BACKGROUND OF THE INVENTION
[0001] Crude petroleum is a limited, natural resource found in the Earth in liquid, gaseous,
and solid forms. Although crude petroleum is a valuable resource, it is discovered
and extracted from the Earth at considerable financial and environmental costs. Moreover,
in its natural form, crude petroleum extracted from the Earth has few commercial uses.
Crude petroleum is a mixture of hydrocarbons (e.g., paraffins (or alkanes), olefins
(or alkenes), alkynes, napthenes (or cycloalkanes), aliphatic compounds, aromatic
compounds, etc.) of varying length and complexity. In addition, crude petroleum contains
other organic compounds (e.g., organic compounds containing nitrogen, oxygen, sulfur,
etc.) and impurities (e.g., sulfur, salt, acid, metals, etc.). Hence, crude petroleum
must be refined and purified at considerable cost before it can be used commercially.
[0002] Crude petroleum is also a primary source of raw materials for producing petrochemicals.
The two main classes of raw materials derived from petroleum are short chain olefins
(e.g., ethylene and propylene) and aromatics (e.g., benzene and xylene isomers). These
raw materials are derived from longer chain hydrocarbons in crude petroleum by cracking
it at considerable expense using a variety of methods, such as catalytic cracking,
steam cracking, or catalytic reforming. These raw materials can be used to make petrochemicals
such as monomers, solvents, detergents, and adhesives, which otherwise cannot be directly
refined from crude petroleum.
[0003] Petrochemicals, in turn, can be used to make specialty chemicals, such as plastics,
resins, fibers, elastomers, pharmaceuticals, lubricants, and gels. Particular specialty
chemicals that can be produced from petrochemical raw materials include fatty acids,
hydrocarbons (e.g., long chain, branched chain, saturated, unsaturated, etc.), fatty
aldehydes, fatty alcohols, esters, ketones, lubricants, etc.
[0004] Due to the inherent challenges posed by petroleum, there is a need for a renewable
petroleum source that does not need to be explored, extracted, transported over long
distances, or substantially refined like crude petroleum. There is also a need for
a renewable petroleum source which can be produced economically without creating the
type of environmental damage produced by the petroleum industry and the burning of
petroleum-based fuels. For similar reasons, there is also a need for a renewable source
of chemicals which are typically derived from petroleum.
[0005] One method of producing renewable petroleum is by engineering microorganisms to produce
renewable petroleum products. Some microorganisms have long been known to possess
a natural ability to produce petroleum products (e.g., yeast to produce ethanol).
More recently, the development of advanced biotechnologies has made it possible to
metabolically engineer an organism to produce bioproducts and biofuels. Bioproducts
(e.g., chemicals) and biofuels (e.g., biodiesel) are renewable alternatives to petroleum-based
chemicals and fuels, respectively. Bioproducts and biofuels can be derived from renewable
sources, such as plant matter, animal matter, and organic waste matter, which are
collectively known as biomass.
[0006] Biofuels can be substituted for any petroleum-based fuel (e.g., gasoline, diesel,
aviation fuel, heating oil, etc.), and offer several advantages over petroleum-based
fuels. Biofuels do not require expensive and risky exploration or extraction. Biofuels
can be produced locally and therefore do not require transportation over long distances.
In addition, biofuels can be made directly and require little or no additional refining.
Furthermore, the combustion of biofuels causes less of a burden on the environment
since the amount of harmful emissions (e.g., green house gases, air pollution, etc.)
released during combustion is reduced as compared to the combustion of petroleum-based
fuels. Moreover, biofuels maintain a balanced carbon cycle because biofuels are produced
from biomass, a renewable, natural resource. Although combustion of biofuels releases
carbon (e.g., as carbon dioxide), this carbon will be recycled during the production
of biomass (e.g., the cultivation of crops), thereby balancing the carbon cycle, which
is not achieved with the use of petroleum based fuels.
[0007] Biologically derived chemicals offer similar advantages over petrochemicals that
biofuels offer over petroleum-based fuels. In particular, biologically derived chemicals
can be converted from biomass to the desired chemical product directly without extensive
refining, unlike petrochemicals, which must be produced by refining crude petroleum
to recover raw materials which are then processed further into the desired petrochemical.
