one endogenous V kappa gene segment,
at least one endogenous J kappa gene segment, and at least one endogenous C kappa
constant region,
wherein endogenous V kappa and J kappa gene segments are separated from a respective
endogenous Eκ sequence on the same chromosome by a distance that substantially prevents
production of an endogenous immunoglobulin kappa light chain polypeptide.
[0269] Provision 56. The vertebrate or cell of provision 55, wherein the endogenous V kappa
and J kappa gene segments are separated from the respective endogenous Eκ sequence
by a distance that is greater than the distance between endogenous V kappa and J kappa
gene segments and a respective endogenous Eκ sequence in an endogenous, non recombinant
kappa light chain locus.
[0270] Provision 57. The cell of provision 55, wherein the cell is a mouse cell or a rat
cell.
[0271] Provision 57a. The vertebrate of provision 55, wherein the vertebrate is derived
from a mouse ES cell or a rat ES cell.
[0272] Provision 58. The vertebrate of provision 55, wherein the vertebrate is a mouse or
a rat.
[0273] Provision 59. The vertebrate or cell of provision 55, wherein said recombinant genome
comprises a targeted insert comprising one or more human V light chain gene segments
and one or more human J light chain gene segments,
wherein the targeted insert is positioned between said endogenous V kappa and J kappa
gene segments and said respective endogenous Eκ sequence.
[0274] Provision 59a. The vertebrate or cell of provision 59, wherein said recombinant genome
is homozygous for the targeted insert.
[0275] Provision 60. The vertebrate or cell of provision 59, wherein the targeted insert
comprises light chain gene segments comprising one or more human Vκ and one or more
Jκ gene segments.
[0276] Provision 60a. The vertebrate or cell of provision 60, wherein said recombinant genome
is homozygous for the targeted insert.
[0277] Provision 61. The vertebrate or cell of any preceding provision, wherein the targeted
insert comprises a repertoire of human Vλ and Jλ gene segments and wherein the targeted
insert has been inserted within 100kb of an endogenous light chain locus enhancer
sequence.
[0278] Provision 62. The vertebrate or cell of any preceding provision, wherein the targeted
insert comprises a repertoire of at least 10 human Vλ gene or human Jλ gene segments
and wherein the targeted insert is positioned upstream to an endogenous light chain
constant region.
[0279] Provision 63. The vertebrate or cell of provision 62, wherein the targeted insert
comprises at least a portion of a human immunoglobulin lambda chain locus from Vλ2-18
to Vλ3-1.
[0280] Provision 64. The vertebrate or cell of provision 62, wherein the targeted insert
comprises at least 2, 3, 4, or 5 human Jλ gene segments.
[0281] Provision 65. The vertebrate or cell of provision 64, wherein the human Jλ gene segments
are different from each other.
[0282] Provision 66. The vertebrate or cell of provision 65, wherein the human Jλ gene segments
are Jλ1, Jλ2, Jλ3, Jλ6, and Jλ7.
[0283] Provision 67. The vertebrate or cell of provision 62, wherein the targeted insert
includes at least a portion of a human immunoglobulin lambda chain locus from Vλ2-18
to Cλ7.
[0284] Provision 68. The vertebrate or cell of provision 62, wherein the targeted insert
excludes human Jλ4Cλ4 and/or human Jλ5Cλ5.
[0285] Provision 69. The vertebrate or cell of provision 62, wherein the targeted insert
includes a human light chain enhancer.
[0286] Provision 70. The vertebrate or cell of provision 69, wherein the human light chain
enhancer is an Eλ sequence and wherein the Eλ sequence is positioned between the human
Jλ gene segments and an endogenous light chain constant region.
[0287] Provision 71. The vertebrate or cell of provision 70, wherein the human Jλ gene segments
are part of a human JλCλ cluster.
[0288] Provision 72. The vertebrate or cell of any preceding provision, wherein the vertebrate
or cell expresses lambda immunoglobulin light chains comprising a repertoire of human
lambda variable regions encoded by human Vλ and Jλ gene segments, wherein the human
Vλ includes Vλ3-1 and, optionally, one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11,
Vλ3-10, Vλ3-9, Vλ2-8, and Vλ4-3, wherein the human Vλ and Jλ gene segments are included
in the targeted insert.
[0289] Provision 73. The vertebrate or cell of any preceding provision, wherein the vertebrate
or cell expresses lambda immunoglobulin light chains comprising a repertoire of human
lambda variable regions encoded by human Vλ and Jλ gene segments , wherein the human
Vλ includes Vλ2-14 and, optionally, one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12,
Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1, wherein the human Vλ and Jλ gene segments
are included in the targeted insert.
[0290] Provision 74. The vertebrate or cell of any preceding provision, wherein the vertebrate
or cell expresses lambda immunoglobulin light chains comprising a repertoire of human
lambda variable regions encoded by human Vλ and Jλ gene segments, wherein the human
Vλ includes including Vλ2-8 and, optionally, one or more of Vλ2-18, Vλ3-16, V2-14,
Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ4-3, and Vλ3-1, wherein the human Vλ and Jλ gene
segments are included in the targeted insert.
[0291] Provision 75. The vertebrate or cell of any preceding provision, wherein the vertebrate
or cell expresses lambda immunoglobulin light chains comprising a repertoire of human
lambda variable regions encoded by human Vλ and Jλ gene segments, wherein the human
Vλ includes Vλ3-10 and, optionally, one or more of Vλ2-18, Vλ3-16, V2-14, Vλ3-12,
Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1, wherein the human Vλ and Jλ gene segments
are included in the targeted insert.
[0292] Provision 76. The vertebrate or cell of any preceding provision, wherein the targeted
insert comprises each functional Vλ gene segment from Vλ2-18 to Vλ3-1 of a human lambda
light chain locus.
[0293] Provision 77. The vertebrate or cell of any preceding provision, wherein at least
a human Vλ3-1 is included in the targeted insert.
[0294] Provision 78. The vertebrate or cell of provision 77, wherein at least Vλ2-18, Vλ3-16,
V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1 are included in the
targeted insert.
[0295] Provision 79. The vertebrate of any preceding provision, wherein the vertebrate expresses
more lambda chains than kappa chains.
[0296] Provision 80. The vertebrate of any preceding provision, wherein the vertebrate expresses
no endogenous kappa chains.
[0297] Provision 81. The vertebrate of any preceding provision, wherein endogenous kappa
chain expression is substantially inactive.
[0298] Provision 82. The vertebrate of provision 81, wherein the endogenous kappa chain
expression is completely inactive.
[0299] Provision 83. The vertebrate of any preceding provision, wherein the vertebrate expresses
immunoglobulin heavy chains.
[0300] Provision 84. The vertebrate or cell of any preceding provision, wherein the targeted
insert includes a human lambda enhancer (Eλ) sequence and wherein the Eλ sequence
is positioned in said endogenous light chain locus.
[0301] Provision 85. The vertebrate or cell of provision 84, wherein the Eλ sequence is
positioned downstream to a 3'-most downstream Cλ region that is included in the targeted
insert.
[0302] Provision 86. The vertebrate or cell of any preceding provision, wherein at least
human JC gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6, and Jλ7-Cλ7 are included
in the targeted insert.
[0303] Provision 87. The vertebrate or cell of any preceding provision, wherein the human
gene segments included in the targeted insert are in germline configuration.
[0304] Provision 88. The vertebrate or cell of provision 87, wherein the targeted insertion
comprises inter-gene segment sequences of a human light chain locus or inter-gene
segment sequences of an endogenous light chain locus.
[0305] Provision 89. The vertebrate or cell of any preceding provision, wherein an endogenous
light chain enhancer remains in the endogenous locus.
[0306] Provision 90. The vertebrate or cell of provision 89, wherein the endogenous enhancer
is in germline configuration.
[0307] Provision 91. The vertebrate or cell of provision 90, wherein the endogenous locus
is a kappa locus.
[0308] Provision 92. The vertebrate or cell of provision 90, wherein the endogenous kappa
enhancer is present.
[0309] Provision 93. The vertebrate or cell of provision 92, wherein the endogenous enhancer
is an iEκ and/or 3' Eκ sequence.
[0310] Provision 94. The vertebrate or cell of provision 90, wherein the germline configuration
is with respect to an endogenous light chain constant region.
[0311] Provision 95. The vertebrate or cell of any preceding provision, wherein the genome
is heterozygous for the targeted insert.
[0312] Provision 96. The vertebrate or cell of provision 95, wherein the targeted insert
comprises human V and J or human V, J, and C light chain gene segments.
[0313] Provision 97. The vertebrate or cell of provision 96, wherein the targeted insert
is positioned in an endogenous light chain lambda locus.
[0314] Provision 98. The vertebrate or cell of provision 96, wherein the targeted insert
is positioned in an endogenous light chain kappa locus.
[0315] Provision 99. The vertebrate or cell of provision 98, wherein the endogenous kappa
enhancer is present and is an iEκ and/or 3' Eκ sequence.
[0316] Provision 100. The vertebrate of provision 95, wherein the vertebrate is derived
from a mouse ES cell or a rat ES cell.
[0317] Provision 101. The vertebrate of provision 95, wherein the vertebrate is a mouse
or a rat.
[0318] Provision 102. The vertebrate or cell of provision 95, wherein the genome comprises
a first targeted insert comprising a human lambda gene segment and a second targeted
insert comprising human kappa immunoglobulin V and J gene segments,
wherein the first targeted insert is positioned in a first endogenous kappa locus
and wherein the second targeted insert is positioned in a second endogenous kappa
locus and upstream to an endogenous kappa constant region.
[0319] Provision 103. The vertebrate or cell of provision 102, wherein an endogenous kappa
light chain enhancer is present in the first and/or second endogenous kappa locus.
[0320] Provision 104. The vertebrate or cell of provision 103, wherein the endogenous kappa
loci are optionally in germline configuration.
[0321] Provision 105. The vertebrate or cell of provision 95, wherein the genome comprises
a first targeted insert comprising a human lambda gene segment and a second targeted
insert comprising human kappa immunoglobulin V and J gene segments,
wherein the first targeted insert is positioned in a first endogenous lambda locus
and wherein the second targeted insert is positioned in a second endogenous lambda
locus and upstream to an endogenous lambda constant region.
[0322] Provision 106. The vertebrate or cell of provision 105, wherein an endogenous lambda
light chain enhancer is present in the first and/or second endogenous lambda locus.
[0323] Provision 106. The vertebrate or cell of provision 105, wherein the endogenous kappa
loci are optionally in germline configuration.
[0324] Provision 107. The vertebrate or cell of any preceding provision, wherein the genome
is homozygous for a targeted insert comprising a human lambda gene segment and positioned
in the endogenous immunoglobulin light chain locus.
[0325] Provision 108. The vertebrate or cell of any preceding provision, wherein the genome
comprises two or more targeted inserts comprising human lambda gene segments and positioned
in the endogenous kappa and/or lambda locus.
[0326] Provision 109. The vertebrate or cell of provision 108, wherein the genome is homozygous
for a first targeted insert comprising a human lambda gene segment and positioned
in each endogenous lambda locus, wherein the vertebrate or cell expresses lambda light
chains comprising human lambda variable regions;
wherein a second targeted insert comprising a human lambda gene segment is positioned
in a first endogenous kappa locus,
wherein a third targeted insert comprising a plurality of human Vκ and Jκ gene segments
is positioned upstream to an endogenous Cκ gene segment in a second endogenous kappa
locus, and
wherein the vertebrate or cell expresses kappa light chains comprising human kappa
variable regions.
[0327] Provision 110. The vertebrate or cell of provision 108, wherein the targeted inserts
comprising a lambda gene segment is positioned in the endogenous kappa and lambda
loci comprise the same repertoire of human lambda gene segments.
[0328] Provision 111. The vertebrate or cell of provision 109, wherein the first and second
targeted inserts comprise the same repertoire of human lambda gene segments.
[0329] Provision 112. The vertebrate or cell of provision 108, wherein the targeted inserts
comprising a lambda gene segment is positioned in the kappa loci and the targeted
inserts positioned in the lambda loci comprise a different repertoire of human lambda
gene segments.
[0330] Provision 113. The vertebrate or cell of provision 109, wherein the first and second
targeted inserts comprise a different repertoire of human lambda gene segments.
[0331] Provision 114. A non-human vertebrate or cell having a genome comprising one or more
first and/or second targeted inserts positioned in at least one endogenous immunoglobulin
locus, wherein the one or more first and/or second targeted inserts each comprise
a repertoire of human immunoglobulin gene segments,
the genome comprising one of the following light chain loci arrangements:
- (a) an L positioned in a first endogenous kappa chain locus and a K positioned in
a second endogenous kappa chain locus;
- (b) an L positioned in a first endogenous lambda chain locus and a K positioned in
a second endogenous lambda chain allele;
- (c) an L positioned in each endogenous kappa chain loci;
- (d) an L positioned in each endogenous lambda chain loci;
- (e) an L positioned in a first endogenous kappa chain locus and with a second endogenous
kappa chain locus is inactive; or
- (f) an L positioned in a first endogenous lambda chain locus and with a second endogenous
lambda chain locus is inactive;
wherein
an L represents a first targeted insert comprising at least functional human Vλ and
Jλ gene segments from Vλ3-1 to Cλ7 comprised by a human lambda chain immunoglobulin
locus;
wherein
a K represents a second targeted insert comprising human Vκ and Jκ gene segments;
and
wherein each L or K is positioned upstream to a constant region, thereby allowing
expression of light chains comprising human V regions derived from recombination of
human V and J gene segments.
[0332] Provision 115. The vertebrate of provision 114, wherein the vertebrate is derived
from a mouse ES cell or a rat ES cell.
[0333] Provision 116. The vertebrate of provision 114, wherein the vertebrate is a mouse
or a rat.
[0334] Provision 117. The vertebrate or cell of provision 114, wherein L further comprises
a human Cλ region
[0335] Provision 118. The vertebrate or cell of provision 114, wherein the L comprises functional
human lambda chain immunoglobulin gene segments from Vλ2-18 to Cλ7.
[0336] Provision 119. The vertebrate or cell of provision 114, wherein the genome comprises
one of the following light chain loci arrangements:
(a) and an L positioned in the first or in the first and second endogenous lambda
chain loci;
(a) and a K positioned in the first or in the first and second endogenous lambda chain
loci;
(a) and an L positioned in the first endogenous lambda chain locus and a K positioned
in the second endogenous lambda chain locus;
(b) and an L positioned in the first or in the first and second endogenous kappa chain
loci;
(b) and a K positioned in the first or in the first and second endogenous kappa chain
loci;
(b) and an L positioned in the first endogenous kappa chain locus and a K positioned
in the second endogenous kappa chain locus;
(c) and a K positioned in the first or in the first and second endogenous lambda chain
loci;
(c) and an L positioned in the first or in the first and second endogenous lambda
chain loci;
(c) and an L positioned in the first endogenous lambda chain locus and a K positioned
in the second endogenous lambda chain locus;
(c) and with the first and second endogenous lambda chain loci is inactive;
(d) and an L positioned in the first or in the first and second endogenous kappa chain
loci;
(d) and a K positioned in the first or in the first and second endogenous kappa chain
loci;
(d) and an L positioned in the first endogenous kappa chain locus and a K positioned
in the second endogenous kappa chain locus; or
(d) and with the first and second endogenous kappa chain loci is inactive.
[0337] Provision 120. The vertebrate or cell of provision 114, wherein endogenous kappa
chain expression is substantially inactive.
[0338] Provision 121. The vertebrate or cell of provision 120, wherein the endogenous kappa
chain expression is completely inactive.
[0339] Provision 122. The vertebrate or cell of provision 114, wherein endogenous lambda
chain expression is substantially inactive.
[0340] Provision 123. The vertebrate or cell of provision 122, wherein the endogenous lambda
chain expression is completely inactive.
[0341] Provision 124. The vertebrate or cell of provision 114, wherein one or more L's are
positioned upstream to an endogenous lambda or kappa constant region.
[0342] Provision 125. The vertebrate or cell of provision 114, wherein one or more L's positioned
in a lambda locus is positioned upstream to an endogenous lambda constant region.
[0343] Provision 126. The vertebrate or cell of provision 114, wherein one or more L's positioned
in a kappa locus is positioned upstream to an endogenous kappa constant region.
[0344] Provision 127. The vertebrate or cell of provision 114, wherein each L positioned
in a lambda locus is positioned upstream to a human lambda constant region.
[0345] Provision 128. The vertebrate or cell of provision 114, wherein each L positioned
in a kappa locus is positioned upstream to a human kappa constant region.
[0346] Provision 129. The vertebrate or cell of provision 114, wherein one or more K's are
positioned upstream to an endogenous lambda or kappa constant region.
[0347] Provision 130. The vertebrate or cell of provision 114, wherein one or more K's positioned
in a lambda locus is positioned upstream to an endogenous lambda constant region.
[0348] Provision 131. The vertebrate or cell of provision 114, wherein each K positioned
in a kappa locus is positioned upstream to an endogenous kappa constant region.
[0349] Provision 132. The vertebrate or cell of provision 114, wherein each K positioned
in a lambda locus is positioned upstream to a human lambda constant region.
[0350] Provision 133. The vertebrate or cell of provision 114, wherein each K positioned
in a kappa locus is positioned upstream to a human kappa constant region.
[0351] Provision 134. The vertebrate or cell of provision 114, wherein the genome comprises
more than one L and each L comprises a different repertoire of human Vλ and Jλ gene
segments.
[0352] Provision 135. The vertebrate or cell of provision 134, wherein the genome comprises
two L's.
[0353] Provision 136. The vertebrate or cell of provision 134, wherein the genome comprises
three L's.
[0354] Provision 137. The vertebrate or cell of provision 114, wherein the genome comprises
more than one L and each L comprises a different repertoire of human Vλ, Jλ, and Cλ
gene segments.
[0355] Provision 138. The vertebrate or cell of provision 114, wherein the genome comprises
more than one K and each K comprises a different repertoire of human Vκ and Jκ gene
segments.
[0356] Provision 139. The vertebrate or cell of provision 138, wherein the genome comprises
two L's.
[0357] Provision 140. The vertebrate or cell of provision 138, wherein the genome comprises
three K's.
[0358] Provision 141. The vertebrate or cell of provision 114, wherein the genome comprises
more than one L and each L comprises a different repertoire of human Vκ, Jκ, and Cκ
gene segments.
[0359] Provision 141a. The vertebrate of provision 114, wherein the vertebrate is derived
from a mouse ES cell or a rat ES cell.
[0360] Provision 142. The vertebrate or cell of any preceding provision, wherein the genome
comprises an immunoglobulin heavy chain locus comprising human VH gene segments.
[0361] Provision 143. A method for producing an antibody or light chain comprising a lambda
variable region specific to a desired antigen, the method comprising immunizing a
vertebrate according to any preceding provision with the desired antigen and recovering
the antibody or light chain or recovering a cell producing the antibody or light chain.
[0362] Provision 144. The method of provision 143, further comprising a step of replacing
the non-human vertebrate constant region with a human constant region thereby producing
a humanised antibody or antibody light chain.
[0363] Provision 145. The method of provision 144, wherein the humanised antibody or antibody
light chain is produced by engineering a nucleic acid encoding the fully humanised
antibody or light chain.
[0364] Provision 146. A humanised antibody or antibody light chain produced by the method
of provision 143.
[0365] Provision 147. A derivative of the humanised antibody or antibody light chain of
provision 146.
[0366] Provision 148. A pharmaceutically composition comprising the humanised antibody or
antibody light chain produced by the method of provision 143 a pharmaceutically acceptable
carrier, excipient, or diluent.
[0367] Provision 149. A method for inactivating endogenous IgK-VJ gene segments in a genome
of a non-human vertebrate or cell, the method comprises positioning in the genome
a targeted insert comprising human immunoglobulin gene segments, wherein the targeted
insert is positioned between an endogenous IgK-VJ gene segment and Eκ enhancer sequence
which increases the physical distance between the endogenous IgK-VJ and the Eκ enhancer,
thereby inactivating the endogenous IgK-VJ gene segments.
[0368] Provision 150. The method of provision 149, wherein the non-human vertebrate is a
mouse or rat.
[0369] Provision 150a. The method of provision 148, wherein the vertebrate developed from
a mouse ES cell or a rat ES cell.
[0370] Provision 151. The method of provision 149, wherein the cell is a mouse cell or a
rat cell.
[0371] Provision 152. The method of provision 149, wherein the human immunoglobulin gene
segments comprise human VL and JL gene segments.
[0372] Provision 153. The method of provision 152, wherein human VL and JL gene segments
comprise human Vλ and Jλ gene segments and/or human Vκ and Jκ gene segments.
[0373] Provision 154. A method for obtaining a pool of immunoglobulin light chains wherein
at least 70 or 80% of the immunoglobulin light chains comprise human Vλ and Jλ regions,
the method comprising
providing the vertebrate or cell of provision 1 and
isolating a sample comprising the immunoglobulin light chains.
[0374] Provision 154a. The method of provision 154, further comprising a step of isolating
the immunoglobulin light chains from the sample.
[0375] Provision 154b. The method of provision 154a, wherein the sample is serum, spleen,
thymus, lymph node, or appendix.
[0376] Provision 154c. The method of provision 154b wherein the spleen comprises splenic
tissue containing B-cells.
[0377] Provision 154d. The method of provision 154c, further comprising a step of isolating
B-cells from splenic tissue.
[0378] Provision 155. The method of provision 154, wherein the immunoglobulin light chains
are included in antibodies or antibody fragments.
[0379] Provision 156. An antibody or antibody fragment isolated in the method of provision
155.
[0380] Provision 156a. A derivative of the antibody or antibody fragment of provision 156.
[0381] Provision 157. A pharmaceutical composition comprising the antibody or antibody fragment
of provision 156 and a pharmaceutically acceptable carrier, excipient, or diluent.
[0382] Provision 158. The method of provision 154, comprising a step of immunizing the vertebrate
with an antigen before the step of isolating a sample comprising the immunoglobulin
light chains.
[0383] Provision 159. A method for obtaining a pool of immunoglobulin light chains wherein
at least 60% of the immunoglobulin light chains comprise human lambda light chains,
the method comprising
providing the vertebrate or cell of provision 19 and
isolating a sample comprising the immunoglobulin light chains.
[0384] Provision 159a. The method of provision 159, further comprising a step of isolating
the immunoglobulin light chains from the sample.
[0385] Provision 159b. The method of provision 159a, wherein the sample is serum, spleen,
thymus, lymph node, or appendix.
[0386] Provision 159c. The method of provision 159b wherein the spleen comprises splenic
tissue containing B-cells.
[0387] Provision 159d. The method of provision 159c, further comprising a step of isolating
B-cells from splenic tissue.
[0388] Provision 160. The method of provision 159, wherein the immunoglobulin light chains