[0008] Hydrocarbons have many commercial uses. For example, shorter chain alkanes are used
as fuels. Methane and ethane are the main constituents of natural gas. Longer chain
alkanes (e.g., from five to sixteen carbons) are used as transportation fuels (e.g.,
gasoline, diesel, or aviation fuel). Alkanes having more than sixteen carbon atoms
are important components of fuel oils and lubricating oils. Even longer alkanes, which
are solid at room temperature, can be used, for example, as a paraffin wax. Alkanes
that contain approximately thirty-five carbons are found in bitumen, which is used
for road surfacing. In addition, longer chain alkanes can be cracked to produce commercially
useful shorter chain hydrocarbons.
[0009] Like short chain alkanes, short chain alkenes are used in transportation fuels. Longer
chain alkenes are used in plastics, lubricants, and synthetic lubricants. In addition,
alkenes are used as a feedstock to produce alcohols, esters, plasticizers, surfactants,
tertiary amines, enhanced oil recovery agents, fatty acids, thiols, alkenylsuccinic
anhydrides, epoxides, chlorinated alkanes, chlorinated alkenes, waxes, fuel additives,
and drag flow reducers.
[0010] Esters have many commercial uses. For example, biodiesel, an alternative fuel, is
comprised of esters (e.g., fatty acid methyl ester, fatty acid ethyl esters, etc.).
Some low molecular weight esters are volatile with a pleasant odor which makes them
useful as fragrances or flavoring agents. In addition, esters are used as solvents
for lacquers, paints, and varnishes. Furthermore, some naturally occurring substances,
such as waxes, fats, and oils are comprised of esters. Esters are also used as softening
agents in resins and plastics, plasticizers, flame retardants, and additives in gasoline
and oil. In addition, esters can be used in the manufacture of polymers, films, textiles,
dyes, and pharmaceuticals.
[0011] Aldehydes are used to produce many specialty chemicals. For example, aldehydes are
used to produce polymers, resins (e.g., Bakelite), dyes, flavorings, plasticizers,
perfumes, pharmaceuticals, and other chemicals, some of which may be used as solvents,
preservatives, or disinfectants. In addition, certain natural and synthetic compounds,
such as vitamins and hormones, are aldehydes, and many sugars contain aldehyde groups.
Fatty aldehydes can be converted to fatty alcohols by chemical or enzymatic reduction.
[0012] Fatty alcohols have many commercial uses. Worldwide annual sales of fatty alcohols
and their derivatives are in excess of U.S. $1 billion. The shorter chain fatty alcohols
are used in the cosmetic and food industries as emulsifiers, emollients, and thickeners.
Due to their amphiphilic nature, fatty alcohols behave as nonionic surfactants, which
are useful in personal care and household products, such as, for example, detergents.
In addition, fatty alcohols are used in waxes, gums, resins, pharmaceutical salves
and lotions, lubricating oil additives, textile antistatic and finishing agents, plasticizers,
cosmetics, industrial solvents, and solvents for fats.
[0013] Acyl-CoA synthase (ACS) esterifies free fatty acids to acyl-CoA by a two-step mechanism.
The free fatty acid first is converted to an acyl-AMP intermediate (an adenylate)
through the pyrophosphorolysis of ATP. The activated carbonyl carbon of the adenylate
is then coupled to the thiol group of CoA, releasing AMP and the acyl-CoA final product
(
Shockey et al., Plant. Physiol., 129: 1710-1722 (2002)).
[0014] FadR is a key regulatory factor involved in fatty acid degradation and fatty acid
biosynthesis pathways (
Cronan et al., Mol. Microbiol., 29(4): 937-943 (1998)). The
E. coli ACS enzyme FadD and the fatty acid transport protein FadL are essential components
of a fatty acid uptake system. FadL mediates transport of fatty acids into the bacterial
cell, and FadD mediates formation of acyl-CoA esters. When no other carbon source
is available, exogenous fatty acids are taken up by bacteria and converted to acyl-CoA
esters, which can bind to the transcription factor FadR and derepress the expression
of the
fad genes that encode proteins responsible for fatty acid transport (FadL), activation
(FadD), and β-oxidation (FadA, FadB, FadE, and FadH). When alternative sources of
carbon are available, bacteria synthesize fatty acids as acyl-ACPs, which are used
for phospholipid synthesis, but are not substrates for β-oxidation. Thus, acyl-CoA
and acyl-ACP are both independent sources of fatty acids that can result in different
end-products (
Caviglia et al., J. Biol. Chem., 279(12): 1163-1169 (2004)).
US 2010/242345 describes genetically engineered microorganisms that produce products from the fatty
acid biosynthethic pathway (fatty acid derivatives) and methods of their use.