are included in antibodies or antibody fragments.
[0389] Provision 161. An antibody or antibody fragment isolated in the method of provision
160.
[0390] Provision 161a. A derivative of the antibody or antibody fragment of provision 161.
[0391] Provision 162. A pharmaceutical composition comprising the antibody or antibody fragment
of provision 161 and a pharmaceutically acceptable carrier, excipient, or diluent.
[0392] Provision 163. The method of provision 159, comprising a step of immunizing the vertebrate
with an antigen before the step of isolating a sample comprising the immunoglobulin
light chains.
[0393] Provision 164. A method for expressing human immunoglobulin VJC light chains in a
non-human vertebrate, the method comprising
providing the vertebrate or cell of provision 40 and
isolating a sample comprising the immunoglobulin VJC light chains.
[0394] Provision 164a. The method of provision 164, wherein the non-human vertebrate develops
from an ES cell.
[0395] Provision 164a. The method of provision 164, further comprising a step of isolating
the immunoglobulin light chains from the sample.
[0396] Provision 164b. The method of provision 164a, wherein the sample is serum, spleen,
thymus, lymph node, or appendix.
[0397] Provision 164c. The method of provision 164b wherein the spleen comprises splenic
tissue containing B-cells.
[0398] Provision 164d. The method of provision 164c, further comprising a step of isolating
B-cells from splenic tissue.
[0399] Provision 165. The method of provision 164, wherein the immunoglobulin VJC light
chains are included in antibodies or antibody fragments.
[0400] Provision 166. An antibody or antibody fragment isolated in the method of provision
165.
[0401] Provision 166a. A derivative of the antibody or antibody fragment of provision 166.
[0402] Provision 167. A pharmaceutical composition comprising the antibody or antibody fragment
of provision 166 and a pharmaceutically acceptable carrier, excipient, or diluent.
[0403] Provision 168. The method of provision 164, comprising a step of immunizing the vertebrate
with an antigen before the step of isolating a sample comprising the immunoglobulin
VJC light chains.
[0404] Provision 169. The method of provision 164, wherein the vertebrate developed from
a mouse ES cell or a rat ES cell.
[0405] Provision 39N. A non-human vertebrate having a genome comprising a recombinant immunoglobulin
light chain locus, said locus comprising a targeted insert positioned in an endogenous
light chain locus,
wherein the targeted insert comprises human lambda light chain locus DNA and is positioned
upstream to a lambda light chain constant region,
wherein said targeted insert includes a repertoire of human Vλ and Jλ gene segments,
wherein the vertebrate expresses immunoglobulin light chains comprising human lambda
variable regions, and
wherein at least 70 or 80% of the immunoglobulin light chains that comprise lambda
variable regions expressed in said vertebrate comprises human lambda variable regions.
[0406] Provision 40N. A non-human vertebrate having a genome comprising a recombinant immunoglobulin
light chain locus, said locus comprising a targeted insert positioned in an endogenous
light chain locus,
wherein the targeted insert comprises human lambda light chain locus DNA which is
positioned upstream to a lambda light chain constant region and includes a repertoire
of human Vλ and Jλ gene segments,
wherein said genome comprises kappa V gene segments positioned upstream to a light
chain constant region,
wherein the vertebrate expresses immunoglobulin light chains comprising lambda variable
regions, and
wherein at least 60% of immunoglobulin light chains expressed by said vertebrate comprises
human lambda variable regions.
[0407] Provision 47N. A method for obtaining a pool of immunoglobulin light chains wherein
at least 70 or 80% of the immunoglobulin light chains comprise human Vλ and Jλ regions,
the method comprising
providing the vertebrate or cell of provision 39N and
isolating a sample comprising the immunoglobulin light chains.
[0408] Provision 48N. A method for obtaining a pool of immunoglobulin light chains wherein
at least 60% of the immunoglobulin light chains comprise human lambda light chains,
the method comprising
providing the vertebrate or cell of provision 40N and
isolating a sample comprising the immunoglobulin light chains.
[0409] Provision 49N. A method for obtaining an immunoglobulin light chain comprising a
human lambda variable region from a pool of immunoglobulin light chains, the method
comprising
providing the vertebrate or cell of provision 40N, thereby providing pool of immunoglobulin
light chains wherein at least 60% of the immunoglobulin light chains comprise human
lambda variable regions and
isolating one or more immunoglobulin light chains from the pool, wherein each isolated
immunoglobulin light chain comprises a human lambda variable region.
[0410] Provision 50N. A method for obtaining an immunoglobulin light chain comprising a
human lambda variable region from a pool of immunoglobulin light chains, the method
comprising
selecting a mouse that expresses immunoglobulin lambda light chains containing human
variable regions,
wherein the mouse comprises a targeted insert positioned upstream to a light chain
constant region,
wherein the targeted insert comprises human immunoglobulin Vλ and Jλ gene segments,
wherein at least 70 or 80% of the immunoglobulin light chains that comprise lambda
variable regions expressed in said vertebrate comprises human lambda variable regions,
wherein endogenous kappa and lambda chain expression is substantially inactive, collecting
serum from said mouse; and
isolating one or more immunoglobulin light chains from the collected serum, wherein
each isolated immunoglobulin light chain comprises a human lambda variable region.
[0411] Provision 51N. A method for obtaining an immunoglobulin light chain comprising a
human lambda variable region from a pool of immunoglobulin light chains, the method
comprising
selecting a mouse that expresses immunoglobulin lambda light chains containing human
variable regions,
wherein the mouse comprises a targeted insert positioned upstream to a light chain
constant region,
wherein the targeted insert comprises human immunoglobulin Vλ and Jλ gene segments,
wherein at least 60% of immunoglobulin light chains expressed by said vertebrate comprises
human lambda variable regions,
wherein endogenous kappa and lambda chain expression is substantially inactive, collecting
serum from said mouse; and
isolating one or more immunoglobulin light chains from the collected serum, wherein
each isolated immunoglobulin light chain comprises a human lambda variable region.
[0412] Provision 52N. A method for obtaining an immunoglobulin light chain comprising a
human lambda variable region from a pool of immunoglobulin light chains, the method
comprising
selecting a mouse that expresses immunoglobulin lambda light chains containing human
variable regions,
wherein the mouse comprises a targeted insert positioned upstream to a light chain
constant region,
wherein the targeted insert comprises human immunoglobulin Vλ and Jλ gene segments,
wherein at least 70 or 80% of the immunoglobulin light chains chains that comprise
lambda variable regions expressed in said vertebrate comprises human lambda variable
regions,
wherein at least 60% of immunoglobulin light chainsexpressed by said vertebrate comprises
human lambda variable regions,
wherein endogenous kappa and lambda chain expression is substantially inactive, collecting
serum from said mouse; and
isolating one or more immunoglobulin light chains from the collected serum, wherein
each isolated immunoglobulin light chain comprises a human lambda variable region.
Non-Human Vertebrates Expressing Kappa & Lambda Variable Regions
(i) K and L Chains Produced in Human-Like Ratios
[0413] The invention is useful for producing light chains that are not skewed to non-human-like
ratios. For example, in mice kappa-type light chains predominate by far over lambda-type
light chains (typically of the order of 95% kappa light chains : 5% lambda light chains
in a wild-type mouse). Humans, on the other hand, typically display around 60% kappa
: around 40% lambda. Thus, lambda expression is much higher than found in a mouse.
It would be desirable to provide a non-human vertebrate, such as a mouse or a rat,
in which a higher proportion of lambda-type light chains can be expressed. This is
useful when the vertebrate expresses light chains bearing human lambda variable regions
and other light chains bearing human kappa variable regions. To this end, the inventors
have demonstrated for the first time such a vertebrate that expresses elevated lambda
light chains, and thus the invention provides the use set out in the claims. The disclosure
further provides:-
[0414] A non-human vertebrate (eg, a mouse or rat) whose genome comprises an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments provided by
insertion into an endogenous light chain locus of the vertebrate upstream of a constant
region, the genome comprising human Vκ and Jκ gene segments provided by insertion
into an endogenous light chain locus of the vertebrate upstream of a constant region,
wherein the vertebrate expresses immunoglobulin light chains comprising kappa light
chain variable regions and immunoglobulin light chains comprising lambda light chain
variable regions, wherein more than 20% of the light chains expressed by the vertebrate
comprise lambda variable regions (eg, as determined by FACS of splenic B cells).
[0415] The remaining light chains express kappa variable regions.
[0416] WO03047336 teaches the desirability of producing human-like kappa:lambda ratios, but this does
not provide an enabled or plausible disclosure of how to achieve this.
(ii) K and L Chains Produced with Normal B-Cell Compartments
[0417] The inventors have successfully generated non-human vertebrates containing targeted
insertion of human V and J lambda gene segments to enable expression of light chains
comprising human lambda variable regions by normal (ie, comparable to wild-type vertebrate)
B-cell compartments. Thus, the inventors have provided such vertebrates that can usefully
produce such light chains with good repertoires and more reliably than prior art transgenic
non-human vertebrates that display comprised B-cell compartments of reduced size and
maturity, and indeed which may not even produce light chains having human lambda variable
regions. Thus, the disclosure provides:-
[0418] A non-human vertebrate (eg, a mouse or rat) whose genome comprises an Ig gene segment
repertoire produced by targeted insertion of human Ig gene segments into one or more
endogenous Ig loci, the genome comprising human Vλ and Jλ gene segments provided by
insertion into an endogenous light chain locus of the vertebrate upstream of a constant
region, the genome comprising human Vκ and Jκ gene segments provided by insertion
into an endogenous light chain locus of the vertebrate upstream of a constant region,
wherein the vertebrate expresses immunoglobulin light chains comprising kappa light
chain variable regions and immunoglobulin light chains comprising lambda light chain
variable regions, and wherein the vertebrate produces a normal proportion or percentage
of mature splenic B-cells (eg, as determined by FACS of splenic B cells).
With regard to non-human vertebrates (i) and (ii), the following embodiments are contemplated
(unless specified, each embodiment applies to (i) or (ii)):-
In an embodiment, the human Vλ and Jλ insertion comprises at least the functional
human V and J gene segments comprised by a human lambda chain Ig locus from Vλ-27
to Cλ7. The human Vλ and Jλ insertion comprises at least human V gene segments Vλ3-27,
Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10,
Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1.
[0419] In an aspect, the human Vλ and Jλ insertion comprises one, more or all of human gene
segments Jλ1, Jλ2, Jλ3, Jλ6 and Jλ7. The human Vλ and Jλ insertion comprises an insertion
of a human Jλ-Cλ cluster, wherein the cluster comprises the J and C gene segments
from Jλ1 to Cλ7. The human Vλ and Jλ insertion comprises an insertion of a human Eλ
enhancer. For example, the Eλ enhancer is provided in germline configuration with
respect to a human Jλ7 that is also comprised by the insertion. For example, the Eλ
enhancer is provided in germline configuration with respect to a human Jλ-Cλ cluster
that is also comprised by the insertion, wherein the cluster comprises Jλ1 to Cλ7
in human germline configuration. In a human germline configuration the Eλ enhancer
is 3' of the Jλ-Cλ cluster.
In an embodiment or vertebrate (i) or (ii), the human Vλ and Jλ insertion is provided
by an insertion of a sequence corresponding to coordinates 22886217 to 23327884 of
human chromosome 22.
In an embodiment or vertebrate (ii), the human Vλ and Jλ insertion is provided by
an insertion of a sequence corresponding to coordinates 23064876 to 23327884 of human
chromosome 22.
[0420] In an embodiment, the human Vκ and Jκ insertion comprises at least the functional
human V and J gene segments comprised by a human kappa chain Ig locus from Vκ1-33
to Jκ5.
[0421] In an aspect, the human Vκ and Jκ insertion comprises at least human V gene segments
Vκ1-33, Vκ2-30, Vκ2-29, Vκ2-28, Vκ1-27, Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13,
Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2 and Vκ4-1.
[0422] In an aspect, the human Vκ and Jκ insertion comprises one, more or all of human J
gene segments Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5.
In an embodiment, more than 30, 35, 40, 45 or 50% of the light chains expressed by
the vertebrate comprise lambda variable regions.
[0423] In an aspect,
from 20 to 40, 45 or 50% of the light chains expressed by the vertebrate comprise
lambda variable regions. In an embodiment, from 30 to 40, 45 or 50% of the light chains
expressed by the vertebrate comprise lambda variable regions. The
kappa light chain variable regions are human kappa light chain variable regions. The
human Vκ and Jκ gene segments are in an endogenous kappa light chain locus of the
vertebrate upstream of a kappa constant region. The
human Vλ and Jλ gene segments are in an endogenous kappa light chain locus of the
vertebrate.
[0424] In an aspect,
the human Vλ and Jλ gene segments are in an endogenous lambda light chain locus of
the vertebrate.
[0425] The
vertebrate expresses light chains comprising human kappa variable regions and expresses
light chains comprising human lambda variable regions. In an example, endogenous (non-human
vertebrate) kappa chain expression is substantially inactive or is inactive and/or
endogenous (non-human vertebrate) lambda chain expression is substantially inactive
or is inactive. Where the vertebrate is a mouse, mouse lambda chain expression is
typically very low (around 5% or less) and in this case it may not be necessary to
engineer the mouse genome to further inactivate endogenous lambda chain expression.
Thus, where the vertebrate is s mouse, endogenous kappa chain expression is substantially
inactive or is inactive and mouse lambda chain expression is 5% or less of all light
chain expression.
In an embodiment, the vertebrate produces a normal proportion or percentage of mature
splenic B-cells. For example, this can be determined by FACS of splenic B cells isolated
from the vertebrate.
In an embodiment, the vertebrate produces a normal ratio of T1, T2 and mature splenic
B-cells. For example, this can be determined by FACS of splenic B cells isolated from
the vertebrate.
[0426] In an aspect, at least 40, 50, 60 or 70 % of total splenic B-cells produced by the
vertebrate are mature B-cells. For example, this can be determined by FACS of splenic
B cells isolated from the vertebrate.
The following definitions apply to any configuration, aspect, provision, clause, attribute,
example or embodiment of the invention or disclosure.
[0427] "Derived from" is used in the ordinary sense of the term. Exemplary synonyms include
"produced as", "resulting from", "received from", "obtained from", "a product of",
"consequence of", and "modified from" For example, a human variable region of a heavy
chain can be derived from recombination of human VH, D and JH gene segments and this
reflects the
in vivo recombination of these gene segments in, for example, a transgenic heavy chain locus
according to the disclosure with any accompanying mutation (eg, junctional mutation).
Samples from which B-cells can be obtained include but are not limited to blood, serum,
spleen, splenic tissue, bone marrow, lymph, lymph node, thymus, and appendix. Antibodies
and immunoglobulin chains can be obtained form each of the previous-mentioned samples
and also from the following non-limiting list of B-cells, ascites fluid, hybridomas,
and cell cultures.
[0428] "Plurality" is used in the ordinary sense of the term and means "at least one" or
"more than one".
[0429] The term "germline configuration" refers to a germline genomic configuration. For
example, human immunoglobulin gene segments of a transgenic immunoglobulin locus are
in a germline configuration when the relative order of the gene segments is the same
as the order of corresponding gene segments in a human germline genome. For example,
when the transgenic locus is a heavy chain locus of the disclosure comprising hypothetical
human immunoglobulin gene segments A, B and C, these would be provided in this order
(5' to 3' in the locus) when the corresponding gene segments of a human germline genome
comprises the arrangement 5'-A-B-C-3'. In an example, when elements of a human immunoglobulin
locus (eg, gene segments, enhancers or other regulatory elements) are provided in
a transgenic immunoglobulin locus according to the disclosure, the human Ig locus
elements are in germline configuration when when the relative order of the gene segments
is the same as the order of corresponding gene segments in a human germline genome
and human sequences between the elements are included, these corresponding to such
sequences between corresponding elements in the human germline genome. Thus, in a
hypothetical example the transgenic locus comprises human elements in the arrangement
5'-A-S1-B-S2-C-S3-3', wherein A, B and C are human immunoglobulin gene segments and
S1-S3 are human inter-gene segment sequences, wherein the corresponding arrangement
5'-A-S1-B-S2-C-S3-3' is present in a human germline genome. For example, this can
be achieved by providing in a transgenic immunoglobulin locus of the disclosure a
DNA insert corresponding to the DNA sequence from A to C in a human germline genome
(or the insert comprising the DNA sequence from A to C). The arrangements in human
germline genomes and immunoglobulin loci are known in the art (eg, see the IMGT at
the World Wide Web (see above), Kabat and other antibody resources referenced herein).
[0430] The term "antibody" includes monoclonal antibodies (including full length antibodies
which have an immunoglobulin Fc region), antibody compositions with polyepitopic specificity,
multispecific antibodies (e.g., bispecific antibodies, diabodies, and single-chain
molecules, as well as antibody fragments (e.g., dAb, Fab, F(ab')2, and Fv). The term
"antibody" also includes H2 antibodies that comprise a dimer of a heavy chain (5'-
VH-(optional Hinge)-CH2-CH3-3') and are devoid of a light chain (akin to naturalluy-occurring
H2 antibodies; see, eg,
Nature. 1993 Jun 3;363(6428):446-8; Naturally occurring antibodies devoid of light chains; Hamers-Casterman C, Atarhouch
T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R). Thus, in
an aspect of the present disclosure, RNA produced from the transgenic heavy chain
locus encodes for heavy chains that are devoid of a CH1 gene segment and comprise
no functional antibody light chain. In an example, RNA produced from the transgenic
heavy chain locus encodes for VH single variable domains (dAbs; domain antibodies).
These can optionally comprise a constant region.
The term "immunoglobulin" (Ig) is used interchangeably with "antibody" herein.
An "isolated" antibody is one that has been identified, separated and/or recovered
from a component of its production environment (e.g., naturally or recombinantly).
Preferably, the isolated polypeptide is free of association with all other components
from its production environment, eg, so that the antibody has been isolated to an
FDA-approvable or approved standard. Contaminant components of its production environment,
such as that resulting from recombinant transfected cells, are materials that would
typically interfere with research, diagnostic or therapeutic uses for the antibody,
and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
In preferred aspects, the polypeptide will be purified: (1) to greater than 95% by
weight of antibody as determined by, for example, the Lowry method, and in some aspects,
to greater than 99% by weight;
(2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal
amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by
SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably,
silver stain. Isolated antibody includes the antibody in situ within recombinant cells
since at least one component of the antibody's natural environment will not be present.
Ordinarily, however, an isolated polypeptide or antibody will be prepared by at least
one purification step.
An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen
binding and/or the variable region of the intact antibody. Examples of antibody fragments
include dAb, Fab, Fab', F(ab')2 and Fv fragments; diabodies; linear antibodies; single-chain
antibody molecules and multispecific antibodies formed from antibody fragments.
[0431] An antibody that "specifically binds to" or is "specific for" a particular polypeptide,
antigen, or epitope is one that binds to that particular polypeptide, antigen, or
epitope without substantially binding to other polypeptides, antigens or epitopes.
For example, binding to the antigen or epitope is specific when the antibody binds
with a K
D of 100 µM or less, 10 µM or less, 1 µM or less, 100 nM or less, eg, 10 nM or less,
1 nM or less, 500 pM or less, 100 pM or less, or 10pM or less. The binding affinity
(K
D) can be determined using standard procedures as will be known by the skilled person,
eg, binding in ELISA and/or affinity determination using surface plasmon resonance
(eg, Biacore™ or KinExA™ solution phase affinity measurement which can detect down
to fM affinities (Sapidyne Instruments, Idaho)). "Pharmaceutically acceptable" refers
to approved or approvable by a regulatory agency of the USA Federal or a state government
or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for
use in animals, including humans. A "pharmaceutically acceptable carrier, excipient,
or adjuvant" refers to an carrier, excipient, or adjuvant that can be administered
to a subject, together with an agent, e.g., any antibody or antibody chain described
herein, and which does not destroy the pharmacological activity thereof and is nontoxic
when administered in doses sufficient to deliver a therapeutic amount of the agent.
Brief Description of the Figures
[0432]
Figs 1 - 8 show an iterative process for insertion of a series of human BACs into
a mouse Ig locus
Figs 9 - 18 show in more detail the process of figures 1-8 for the IgH and kappa locus
Figs 19 and 20 show the principles behind antibody generation in chimaeric mice
Fig 21 shows a possible insertion site for the human DNA in a mouse chromosome
Figs 22 - 26 disclose an alternative iterative process for insertion of a series of
human BACs into a mouse Ig locus
Figs 27 - 29 illustrate a mechanism for inversion of the host VDJ region
Fig 30 illustrates proof of principle for insertion of a plasmid using an RMCE approach
Fig 31 illustrates sequential RMCE - Integration into Landing Pad
Fig 32 illustrates confirmation of Successful Insertion into Landing Pad
Fig 33 illustrates PCR Confirmation of 3' End Curing
Fig 34 illustrates insertion of BAC#1 and PCR Diagnostics
Fig 35 illustrates JH and JK usage
Fig 36 illustrates DH usage
Fig 37 illustrates the distribution of CDR-H3 length in human VDJCµ transcripts from
chimera mice
Fig 38 illustrates the distribution of nucleotide numbers of deletion and insertion
in IGH-VDI or IGK-VJ junctions
Fig 39 illustrates Distribution of JH Usage Within Each VHs
Fig 40 illustrates Distribution of DH Usage Within Each VHs
Fig 41 illustrates Nucleotide Gain or Loss at VJ Joints Generates IGK Variants
Fig 42 illustrates Hypermutaion in J Regions Generates IGK Variants
Fig 43 illustrates Joint Diversity Produces Functional CDS
Fig 44 illustrates a plot of identity of JH gene segment use a 5'-RACE Cµ-specific library generated from the splenic B lymphocytes
of transgenic mice according to the disclosure in which endogenous gene segment use
has been inactivated by inversion
Fig 45 illustrates the ratio of mouse VH to human VH usage as determined from antibody sequences from splenic B lymphocytes of transgenic
mice according to the disclosure in which endogenous gene segment use has been inactivated