[0015] There remains a need for methods and compositions for enhancing the production of
biologically derived chemicals, such as fatty acids and fatty acid derivatives. This
invention provides such methods and compositions. The invention further provides products
derived from the fatty acids and derivatives thereof produced by the methods described
herein, such as fuels, surfactants, and detergents.
BRIEF SUMMARY OF THE INVENTION
[0016] The invention provides improved methods of producing a fatty acid or a fatty acid
derivative thereof in a bacterial host cell. The method comprises (a) providing a
genetically engineered bacterial host cell comprising a heterologous promoter and/or
ribosome binding site operably linked to a polynucleotide sequence encoding a FadR
polypeptide, said promoter and/or ribosome binding site causing overexpression of
the FadR polypeptide in said cell, (b) culturing the engineered bacterial host cell
in a culture medium under conditions permissive for the production of a fatty acid
or a fatty acid derivative thereof, and (c) isolating the fatty acid or fatty acid
derivative thereof from the engineered bacterial host cell, wherein the fatty acid
or fatty acid derivative thereof is a fatty acid, an acyl-ACP, an acyl-CoA, a fatty
aldehyde, a short chain alcohol, a long chain alcohol, a fatty alcohol, a hydrocarbon,
or an ester. As a result of this method, one or more of the titer, yield, or productivity
of the fatty acid or fatty acid derivative produced by the engineered bacterial host
cell is increased relative to that of the corresponding wild-type host cell.
[0017] Also disclosed are fatty acids and fatty acid derivatives, such as an acyl-CoA, a
fatty aldehyde, a short chain alcohol, a long chain alcohol, a fatty alcohol, a hydrocarbon,
or an ester, produced by the methods of the invention. Further disclosed are biofuel
compositions and surfactant compositions comprising a fatty acid or a fatty acid derivative
produced by the methods of the invention.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0018]
FIG. 1 is a chart of exemplary genes suitable for use in practicing the invention.
Polypeptide and/or polynucleotide accession numbers are from the National Center for
Biotechnology Information (NCBI) database, and enzyme EC numbers are from the Nomenclature
Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB).
FIG. 2 is a graph of fatty species production in a control E. coli strain (ALC310) or the transposon insertion strain, D288.
FIG. 3 is a diagram depicting the location of the transposon insertion in the D288
strain.
FIG. 4 is a bar graph of total fatty species (FA) titers in expression library E. coli strains having altered expression of wild-type FadR or mutant FadR[S219N] as compared
to FA titers in the control E. coli strain (ALC487).
FIG. 5 is a bar graph of total fatty species (FA) titers in three separate shake flask
(SF) fermentations of E. coli strain D512 having altered expression of wild-type FadR as compared to FA titers
in the control ALC487 strain.
FIG. 6 is a bar graph of total fatty species yield on carbon in shake flask fermentations
of the control ALC487 strain or E. coli strain D512 having altered expression of wild-type FadR.
FIG. 7 is a graph of fatty acid and fatty alcohol production and total fatty species
yield in 5 L bioreactor fermentations of the control ALC487 strain fed at a glucose
rate of 10 g/L/hr or the D512 strain having altered expression of wild-type FadR fed
at a glucose rate of 10 g/L/hr or 15 g/L/hr. The bars represent fatty alcohol or fatty
acid titer, and the circles represent total fatty species yield on carbon.
FIG. 8 is a graph of fatty acid and fatty alcohol production and total fatty species
yield in shake flask fermentations of the D512 strain or a D512 strain in which the
entD gene was deleted. The bars represent fatty acid or fatty alcohol titer, and the circles
represent fatty acid yield.
FIG. 9 is a graph of total fatty species (fatty acids and FAME) titers and yields
in two ribosome binding site (RBS) library E. coli strains having altered expression of mutant FadR[S219N] (i.e., P1A4 and P1G7) as
compared to the total fatty species titers and yields in the parental E. coli strain (DAM1-pDS57) in shake flask (SF) fermentations at 32 °C. The bars represent
total fatty species titers after 56 hours of culture, and the squares represent total
fatty species yield after 56 hours of culture.
FIG. 10 is a line graph of combined FAME and free fatty acid (FFA) titers in the parental
DAM1 pDS57 strain, or RBS library strains P1A4 or P1G7 in bioreactor fermentations
at several timepoints following induction of FAME and FFA production, wherein DAM1
P1A4 and DAM1 P1G7 express FadR and DAM1 pDS57 does not express FadR.
FIG. 11 is a line graph of combined FAME and FFA yields in the parental DAM1 pDS57
strain, or RBS library strains P1A4 or P1G7 in bioreactor fermentations at several
time points following induction of FAME and FFA production, wherein DAM1 P1A4 and
DAM1 P1G7 express FadR and DAM1 pDS57 does not express FadR.
DETAILED DESCRIPTION OF THE INVENTION
[0019] The invention is based, at least in part, on the discovery that altering the level
of expression of FadR in a host cell facilitates enhanced production of fatty acids
and fatty acid derivatives by the host cell.
[0020] The invention provides improved methods of producing a fatty acid or a fatty acid
derivative in a bacterial host cell. The method comprises (a) providing a genetically
engineered bacterial host cell comprising a heterologous promoter and/or ribosome
binding site operably linked to a polynucleotide sequence encoding a FadR polypeptide,
said promoter and/or ribosome binding site causing overexpression of the FadR polypeptide
in said cell, (b) culturing the engineered bacterial host cell in a culture medium
under conditions permissive for the production of a fatty acid or derivative thereof,
and (c) isolating the fatty acid or derivative thereof from the engineered bacterial
host cell, wherein the fatty acid or derivative thereof is a fatty acid, an acyl-ACP,
an acyl-CoA, a fatty aldehyde, a short chain alcohol, a long chain alcohol, a fatty
alcohol, a hydrocarbon, or an ester. As a result of this method, one or more of the
titer, yield, or productivity of the fatty acid or fatty acid derivative produced
by the engineered bacterial host cell is increased relative to that of the corresponding
wild-type host cell.
DEFINITIONS
[0021] As used in this specification and the appended claims, the singular forms "a," "an"
and "the" include plural referents unless the context clearly dictates otherwise.
Thus, for example, reference to "a recombinant host cell" includes two or more such
recombinant host cells, reference to "a fatty alcohol" includes one or more fatty
alcohols, or mixtures of fatty alcohols, reference to "a nucleic acid coding sequence"
includes one or more nucleic acid coding sequences, reference to "an enzyme" includes
one or more enzymes, and the like.
[0022] Unless defined otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the art to which the
invention pertains. Although other methods and materials similar, or equivalent, to
those described herein can be used in the practice of the present invention, the preferred
materials and methods are described herein.
[0023] In describing and claiming the present invention, the following terminology will
be used in accordance with the definitions set out below.
[0024] Accession Numbers: Sequence Accession numbers throughout this description were obtained
from databases provided by the NCBI (National Center for Biotechnology Information)
maintained by the National Institutes of Health, U.S.A. (which are identified herein
as "NCBI Accession Numbers" or alternatively as "GenBank Accession Numbers"), and
from the UniProt Knowledgebase (UniProtKB) and Swiss-Prot databases provided by the
Swiss Institute of Bioinformatics (which are identified herein as "UniProtKB Accession
Numbers").
[0025] Enzyme Classification (EC) Numbers: EC numbers are established by the Nomenclature
Committee of the International Union of Biochemistry and Molecular Biology (IUBMB),
description of which is available on the IUBMB Enzyme Nomenclature website on the
World Wide Web. EC numbers classify enzymes according to the reaction catalyzed.
[0026] The term "FadR polypeptide" refers to a polypeptide having biological activity corresponding
to that of FadR derived from
E. coli MG1655 (SEQ ID NO: 1).
[0027] As used herein, the term "fatty acid or derivative thereof" means a "fatty acid"
or a "fatty acid derivative." The term "fatty acid" means a carboxylic acid having
the formula RCOOH. R represents an aliphatic group, preferably an alkyl group. R can
comprise between about 4 and about 22 carbon atoms. Fatty acids can be saturated,
monounsaturated, or polyunsaturated. In a preferred embodiment, the fatty acid is
made from a fatty acid biosynthetic pathway. A "fatty acid derivative" is a product
made in part from the fatty acid biosynthetic pathway of the production host organism.
"Fatty acid derivatives" includes products made in part from acyl-ACP or acyl-ACP
derivatives. Exemplary fatty acid derivatives include, for example, acyl-CoA, fatty
acids, fatty aldehydes, short and long chain alcohols, hydrocarbons, fatty alcohols,
esters (e.g., waxes, fatty acid esters, or fatty esters), terminal olefins, internal
olefins, and ketones.