by inversion
Fig 46 illustrates inversion strategy schematic
Fig 47 illustrates targeting construct R57 for inversion
Fig 48 illustrates sequence analysis from a Cµ-specific 5'-RACE library of splenic
B lymphocytes of S1inv1 (one human IGH BAC (ie, multiple human VH, all functional human D and JH) with an
inverted endogenous IGH locus) mouse shows that practically all the transcripts came
from rearranged human VH-D-JH gene segments
Fig 49 illustrates that the S1inv1 mouse shows a similar usage of both D and JH gene segments to human
Fig 50 illustrates that mouse VH usage is further significantly reduced following insertion of the 2nd human BAC into the endogenous heavy chain locus
Fig 51 illustrates a gel showing that normal class-switching (to IgG-type) was observed
in transcripts from mice of the disclosure. The rearranged transcripts were detected
using RT-PCR with human VH-specific and mouse Cγ-specific primers for amplification
from peripheral blood cells of immunized transgenic mice
Fig 52 illustrates sequence analysis amplified fragments demonstrate hypermutation
occurred within the human variable regions of these IGγ chains from mice of the disclosure
Fig 53 illustrates Flow cytometric analysis showing normal B-cell compartments in
transgenic mice of the disclosure
Figs 54 & 55 illustrate normal IgH isotypes and serum levels are obtained in transgenic
animals of the disclosure following immunisation with antigens
Fig 56, part 1 illustrates the first and second BACs used for insertion into mouse
endogenous light chain loci. The human DNA in each BAC is shown. Part 2 of figure
56 shows the insertion point of human lambda Ig locus DNA into the mouse endogenous
kappa chain locus. Part 3 of figure 56 shows the insertion point of human lambda Ig
locus DNA into the mouse endogenous lambda chain locus.
Fig 57 shows the results of FACS analysis to determine mouse and human Cλ expression
(and thus correspondingly mouse and human variable region expression) in B220+ splenic B cells from P1 homozygous mice (P1/P1) compared to wild-type mice (WT).
Fig 58A shows the results of FACS analysis to determine mouse Cκ and Cλ expression
in B220+ splenic B cells from P2 homozygous mice (P2/P2) compared to wild-type mice (WT).
No detectable mouse Cκ expression was seen.
Fig 58B shows the results of FACS analysis to determine human Cλ expression (and thus
correspondingly human variable region expression) in B220+ splenic B cells from P2 homozygous mice (P2/P2) compared to wild-type mice (WT).
Fig 59 shows human Vλ usage in P2 homozygous mice (P2/P2) and typical Vλ usage in
humans (inset)
Fig 60 shows human Jλ usage in P2 homozygous mice (P2/P2) and typical Jλ usage in
humans (inset)
Fig 61 shows Vλ usage is very high in P2 homozygous mice (P2/P2).
Fig 62 shows the distribution of mouse Vκ and human Vλ gene segment usage from the
chimaeric kappa locus in P2 homozygous mice (P2/P2).
Fig 63 illustrates RSS arrangement in the lambda and kappa loci.
Fig 64A shows the results of FACS analysis to determine mouse and human Cλ expression
(and thus correspondingly mouse and human variable region expression) in B220+ splenic B cells from L2 homozygous mice in which endogenous kappa chain expression
has been inactivated (L2/L2; KA/KA) compared to mice having no human lambda DNA inserted
and in which endogenous kappa chain expression has been inactivated (KA/KA). Very
high human Vλ usage was seen in the L2/L2; KA/KA) mice, almost to the exclusion of
mouse Vλ use.
Fig 64B: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS
analysis on splenic B-cells from transgenic L2/L2; KA/KA mice (L2 homozygotes; homozygous
for human lambda gene segment insertion into endogenous lambda loci; endogenous kappa
chain expression having been inactivated) compared with splenic B-cells from mice
expressing only mouse antibodies (KA/KA mice). The results show that the splenic B-cell
compartments in the mice of the disclosure are normal (ie, equivalent to the compartments
of mice expressing only mouse antibody chains).
Fig 65: B-cell development and markers in the bone marrow and splenic compartments.
Fig 66A: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS
analysis on splenic B-cells from transgenic S1 F/HA, KA/+ mice of the disclosure expressing
heavy chain variable regions which are all human (where endogenous heavy chain expression
has been inactivated by inversion), compared with splenic B-cells from mice expressing
only mouse antibodies. The results show that the splenic B-cell compartments in the
mice of the disclosure are normal (ie, equivalent to the compartments of mice expressing
only mouse antibody chains).
S1 F/HA, +/KA = (i) S1 F - first endogenous heavy chain allele has one human heavy
chain locus DNA insertion, endogenous mouse VDJ region has been inactivated by inversion
and movement upstream on the chromosome; (ii) HA - second endogenous heavy chain allele
has been inactivated (by insertion of an endogenous interrupting sequence); (iii)
+ - first endogenous kappa allele is a wild-type kappa allele; and (iv) KA - the second
endogenous kappa allele has been inactivated (by insertion of an endogenous interrupting
sequence). This arrangement encodes exclusively for heavy chains from the first endogenous
heavy chain allele.
Fig 66B: Splenic B-Cell Compartment Analysis. This figure shows the results of FACS
analysis on splenic B-cells from transgenic S1 F/HA, K2/KA mice of the disclosure
expressing heavy chain variable regions which are all human (where endogenous heavy
chain expression has been inactivated by inversion) and human kappa chain variable
regions, compared with splenic B-cells from +/HA, K2/KA mice. The results show that
the splenic B-cell compartments in the mice of the disclosure are normal.
S1 F/HA, K2/KA = (i) K2 - the first endogenous kappa allele has two kappa chain locus
DNA insertions between the most 3' endogenous Jκ and the mouse Cκ, providing an insertion
of 14 human Vκ and Jκ1-Jκ5; and (ii) KA - the second endogenous kappa allele has been
inactivated (by insertion of an endogenous interrupting sequence). This arrangement
encodes exclusively for heavy chains comprising human variable regions and substantially
kappa light chains from the first endogenous kappa allele.
+/HA, K2/KA - this arrangement encodes for mouse heavy chains and human kappa chains.
Fig 67A: Bone marrow B progenitor compartment analysis. This figure shows the results
of FACS analysis on bone marrow (BM) B-cells from transgenic S1 F/HA, KA/+ mice of
the disclosure expressing heavy chain variable regions which are all human (where
endogenous heavy chain expression has been inactivated by inversion), compared with
BM B-cells from mice expressing only mouse antibodies. The results show that the BM
B-cell compartments in the mice of the disclosure are normal (ie, equivalent to the
compartments of mice expressing only mouse antibody chains).
Fig 67B: Bone marrow B progenitor compartment analysis. This figure shows the results
of FACS analysis on bone marrow (BM) B-cells from transgenic S1 F/HA, K2/KA mice of
the disclosure expressing heavy chain variable regions which are all human (where
endogenous heavy chain expression has been inactivated by inversion) and human kappa
chain variable regions, compared with BM B-cells from +/HA, K2/KA mice. The results
show that the BM B-cell compartments in the mice of the disclosure are normal.
Fig 68: shows Ig quantification for subtype and total Ig in various mice: S1 F/HA,
KA/+ = (i) S1F - first endogenous heavy chain allele has one human heavy chain locus
DNA insertion, endogenous mouse VDJ region has been inactivated by inversion and movement
upstream on the chromosome; (ii) HA - second endogenous heavy chain allele has been
inactivated (by insertion of an endogenous interrupting sequence); (iii) KA - the
first endogenous kappa allele has been inactivated (by insertion of an endogenous
interrupting sequence); and (iv) + - second endogenous kappa allele is a wild-type
kappa allele. This arrangement encodes exclusively for heavy chains from the first
endogenous heavy chain allele.
S1 F/HA, K2/KA = (i) K2 - the first endogenous kappa allele has two kappa chain locus
DNA insertions between the most 3' endogenous Jκ and the mouse Cκ, providing an insertion
of 14 human Vκ and Jκ1-Jκ5; and (ii) KA - the second endogenous kappa allele has been
inactivated (by insertion of an endogenous interrupting sequence). This arrangement
encodes exclusively for heavy chains comprising human variable regions and substantially
kappa light chains from the first endogenous kappa allele.
+/HA, K2/+ - this arrangement encodes for mouse heavy chains and both mouse and human
kappa chains.
+/HA, +/KA - this arrangement encodes for mouse heavy and kappa chains.
In this figure, "Sum Ig" is the sum of IgG and IgM isotypes.
Fig 69: shows Ig quantification for subtype and total Ig in various mice: S1 F/HA,
K2/KA (n=15) and 12 mice expressing only mouse antibody chains (+/HA, +/KA (n=6) and
wild-type mice (WT; n=6)).
Sequences
[0433]
SEQ ID No 1 is a Rat switch sequence
SEQ ID No 2 is a landing pad targeting vector (long version)
SEQ ID No 3 is a landing pad targeting vector (shorter version)
SEQ ID No 4 is the mouse strain 129 switch
SEQ ID No 5 is the mouse strain C57 switch
SEQ ID No 6 is the 5' homology arm of a landing pad
SEQ ID No 7 is oligo HV2-5
SEQ ID No 8 is oligo HV4-4
SEQ ID No 9 is oligo HV1-3
SEQ ID No 10 is oligo HV1-2
SEQ ID No 11 is oligo HV6-1
SEQ ID No 12 is oligo Cµ
SEQ ID No 13 is oligo KV1-9
SEQ ID No 14 is oligo KV1-8
SEQ ID No 15 is oligo KV1-6
SEQ ID No 16 is oligo KV1-5
SEQ ID No 17 is oligo Cκ
SEQ ID Nos 18 - 20 are rat switch sequences
SEQ ID No 21 is X1X2 T F G Q, where X1X2= PR, RT, or PW
SEQ ID No 22 is X1X2 T F G Q G T K V E I K R A D A, where XiX2= PR, RT, or PW;
SEQ ID No 23 is X3X4 T F G Q, where X3X4= PR or PW
SEQ ID No 24 is X3X4 T F G Q G T K V E I K R A D A, where X3X4= PR or PW
SEQ ID No 25 is Primer E1554
SEQ ID No 26 is Primer E1555
SEQ ID No 27 is Primer ELP1352_Cγ1
SEQ ID No 28 is Primer ELP1353_Cγ2b
SEQ ID No 29 is Primer ELP1354_Cγ2a
SEQ ID No 30 is Primer ELP1356_VH4-4
SEQ ID No 31 is Primer ELP1357_VH1-2,3
SEQ ID No 32 is Primer ELP1358_VH6-1
SEQ ID No 33 is Primer mlgG1_2 rev
SEQ ID No 34 is Primer mlgG2b rev
SEQ ID No 35 is Primer mlgG2a_2 rev
SEQ ID No 36 is Primer mCH1 unirev
SEQ ID No 37 is Primer mCH1 unirev_2
SEQ ID Nos 38-45 are CDRH3 sequences
SEQ ID Nos 46 - 50 is 3, 4, 5, 6 or more (up to 82) repeats of GGGCT
SEQ ID NOs 51 - 55 are heavy chain CDR1 sequences against CTB (cloned and reference)
SEQ ID NOs 56 - 60 are heavy chain CDR2 sequences against CTB (cloned and reference)
SEQ ID NOs 61 - 63 are heavy chain CDR3 sequences against CTB (cloned and reference)
SEQ ID NOs 64 - 68 are J Region sequences against CTB (cloned and reference)
Detailed Description of the Invention
[0434] It will be understood that particular embodiments described herein are shown by way
of illustration and not as limitations of the invention. The principal features of
this invention can be employed in various embodiments without departing from the scope
of the invention. Those skilled in the art will recognize, or be able to ascertain
using no more than routine study, numerous equivalents to the specific procedures
described herein. The use of the word "a" or "an" when used in conjunction with the
term "comprising" in the claims and/or the specification may mean "one," but it is
also consistent with the meaning of "one or more," "at least one," and "one or more
than one." The use of the term "or" in the claims is used to mean "and/or" unless
explicitly indicated to refer to alternatives only or the alternatives are mutually
exclusive, although the disclosure supports a definition that refers to only alternatives
and "and/or." Throughout this application, the term "about" is used to indicate that
a value includes the inherent variation of error for the device, the method being
employed to determine the value, or the variation that exists among the study subjects.
As used in this specification and claim(s), the words "comprising" (and any form of
comprising, such as "comprise" and "comprises"), "having" (and any form of having,
such as "have" and "has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as "contains" and
"contain") are inclusive or open-ended and do not exclude additional, unrecited elements
or method steps
The term "or combinations thereof" as used herein refers to all permutations and combinations
of the listed items preceding the term. For example, "A, B, C, or combinations thereof
is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order
is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB.
Continuing with this example, expressly included are combinations that contain repeats
of one or more item or term, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, CABABB, and
so forth. The skilled artisan will understand that typically there is no limit on
the number of items or terms in any combination, unless otherwise apparent from the
context.
[0435] As a source of antibody gene segment sequences, the skilled person will also be aware
of the following available databases and resources (including updates thereof):
[0436] The Kabat Database (G. Johnson and T. T.Wu, 2002; World Wide Web (
www) kabatdatabase.com). Created by E. A. Kabat and T. T. Wu in 1966, the Kabat database
publishes aligned sequences of antibodies, T-cell receptors, major histocompatibility
complex (MHC) class I and II molecules, and other proteins of immunological interest.
A searchable interface is provided by the Seqhuntll
tool, and a range of utilities is available for sequence alignment, sequence subgroup
classification, and the generation of variability plots. See also
Kabat, E. A.,Wu, T. T., Perry, H., Gottesman, K., and Foeller, C. (1991) Sequences
of Proteins of Immunological Interest, 5th ed., NIH Publication No. 91-3242, Bethesda,
MD, in particular with reference to human gene segments for use in the present invention.
[0437] KabatMan (A. C. R. Martin, 2002; World Wide Web (
www) bioinf.org.uk/abs/simkab.html). This is a web interface to make simple queries to
the Kabat sequence database.
[0438] IMGT (the International ImMunoGeneTics Information System®; M.-P. Lefranc, 2002; World
Wide Web (
www) imgt.cines.fr). IMGT is an integrated information system that specializes in antibodies,
T cell receptors, and MHC molecules of all vertebrate species. It provides a common
portal to standardized data that include nucleotide and protein sequences, oligonucleotide
primers, gene maps, genetic polymorphisms, specificities, and two-dimensional (2D)
and three-dimensional (3D) structures. IMGT includes three sequence databases
(IMGT/
LIGM-DB, IMGT/
MHC-DB, IMGT/
PRIMERDB), one genome database
(IMGT/
GENE-DB), one 3D structure database
(IMGT/
3Dstructure-DB), and a range of web resources ("
IMGT Marie-Paule page") and interactive tools.
[0439] V-BASE (I. M. Tomlinson, 2002; World Wide Web (
www) mrc-cpe.cam.ac.uk/vbase). V-BASE is a comprehensive directory of all human antibody
germline variable region sequences compiled from more than one thousand published
sequences. It includes a version of the alignment software DNAPLOT (developed by Hans-Helmar
Althaus and Werner Müller) that allows the assignment of rearranged antibody V genes
to their closest germline gene segments.
[0440] Antibodie-Structure and Sequence (A. C. R. Martin, 2002; World Wide Web (
www) bioinf.org.uk/abs). This page summarizes useful information on antibody structure
and sequence. It provides a query interface to the Kabat antibody sequence data, general
information on antibodies, crystal structures, and links to other antibody-related
information. It also distributes an automated summary of all antibody structures deposited
in the Protein Databank (PDB). Of particular interest is a thorough description and
comparison of the various numbering schemes for antibody variable regions.
[0441] AAAAA (A Ho's Amazing Atlas of Antibody Anatomy; A. Honegger, 2001; World Wide Web (
www) unizh.ch/~antibody). This resource includes tools for structural analysis, modeling,
and engineering. It adopts a unifying scheme for comprehensive structural alignment
of antibody and T-cell-receptor sequences, and includes Excel macros for antibody
analysis and graphical representation.
[0442] WAM (Web Antibody Modeling; N. Whitelegg and A. R. Rees, 2001; World Wide Web (
www) antibody.bath.ac.uk). Hosted by the Centre for Protein Analysis and Design at the
University of Bath, United Kingdom. Based on the AbM package (formerly marketed by
Oxford Molecular) to construct 3D models of antibody Fv sequences using a combination
of established theoretical methods, this site also includes the latest antibody structural
information.
[0443] Mike's Immunoglobulin Structure/Function Page (M. R. Clark, 2001; World Wide Web (
www)
path.cam.ac.uk/
∼mrc7/
mikeimages.html) These pages provide educational materials on immunoglobulin structure and function,
and are illustrated by many colour images, models, and animations. Additional information
is available on antibody humanization and Mike Clark's Therapeutic Antibody Human
Homology Project, which aims to correlate clinical efficacy and anti-immunoglobulin
responses with variable region sequences of therapeutic antibodies.
[0444] The Antibody Resource Page (The Antibody Resource Page, 2000; World Wide Web (
www) antibodyresource.com). This site describes itself as the "complete guide to antibody
research and suppliers." Links to amino acid sequencing tools, nucleotide antibody
sequencing tools, and hybridoma/cell-culture databases are provided.
[0445] Humanization bY Design (J. Saldanha, 2000; World Wide Web (
www) people.cryst.bbk.ac.uk/~ubcg07s). This resource provides an overview on antibody
humanization technology. The most useful feature is a searchable database (by sequence
and text) of more than 40 published humanized antibodies including information on
design issues, framework choice, framework back-mutations, and binding affinity of
the humanized constructs.
[0447] Any part of this disclosure may be read in combination with any other part of the
disclosure, unless otherwise apparent from the context.
[0448] The following examples are put forth so as to provide those of ordinary skill in
the art with a complete disclosure and description of how to make and use the invention,
and are not intended to limit the scope of what the inventors regard as their invention.
Examples
Example 1
BAC Recombineering
[0449] Overall strategy: A mouse model of the disclosure can be achieved by inserting ∼960kb of the human
heavy chain locus containing all the V, D and J-regions upstream of the mouse constant
region and 473kb of the human kappa region upstream of the mouse constant region.
Alternatively, or in tandem, the human lambda region is inserted upstream of the mouse
constant region. This insertion is achieved by gene targeting in ES cells using techniques
well known in the art.
[0450] High fidelity insertion of intact V-D-J regions into each locus in their native (wild-type)
configuration is suitably achieved by insertion of human bacterial artificial chromosomes
(BACs) into the locus. Suitably the BACs are trimmed so that in the final locus no
sequence is duplicated or lost compared to the original. Such trimming can be carried
out by recombineering.
[0451] The relevant human BACs, suitably trimmed covering these loci are on average 90kb
in size.
[0452] In one approach the full complement of human D and J-elements as well as seven or
eight human V-regions are covered by the first BACs to be inserted in the experimental
insertion scheme described below. The first BACs to be inserted in the IgH and IgK
loci may contain the following V-regions. IgH :V6-1, VII-1-1, V1-2, VIII-2-1, V1-3,
V4-4, V2-5 and IgK: V4-1, V5-2, V7-3, V2-4, V1-5, V1-6, V3-7, V1-8.
[0453] Suitably the performance of each locus is assessed after the first BAC insertion
using chimaeric mice and also after each subsequent BAC addition. See below for detailed
description of this performance test.
[0454] Nine additional BAC insertions will be required for the
IgH locus and five for
IgK to provide the full complement of human V-regions covering all 0.96Mb and 0.473Mb
of the
IgH and
IgK loci
, respectively.
[0455] Not all BACs retain their wild-type configuration when inserted into the ES cell
genome. Thus, high density genomic arrays were deployed to screen ES cells to identify
those with intact BAC insertions (
Barrett, M.T., Scheffer, A., Ben-Dor, A., Sampas, N., Lipson, D., Kincaid, R., Tsang,
P., Curry, B., Baird, K., Meltzer, P.S., et al. (2004). Comparative genomic hybridization
using oligonucleotide microarrays and total genomic DNA. Proceedings of the National
Academy of Sciences of the United States of America 101, 17765-17770.).This screen also enables one to identify and select against ES clones in which
the ES cell genome is compromised and thus not able to populate the germ line of chimeric
animals. Other suitable genomic tools to facilitate this assessment include sequencing
and PCR verification.
[0456] Thus in one aspect the correct BAC structure is confirmed before moving to the next
step.
[0457] It is implicit from the description above that in order to completely engineer the
loci with 90kb BACs, it is necessary to perform a minimum of 10 targeting steps for
IgH and 5 steps for the
IgK. Mice with an IgL locus can be generated in a similar manner to the IgK locus. Additional
steps are required to remove the selection markers required to support gene targeting.
Since these manipulations are being performed in ES cells in a step-wise manner, in
one aspect germ line transmission capacity is retained throughout this process.
[0458] Maintaining the performance of the ES cell clones through multiple rounds of manipulation
without the need to test the germ line potential of the ES cell line at every step
may be important in the present disclosure. The cell lines currently in use for the
KOMP and EUCOMM global knockout projects have been modified twice prior to their use
for this project and their germ line transmission rates are unchanged from the parental
cells (these lines are publicly available, see World Wide Web (
www) komp.org and World Wide Web (www) eucomm.org). This cell line, called JM8, can generate
100% ES cell-derived mice under published culture conditions (
Pettitt, S.J., Liang, Q., Rairdan, X.Y., Moran, J.L., Prosser, H.M., Beier, D.R.,
Lloyd, K.C., Bradley, A., and Skarnes, W.C. (2009). Agouti C57BL/6N embryonic stem
cells for mouse genetic resources. Nature Methods.). These cells have demonstrated ability to reproducibly contribute to somatic and
germ line tissue of chimaeric animals using standard mouse ES cell culture conditions.
This capability can be found with cells cultured on a standard feeder cell line (SNL)
and even feeder-free, grown only on gelatine-coated tissue culture plates. One particular
sub-line, JM8A3, maintained the ability to populate the germ line of chimeras after
several serial rounds of sub-cloning. Extensive genetic manipulation via, for example,
homologous recombination - as would be the case in the present disclosure - cannot
compromise the pluripotency of the cells. The ability to generate chimeras with such
high percentage of ES cell-derived tissue has other advantages. First, high levels
of chimerism correlates with germ line transmission potential and provide a surrogate
assay for germ line transmission while only taking 5 to 6 weeks. Second, since these
mice are 100% ES cell derived the engineered loci can be directly tested, removing
the delay caused by breeding. Testing the integrity of the new Ig loci is possible
in the chimera since the host embryo will be derived from animals that are mutant
for the RAG-1 gene as described in the next section.
[0460] RAG-1 complementation: While many clones will generate 100% ES derived mice some will not. Thus, at every
step mice are generated in a RAG-1-deficient background. This provides mice with 100%
ES-derived B- and T-cells which can be used directly for immunization and antibody
production. Cells having a RAG-2 deficient background, or a combined RAG-1/RAG-2 deficient
background may be used, or equivalent mutations in which mice produce only ES cell-derived
B cells and/or T cells.
[0461] In order that only the human-mouse
IgH or
IgK loci are active in these mice, the human-mouse
IgH and
IgK loci can be engineered in a cell line in which one allele of the
IgH or
IgK locus has already been inactivated. Alternatively the inactivation of the host Ig
locus, such as the IgH or IgK locus, can be carried out after insertion.
[0462] Mouse strains that have the RAG-1 gene mutated are immunodeficient as they have no
mature B- or T-lymphocytes (
US 5,859,307). T- and B-lymphocytes only differentiate if proper V(D)J recombination occurs. Since
RAG-1 is an enzyme that is crucial for this recombination, mice lacking RAG-1 are
immunodeficient. If host embryos are genetically RAG-1 homozygous mutant, a chimera
produced by injecting such an embryo will not be able to produce antibodies if the
animal's lymphoid tissues are derived from the host embryo. However, JM8 cells and
AB2.1 cells, for example, generally contribute in excess of 80% of the somatic tissues
of the chimeric animal and would therefore usually populate the lymphoid tissue. JM8
cells have wild-type RAG-1 activity and therefore antibodies produced in the chimeric
animal would be encoded by the engineered JM8 ES cell genome only. Therefore, the
chimeric animal can be challenged with an antigen by immunization and subsequently
produce antibodies to that antigen. This allows one skilled in the art to test the
performance of the engineered human/mouse IgH and IgK loci as described in the present
disclosure. See figures 19 and 20.
[0463] One skilled in the art would use the chimeric animal as described to determine the
extent of antibody diversity (see e.g.
Harlow, E. & Lane, D. 1998, 5th edition, Antibodies: A Laboratory Manual, Cold Spring
Harbor Lab. Press, Plainview, NY). For example, the existence in the chimeric animal's serum of certain antibody epitopes
could be ascertained by binding to specific anti-idiotype antiserum, for example,
in an ELISA assay. One skilled in the art could also sequence the genomes of B-cell
clones derived from the chimeric animal and compare said sequence to wild-type sequence
to ascertain the level of hypermutation, such hypermutation indicative of normal antibody
maturation.
[0464] One skilled in the art would also use said chimeric animal to examine antibody function
wherein said antibodies are encoded from the engineered Ig loci (see e.g.
Harlow, E. & Lane, D. 1998, 5th edition, Antibodies: A Laboratory Manual, Cold Spring
Harbor Lab. Press, Plainview, NY). For example, antisera could be tested for binding an antigen, said antigen used
to immunize the chimeric animal. Such a measurement could be made by an ELISA assay.
Alternatively, one skilled in the art could test for neutralization of the antigen
by addition of the antisera collected from the appropriately immunized chimeric animal.
[0465] It is well known to those skilled in the art that positive outcomes for any of these
tests demonstrate the ability of the engineered Ig loci, the subject of the instant
disclosure, to encode antibodies with human variable regions and mouse constant regions,
said antibodies capable of functioning in the manner of wild-type antibodies.
[0466] Experimental Techniques: Recombineering for the production of vectors for use in homologous recombination
in ES cells is disclosed in, for example,
WO9929837 and
WO0104288, and the techniques are well known in the art. In one aspect the recombineering of
the human DNA takes place using BACs as a source of said human DNA. Human BAC DNA
will be isolated using QIAGEN®, BAC purification kit. The backbone of each human BAC
will be modified using recombineering to the exact same or similar configuration as
the BAC already inserted into the mouse IgH region. The genomic insert of each human
BAC will be trimmed using recombineering so that once the BACs are inserted, a seamless
contiguous part of the human V(D)J genomic region will form at the mouse IgH or IgK
locus. BAC DNA transfection by electroporation and genotyping will be performed accordingly
to standard protocols (
Prosser, H.M., Rzadzinska, A.K., Steel, K.P., and Bradley, A. (2008). "Mosaic complementation
demonstrates a regulatory role for myosin VIIa in actin dynamics of stereocilia."
Molecular and Cellular Biology 28, 1702-1712;
Ramirez-Solis, R., Davis, A.C., and Bradley, A. (1993). "Gene targeting in embryonic
stem cells." Methods in Enzymology 225, 855-878.). Recombineering will be performed using the procedures and reagents developed by
Pentao Liu and Don Court's laboratories (
Chan, W., Costantino, N., Li, R., Lee, S.C., Su, Q., Melvin, D., Court, D.L., and
Liu, P. (2007). "A recombineering based approach for high-throughput conditional knockout
targeting vector construction." Nucleic Acids Research 35, e64).
[0467] These and other techniques for gene targeting and recombination of BAC-derived chromosomal
fragments into a non-human mammal genome, such as a mouse are well-known in the art
and are disclosed in, for example, in World Wide Web (
www) eucomm.org/information/targeting and World Wide Web (
www) eucomm.org/information/publications.
[0468] Cell culture of C57BL/6N-derived cell lines, such as the JM8 male ES cells will follow
standard techniques. The JM8 ES cells have been shown to be competent in extensively
contributing to somatic tissues and to the germline, and are being used for large
mouse mutagenesis programs at the Sanger Institute such as EUCOMM and KOMP (
Pettitt, S.J., Liang, Q., Rairdan, X.Y., Moran, J.L., Prosser, H.M., Beier, D.R.,
Lloyd, K.C., Bradley, A., and Skarnes, W.C. (2009). "Agouti C57BL/6N embryonic stem
cells for mouse genetic resources." Nature Methods.). JM8 ES cells (1.0X10
7) will be electroporated (500µF, 230V; Bio-Rad®) with 10µg I-Scel linearized human
BAC DNA. The transfectants will be selected with either Puromycin (3µg/ml) or G418
(150µg/ml). The selection will begin either 24 hours (with G418) or 48 hours (with
Puromycin) post electroporation and proceed for 5 days. 10µg linearized human BAC
DNA can yield up to 500 Puromycin or G418 resistant ES cell colonies. The antibiotic
resistant ES cell colonies will be picked into 96-well cell culture plates for genotyping
to identify the targeted clones.
[0469] Once targeted mouse ES cell clones are identified, they will be analyzed by array
Comparative Genomic Hybridization (CGH) for total genome integrity (
Chung, Y.J., Jonkers, J., Kitson, H., Fiegler, H., Humphray, S., Scott, C., Hunt,
S., Yu, Y., Nishijima, I., Velds, A., et al. (2004). "A whole-genome mouse BAC microarray
with 1-Mb resolution for analysis of DNA copy number changes by array comparative
genomic hybridization." Genome research 14, 188-196.and
Liang, Q., Conte, N., Skarnes, W.C., and Bradley, A. (2008). "Extensive genomic copy
number variation in embryonic stem cells." Proceedings of the National Academy of
Sciences of the United States of America 105, 17453-17456.). ES cells that have abnormal genomes do not contribute to the germline of the chimeric
mice efficiently. BAC integrity will be examined by PCR-amplifying each known functional
V gene in the BAC. For example, in one approach the first human BAC chosen for the
IgH locus has 6 functional V genes. To confirm the integrity of this BAC for the presence
of these 6 IGH V genes, at least 14 pairs of PCR primers will be designed and used
to PCR-amplify genomic DNA from the targeted ES cells. The human wild-type size and
sequence of these fragments will ensure that the inserted BAC has not been rearranged.
[0470] More detailed CGH will also confirm the integrity of the inserted BACs. For example,
one skilled in the art could use an oligo aCGH platform, which is developed by Agilent
Technologies, Inc. This platform not only enables one to study genome-wide DNA copy
number variation at high resolution (
Barrett, M.T., Scheffer, A., Ben-Dor, A., Sampas, N., Lipson, D., Kincaid, R., Tsang,
P., Curry, B., Baird, K., Meltzer, P.S., et al. (2004). "Comparative genomic hybridization
using oligonucleotide microarrays and total genomic DNA." Proceedings of the National
Academy of Sciences of the United States of America 101, 17765-17770.), but permit examination of a specific genome region using custom designed arrays.
Comparing the traditional aCGH techniques which rely on cDNA probes or whole BAC probes,
the 60-mer oligonucleotides probes can ensure specific hybridization and high sensitivity
and precision that is needed in order to detect the engineered chromosome alterations
that were made. For example, oligos designed to hybridize at regular intervals along
the entire length of the inserted BAC would detect even quite short deletions, insertions
or other rearrangements. Also, this platform provides the greatest flexibility for
customized microarray designs. The targeted ES cell genomic DNA and normal human individual
genomic DNA will be labelled separately with dyes and hybridized to the array. Arrays
slides will be scanned using an Aglient Technologies DNA microarray scanner. Reciprocal
fluorescence intensities of dye Cy5 and dye Cy3 on each array image and the log2 ratio
values will be extracted by using Bluefuse software (Bluegnome). Spots with inconsistent
fluorescence patterns ("confidence" < 0.29 or "quality" = 0) will be excluded before
normalizing all log2 ratio values. Within an experiment, Log2 ratio between -0.29
and +0.29 for the signal from any oligo probe are regarded as no copy number change.
The log2 ratio threshold for "Duplication" is usually >0.29999, and for deletion is
<0.29999.
[0471] Once the first human BAC is inserted into the mouse IgH locus and confirmed to be
in its intact, native configuration, the FRT-flanked BAC backbone will be excised
by using Flp site-specific recombinase. If regular Flp-catalyzed FRT recombination
is not high enough, one can use Flo, an improved version of Flpo recombinase which
in certain tests is 3-4 times more efficient than the original Flp in ES cells. After
the BAC backbone is excised, ES cells will become sensitive to Puromycin (or G418)
and resistant to FIAU (for loss of the TK cassette). The excision events will be further
characterized by PCR amplification of the junction fragment using human genomic DNA
primers. These FRT-flanked BAC backbone-free ES cells will be used for the next round
of human BAC insertion and for blastocyst injection.
[0472] Targeting of the genome of an ES cell to produce a transgenic mouse may be carried
out using a protocol as explained by reference to the attached figures 1- 18.
[0473] Figure 1 illustrates three basic backbone vectors; an initiating cassette and 2 large
insert vectors 1 and 2 respectively. The initiating cassette comprises sequences homologous
to the desired site of insertion into the mouse genome, those sites flanking a selectable
marker and stuffer primer sequence for PCR based genotyping to confirm correct insertion
of BACs. The Stuffer-primer sequence provides the basis for genotyping each BAC addition
step. This sequence is considered to provide a robust well validated sequence template
for PCR primer and may be located at the IScel site, ideally ∼1 kb from the BAC insert.
[0474] The large insert vectors comprise human DNA on plasmids with selectable markers and
a unique restriction site for linearisation of the plasmid to aid in homologous recombination
into the genome of the ES cell.
[0475] Figure 2 illustrates insertion of an initiating cassette into the mouse genome by
Homologous recombination between the mouse J4 and C alpha exons. Puromycin selection
allows identification of ES cells with insertion of the cassette. pu(Delta)tk is a
bifunctional fusion protein between puromycin N-acetyltransferase (Puro) and a truncated
version of herpes simplex virus type 1 thymidine kinase (DeltaTk). Murine embryonic
stem (ES) cells transfected with pu(Delta)tk become resistant to puromycin and sensitive
to 1-(-2-deoxy-2-fluoro-1-beta-D-arabino-furanosyl)-5-iodouracil (FIAU). Unlike other
HSV1 tk transgenes, puDeltatk is readily transmitted through the male germ line. Thus
pu(Delta)tk is a convenient positive/negative selectable marker that can be widely
used in many ES cell applications.
[0476] Figure 3 illustrates targeting of the large insert vector 1 to the mouse ES cell
genome. Linearisation of the vector is made at the same position as the stuffer primer
sequence which allows for a gap repair genotyping strategy, well known in the art
- see
Zheng et al NAR 1999, Vol 27, 11, 2354 - 2360. In essence, random insertion of the targeting vector into the genome will not 'repair'
the gap whereas a homologous recombination event will repair the gap. Juxtaposition
of appropriate PCR primer sequences allows colonies to be screened individually for
a positive PCR fragment indicating proper insertion. Positive selection using G418
allows for identification of mouse ES cells containing the neo selection marker. PCR
verification can be made of all critical V, D and J regions. Array comparative genomic
hybridization can be used to validate the BAC structure.
[0477] Figure 4 illustrates the
puro-delta-tk cassette and the BAC plasmid backbone is deleted using Flpe and select in FIAU. Since
Flpe works inefficiently in mouse ES cells (5% deletion with transient Flpe expression),
it is expected that in most cases, the recombination occurs between the two FRT sites
flanking the BAC backbone. Flpo can also be tested to find out the recombination efficiency
between two FRT sites that are 10kb away.
[0478] Given that the FRT deletion step is selectable it is possible to pool FIAU resistant
clones and proceed immediately to the next step in parallel with clonal analysis.
Alternatively it may be desirable to show by short range PCR that the human sequences
are now adjacent to those of the mouse as shown (Hu-primer 1 and Mo-primer)
[0479] At this stage a 200kb human locus will have been inserted.
[0480] Figure 5 illustrates a second large insert vector is targeted into the ES cell chromosome.
The human BAC is targeted to the mouse IgH locus using the same initiation cassette
insertion followed by
ISce1 BAC linearization, BAC targeting to the initiation cassette and gap-repair genotyping
strategy. Verification of the BAC insertion is carried out as before.
[0481] Figure 6 illustrates the FRTY flanked BAC backbone of large insert vector 2 and the
neo marker are deleted via
Flpo. Note that this is not selectable, thus it will be necessary for clonal analysis at
this point. This will enable confirmation of the juxtaposition of the human 2 insert
with human 1 and other validation efforts.
[0482] At this stage a ∼ 200kb human locus will have been inserted.
[0483] Figure 7 illustrates the next large insert vector targeted to the mouse IgH locus.
The pu-delta TK cassette is then removed, as for figure 4. The process can be repeated
to incorporate other BACs.
[0484] Figure 8 illustrates the final predicted ES cell construct.
[0485] Figures 9 - 18 provide a further level of detail of this process.
Example 2
Site-Specific Recombination
[0486] In a further method of the disclosure site specific recombination can also be employed.
Site-specific recombination (SSR) has been widely used in the last 20-years for the
integration of transgenes into defined chromosomal loci. SSR involves recombination
between homologous DNA sequences.
[0488] The largest insert size of a BAC is about 300-kb and therefore this places an upper
limit on cassette size for RMCE.
[0489] In the present disclosure a new SSR-based technique called sequential RMCE (SRMCE)
was used, which allows continuous insertion of BAC inserts into the same locus.
[0490] The method comprises the steps of
- 1 insertion of DNA forming an initiation cassette (also called a landing pad herein)
into the genome of a cell;
- 2 insertion of a first DNA fragment into the insertion site, the first DNA fragment
comprising a first portion of a human DNA and a first vector portion containing a
first selectable marker or generating a selectable marker upon insertion;
- 3 removal of part of the vector DNA;
- 4 insertion of a second DNA fragment into the vector portion of the first DNA fragment,
the second DNA fragment containing a second portion of human DNA and a second vector
portion, the second vector portion containing a second selectable marker, or generating
a second selectable marker upon insertion;
- 5 removal of any vector DNA to allow the first and second human DNA fragments to form
a contiguous sequence; and
- 6 iteration of the steps of insertion of a part of the human V(D)J DNA and vector
DNA removal, as necessary, to produce a cell with all or part of the human VDJ or
VJ region sufficient to be capable of generating a chimaeric antibody in conjunction
with a host constant region,
wherein the insertion of at least one DNA fragment uses site specific recombination.
[0491] In one specific aspect the approach utilizes three heterospecific and incompatible
loxP sites. The method is comprised of the steps as follows, and illustrated in Figures
22 - 26:
- 1. Targeting a landing pad into the defined locus. An entry vector containing an HPRT mini-gene flanked by inverted piggyBac (PB) ITRs
is targeted into defined region (for example: a region between IGHJ and Eµ or IGKJ
and Eκ or IGLC1 and Eλ3-1) to serve as a landing pad for BAC targeting. The HPRT mini-gene
is comprised of two synthetic exons and associated intron. The 5' HPRT exon is flanked
by two heterospecific and incompatible loxP sites (one wild-type and the other a mutated
site, lox5171) in inverted orientation to each other (Fig 22). These two loxP sites
provide recombination sites for the BAC insertion through RMCE.
- 2. Insertion of the 1st modified BAC into the targeted landing pad. The 1st BAC has a length of DNA to be inserted into the genome flanked by engineered modifications.
The 5' modification (loxP - neo gene - lox2272 - PGK promoter - PB 5'LTR) and 3' modification
(PB3'LTR - puroΔTK gene - lox5171) is depicted in Fig 23 along with the relative orientations
of the lox sites and PB LTRs. With transient CRE expression from a co-electroporated
vector, the DNA sequence would be inserted into the defined locus through RMCE. The
cells in which a correct insertion has occurred can be selected as follows: (i) Puromycin-resistance
(the puroΔTK gene has acquired a promoter - "PGK" - from the landing pad), (ii) 6TG-resistance
(the HPRT mini-gene has been disrupted), and (iii) G418-resistance (selects for any
insertion via the 5' region PGK-neo arrangement). Any combination of these selection
regimes can be used. G418- and 6TG-resistance select for correct events on the 5'
end while puro-resistance selects for correct events on the 3' end.
- 3. Curing (removing) the 3' modification of the 1st insertion. A properly inserted 1st BAC results the 3' end having a puroΔTK gene flanked by inverted PB LTRs (Fig 24)
- essentially a proper transposon structure. This transposon can then be removed by
the transient expression of the piggyBac transposase (from an electroporated vector).
Cells with the correct excision event can be selected by FIAU resistance - ie, no
thymidine kinase activity from the puroΔTK gene. This completely removes the 3' modification
leaving no trace nucleotides.
- 4. Insertion of a 2nd modified BAC into the 5' end of 1st insertion. The 2nd BAC has a length of DNA to be inserted into the genome (usually intended to be contiguous
with the DNA inserted with the 1st BAC) flanked by engineered modifications. The 5' modification (loxP - HPRT mini gene
5' portion - lox5171 - PGK promoter-PB5'LTR) and 3' modification (PB3'LTR - puroΔTK
- lox2272) is depicted in Fig 25 along with the relative orientations of the lox sites
and PB LTRs. With transient CRE expression from a co-electroporated vector, the DNA
sequence would be inserted into the defined locus through RMCE. The cells in which
a correct insertion has occurred can be selected as follows: (i) HAT-resistance (the
HPRT mini-gene is reconstituted by a correct insertion event, ie: the 5' and 3' exon
structures are brought together), and (ii) puromycin-resistance (puroΔTK gene has
acquired a promoter - "PGK" - from the landing pad).
- 5. Curing (removing) the 3' modification of the 2nd insertion. A properly inserted 2nd BAC results the 3' end having a puroΔTK gene flanked by inverted PB LTRs (Fig 26)
- essentially a proper transposon structure, exactly analogous to the consequence
of a successful 1st BAC insertion. And therefore this transposon can likewise be removed by the transient
expression of the piggyBac transposase (from an electroporated vector). Cells with
the correct excision event can be selected by FIAU resistance - ie, no thymidine kinase
activity from the puroΔTK gene. This completely removes the 3' modification leaving
no trace nucleotides.
- 6. After curing of the 3' modification of the 2nd BAC insertion, the landing pad becomes identical to the original. This entire process,
steps 2 through 5, can be repeated multiple times to build up a large insertion into
the genome. When complete, there are no residual nucleotides remaining other than
the desired insertion.
[0492] With the insertion of an odd number of BACs into the Ig loci, the endogenous VDJ
or VJ sequences can be inactivated through an inversion via chromosomal engineering
as follows (see figures 27 - 29):
- 1. Targeting a "flip-over" cassette into a 5' region 10 to 40 megabases away from the
endogenous VDJ or VJ. The flip-over vector (PB3'LTR - PGK promoter - HPRT mini gene 5' portion - loxP -
puroΔTK - CAGGS promoter - PB3'LTR) is depicted in Fig 27 along with the relative
orientations of the lox sites and PB LTRs.
- 2. Transient CRE expression will result in recombination between the loxP site in
the "flip-over" cassette and the loxP site in the 5' modification. This 5' modification
is as described in Steps 2 and 3 above - essentially the modification resulting from
insertion of an odd number of BACs, after the 3' modification has been cured. The
loxP sites are inverted relative to one another and therefore the described recombination
event results in an inversion as depicted in Fig 28. Cells with the correct inversion
will be HAT-resistance since the HPRT mini-gene is reconstituted by a correct inversion.
- 3. A correct inversion also leaves two transposon structures flanking the "flip-over"
cassette and the 5' modification. Both can be excised with transient piggyBAC transposase
expression, leaving no remnant of either modification (Fig 29). Cells with the correct
excisions can be selected as follows: (i) 6TG-resistance (the HPRT mini-gene is deleted)
and (ii) FIAU-resistance (the puroΔTK gene is deleted). An inversion as described
in the Ig loci would move the endogenous IGH-VDJ or IGK-VJ region away from the Eµ
or Eκ enhancer region, respectively, and lead to inactivation of the endogenous IGH-VDJ
or IGK-VJ regions.
[0493] The methods of insertion of the disclosure suitably provide one or more of:
Selection at both 5' and 3' ends of the inserted DNA fragment;
Efficient curing of the 3' modification, preferably by transposase mediated DNA excision;
Inactivation of endogenous IGH or IGK activity through an inversion; and
Excision of modifications, leaving no nucleotide traces remaining in the chromosome.
Example 3 (For illustration only) Insertion of a Test Vector Into the Genome at a
Defined Location
[0494] Proof of concept of the approach is disclosed in Figure 30. In Figure 30 a landing
pad as shown in figure 22 was inserted into the genome of a mouse by homologous recombination,
followed by insertion of the R21 plasmid into that landing pad via cre-mediated site
specific recombination. The insertion event generated a number of general insertion
events, 360 G418 resistant colonies, of which ∼220 were inserted into the desired
locus, as demonstrated by disruption of the HRPT minilocus.
[0495] The R21 vector mimicks the 1
st BAC insertion vector at the 5' and 3' ends, including all selection elements and
recombinase target sites. In place of BAC sequences, there is a small 'stuffer' sequence.
This vector will both test all the principals designed in the disclosure and allow
easy testing of the results in that PCR across the stuffer is feasible and therefore
allows both ends of the insertion to be easily tested. R21 was co-electroporated with
a cre-expressing vector into the ES cells harbouring the landing pad in the IGH locus.
[0496] Four sets of transformed cells were transfected in parallel and then placed under
different selection regimes as indicated in Figure 30. G418 selection (neo gene expression)
resulted in the largest number of colonies due to there being no requirement for specific
landing-pad integration. Any integration of R21 into the genome will provide neo expression
leading to G418-resistance. Puro selection resulted in a similar colony number to
Puro + 6TG or G418 + 6TG, suggesting that the stringency of Puro selection is due
to the PuroΔTK lacking a promoter in the vector. Puro expression is only acquired
when an integration occurs near a promoter element - in this design most likely specifically
in the landing pad. These conclusions are supported by the results from junction PCR
which is shown in Figure 31.
[0497] The next step in the disclosure is to 'cure' the 3' end of the integrated BAC vector,
leaving a seamless transition between the insertion and the flanking genome. This
curing was demonstrated by expanding an individual clone from above (R21 inserted
into the landing pad) and expressing piggyBac recombinase in this clone via transfection
of an expressing plasmid. FIAU was used to select colonies in which the 3' modification
was excised - ie, through loss of the 'PGK-puroΔTK' element between the piggyBac terminal
repeats. Fifty such clones resulted from a transfection of 10
6 cells; of these six were tested for the expected genomic structure. Successful curing
resulted in positive PCR between the primer set labelled "3" in Figure 32. Of the