[0028] A "fatty acid derivative composition" as referred to herein is produced by a recombinant
host cell and typically comprises a mixture of fatty acid derivative. In some cases,
the mixture includes more than one type of product (e.g., fatty acids and fatty alcohols,
fatty acids and fatty acid esters or alkanes and olefins). In other cases, the fatty
acid derivative compositions may comprise, for example, a mixture of fatty alcohols
(or another fatty acid derivative) with various chain lengths and saturation or branching
characteristics. In still other cases, the fatty acid derivative composition comprises
a mixture of both more than one type of product and products with various chain lengths
and saturation or branching characteristics.
[0029] As used herein "acyl-CoA" refers to an acyl thioester formed between the carbonyl
carbon of alkyl chain and the sulfhydryl group of the 4'-phosphopantethionyl moiety
of coenzyme A (CoA), which has the formula R-C(O)S-CoA, where R is any alkyl group
having at least 4 carbon atoms.
[0030] As used herein "acyl-ACP" refers to an acyl thioester formed between the carbonyl
carbon of alkyl chain and the sulfhydryl group of the phosphopantetheinyl moiety of
an acyl carrier protein (ACP). The phosphopantetheinyl moiety is post-translationally
attached to a conserved serine residue on the ACP by the action of holo-acyl carrier
protein synthase (ACPS), a phosphopantetheinyl transferase. In some embodiments an
acyl-ACP is an intermediate in the synthesis of fully saturated acyl-ACPs. In other
embodiments an acyl-ACP is an intermediate in the synthesis of unsaturated acyl-ACPs.
In some embodiments, the carbon chain will have about 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 carbons. Each of these acyl-ACPs
are substrates for enzymes that convert them to fatty acid derivatives.
[0031] As used herein, the term "fatty acid biosynthetic pathway" means a biosynthetic pathway
that produces fatty acids. The fatty acid biosynthetic pathway includes fatty acid
synthases that can be engineered to produce fatty acids, and in some embodiments can
be expressed with additional enzymes to produce fatty acids having desired carbon
chain characteristics.
[0032] As used herein, "fatty aldehyde" means an aldehyde having the formula RCHO characterized
by a carbonyl group (C=O). In some embodiments, the fatty aldehyde is any aldehyde
made from a fatty acid or fatty acid derivative.
[0033] As used herein, "fatty alcohol" means an alcohol having the formula ROH. In some
embodiments, the fatty alcohol is any alcohol made from a fatty acid or fatty acid
derivative.
[0034] In certain embodiments, the R group of a fatty acid, fatty aldehyde, or fatty alcohol
is at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17,
at least 18, or at least 19, carbons in length. Alternatively, or in addition, the
R group is 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less,
14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less,
7 or less, or 6 or less carbons in length. Thus, the R group can have an R group bounded
by any two of the above endpoints. For example, the R group can be 6-16 carbons in
length, 10-14 carbons in length, or 12-18 carbons in length. In some embodiments,
the fatty acid, fatty aldehyde, or fatty alcohol is a C
6, C
7, C
8, C
9, C
10, C
11, C
12, C
13, C
14, C
15, C
16, C
17, C
18, C
19, C
20, C
21, C
22, C
23, C
24, C
25, or a C
26 fatty acid, fatty aldehyde, or fatty alcohol. In certain embodiments, the fatty acid,
fatty aldehyde, or fatty alcohol is a C
6, C
8, C
10, C
12, C
13, C
14, C
15, C
16, C
17, or C
18 fatty acid, fatty aldehyde, or fatty alcohol.
[0035] The R group of a fatty acid, fatty aldehyde, or fatty alcohol can be a straight chain
or a branched chain. Branched chains may have more than one point of branching and
may include cyclic branches. In some embodiments, the branched fatty acid, branched
fatty aldehyde, or branched fatty alcohol is a C
6, C
7, C
8, C
9, C
10, C
11, C
12, C
13, C
14, C
15, C
16, C
17, C
18, C
19, C
20, C
21, C
22, C
23, C
24, C
25, or a C
26 branched fatty acid, branched fatty aldehyde, or branched fatty alcohol. In particular
embodiments, the branched fatty acid, branched fatty aldehyde, or branched fatty alcohol
is a C
6, C
8, C
10, C
12, C
13, C
14, C
15, C
16, C
17, or C
18 branched fatty acid, branched fatty aldehyde, or branched fatty alcohol. In certain
embodiments, the hydroxyl group of the branched fatty acid, branched fatty aldehyde,
or branched fatty alcohol is in the primary (C
1) position.