6 clones, 4 had correct excisions, 1 clone remained in the original configuration
and 1 other had a deletion.
[0498] These data demonstrate iterative insertion of DNA into a landing pad at a defined
genomic locus using the approaches outlined above.
Example 4 (For illustration only) Insertion of Large Parts of the Human IG Loci Into
Defined Positions in the Mouse Genome
[0499] Example 3 demonstrated that the design of the claimed disclosure was capable of providing
for the insertion of a test vector into the genome at a defined location, in this
case the R21 vector into the mouse IGH locus. The use of the appropriate selection
media and the expression of cre-recombinase resulted in a genomic alteration with
the predicted structure.
[0500] The same design elements described in this disclosure were built into the 5' and
3' ends of a BAC insert. Said insert comprised human sequences from the IGH locus
and was approximately 166-kb. This engineered BAC was electroporated along with a
cre-expressing plasmid DNA into mouse ES cells harbouring the landing pad at the mouse
IGH locus. The transfected cell population was grown in puro-containing media to select
for appropriate insertion events.
[0501] Seven resulting clones were isolated and further analysed. The expected recombination
event and resulting structure are depicted in Figure 33. Based upon data from the
R21 experiment outlined in Example 3, a stringent selection for correct clones was
expected when the transfected population was selected in puro-containing media. This
is because the puro-coding region requires a promoter element and this is preferentially
supplied by the landing pad after recombination. Accordingly, the majority of the
7 isolated clones had inserted correctly into the genome at the landing pad as determined
by the diagnostic PCR.
[0502] The primers for diagnosing a correct insertion are depicted in Figure 33. Correct
junctions are present in the genome if a 610-bp fragment is amplified between primers
'A' and 'X' and a 478-bp fragment is amplified between primers 'Y' and 'B' (Figures
33 and 34). Note that there are amplified fragments between 'A' and '1' primers and
'2' and 'B' primers indicating the presence of parental genome (that is, the landing
pad alone). These result from parental cells present internally in the cell colonies
under puro-selection that escape the selection due to the geometry of a colony. After
passaging the colony through puro-containing media, these parental junction fragments
disappear indicating that the parental cells are removed from the population. In addition,
all the clones were shown to be resistant to 6-TG as expected if the HPRT gene is
inactivated by the correct insertion event.
[0503] These data indicate that the disclosed strategy for inserting large parts of the
human IG loci into defined positions in the mouse genome will enable the construction
of a mouse with a plurality of the variable regions of human IG regions upstream of
the mouse constant regions as described.
Example 5 (For illustration only) Inserted Loci Are Functional in Terms of Gene Rearrangement,
Junctional Diversity as Well as Expression
[0504] Bacterial artificial chromosomes (BACs) were created, wherein the BACs had inserts
of human Ig gene segments (human V, D and/or J gene segments). Using methods described
herein, landing pads were used in a method to construct chimaeric Ig loci in mouse
embryonic stem cells (ES cells), such that chimaeric IgH and IgK loci were provided
in which human gene segments are functionally inserted upstream of endogenous constant
regions. To test if the human IgH-VDJ or IgK-VJ gene segments in the chimaera mice
derived from human BAC-inserted ES cell clones appropriately rearrange and express,
RT-PCR was performed for the RNA samples of white blood cells from those mice with
the primer pairs of human variable(V) region and mouse constant(C) region. The sequences
of oligos are shown as follows (Table 1). Each V oligo is paired with C oligo (HV
with Cµ; KV with Cκ) for PCR reaction.
Table 1:
| Oligo |
Sequence |
| HV2-5 |
AGATCACCTTGAAGGAGTCTGGTCC (SEQ ID NO 7) |
| HV4-4 |
TGGTGAAGCCTTCGGAGACCCTGTC (SEQ ID NO 8) |
| HV1-3 |
CACTAGCTATGCTATGCATTGGGTG (SEQ ID NO 9) |
| HV1-2 |
ATGGATCAACCCTAACAGTGGTGGC (SEQ ID NO 10) |
| HV6-1 |
GGAAGGACATACTACAGGTCCAAGT (SEQ ID NO 11) |
| Cµ |
TAGGTACTTGCCCCCTGTCCTCAGT (SEQ ID NO 12) |
| KV1-9 |
AGCCCAGTGTGTTCCGTACAGCCTG (SEQ ID NO 13) |
| KV1-8 |
ATCCTCATTCTCTGCATCTACAGGA (SEQ ID NO 14) |
| KV1-6 |
GGTAAGGATGGAGAACACTGGCAGT (SEQ ID NO 15) |
| KV1-5 |
TTAGTAGCTGGTTGGCCTGGTATCA (SEQ ID NO 16) |
| Cκ |
CTTTGCTGTCCTGATCAGTCCAACT (SEQ ID NO 17) |
[0505] Using the one-step formulation of SuperScript™ III One-Step RT-PCR System with Platinum®
Taq High Fidelity (Invitrogen™; World Wide Web (
www) invitrogen.com/site/us/en/home/
References/protocols/nucleic-acid-amplification-and-expression-profiling/pcr-protocol/superscript-3-one-step-rt-pcr-system-with-platinum-taq-high-fidelity.html#prot3),
both cDNA synthesis and PCR amplification were achieved in a single tube using gene-specific
primers and target RNAs.
[0506] The RT-PCR results showed most of the human IGH-VDJ or IGK-VJ gene segments appropriately
rearrange and express in the chimaera mice. To investigate the details about the diversity
generated from VDJ/VJ rearrangement, those specific RT-PCR fragments were cloned into
a common vector for sequencing.
Sequencing results indicate that JH, DH, and JK usages (Fig 35 and Fig 36) are similar
to human results. In addition, the results from the IGH-VDJCµ transcripts show that
the range and mean of CDR-H3 length (Fig 37) are similar to that observed in human.
The junctional diversity generated from exonuclease and nucleotide addition activities
(Fig 38) was also observed. The IGH rearrangement possessed a higher frequency of
these activities compared to the IGK one. These data suggest that the inserted loci
are functional in terms of gene rearrangement, junctional diversity as well as expression.
Example 6 (For illustration only) Productive VJ Rearrangement and Somatic Hypermutation
can be Obtained
[0507] Figure 41 shows an analysis of kappa mRNA from mice B-cells bearing rearranged VJ,
the VJ having been rearranged from human germline kappa V1-8 and J1, and demonstrates
that both that productive VJ rearrangement and somatic hypermutation can be obtained,
the latter as seen from the changes in antibodies encoded by mRNA with respect to
the germline sequences. The same is displayed for V1-6 and J1 in Figure 42. Importantly,
the recombination eliminates stop codons that are encoded by the combination of (unmutated)
human germline gene segments, thereby allowing for antibody-encoding mRNA sequences.
Figure 43 demonstrates that inserted human kappa V1-5 J1 and V1-5 J4 can produce functional
coding sequences in vivo and junctional diversity.
Example 7 (For illustration only) Inactivation of Use of Endogenous IGHV Gene Segments
for Expressed Rearranged Heavy Chain by Inversion
Introduction
[0508] A 5'-RACE Cµ-specific library was generated from the splenic B lymphocytes of transgenic
mice, denoted S1 mice. These mice comprise transgenic heavy chain loci, each locus
containing the six most 3' functional human V
H gene segments (V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1), and all the human D and J
H gene segments (comprising functional human D gene segments D1-1, 2-2, 3-3, 4-4, 5-5,
6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16, 4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26
and 7-27; and functional human J gene segments J1, J2, J3, J4, J5 and J6) inserted
into the endogenous heavy chain locus between endogenous IGHJ4 and Eµ (mouse chromosome
12: between coordinates 114666435 and 114666436). The human DNA was obtained from
a bacterial artificial chromosome (BAC) containing the sequence of human chromosome
14 from coordinate 106328951 to coordinate 106494908. Further details on the construction
of transgenic antibody loci using sRMCE is given elsewhere herein and in
WO2011004192. 4x96-well plates of clones were randomly picked for sequencing to determine the
usage of the gene segments. All detected immunoglobulin heavy chains were rearranged
from mouse V
H or human V
H with human D-J
H. No mouse D and J
H segments were detected in rearranged products (Fig 44).
[0509] This result indicates that insertion of human V
H-D-J
H gene segments into an endogenous locus between the last endogenous J region (in this
case, J
H4) and the Eµ enhancer effectively inactivates the use of endogenous D and J
H gene segments for expressed rearranged immunoglobulin heavy chains.
[0510] The ratio of mouse V
H to human V
H usage was around 3 to 1 (Fig 45). To completely eliminate mouse V
H use for antibody generation, the endogenous mouse V
H-D-J
H was inverted and moved to a distant region of the same chromosome. The rearrangement
of mouse V
Hs to human D-J
H segments was totally blocked by effects of inversion and distance from the heavy
chain locus.
[0511] The inversion strategy included three steps: (a) targeting of an inversion cassette,
(b) inversion of endogenous VDJ and (c) excision of markers (Fig 46).
(a) Targeting of the inversion cassette:
[0512] The inversion cassette consists of four components: a CAGGS promoter-driven puromycin-resistant-delta-thymidine
kinase (puroΔtk) gene, a 5' HPRT gene segment under the PGK promoter control, a loxP
site between them and inversely oriented to another loxP site already in the heavy
chain locus, and two flanking piggyback LTRs (PB3'LTRs). The inversion targeting cassette
was inserted to a region that is 5' and distant to the endogenous IGH locus at chromosome
12 as shown in figure 46. The targeted ES clones were identified and confirmed by
PCR.
(b) Inversion:
[0513] Following the insertion, transient expression of cre from a transfected plasmid resulted
in inversion of a section of chromosome 12 fragment including the endogenous V
H-D-J
H locus and intervening sequences through recombination of two inverted loxP sites,
ie, those in the inversion cassette and the landing pad for the BAC insertion respectively.
The invertants were selected by HAT and confirmed by junction PCRs cross the two recombined
loxP sites.
(c) Excision of markers:
[0514] The inversion rearranged the relative orientation of the PB3'LTRs from the inversion
cassette and PB5'LTR from the landing pad to generate two piggyBac transposon structures
flanking the inverted region. With transient expression of piggyBac transposase (PBase),
these two transposons were excised from the chromosome (and thus the mouse cell genome).
The cured ES clones were selected by 1-(-2-deoxy-2-fluoro-1-b-D-arabinofuranosyl)-5-iodouracil
(FIAU) and 6TG, and confirmed by junction PCRs cross the excised regions.
Methods
[0516] Targeting of the locus for inversion: Briefly, S1 cell line (S1.11.1) was cultured in M15 medium (Knockout™ DMEM supplemented
with 15% fetal bovine serum, 2 mM glutamine, antibiotics, and 0.1 mM 2-mercaptoethonal).
Targeting construct R57 (Fig 47) was linearized outside the region of homology by
Notl. A total of 20 µg of the linearized construct was electroporated into S1 cell
lines (AB2.1-derived) with a Bio-Rad® Gene Pulser™, and 107 cells were plated onto
three 90-mm-diameter SNL76/7 feeder plates containing M15 medium. At 24 h after electroporation,
M15 containing puromycin (3 µg of the active ingredient per ml) was added to each
90-mm-diameter plate, and the cells were maintained under selection for 9 days. 96
puromycin-resistant clones were then picked and expanded in 96-well plates. The targeting
events were identified by long-range PCR.
[0517] Cre-loxP mediated inversion: 12 positive clones were pooled together and cultured in a 6-well tissue culture plate
with M15 medium. The cells were transfected with 10 µg of pCAGGS-Cre plasmid for the
inversion of mouse endogenous locus and then plated onto three 90-mm-diameter SNL76/7
feeder plates containing M15 medium. At 24 h after electroporation, M15 containing
1XHAT (hypoxanthine-aminopterin-thymidine) was added to each 90-mm-diameter plate,
and the cells were maintained under selection for 7 days and then treated with 1XHT
(hypoxanthine-thymidine) for 2 days. 48 HAT resistant colonies were picked and genotyped
by PCR amplification of the junctions after Cre-loxP mediated inversion.
[0518] HyPBase-mediated marker excision: 12 positive clones were pooled together and cultured in 6-well tissue culture plate
using M15 medium. The cells were transfected with 5 µg of HyPBase plasmid to activate
the PB transposon LTRs flanking two selection markers (Hprt-mini gene and PGK-puroΔtk
gene) and plated onto one 90-mm-diameter SNL76/7 feeder plates containing M15 medium.
At 72 h after electroporation, a serial dilution of the cells was then plated onto
three 90-mm-diameter SNL76/7 feeder plates containing M15 supplemented with 1-(-2-deoxy-2-fluoro-1-b-D-arabinofuranosyl)-5-iodouracil
(FIAU). Cells were maintained under selection for 10 days, and FIAU-resistant colonies
were counted, picked, and expanded in 96-well plates. Positive clones were identified
by PCR amplification of the junctions after excision of the selection markers. Positive
clones were then expanded for blastocyst microinjection.
[0519] Generation of chimera and breeding: Mouse chimaeras were generated by microinjection of ES cells into C57/BL6 blastocysts
and transfered into pseudopregnant recipients. Male chimaeras were test-crossed with
C57/BL6 mice. Agouti F1 offspring were genotyped by S1 3' junction PCR. Test-cross
positive heterozygotes were further intercrossed to generate homozygotes.
[0520] Determination of VH-D-JH usage by rapid amplification of 5'-cDNA ends (5' RACE) PCR: Total RNA was extracted from the spleen of S1inv1 mouse (KMSF30.1d) with TRIzol®
Reagent (Invitrogen™, Life Technologies Ltd™) and treated with DNase I. Rapid amplification
of 5'-cDNA ends (5' RACE) PCR was performed using 5'/3' RACE kit (2nd Generation,
Roche) following the protocol supplied by the manufacturer. The first-strand cDNA
was synthesised using primer E1554 (5'- ATGACTTCAGTGTTGTTCTGGTAG -3'; SEQ ID No 25)
which is located at the mouse endogenous Cµ region. The synthesised first cDNA strand
was purified using High Pure PCR Product Purification Kit (Roche). Poly(A) tail was
added following the protocol supplied with the 5'/3' RACE kit (2nd Generation, Roche).
The 5' end of the V
H-D-J
H rearranged transcript was amplified by nested PCR with forward primers Oligo dT,
which is included in the kit, and nested Cµ-specific reverse primers E1555 (5'- CACCAGATTCTTATCAGAC
-3'; SEQ ID No 26). Following reaction, the 5' RACE PCR product was checked on a 1%
agarose gel and purified using QIAquick® Gel Extraction Kit (QIAGEN) as the protocol
supplied with the kit, then cloned into pDrive vector using QIAGEN PCR Cloning Kit
(QIAGEN) for sequencing analysis.
Results
[0521] The sequence analysis from a Cµ-specific 5'-RACE library of splenic B lymphocytes
of S1
inv1 (one human IGH BAC (ie, multiple human VH, all functional human D and JH) with an
inverted endogenous IGH locus version 1) mouse shows that practically all the transcripts
came from rearranged human V
H-D-J
H gene segments (Fig 48). Mouse V
H usage was rarely detected (0.4%), and no mouse D and J
H usage was detected. Human V
H usage was 99.6% and only human D and J
H were used; it was hypothesized that the rare mouse V
H usage was due to trans-switching with another chromosome and not due to use of moue
V
H from the inverted sequences. The inversion resulted in complete inactivation of the
endogenous V
H use.
[0522] This result indicates that inversion is an effective way to inactivate the rearrangement
of endogenous VH gene segments. The S1
inv1 mouse also shows a similar usage of both D and J
H gene segments to human (Fig 49) (
Link, JM et al. Mol. Immunol. 2005. 42, 943-955). Thus, a mouse was produced that comprises a transgenic heavy chain locus that expresses
heavy chains comprising human variable regions, but no mouse variable regions, and
furthermore the human variable regions demonstrated a normal, human sequence distribution
corresponding to human D and J usage observed in humans.
Example 8 (For illustration only) Inactivation of Use of Endogenous IGHV Gene Segments
for Expressed Rearranged Heavy Chain By Insertion Of Human IgH Genomic DNA
Introduction
[0523] Insertion of human BACs with V
H-D-J
H gene segments into an endogenous mouse heavy chain locus between J
H4 and Eµ in chromosome 12 allows human V
H-D-J
H gene segments to effectively use mouse Eµ and 3' enhancers and rearrange to generate
chimeric antibody with human variable region and mouse constant region. Meanwhile,
the endogenous V
H-D-J
H gene segments are pushed away from endogenous enhancers and constant regions. This
distance effect results in inactivation of mouse D and J
H use for expressed rearranged antibody products. As the distance increases by stepwise
BAC insertion, it is expected that the mouse VH usage would be significantly reduced.
Results
[0524] Insertion of human DNA from a 1
st human BAC (BAC comprising a the sequence of mouse Chromosome 14 from coordinate 106328951
to coordinate 106494908; containing six most 3' functional V
H gene segments (V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1), and all the human D and J
H gene segments) into the heavy chain endogenous locus of a AB2.1 ES cell genome between
endogenous IGHJ4 and Eµ (at mouse chromosome 12: between coordinates 114666435 and
114666436) effectively inactivates the use of endogenous D and J
H gene segments for expressed rearranged immunoglobulin heavy chain (Fig 44). The rearranged
transcripts with mouse V
H gene segments are reduced in the resulting S1 mouse. The proportion of transcripts
using mouse V
H is around 75% of all observed sequences (Fig 45).
[0525] Following the 1
st BAC DNA insertion, human DNA from a 2
nd human BAC (Chr14: 106494909-106601551) (BAC comprising a the sequence of mouse Chromosome
14 from coordinate 106494909 to coordinate 106601551; containing 5 more functional
VH gene segments (V
H3-13, 3-11, 3-9, 1-8, 3-7)) was inserted into the landing pad left behind after curing
following the 1
st BAC insertion (see, eg, Fig 24). The mouse V
H usage is further significantly reduced following this insertion of the 2
nd BAC into the locus. The proportion of transcripts using mouse VH was further reduced
to 35% of all observed sequences (Fig 50).
[0526] This result indicate that the endogenous V
H-D-J
H gene segments could be inactivated (ie, not used for expressed rearranged heavy chains)
through insertion of human VDJ sequences from one or more BACs. As the distance increases
by stepwise BAC insertion, it is expected that the mouse VH usage would be significantly
reduced.
Example 9 (For illustration only) Normal Class Switch and Hypermutation in Transgenic
Mice of the Disclosure
Introduction
[0527] The B cell arm of the immune system has evolved to produce high affinity, antigen-specific
antibodies in response to antigenic challenge. Antibodies are generated in B lymphocytes
by a process of gene rearrangement in which variable (V), diversity (D; for the IGH
locus) and joining (J) gene segments are recombined, transcribed and spliced to a
Cµ (for IGH) or a Cκ or Cλ (for IGL) constant region gene segment to form an IgM antibody.
Depending on the stage of B cell development, IgM is either located on the cell surface
or secreted. The recombination process generates a primary antibody repertoire with
sufficient germ line diversity to bind a wide range of antigens. However, it is usually
not large enough to provide the high affinity antibodies that are required for an
effective immune response to an antigen such as an infectious agent. Therefore, the
immune system adopts a two-stage diversification process to increase diversity further.
When challenged with antigens, B cells undergo selection and maturation by a process
called somatic mutation. B cells expressing antibodies which bind to antigen undergo
multiple rounds of diversification, clonal expansion and antigen selection in the
germinal centres (GCs) of the secondary lymphoid organs. During this process, the
rearranged variable regions of the immunoglobulin genes acquire somatic hypermutation
through nucleotide substitution, addition or deletion. This stepwise process creates
a secondary repertoire from the weak binders selected originally from the primary
repertoire and combines rapid proliferation of antigen-reactive B cells with intense
selection for quality of binding, eventually giving rise to high affinity antibodies
with broad epitope coverage. During this process, antibodies undergo class switching
in which the Cµ constant region is replaced by Cγ, Cα or Cε to produce respectively
IgG , A or E classes of antibody with different effector functions.
[0528] Insertion of 1
st human BAC (Chr14: 106328951-106494908) containing six most 3' functional V
H gene segments (V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1), and all the D and J
H gene segments into the locus between endogenous IGHJ4 and Eµ (Chr12: 114666435 and
114666436) produces transgenic mice that generate chimeric immunoglobulin heavy chains
containing human variable and mouse constant regions. This result demonstrates that
human immunoglobulin gene segments are able to be rearranged and expressed in mice.
Here, RT-PCR experiments and sequence analysis were performed to further demonstrate
that immunized transgenic mice have proper class switch and hypermutation for generated
antibodies.
Methods
[0529] RT-PCR and sequence analysis: Wild type or S1 chimera mice at 6-8 weeks of age were primed by intraperitoneal injection
of 10
6 sheep RBCs suspended in phosphate buffer saline (PBS). The immunized mice were boosted
twice with the same amount of sheep RBCs two and four weeks after priming. Four days
after the last boost, peripheral blood cells were collected from the immunized mice.
Total RNA was isolated from peripheral blood cells with TRIzol® reagent (Invitrogen™)
and treated with DNase I. Reverse transcription polymerase chain reaction (RT-PCR)
was performed using SuperScript® III First-Strand Synthesis System (Invitrogen™) following
the protocol supplied by the manufacturer. The 1 st strand cDNA was synthesized with
the specific Cγ primers (Cγ1, Cγ2a, Cγ2b), following by PCR with specific human V
primers (VH1-2,3, VH4-4, VH6-1) and Cγ primers (Table 2). Following reaction, the
RT-PCR product was checked on a 1% agarose gel and purified using QIAquick® Gel Extraction
Kit (QIAGEN) as the protocol supplied with the kit, then cloned into pDrive vector
using QIAGEN PCR Cloning Kit (QIAGEN) for sequencing analysis.
Table 2:
| ELP1352_Cγ1 |
5'-AGAGCGGCCGCTGGGCAACGTTGCAGGTGACGGTC-3' |
SEQ ID No 27 |
| ELP1353_Cγ2b |
5'-AGAGCGGCCGCTTTGTCCACCGTGGTGCTGCTGG-3' |
SEQ ID No 28 |
| ELP1354_Cγ2a |
5'-AGAGCGGCCGCACATTGCAGGTGATGGACTGGC-3' |
SEQ ID No 29 |
| ELP1356_VH4-4 |
5'-AGGACGCGTGAAACACCTGTGGTTCTTCCTCCTGC-3' |
SEQ ID No 30 |
| ELP1357_VH1-2,3 |
5'-AGGACGCGTCACCATGGACTGGACCTGGAGGAT-3' |
SEQ ID No 31 |
| ELP1358_VH6-1 |
5'-AGGACGCGTATGTCTGTCTCCTTCCTCATCTTCC-3' |
SEQ ID No 32 |
Results
[0530] The rearranged transcripts were detected using RT-PCR with human VH-specific and
mouse Cγ-specific primers for amplification from peripheral blood cells of immunized
transgenic mice (Fig 51). Further sequence analysis of these amplified fragments demonstrated
hypermutation happened within the human variable regions of these IGγ chains (Fig
52). These results indicate that loci of the disclosure comprising insertion of human
IGH BAC containing V
H, D and J
H gene segments into the locus between endogenous IGHJ4 and Eµ regions has normal class
switching and hypermutation functionality (IgM to IgG) following antigen challenge.
Example 10 (For illustration only) Normal B Cell Compartments in Transgenic Mice of
the Disclosure
Introduction
[0531] In mice, about 2 X 10
7 bone marrow immature B cells are produced daily. Among them, only 10-20% of these
cells survive to exit the bone marrow and enter the spleen. The immature splenic B
cell population is divided into two distinct subsets: transitional 1 (T1) and transitional
2 (T2) B cells.
In vivo experiments indicate that T1 cells give rise to T2 cells, whereas T2 cells can further
differentiate into mature (M) B cells. In contrast to immature B cells (3-4 days old),
mature B cells are long-lived (15-20 weeks old) and are ready to respond to antigens
(
Pillai S et al; Immunol. Reviews. 2004. 197: 206-218). Thus, the component of mature B cell population is directly linked to the efficiency
of humoral immune response.
[0532] The T1, T2 and M cell populations can be categorized by their cell surface IgM and
IgD levels. A normal phenotype of splenic B cell compartment is required to mount
a robust immune response.
Methods
[0533] Flow cytometric analysis of mature B lymphocytes: To obtain a single cell suspension from spleen, the spleens of mice listed below
were gently passaged through a 30 µm cell strainer. Single cells were resuspended
in PBS supplemented with 3% heat inactivated foetal calf serum (FCS; Gibco®). The
following antibodies were used for staining: Antibody against B220/CD45R conjugated
with allophycocyanin (APC) (eBioscience, clone RA3-6B2), antibody against IgD receptor
conjugated with phycoerythrin (PE) (eBioscience, clone 11-26) and IgM receptor conjugated
with fluorescein isothiocyanate (FITC) (eBioscience, clone 11/41).
[0534] 5x10
6 cells were used for each staining. To each vial containing splenocytes a cocktail
of antibodies was added consisting of: IgD (PE) (eBioscience, clone 11-26), IgM (FITC)
and B220/CD45R (APC). Cells were incubated at 6°C for 15 minutes, washed to remove
excess of unbound antibodies and analysed using a fluorescence-activated cell sorting
(FACS) analyser from Miltenyi Biotech. B-cells were gated as B220
+IgM
+IgD
- for T1 population, B220
+IgM
+IgD
+ for T2 population and B220
+IgM
-IgD
+ for M population. Percentage of cells was calculated using gating system.
Results
[0535] Four different genotypes of mice were generated:-
- Wild type (WT);
- A transgenic mouse homozygous for a heavy chain transgene comprising insertion of
the 1st BAC human DNA noted above in which there are 6 human VH, all functional human D and
JH gene segments(S1/S1);
- A transgenic mouse homozygous for a heavy chain transgene comprising insertion of
a human VH, all functional human D and JH gene segments (H1/H1); and
- A transgenic mouse homozygous for a kappa chain transgene comprising insertion of
6 functional human Vκ and 5 functional Jκ gene segments (K1/K1).
[0536] Spleens from these naïve mice were collected and analysed for their B cell compartments.
The number and percentages of T1, T2 and M cells among those mice are similar (Fig
53), indicating that genetic manipulation of endogenous IG loci in transgenic mice
according to the disclosure do not compromise their B cell development. These data
help to establish that animals according to the disclosure provide a robust platform
for antibody discovery.
[0537] As explained in Example 16 below, further analysis was performed on S1 mice in which
endogenous heavy chain expression has been inactivated (S1 F mice in which there is
inactivation by inversion as herein described). As explained, normal splenic and bone
marrow compartments are seen in such mice of the disclosure (ie, equivalent to the
compartments of mice expressing only mouse antibody chains).
Example 11 (For illustration only) Normal IgH Isotypes & Serum Levels in Transgenic
Animals of the Disclosure
[0538] Transgenic mice (H1) carrying all human JH, all human DH and human Vh2-5 under control
of a rat switch region or mice (S1) carrying all human JH, all human DH and human
Vh2-5, Vh7-41, Vh4-4, Vh1-3, Vh1-2 and Vh6-1 under control of a mouse switch region
were immunised with 100µg Cholera Toxin B subunit (CTB; Sigma-Aldrich® C9903) emulsified
in Complete Freund's Adjuvant CFA; Sigma-Aldrich® F 5881). At least three animals
were injected sc or ip and then boosted with 25µg antigen in Incomplete Freund's Adjuvant
(IFA; Sigma-Aldrich® F 5506) at (i) 14 days and 21 days or (ii) 28 days after priming.
Blood was taken before priming at day "-1" (pre-bleeds) and on the day the spleens
were taken (usually 4d after last boost). Serum was analysed by ELISA using an antigen
independent assessment of Ig isotypes. This assay detects total serum antibodies of
all species. Specific detection for mouse IgG1, IgG2a, IgG2b and IgM was used ((Anti-mouse
IgG1 HRP AbD Serotec STAR132P, Anti-mouse IgG2a HRP AbD Serotec STAR133P, Anti-mouse
IgG2b HRP AbD Serotec STAR134P, Anti-mouse IgM HRP Abcam® ab97230) and concentrations
were read off a standard curve produced for each isotype using polyclonal isotype
controls (IgG1, Kappa murine myeloma Sigma-Aldrich® M9269, IgG2a, Kappa murine myeloma
Sigma-Aldrich® M9144, IgG2b, Kappa from murine myeloma Sigma-Aldrich® M8894, IgM,
Kappa from murine myeloma Sigma-Aldrich® M3795). Results (Figures 54 & 55 for H1 homozygous
and S1 homozygous and heterozygous mice) showed that even with these relatively short
immunisation regimes mice showed an increase in overall IgG levels after immunisation
over pre-bleeds. In cases where control mice (+/+) not carrying any human immunoglobulin
genes were included and immunised, these mice showed comparable changes in total observed
Ig levels (Figure 54). Individual isotype levels were more variable between animals
possibly showing various stages of class switching. IgM levels never exceeded 800
µg/ml whereas IgG levels reached more than 6mg/ml in some animals. Non-immunised controls
showed no such increases in switched isotype Ig levels.
[0539] These results demonstrate that mice comprising multiple human VDJ gene segments under
the control of a rat Sµ rat or mouse switch are able to undergo productive recombination
and class switching in response to antigen challenge and that the mice produce antibody
levels that are broadly comparable to unmodified mice The transgenic mice are able
to produce antibodies of each of the IgG1, IgG2a, IgG2b and IgM isotypes after immunisation.
Titers for CTB-specific Ig in pre-bleeds and terminal bleeds were determined and all
immunised animals showed at CTB-specific titres of at least 1/100 000.
Example 12 (For illustration only) Generation of Anti-Ovalbumin Antibodies with Sub-50nm
Affinities From Animals of the Disclosure
[0540] Transgenic mice carrying all human JH, all human DH and human Vh2-5 under control
of a rat Sµ switch region were immunised with 25µg ovalbumin (OVA; Sigma-Aldrich®
A7641) in Sigma-Aldrich® adjuvant (Sigma Adjuvant System® S6322) ip and then boosted
with the same amount of OVA in adjuvant at day 14 and day 21. Spleenocytes were taken
4 days later and fused using 1 ml polyethyleneglycol (PEG Average MW1450; Sigma-Aldrich®
P7306) with a myeloma line. Fused hybridoma cells were plated on 5 96-well plates
and after selection with hypoxanthine-aminopterin-thymidine (HAT) wells tested for
expression of OVA-specific antibodies by ELISA. Clones positive by ELISA were re-tested
by surface plasmon resonance (SPR) and binding kinetics determined using the ProteOn™
XPR36 (Bio-Rad®). Briefly, anti-mouse IgG (GE Biacore™ BR-1008-38) was coupled to
a GLM biosensor chip by primary amine coupling, this was used to capture the antibodies
to be tested directly from tissue culture supernatants. Ovalbumin was used as the
analyte and passed over the captured antibody surface at 1024nM, 256nM, 64nM, 16nM,
4nM with a 0nM (i.e. buffer alone) used to double reference the binding data. Regeneration
of the anti-mouse IgG capture surface was by 10mM glycine pH1.7, this removed the
captured antibody and allowed the surface to be used for another interaction. The
binding data was fitted to 1:1 model inherent to the ProteOn™ XPR36 analysis software.
The run was carried out 1xHBS-EP (10mM Hepes, 150mM NaCl, 3mM EDTA, 0.05% polysorbate,
pH7.6 (Teknova H8022)) used as running buffer and carried out at 25°C.
For 8 positive clones, heavy chain V-regions were recovered by RT-PCR (Access RT-PCR
System, A1250, Promega) using forward primers specific for Ig signal sequences
[0541] (
Wardemann et al Science 301, 1374 (2003)) and the following reverse primers for the constant regions of mouse IgG (Table
3):
Table 3:
| Primer Name |
Sequence |
bp |
|
| mIgG1_2 rev |
GGGGCCAGTGGATAGACAGAT |
21 |
SEQ ID No 33 |
| mIgG2b rev |
CAGTGGATAGACTGATGG |
18 |
SEQ ID No 34 |
| mIgG2a_2 rev |
CAGTGGATAGACCGATGG |
21 |
SEQ ID No 35 |
| mCH1 unirev |
KCAGGGGCCAGTGGATAGAC |
20 |
SEQ ID No 36 |
| mCH1 unirev_2 |
TARCCYTTGACMAGGCATCC |
20 |
SEQ ID No 37 |
[0542] RT-PCR products were either directly sequenced using the same primer pairs or cloned
in to TA plasmids (TOPO® TA Cloning® Kit for Sequencing, K4595-40, Invitrogen™) and
submitted for plasmid sequencing. Results (Table 4, below) show that CDRH3 sequences
had variable CDRs except for two identical clones (16C9 and 20B5) that also had near
identical KD kinetic values. The determined equilibrium binding constant KD ranged
from 0.38 nM to 40.60 nM, as determined by SPR at 25°C.
[0543] These results demonstrate that mice comprising multiple human VDJ gene segments under
the control of a rat Cµ switch are able to undergo productive recombination and produce
high affinity antigen-specific antibodies whose CDR3 regions have sequences encoded
by human gene segments (human JH was separately identified by V-Quest, IMGT).
Table 4:
| KD [nM] |
clone code |
CDR3 and FR4 (underlined) according to Kabat definition |
|
| 0.38 |
16C9 |
QEVINYYYYGMDVWGQGTTVTVSS |
SEQ ID No 38 |
| 0.52 |
20B5 |
QEVINYYYYGMDVWGQGTTVTVSS |
SEQ ID No 39 |
| 5.89 |
19F4 |
LEMATINYYYYGMDVWGQGTMVTVSS |
SEQ ID No 40 |
| 39.70 |
19E1 |
QEFGNYYYYGMDVWGQGTTVTVSS |
SEQ ID No 41 |
| 3.10 |
19G8 |
QEDGNPYYFGMDFWGQGTTVTVSS |
SEQ ID No 42 |
| 8.95 |
20H10 |
GSSYYYDGMDVWGQGTTVTVSS |
SEQ ID No 43 |
| 4.46 |
18D10 |
LENDYGYYYYGMDVWGQGTTVTVSS |
SEQ ID No 44 |
| 40.60 |
16F2 |
RGGLSPLYGMDVWGQGTTVTVSS |
SEQ ID No 45 |
Example 13 (For illustration only) Generation of Anti-Cholera Toxin B Antibodies With
Human Vh Regions from Animals of the Disclosure
[0544] Transgenic mice carrying all human JH, all human DH and human Vh2-5, Vh7-41, Vh4-4,
Vh1-3, Vh1-2 and Vh6-1 under control of a mouse Sµ switch region were immunised and
fused as described in Example 11. Fused hybridoma cells were plated on 5 96-well plates
and after selection with hypoxanthine-aminopterin-thymidine (HAT) or G418 (Gibco®
Cat No 10131-027, Lot 503317) and wells tested for expression of CTB-specific antibodies
by ELISA. Clones positive by ELISA were re-tested by surface plasmon resonance SPR
and binding kinetics determined using the ProteOn XPR36™ (Bio-Rad®).
Briefly, anti-mouse IgG (GE Biacore™ BR-1008-38) was coupled to a GLM biosensor chip
by primary amine coupling, this was used to capture the antibodies to be tested directly
from tissue culture supernatants. Cholera toxin B was used as analyte and passed over
the captured antibody surface at 256nM, 64nM, 16nM, 4nM and 1nM, with a 0nM (i.e.
buffer alone) used to double reference the binding data. Regeneration of the anti-mouse
IgG capture surface was by 10mM glycine pH1.7, this removed the captured antibody
and allowed the surface to be used for another interaction. The binding data was fitted
to 1:1 model inherent to the ProteOn XPR36™ analysis software. The run was carried
out 1xHBS-EP (10mM Hepes, 150mM NaCl, 3mM EDTA, 0.05% polysorbate, pH7.6 (Teknova
H8022)) used as running buffer and carried out at 37°C.
[0545] From the clones initially identified by ELISA, binding to CTB was confirmed by SPR.
However, due to the pentameric nature of the cholera toxin B, the majority of fits
to the 1:1 model were poor and the equilibrium binding constant KDs could not be accurately
determined. Where fits were acceptable, equilibrium binding constant KDs determined
ranged from 0.21 nM to 309nM but due to the pentameric nature of cholera toxin B these
are likely to be the result of multimeric interactions and therefore apparent affinities
with possible avidity components.
[0546] Clones identified by SPR for binding to CTB were subjected to RT-PCR as described
in Example 12 to recover the Vh regions. RT-PCR products were directly sequenced using
the same primer pairs. Results were obtained for only 14 clones presumably because
the human primers described in Wardemann
et al were not designed to amplify mouse Vh regions and therefore may have failed to amplify
certain mouse Vh classes. Results showed that 3 of the 14 CTB-specific recovered heavy
chain V-region sequences were human V, D and J regions as identified by V-Quest, IMGT
(Table 5).
Table 5: Alignment of heavy chain CDRs and J-region of 3 clones identified as binding to CTB
and preferentially matching with human reference sequences from IMGT database; note
that the KD values given here are apparent values due to the avidity of the CTB-antibody
interaction
| Vh region |
Clone Name |
Sequence (Kabat definitions) |
KD [nM] |
| |
|
CDR1 |
CDR2 |
CDR3 |
J-regions |
|
| IGHV4-4*02 |
- |
SSNWWS (SEQ ID NO 51) |
EIYHSGSTNYHPSLKS (SEQ ID NO 56) |
n/a |
IGHJ2*01 |
YWYFDLWGRGTLVTVSS [SEQ ID NO 64) |
- |
| |
12D10 |
SGNWWS ID NO 52) |
EIYHSGNTNYNPSLKS (SEQ ID NO 57) |
GPLTGEKYYFDL (SEQ ID NO 61) |
|
-YYFDLWGRGTLVTVSS (SEQ ID NO 65) |
0..27 |
| |
1283 |
RSNWWS (SEQ ID NO 53) |
EIYHSGSTNYNPSLKS (SEQ ID NO 58) |
IGDWYFDL (SEQ ID NO 62) |
|
-WYFDLWGRGTLVTVSS (SEQ ID NO 66) |
0.85 |
| |
|
|
|
|
|
|
|
| IGHV6-1*01 |
- |
SNSAAWN (SEQ ID NO 54) |
RTYYRSKWYNDYAVSVKS (SEQ ID NO 59) |
n/a |
IGHJ3*01 |
DAFDVWGQGTMVTVSS (SEQ ID NO 67) |
- |
| |
4A12 |
SNSAAWN (SEQ ID NO 55) |
RTYYRSKWYND YKVSVKS (SEQ ID NO 60) |
EGSHSGSGWYLDAFDI (SEQ ID NO 63) |
|
DAFDIWGQGTKVTVSS (SEQ ID NO 68) |
1.61 |
Example 14: (For illustration only) High Human Lambda Variable Region Expression in
Transgenic Mice Comprising Human Lambda Gene Segments Inserted into Endogenous Kappa
Locus
[0547] Insertion of human lambda gene segments from a 1
st IGL BAC to the IGK locus of mouse AB2.1 ES cells (Baylor College of Medicine) was
performed to create a chimaeric light chain allele denoted the P1 allele (Fig.56).
The inserted human sequence corresponds to the sequence of human chromosome 22 from
position 23217291 to position 23327884 and comprises functional lambda gene segments
Vλ3-1, Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7. The insertion was made between
positions 70674755 and 706747756 on mouse chromosome 6, which is upstream of the mouse
Cκ region and 3'Eκ (ie, within 100kb of the endogenous light chain enhancer) as shown
in Figure 56. The mouse Vκ and Jκ gene segments were retained in the chimaeric locus,
immediately upstream of the inserted human lambda DNA. The mouse lambda loci were
left intact. Mice homozygous for the chimaeric P1 locus were generated from the ES
cells using standard procedures.
[0548] A second type of mice were produced (P2 mice) in which more human functional Vλ gene
segments were inserted upstream (5') of human Vλ3-1 by the sequential insertion of
the BAC1 human DNA and then BAC2 DNA to create the P2 allele. The inserted human sequence
from BAC2 corresponds to the sequence of human chromosome 22 from position 23064876
to position 23217287 and comprises functional lambda gene segments Vλ2-18, Vλ3-16,
V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8 and Vλ4-3. Mice homozygous for the chimaeric
P2 locus were generated from the ES cells using standard procedures.
[0549] FACS analysis of splenic B cells from the P1 and P2 homozygotes was performed to
assess lambda versus kappa expression and human lambda versus mouse lambda expression
in the transgenic mice.
[0550] Standard 5'-RACE was carried out to analyse RNA transcripts from the light chain
loci in P2 homozygotes.
Light Chain Expression & FACS Analysis
[0551] To obtain a single cell suspension from spleen, the spleen was gently passage through
a 30µm cell strainer. Single cells were resuspended in Phosphate-Buffered Saline (PBS)
supplemented with 3% heat inactivated foetal calf serum (FCS).
[0552] The following antibodies were used for staining:
[0553] Rat anti-mouse lambda (mCλ) phycoerythrin (PE) antibody (Southern Biotech), rat anti-mouse
kappa (mCκ) (BD Pharmingen, clone 187.1) fluorescein isothiocyanate (FITC), antihuman
lambda (hCλ) (eBioscience, clone 1-155-2) phycoerythrin (PE), anti-B220/CD45R (eBioscience,
clone RA3-6B2) allophycocyanin (APC). NB: light chains bearing human Cλ was expected
to have variable regions derived from the rearrangement of inserted human Vλ and human
Jλ. Light chains bearing mouse Cλ was expected to have variable regions derived from
the rearrangement of mouse Vλ and Jλ from the endogenous lambda loci.
[0554] 5x10
6 cells were added to individual tubes, spun down to remove excess of fluid, and resuspended
in fresh 100µl of PBS + 3% FCS. To each individual tube the following antibodies were
added:
[0555] For staining of mλ versus mκ 1µl of each antibody was added in addition to 1µl of
B220/CD45R antibody. For detection of B cells expressing human lambda light chain,
the mλ antibody was substituted with hλ antibody. Cells were incubated in the dark
at 6°C for 15 minutes followed by several washes with fresh PBS+3%FCS to remove unbound
antibody. Cells were analysed using fluorescence-activated cell sorting
(FACS
) analyser from Miltenyi Biotech.
[0556] Alive spleenocytes were gated using side scatter (SSC) and forward scatter (FSC).
Within the SSC and FSC gated population, a subpopulation of B220/CD45R (mouse B-cells)
was detected using the APC fluorochrome. Single positive B220/CD45R population was
further subdivided into a cell bearing either mλ or hλ PE fluorochrome in conjunction
with mκ FITC fluorochrome. The percentage of each population was calculated using
a gating system.
[0557] Surprisingly, FACS analysis of splenic B cells from the P1 homozygotes showed no
detectable mouse Cκ expression (Fig. 57), indicating that insertion of the human lambda
locus DNA from BAC1 interrupts expression of the endogenous IGK chain.
[0558] The strong expression of endogenous Cλ and weak expression of human Cλ in the splenic
B cells grouped by FACS analysis (mouse Cλ: human Cλ = 65: 32) in these mice suggest
that inserted human IGL sequence, although interrupts the IGK activity, cannot totally
compete with the endogenous IGL genes.
[0559] The FACS analysis again surprisingly showed no detectable mouse Cκ expression in
the P2 homozygotes (Figs. 58A & B). However, the human Cλ greatly predominates in
expressed B cells grouped as mouse or human Cλ following FACS analysis (mouse Cλ:
human Cλ = 15: 80 corresponding to a ratio of 15 mouse lambda variable regions: 80
human lambda variable regions, ie, 84% human lambda variable regions with reference
to the grouped B-cells - which corresponds to 80% of total B-cells) from the P2 homozygotes
. While not wishing to be bound by any theory, we suggest that the inserted human
lambda locus sequence from the 2
nd BAC provides some advantages to compete with endogenous lambda gene segment rearrangement
or expression.
[0560] We analysed human Vλ and Jλ usage in the P2 homozygotes. See Figure 59 which shows
the human Vλ usage in P2 homozygotes. The observed usage was similar to that seen
in humans (as per
J Mol Biol. 1997 Apr 25;268(1):69-77; "The creation of diversity in the human immunoglobulin V(lambda) repertoire"; Ignatovich
O
et al). Further, the human Jλ usage was similar to that seen in humans (Figure 60). The
Vλ versus Vκ usage analysis of human Cλ transcripts by sequencing of non-bias 5'-RACE
(rapid amplification of cDNA ends) PCR clones showed that among 278 clone sequences,
only one used Vκ for rearrangement to Jλ (human Jλ), and all others (277 clones) used
human Vλ (Figs. 61 & 62; Vλ2-5 was detected at the RNA transcript level, but this
is a pseudogene which is usually not picked up by usage a the protein level). While
not wishing to be bound by any theory, we suggest that the retained mouse Vκ gene
segments essentially cannot efficiently rearrange with the inserted human Jλ gene
segments because they have the same type of RSSs (recombination signal sequences;
see explanation below) and are incompatible for rearrangement (Fig. 63). This result
also indicates that the inactivation of the endogenous IGK activity and predominate
expression of the inserted human lambda sequence can be achieved without further modification
of the IGK locus, for example, deletion or inversion of endogenous kappa loci gene
segments is not necessary, which greatly simplifies the generation of useful transgenic
mice expressing light chains bearing human lambda variable regions (ie, variable regions
produced by recombination of human Vλ and Jλ gene segments).
The arrangement of recombination signal sequences (RSSs) that mediate V(D)J recombination
in vivo is discussed, eg, in
Cell. 2002 Apr;109 Suppl:S45-55; "The mechanism and regulation of chromosomal V(D)J recombination"; Bassing CH, Swat
W, Alt FW. Two types of RSS element have been identified: a one-turn RSS (12-RSS)
and a two-turn RSS (23-RSS). In natural VJ recombination in the lambda light chain
locus, recombination is effected between a two-turn RSS that lies 3' of a V lambda
and a one-turn RSS that lies 5' of a J lambda, the RSSs being in opposite orientation.
In natural VJ recombination in the kappa light chain locus, recombination if effected
between a one-turn RSS that lies 3' of a V kappa and a two-turn RSS that lies 5' of
a J kappa, the RSSs being in opposite orientation. Thus, generally a two-turn RSS
is compatible with a one-turn RSS in the opposite orientation.
Thus, the inventors have demonstrated how to (i) inactivate endogenous kappa chain
expression by insertion of human lambda gene segments into the kappa locus; and (ii)
how to achieve very high human lambda variable region expression (thus providing useful
light chain repertoires for selection against target antigen) - even in the presence
of endogenous lambda and kappa V gene segments. Thus, the inventors have shown how
to significantly remove (lambda) or totally remove (kappa) V gene segment competition
and thus endogenous light chain expression by the insertion of at least the functional
human lambda gene segments comprised by BACs 1 and 2. In this example a very high
level of human lambda variable region expression was surprisingly achieved (84% of
total lambda chains and total light chains as explained above).
Example 15: (For illustration only) High Human Lambda Variable Region Expression in
Transgenic Mice Comprising Human Lambda Gene Segments Inserted into Endogenous Lambda
Locus
[0561] Insertion of human lambda gene segments from the 1
st and 2
nd IGL BACs to the lambda locus of mouse AB2.1 ES cells (Baylor College of Medicine)
was performed to create a lambda light chain allele denoted the L2 allele (Fig.56).
The inserted human sequence corresponds to the sequence of human chromosome 22 from
position 23064876 to position 23327884 and comprises functional lambda gene segments
Vλ2-18, Vλ3-16, V2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, Jλ1-Cλ1,
Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7. The insertion was made between positions 19047551
and 19047556 on mouse chromosome 16, which is upstream of the mouse Cλ region and
between Eλ4-10 and Eλ3-1 (ie, within 100kb of the endogenous light chain enhancers)
as shown in Figure 56. The mouse Vλ and Jλ gene segments were retained in the locus,
immediately upstream of the inserted human lambda DNA. The mouse kappa loci were inactivated
to prevent kappa chain expression. Mice homozygous for the L2 locus were generated
from the ES cells using standard procedures.
[0562] Using a similar method to that of Example 14, FACS analysis of splenic B cells from
the L2 homozygotes was performed to assess lambda versus kappa expression and human
lambda versus mouse lambda expression in the transgenic mice.
Light Chain Expression & FACS Analysis
[0563] The FACS analysis of splenic B-cells in L2 homozygotes under the IGK knockout background
(in which Vκ and Jκ gene segments have been retained) surprisingly showed that expression
of human Cλ greatly predominates in B-cells grouped as mouse or human Cλ following
FACS analysis (mouse Cλ: human Cλ = 5: 93 corresponding to a ratio of 5 mouse lambda
variable regions: 93 human lambda variable regions, ie, 95% human lambda variable
regions with reference to the grouped B-cells - which corresponds to 93% of total
B-cells) (Fig. 64A), demonstrating that inserted human IGλ gene segments within the
endogenous IGλ locus can outcompete the endogenous IGλ gene segment rearrangement
or expression.
[0564] Thus, the inventors have demonstrated how to achieve very high human lambda variable
region expression (thus providing useful light chain repertoires for selection against
target antigen) - even in the presence of endogenous lambda and kappa V gene segments.
Thus, the inventors have shown how to significantly remove endogenous lambda V gene
segment competition and thus endogenous lambda light chain expression by the insertion
of at least the functional human lambda gene segments comprised by BACs 1 and 2. In
this example a very high level of human lambda variable region expression was surprisingly
achieved (95% of total lambda chains and total light chains as explained above).
[0565] These data indicate that mice carrying either P (Example 14) or L (Example 15) alleles
produced by targeted insertion of the functional gene segments provided by BAC1 and
BAC2 can function in rearrangement and expression in mature B cells. These two types
of alleles are very useful for providing transgenic mice that produce human Ig lambda
chains for therapeutic antibody discovery and as research tools.
Transgenic Mice of the Disclosure Expressing Human Lambda Variable Regions Develop
Normal Splenic Compartments
In spleen, B cells are characterized as immature (T1 and T2) and mature (M) based
on the levels of cell surface markers, IgM and IgD. T1 cells have high IgM and low
IgD. T2 cells have medium levels of both them. M cells have low IgM but high IgD (figure
65). See also
J Exp Med. 1999 Jul 5;190(1):75-89; "B cell development in the spleen takes place in discrete steps and is determined
by the quality of B cell receptor-derived signals"; Loder F
et al. Using methods similar to those described in Example 16 below, splenic B-cells from
the animals were scored for IgD and IgM expression using FACS. We compared control
mice KA/KA (in which endogenous kappa chain expression has been inactivated, but not
endogenous lambda chain expression) with L2/L2;KA/KA mice (L2 homozyotes). The L2
homozygotes surprisingly showed comparable splenic B-cell compartments to the control
mice (Fig. 64B).
Example 16: (For illustration only) Assessment of B-Cell and Ig Development in Transgenic
Mice of the Disclosure
[0566] We observed normal Ig subtype expression & B-cell development in transgenic mice
of the disclosure expressing antibodies with human heavy chain variable regions substantially
in the absence of endogenous heavy and kappa chain expression.
Using ES cells and the RMCE genomic manipulation methods described above, mice were
constructed with combinations of the following Ig locus alleles:-S1 F/HA, +/KA = (i)
S1F - first endogenous heavy chain allele has one human heavy chain locus DNA insertion,
endogenous mouse VDJ region has been inactivated by inversion and movement upstream
on the chromosome (see the description above, where this allele is referred to as
S1
inv1); (ii) HA - second endogenous heavy chain allele has been inactivated (by insertion
of an endogenous interrupting sequence); (iii) + - first endogenous kappa allele is
a wild-type kappa allele and (iv) KA - the second endogenous kappa allele has been
inactivated (by insertion of an endogenous interrupting sequence). This arrangement
encodes exclusively for heavy chains from the first endogenous heavy chain allele.
[0567] S1 F/HA, K2/KA = (i) K2 - the first endogenous kappa allele has two kappa chain locus
DNA insertions between the most 3' endogenous Jκ and the mouse Cκ, providing an insertion
of 14 human Vκ and Jκ1-Jκ5; and (ii) KA-the second endogenous kappa allele has been
inactivated (by insertion of an endogenous interrupting sequence). This arrangement
encodes exclusively for heavy chains comprising human variable regions and substantially
kappa light chains from the first endogenous kappa allele.
[0568] +/HA, K2/KA - this arrangement encodes for mouse heavy chains and human kappa chains.
[0569] +/HA, +/KA - this arrangement encodes for mouse heavy and kappa chains - the mice
only produce mouse heavy and light chains.
[0570] In bone marrow, B progenitor populations are characterized based their surface markers,
B220 and CD43. PreProB cells carry germline IGH and IGK/L configuration and have low
B220 and high CD43 on their cell surface. ProB cells start to initiate VDJ recombination
in the IGH locus and carry medium levels of both B220 and CD43. PreB cells carry rearranged
IGH VDJ locus and start to initiate light chain VJ rearrangement, and have high B220
but low CD43. In spleen, B cells are characterized as immature (T1 and T2) and mature
(M) based on the levels of cell surface markers, IgM and IgD. T1 cells have high IgM
and low IgD. T2 cells have medium levels of both them. M cells have low IgM but high
IgD (figure 65). See also
J Exp Med. 1991 May 1;173(5):1213-25; "
Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse
bone marrow"; Hardy RR et al and J Exp Med. 1999 Jul 5;190(1):75-89; "B cell development in the spleen takes place in discrete steps and is determined
by the quality of B cell receptor-derived signals"; Loder F
et al.
[0571] Transgenic Mice of the Disclosure Develop Normal Splenic and BM Compartments
(a) Analysis of the Splenic Compartment
[0572] For each mouse, to obtain a single cell suspension from spleen, the spleen was gently
passaged through a 30µm cell strainer. Single cells were resuspended in
Phosphate-Buffered Saline (PBS) supplemented with 3% heat inactivated foetal calf serum (FCS). 5x10
6 cells were added to individual tubes, spun down to remove excess of fluid and resuspended
in fresh 100µl of PBS + 3% FCS. To each individual tube the following antibodies were
added: anti-B220/CD45R (eBioscience, clone RA3-6B2) allophycocyanin (APC), antibody
against IgD receptor conjugated with phycoerythrin (PE) (eBioscience, clone 11-26)
and antibody against IgM receptor conjugated with fluorescein isothiocyanate (FITC)
(eBioscience, clone 11/41).
[0573] For staining of IgM vs IgD, 5x10
6 cells were used for each staining. To each vial containing splenocytes a cocktail
of antibodies was added consisting of: anti- IgD (PE), anti-IgM (FITC) and anti-B220/CD45R
(APC). Cells were incubated at 6°C for 15 minutes, washed to remove excess unbound
antibodies and analysed using a fluorescence-activated cell sorting
(FACS
) analyser from Miltenyi Biotech. B-cells were gated as B220
HIGH IgM
HIGH IgD
LOW (ie, B220
+ IgM
+ IgD
-) for T1 population, B220
HIGH IgM
HIGH IgD
HIGH (B220
+ IgM
+ IgD
+) for T2 population and B220
HIGH IgM
LOW IgD
HIGH (B220
+ IgM
- IgD
+) for M population. Percentage of cells was calculated using gating system. We used
gates to identify and define subsets of cell populations on plots with logarithmic
scale. Before gates are applied a single stain antibody for each fluorochrome is used
to discriminate between a positive (high intensity fluorochrome) and negative (no
detectable intensity fluorchrome) population. Gates are applied based on fluorochrome
intensities in the same manner to all samples. The single stains were:
IgD-PE
IgM-FITC
B220-APC
[0574] Alive spleenocytes were gated using side scatter (SSC) and forward scatter (FSC).
Within the SSC and FSC gated population, a subpopulation of B220/CD45R positive cells
(mouse B-cells) was detected using the APC fluorochrome. The single positive B220/CD45R
population was further subdivided into a cell bearing either IgM fluorescein isothiocyanate
(FITC) or IgD fluorochrome in conjunction with mκ FITC fluorochrome. The percentage
of each population was calculated using gating system. The splenic B-Cell compartments
in the mice of the disclosure are normal (ie, equivalent to the compartments of mice
expressing only mouse antibody chains).
(b) Bone marrow B progenitor analysis
[0575] To obtain a single cell suspension from bone marrow for each mouse, the femur and
tibia were flushed with
Phosphate-Buffered Saline (PBS) supplemented with 3% heat inactivated foetal calf serum (FCS). Cells were further
passage through a 30µm cell strainer to remove bone pieces or cell clumps. Cells were
resuspended in cold PBS supplemented with 3% serum. 2x10
6 cells were added to individual tubes, spun down to remove excess of buffer, and resuspended
in fresh 100µl of PBS + 3% FCS. To each individual tube the following antibodies were
added: anti-Leukosialin (CD43) fluorescein isothiocyanate (FITC) (eBioscience, clone
eBioR2/60) and anti-B220/CD45R (eBioscience, clone RA3-6B2) allophycocyanin (APC).
Cells were incubated in the dark at 6°C for 15 minutes followed by several washes
with fresh PBS+3%FCS to remove unbound antibody. Cells were analysed using a
fluorescence-activated cell sorting (FACS) analyser from Miltenyi Biotech. Alive bone marrow cells were gated using side scatter
(SSC) and forward scatter (FSC). We used gates to identify and define subsets of cell
populations on plots with logarithmic scale. Before gates are applied a single stain
antibody for each fluorochrome is used to discriminate between a positive (high intensity
fluorochrome) and negative (no detectable intensity fluorchrome) population. Gates
are applied based on fluorochrome intensities in the same manner to all samples. The
single stains were:
B220-APC
CD43-FITC
Within the alive population a double population of B220/CD45R and CD43 positive cells
was identified as a pre-B, pro-B and pre-pro B cells. The splenic B-Cell compartments
in the mice of the disclosure are normal (ie, equivalent to the compartments of mice
expressing only mouse antibody chains).
Transgenic Mice of the Disclosure Develop Normal Ig Expression
Quantification of serum IgM and IgG
[0576] 96-well NUNC plates were coated initially with a capture antibody (goat anti-mouse
Fab antibody at 1 µg/ml) overnight at 4°C). The IgG plates used anti-Fab, (M4155 Sigma)
and the IgM plates used anti-Fab (OBT1527 AbD Serotec). Following three washes with
phosphate buffer saline (PBS) containing 0.1% v/v Tween20, plates were blocked with
200 µl of PBS containing 1% w/v bovine serum albumin (BSA) for 1 hour at room temperature
(RT). The plates were washed three times as above and then 50 µl of standards (control
mouse isotype antibodies, IgG1 (M9269 Sigma), IgG2a (M9144 Sigma), IgG2b (M8894 sigma),
IgM (M3795 Sigma) or serum samples diluted in PBS with 0.1 % BSA were added to each
well, and incubated for 1 hour at RT. After washing three times as above 100 µl of
detection antibody (goat anti-mouse isotype specific antibody-horseradish peroxidase
conjugated, 1/10000 in PBS with 0.1% Tween) (anti-mouse IgG1 (STAR132P AbD Serotec),
anti-mouse IgG2a (STAR133P AdD Serotec), anti-mouse IgG2b (STAR134P AbD Serotec) and
anti-mouse IgM (ab97230 Abcam) were added into each well and incubated for 1 hour
at RT. The plates were washed three times as above and developed using tetramethylbenzidine
substrate (TMB, Sigma) for 4-5 minutes in the dark at RT. Development was stopped
by adding 50 µl/well of 1 M sulfuric acid. The plates were read with a Biotek Synergy
HT plate reader at 450 nm.
Conclusion:
[0577] Inversion of endogenous V
H-D-J
H following the human IGH BAC insertion results in inactivation of rearrangement of
endogenous V
H to inserted human D-J
H. The inventors observed, however, that surprisingly the inactivation of endogenous
heavy chain expression does not change the ratio of B-cells in the splenic compartment
(Fig. 66) or bone marrow B progenitor compartment (Fig. 67) and the immunoglobulin
levels in serum are normal and the correct Ig subtypes are expressed (Fig. 68). This
was shown in mice expressing human heavy chain variable regions with mouse light chains
(Figs 66A and 67A) as well as in mice expressing both human heavy chain variable regions
and human light chain variable regions (Figs 66B and 67B). These data demonstrate
that inserted human IGH gene segments (an insertion of at least human V
H gene segments V
H2-5, 7-4-1, 4-4, 1-3, 1-2, 6-1, and all the human D and J
H gene segments D1-1, 2-2, 3-3, 4-4, 5-5, 6-6, 1-7, 2-8, 3-9, 5-12, 6-13, 2-15, 3-16,
4-17, 6-19, 1-20, 2-21, 3-22, 6-25, 1-26 and 7-27; and J1, J2, J3, J4, J5 and J6)
are fully functional in the aspect of rearrangement, BCR signalling and B cell maturation.
Functionality is retained also when human light chain VJ gene segments are inserted
to provide transgenic light chains, as per the insertion used to create the K2 allele.
This insertion is an insertion comprising human gene segments Vκ2-24, Vκ3-20, Vκ1-17,
Vκ1-16, Vκ3-15, Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2, Vκ4-1,
Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5. Greater than 90% of the antibodies expressed by the S1
F/HA; K2/KA mice comprised human heavy chain variable regions and human kappa light
chain variable regions. These mice are, therefore, very useful for the selection of
antibodies having human variable regions that specifically bind human antigen following
immunisation of the mice with such antigen. Following isolation of such an antibody,
the skilled person can replace the mouse constant regions with human constant regions
using conventional techniques to arrive at totally human antibodies which are useful
as drug candidates for administration to humans (optionally following mutation or
adaptation to produce a further derivative, eg, with Fc enhancement or inactivation
or following conjugation to a toxic payload or reporter or label or other active moiety).
[0578] A further experiment was carried out to assess the IgG and IgM levels and relative
proportions in transgenic mice of the disclosure that express antibodies that have
human heavy and light (kappa) variable regions (S1F/HA, K2/KA mice; n=15). These were
compared against 12 mice expressing only mouse antibody chains (+/HA, +/KA (n=6) and
wild-type mice (WT; n=6)). The results are tabulated below (Table 6) and shown in
Figure 69.
[0579] It can be seen that the mice of the disclosure, in which essentially all heavy chain
variable regions are human heavy chain variable regions, expressed normal proportions
of IgM and IgG subtypes, and also total IgG relative to IgM was normal.
Table 6:
| |
IgG1 (µg/mL) |
IgG2a (µg/mL) |
IgG2b (µg/mL) |
IgM (µg/mL) |
Total IgG + IgM (µg/mL) |
| KMCB22.1a S1F/HA, K2/KA |
30.5 |
38.3 |
49.9 |
224.4 |
343.1 |
| KMCB 19.1d S1 F/HA, K2/KA |
103.6 |
181.2 |
85.6 |
351.7 |
722.1 |
| KMCB 19.1h S1 F/HA, K2/KA |
191.4 |
456.6 |
383.3 |
643.2 |
1674.6 |
| KMCB 20.1a S1F/HA, K2/KA |
53.6 |
384.4 |
249.7 |
427.1 |
1114.7 |
| KMCB 20.1c S1F/HA, K2/KA |
87.3 |
167.0 |
125.7 |
422.1 |
802.1 |
| KMCB 20.1f S1F/HA, K2/KA |
55.4 |
177.2 |
95.6 |
295.7 |
623.9 |
| KMCB22.1f S1F/HA, K2/KA |
61.1 |
56.3 |
111.4 |
245.8 |
474.5 |
| KMCB23.1c S1F/HA, K2/KA |
71.4 |
70.7 |
80.5 |
585.4 |
808.0 |
| KMCB23.1d S1F/HA, K2/KA |
65.4 |
148.7 |
187.4 |
255.4 |
657.0 |
| KMCB24.1f S1F/HA, K2/KA |
60.0 |
56.6 |
150.5 |
294.8 |
561.9 |
| KMCB13.1a S1F/HA, K2/KA |
101.2 |
200.5 |
269.8 |
144.1 |
715.7 |
| KMCB13.1d S1F/HA, K2/KA |
124.5 |
117.5 |
246.6 |
183.2 |
671.9 |
| KMCB17.1f S1F/HA, K2/KA |
58.3 |
174.2 |
116.2 |
218.1 |
566.8 |
| KMCB14.1a S1F/HA, K2/KA |
51.9 |
46.5 |
27.9 |
222.2 |
348.6 |
| KMCB14.1b S1F/HA, K2/KA |
11.5 |
54.2 |
48.5 |
194.4 |
308.6 |
| KMCB19.1e +/HA, +/KA |
233.0 |
6.7 |
465.6 |
420.9 |
1126.3 |
| KMCB19.1f +/HA, +/KA |
154.3 |
4.6 |
610.2 |
435.7 |
1204.8 |
| KMCB19.1l +/HA, +/KA |
113.5 |
1.1 |
246.8 |
374.6 |
736.0 |
| KMCB20.1e +/HA, +/KA |
561.0 |
4.3 |
614.3 |
482.1 |
1661.7 |
| KMCB13.1e +/HA, +/KA |
439.3 |
17.1 |
584.1 |
196.9 |
1237.3 |
| KMCB14.1c +/HA, +/KA |
93.4 |
1.3 |
112.0 |
106.8 |
313.6 |
| KMWT 1.3c WT |
212.9 |
155.2 |
104.6 |
233.7 |
706.4 |
| KMWT 1.3d WT |
297.1 |
203.2 |
144.6 |
248.6 |
893.5 |
| KMWT 1.3e WT |
143.1 |
174.2 |
619.1 |
251.8 |
1188.2 |
| KMWT 1.3f WT |
218.8 |
86.8 |
256.1 |
294.8 |
856.4 |
| KMWT 1.3b WT |
150.2 |
114.2 |
114.7 |
225.6 |
604.7 |
| KMWT 3.1e WT |
125.9 |
335.5 |
174.6 |
248.9 |
884.9 |
Example 17:
Assessment of Kappa : Lambda Ratio & Spienic B-cell Compartments in Transgenic Mice
of the Disclosure and the P3/K3F mice of the Invention
[0580] Mice comprising the following genomes were obtained.
WT/WT = wild-type;
KA/KA = each endogenous kappa allele has been inactivated; and the endogenous lambda
loci are left intact;
K3F/K3F = each endogenous kappa allele has three kappa chain locus DNA insertions
between the 3' most endogenous Jκ and the mouse Cκ, providing insertion of human V
gene segments Vκ2-40, Vκ1-39, Vκ1-33, Vκ2-30, Vκ2-29, Vκ2-28, Vκ1-27, Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15,
Vκ1-13, Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2 and Vκ4-1 and human J gene
segments Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5 (the human V gene segments being 5' of the human
J gene segments); each endogenous kappa VJ has been inactivated by inversion and movement
upstream on the chromosome; and the endogenous lambda loci are left intact;
L2/L2 = as described in Example 15 (L2 homozygotes where human lambda variable region
DNA has been inserted into the endogenous lambda loci; the endogenous kappa loci are
left intact);
L2/L2;KA/KA = as L2/L2 but the endogenous kappa alleles have been inactivated (by
insertion of an endogenous interrupting sequence=KA);
L3/L3;KA/KA = as L2/L2;KA/KA but supplemented by a third human lambda variable region
DNA insertion 5' of the second lambda DNA insertion in the endogenous lambda loci
such that the following human lambda gene segments are inserted between 3' most endogenous
Jλ and the mouse Cλ: human V gene segments Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21,
Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1,
human J and C gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 (non functional
segments Jλ4-Cλ4, Jλ5-Cλ5 were also included), thus providing an insertion corresponding
to coordinates 22886217 to 23327884 of human chromosome 22 inserted immediately after
position 19047551 on mouse chromosome 16;
S3F/HA;KA/KA;L3/L3 = first endogenous heavy chain allele has three human heavy chain
variable region DNA insertions between the 3' most endogenous JH and the Eµ, providing insertion of human gene segments VH2-26, VH1-24, VH3-23, VH3-21, VH3-20, VH1-18, VH3-15, VH3-13, VH3-11, VH3-9, VH1-8, VH3-7, VH2-5, VH7-4-1, VH4-4, VH1-3, VH1-2, VH6-1, D1-1, D2-2, D3-9, D3-10, D4-11, D5-12, D6-13, D1-14, D2-15, D3-16, D4-17, D5-18,
D6-19, D1-20, D2-21, D3-22, D4-23, D5-24, D6-25, D1-26, D7-27, JH1, JH2, JH3, JH4, JH5 and JH6 (in the order: human V gene segments, human D gene segments and human J gene segments);
the endogenous heavy chain VDJ sequence has been inactivated by inversion and movement
upstream on the chromosome; and the endogenous lambda loci are left intact; the second
endogenous heavy chain allele has been inactivated by insertion of an endogenous interrupting
sequence = HA); the endogenous kappa alleles have been inactivated (=KA/KA); and the
endogenous lambda alleles have been modified by insertion of human lambda variable
region DNA (=L3/L3);
P2/WT = P2 allele (human lambda variable region DNA as described in Example 14) at
one endogenous kappa locus; the other endogenous kappa locus left intact; both endogenous
lambda loci left intact;
P2/P2 = see Example 14; both endogenous lambda loci left intact;
P2/K2 = P2 allele at one endogenous kappa locus; the other endogenous kappa locus
having two DNA insertions between the 3' most endogenous Jκ and the mouse Cκ, providing
insertion of human V gene segments Vκ2-24, Vκ3-20, Vκ1-17, Vκ1-16, Vκ3-15, Vκ1-13,
Vκ1-12, Vκ3-11, Vκ1-9, Vκ1-8, Vκ1-6, Vκ1-5, Vκ5-2 and Vκ4-1 and human J gene segments
Jκ1, Jκ2, Jκ3, Jκ4 and Jκ5 (the human V gene segments being 5' of the human J gene
segments); both endogenous lambda loci left intact;
P3/K3F = as one endogenous kappa locus having an insertion between the following human
lambda gene segments are inserted between the 3' most endogenous Jκ and the mouse
Cκ, providing insertion of human V gene segments Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21,
Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3 and Vλ3-1,
human J and C gene segments Jλ1-Cλ1, Jλ2-Cλ2, Jλ3-Cλ3, Jλ6-Cλ6 and Jλ7-Cλ7 (non functional
segments Jλ4-Cλ4, Jλ5-Cλ5 were also included), thus providing an insertion corresponding
to coordinates 22886217 to 23327884 of human chromosome 22 inserted immediately after
position 70674755 on mouse chromosome 6; the other endogenous kappa locus having the
K3F allele described above (human V and J kappa gene segments inserted); both endogenous
lambda loci left intact;
P2/P2; L2/WT = As P2/P2 but wherein one endogenous lambda locus has the L2 allele
(human lambda V and J gene segments inserted) and the other endogenous lambda locus
is wild-type; and
P2/P2; L2/L2 = homozygous for P2 and L2 alleles at endogenous kappa and lambda loci
respectively.
[0581] FACS analysis of splenic B-cells (as described above) was carried out and proportions
of light chain expression were determined. We also determined the proportions of T1,
T2 and mature (M) splenic B-cells and compared with wild-type mice, in order to assess
whether or not we obtained normal splenic B-cell compartments in the transgenic mice.
The results are shown in Tables 7 and 8. We also assessed the proportion of B220 positive
cells as an indication of the proportion of B-cells in the splenic cell samples.
Table 7: Comparisons With Mice With Human Lambda Variable Region Inserts At Endogenous
Lambda Locus
| Genotype |
B220 |
IGL percentage |
Splenic B-cell compartment |
| mIGK |
mIGλ |
hIGA |
T1 |
T2 |
M |
| WT/WT (n=2) |
20% |
90% |
3.80% |
|
16% |
16.5 |
57.50% |
| KA/KA (n=2) |
13.60% |
0.28% |
68.50% |
0% |
33% |
9% |
41% |
| K3F/K3F (n=2) |
20% |
83% |
7% |
|
16% |
15.50% |
58% |
| L2/L2 (n=2) |
17.80% |
91.60% |
1.60% |
6.50% |
21.50% |
10% |
50% |
| L2/L2;KA/KA (n=1) |
9.10% |
0% |
5% |
93% |
28% |
7% |
44% |
| L3/L3;KA/KA (n=2) |
16.90% |
0.10% |
4.50% |
93.20% |
17.40% |
13.10% |
53.90% |
| S3F/HA;KA/K; L3/L3 (n=1) |
19% |
0.20% |
3.80% |
98% |
15.50% |
19% |
53.20% |
Table 8: Mice With Human Lambda Variable Region Inserts At Endogenous Kappa Locus
| Genotype |
B220 |
IGL Percentage |
Splenic B-cell compartment |
| mIGκ |
mIGλ |
hIGλ |
T1 |
T2 |
M |
| P2/WT (n=2) |
N.D |
90% |
4.20% |
6.55% |
17.30% |
8.90% |
52.50% |
| P2/P2 (n=2) |
14.80% |
0.20% |
15% |
76% |
27.50% |
12% |
42% |
| P2/K2 (n=2) |
18.20% |
78.80% |
7.90% |
15.60% |
19.50% |
12% |
50% |
| P3/K3F (n=2) |
18.40% |
64.80% |
11.60% |
19.40% |
11.80% |
18.40% |
56.10% |
| P2/P2; L2/WT (n=2) |
20.40% |
0.05% |
8.50% |
94% |
13.10% |
16.10% |
59.90% |
| P2/P2; L2/L2 (n=2) |
12.70% |
0.07% |
5.10% |
95.40% |
13.40% |
13.80% |
57.30% |
Conclusions
[0582] As demonstrated by L2/L2;KA/KA and L3/L3;KA/KA, the human lambda variable region
DNA insertions at the endogenous lambda locus (with an endogenous kappa knockout)
displayed predominate expression of light chains bearing human lambda variable regions
(indicated by the expression of Cλ-positive chains at around 93%). This surprisingly
occurs even though endogenous mouse lambda variable region DNA is still present, indicating
that the inserted human lambda variable region DNA can outcompete endogenous IGλ rearrangement.
[0583] Furthermore, mice having the human V and J gene segments present in the homozygous
L3 insertion produce B-cells (B220 positive cells) at a proportion that is similar
to wild-type and additionally produce a normal proportion or percentage of mature
splenic B-cells (ie, similar to wild-type). This is confirmed not only by the L3/L3;KA/KA
mice, but also was observed for S3F/HA;KA/KA;L3/L3, which also comprises a chimaeric
(human-mouse) IgH locus.
[0584] Also, we observed that mice having the human V and J gene segments present in the
homozygous K3F insertion produce B-cells (B220 positive cells) at a proportion that
is similar to wild-type and additionally produce a normal proportion or percentage
of mature splenic B-cells (ie, similar to wild-type).
[0585] Mice having the human V and J gene segments present in the homozygous P2 insertion
at the endogenous kappa locus showed high expression of light chains comprising human
lambda variable regions (as indicated by an observed proportion of 76%). We could
skew to an even higher percentage overall by combining insertion of human lambda V
and J gene segments at both the endogenous kappa and lambda loci (see P2/P2; L2/WT
at around 94% and P2/P2; L2/L2 at around 95%). Furthermore, mice comprising the human
V and J gene segment arrangement of P2/P2; L2/L2 produce a normal proportion or percentage
of mature splenic B-cells (ie, similar to wild-type).
[0586] When human lambda V and J gene segments were inserted at one endogenous kappa locus
and the other endogenous kappa locus comprised an insertion of human kappa V and J
gene segments, we obtained mice that could express light chains comprising lambda
variable regions and also light chains comprising kappa variable regions. Surprisingly
observed that we could raise the proportion of light chains comprising lambda variable
regions above that seen in a wild-type mouse where only 5% or less of light chains
typically comprise lambda variable regions. We observed a proportion of around 22%
for the P2/K2 genotype and around 31% for the P3/K3F genotype. The proprtion observed
with the latter genotype approximates that seen in a human where typically around
60% of light chains comprise kappa variable regions and around 40% of light chains
comprise lambda variable regions. Also in the P2/K2 and P3/K3F cases, the mice produced
a normal proportion of B-cells as compared with wild-type mice. Furthermore, mice
comprising the human V and J gene segment arrangement of P3/K3F produce a normal proportion
or percentage of mature splenic B-cells (ie, similar to wild-type).
Other Embodiments
[0587] From the foregoing description, it will be apparent that variations and modifications
may be made to the invention described herein to adopt it to various usages and conditions.
Such embodiments are also within the scope of the following claims.
[0588] The recitation of a listing of elements in any definition of a variable herein includes
definitions of that variable as any single element or combination (or subcombination)
of listed elements. The recitation of an embodiment herein includes that embodiment
as any single embodiment or in combination with any other embodiments or portions
thereof.
[0589] All publications and patent applications mentioned in the specification are indicative
of the level of skill of those skilled in the art to which this invention pertains.
SEQUENCE LISTING
[0590]
<110> Kymab Limited
<120> Animal models and therapeutic molecules
<130> 25077.38
<150> US 13433084
<151> 28.03.2012
<150> US 13434361
<151> 29.3.2012
<160> 68
<170> PatentIn version 3.5
<210> 1
<211> 4272
<212> DNA
<213> Rattus norvegicus
<400> 1



<210> 2
<211> 22190
<212> DNA
<213> Artificial Sequence
<220>
<223> Tragetting Vector (long version)
<400> 2













<210> 3
<211> 14130
<212> DNA
<213> Artificial Sequence
<220>
<223> Targetting vector (short version)
<400> 3









<210> 4
<211> 3551
<212> DNA
<213> Mus musculus
<220>
<221> misc_feature
<222> (1399)..(1498)
<223> n is a, c, g, or t
<400> 4



<210> 5
<211> 2484
<212> DNA
<213> Mus musculus
<400> 5


<210> 6
<211> 4515
<212> DNA
<213> Artificial Sequence
<220>
<223> 5' homology arm of targetting vector
<400> 6




<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide HV2-5
<400> 7
agatcacctt gaaggagtct ggtcc 25
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide HV4-4
<400> 8
tggtgaagcc ttcggagacc ctgtc 25
<210> 9
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide HV1-3
<400> 9
cactagctat gctatgcatt gggtg 25
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide HV1-2
<400> 10
atggatcaac cctaacagtg gtggc 25
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide HV6-1
<400> 11
ggaaggacat actacaggtc caagt 25
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide C
<400> 12
taggtacttg ccccctgtcc tcagt 25
<210> 13
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide KV1-9
<400> 13
agcccagtgt gttccgtaca gcctg 25
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide KV1-8
<400> 14
atcctcattc tctgcatcta cagga 25
<210> 15
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide KV1-6
<400> 15
ggtaaggatg gagaacactg gcagt 25
<210> 16
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide KV1-5
<400> 16
ttagtagctg gttggcctgg tatca 25
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide Ck
<400> 17
ctttgctgtc ctgatcagtc caact 25
<210> 18
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<220>
<221> repeat_region
<222> (1)..(10)
<223> Repeated 148 times
<400> 18
gagctgagct 10
<210> 19
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<220>
<221> repeat_region
<222> (1)..(10)
<223> Repeat 25 times
<400> 19
ggggtggggt 10
<210> 20
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<220>
<221> repeat_region
<222> (1)..(5)
<223> Repeat 82 times
<400> 20
gggctgggct 10
<210> 21
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Antibody Sequence
<220>
<221> MISC_FEATURE
<222> (1)..(2)
<223> Xaa Xaa = PR, RT, or PW
<400> 21

<210> 22
<211> 17
<212> PRT
<213> Artificial Sequence
<220>
<223> Antibody Sequence
<220>
<221> MISC_FEATURE
<222> (1)..(2)
<223> Xaa Xaa= PR, RT, or PW
<400> 22

<210> 23
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Antibody Sequence
<220>
<221> MISC_FEATURE
<222> (1)..(2)
<223> Xaa Xaa = PR or PW
<400> 23

<210> 24
<211> 17
<212> PRT
<213> Artificial Sequence
<220>
<223> Antibody Sequence
<220>
<221> MISC_FEATURE
<222> (1)..(2)
<223> Xaa Xaa = PR or PW
<400> 24

<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer E1554
<400> 25
atgacttcag tgttgttctg gtag 24
<210> 26
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer E1555
<400> 26
caccagattc ttatcagac 19
<210> 27
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1352_Cy1
<400> 27
agagcggccg ctgggcaacg ttgcaggtga cggtc 35
<210> 28
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1353_Cy2b
<400> 28
agagcggccg ctttgtccac cgtggtgctg ctgg 34
<210> 29
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1354_Cy2a
<400> 29
agagcggccg cacattgcag gtgatggact ggc 33
<210> 30
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1356_VH4-4
<400> 30
aggacgcgtg aaacacctgt ggttcttcct cctgc 35
<210> 31
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1357_VH1-2,3
<400> 31
aggacgcgtc accatggact ggacctggag gat 33
<210> 32
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> ELP1358_VH6-1
<400> 32
aggacgcgta tgtctgtctc cttcctcatc ttcc 34
<210> 33
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> mIgG1_2 rev
<400> 33
ggggccagtg gatagacaga t 21
<210> 34
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> mIgG2b rev
<400> 34
cagtggatag actgatgg 18
<210> 35
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> mIgG2a_2 rev
<400> 35
cagtggatag accgatgg 18
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> mCH1 unirev
<220>
<221> misc_feature
<222> (1)..(1)
<223> K = G or T
<400> 36
kcaggggcca gtggatagac 20
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> mCH1 unirev_2
<220>
<221> misc_feature
<222> (3)..(3)
<223> R = A or G
<220>
<221> misc_feature
<222> (6)..(6)
<223> Y = C or T
<220>
<221> misc_feature
<222> (12)..(12)
<223> M = A or C
<400> 37
tarccyttga cmaggcatcc 20
<210> 38
<211> 24
<212> PRT
<213> Artificial Sequence
<220>
<223> 16C9
<400> 38

<210> 39
<211> 24
<212> PRT
<213> Artificial Sequence
<220>
<223> 20B5
<400> 39


<210> 40
<211> 26
<212> PRT
<213> Artificial Sequence
<220>
<223> 19F4
<400> 40

<210> 41
<211> 24
<212> PRT
<213> Artificial Sequence
<220>
<223> 19E1
<400> 41

<210> 42
<211> 24
<212> PRT
<213> Artificial Sequence
<220>
<223> 19G8
<400> 42

<210> 43
<211> 22
<212> PRT
<213> Artificial Sequence
<220>
<223> 20H10
<400> 43

<210> 44
<211> 25
<212> PRT
<213> Artificial Sequence
<220>
<223> 18D10
<400> 44

<210> 45
<211> 23
<212> PRT
<213> Artificial Sequence
<220>
<223> 16F2
<400> 45

<210> 46
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<400> 46
gggctgggct gggct 15
<210> 47
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<400> 47
gggctgggct gggctgggct 20
<210> 48
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<400> 48
gggctgggct gggctgggct gggct 25
<210> 49
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<400> 49
gggctgggct gggctgggct gggctgggct 30
<210> 50
<211> 10
<212> DNA
<213> Artificial Sequence
<220>
<223> Rat Switch
<220>
<221> repeat_region
<222> (1)..(5)
<223> Repeat 6 to 81 times
<400> 50
gggctgggct 10
<210> 51
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHV4-4*02 CDR1
<400> 51

<210> 52
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> 12D10 CDR1
<400> 52

<210> 53
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> 1283 CDR1
<400> 53

<210> 54
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHV6-1*01 CDR1
<400> 54

<210> 55
<211> 7
<212> PRT
<213> Artificial Sequence
<220>
<223> 4A12 CDR1
<400> 55

<210> 56
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHV4-4*02 CDR2
<400> 56

<210> 57
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 12D10 CDR2
<400> 57

<210> 58
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 1283 CDR2
<400> 58

<210> 59
<211> 18
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHV6-1*01 CDR2
<400> 59

<210> 60
<211> 18
<212> PRT
<213> Artificial Sequence
<220>
<223> 4A12 CDR2
<400> 60

<210> 61
<211> 12
<212> PRT
<213> Artificial Sequence
<220>
<223> 12D10 CDR3
<400> 61

<210> 62
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> 1283 CDR3
<400> 62

<210> 63
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 4A12 CDR3
<400> 63

<210> 64
<211> 17
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHJ2*01 J-region
<400> 64

<210> 65
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 12D10 J-region
<400> 65

<210> 66
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 1283 J-Region
<400> 66

<210> 67
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> IGHJ3*01 J-Region
<400> 67

<210> 68
<211> 16
<212> PRT
<213> Artificial Sequence
<220>
<223> 4A12 J-region
<400> 68