[0036] In certain embodiments, the branched fatty acid, branched fatty aldehyde, or branched
fatty alcohol is an iso-fatty acid, iso-fatty aldehyde, or iso-fatty alcohol, or an
antesio-fatty acid, an anteiso-fatty aldehyde, or anteiso-fatty alcohol. In exemplary
embodiments, the branched fatty acid, branched fatty aldehyde, or branched fatty alcohol
is selected from iso-C
7:0, iso-C
8:0, iso-C
9:0, iso-C
10:0, iso-C
11:0, iso-C
12:0, iso-C
13:0, iso-C
14:0, iso-C
15:0, iso-C
16:0, iso-C
17:0, iso-C
18:0, iso-C
19:0, anteiso-C
7:0, anteiso-C
8:0, anteiso-C
9:0, anteiso-C
10:0, anteiso-C
11:0, anteiso-C
12:0, anteiso-C
13:0, anteiso-C
14:0, anteiso-C
15:0, anteiso-C
16:0, anteiso-C
17:0, anteiso-C
18:0, and anteiso-C
19:0 branched fatty acid, branched fatty aldehyde or branched fatty alcohol.
[0037] The R group of a branched or unbranched fatty acid, branched or unbranched fatty
aldehyde, or branched or unbranched fatty alcohol can be saturated or unsaturated.
If unsaturated, the R group can have one or more than one point of unsaturation. In
some embodiments, the unsaturated fatty acid, unsaturated fatty aldehyde, or unsaturated
fatty alcohol is a monounsaturated fatty acid, monounsaturated fatty aldehyde, or
monounsaturated fatty alcohol. In certain embodiments, the unsaturated fatty acid,
unsaturated fatty aldehyde, or unsaturated fatty alcohol is a C6:1, C7:1, C8:1, C9:1,
C10:1, C11:1, C12:1, C13:1, C14:1, C15:1, C16:1, C17:1, C18:1, C19:1, C20:1, C21:1,
C22:1, C23:1, C24:1, C25:1, or a C26:1 unsaturated fatty acid, unsaturated fatty aldehyde,
or unsaturated fatty alcohol. In certain preferred embodiments, the unsaturated fatty
acid, unsaturated fatty aldehyde, or unsaturated fatty alcohol is C10:1 , C12:1, C14:1,
C16:1, or C18:1. In yet other embodiments, the unsaturated fatty acid, unsaturated
fatty aldehyde, or unsaturated fatty alcohol is unsaturated at the omega-7 position.
In certain embodiments, the unsaturated fatty acid, unsaturated fatty aldehyde, or
unsaturated fatty alcohol comprises a cis double bond.
[0038] As used herein, the term "alkane" means saturated hydrocarbons or compounds that
consist only of carbon (C) and hydrogen (H), wherein these atoms are linked together
by single bonds (i.e., they are saturated compounds).
[0039] The terms "olefin" and "alkene" are used interchangeably herein, and refer to hydrocarbons
containing at least one carbon-to-carbon double bond (i.e., they are unsaturated compounds).
[0040] The terms "terminal olefin," "α-olefin", "terminal alkene" and "1-alkene" are used
interchangeably herein with reference to α-olefins or alkenes with a chemical formula
C
xH2
x, distinguished from other olefins with a similar molecular formula by linearity of
the hydrocarbon chain and the position of the double bond at the primary or alpha
position.
[0041] As used herein, the term "fatty ester" may be used in reference to an ester. In a
preferred embodiment, a fatty ester is any ester made from a fatty acid, for example
a fatty acid ester. In some embodiments, a fatty ester contains an A side and a B
side. As used herein, an "A side" of an ester refers to the carbon chain attached
to the carboxylate oxygen of the ester. As used herein, a "B side" of an ester refers
to the carbon chain comprising the parent carboxylate of the ester. In embodiments
where the fatty ester is derived from the fatty acid biosynthetic pathway, the A side
is contributed by an alcohol, and the B side is contributed by a fatty acid.
[0042] Any alcohol can be used to form the A side of the fatty esters. For example, the
alcohol can be derived from the fatty acid biosynthetic pathway. Alternatively, the
alcohol can be produced through non-fatty acid biosynthetic pathways. Moreover, the
alcohol can be provided exogenously. For example, the alcohol can be supplied in the
fermentation broth in instances where the fatty ester is produced by an organism.
Alternatively, a carboxylic acid, such as a fatty acid or acetic acid, can be supplied
exogenously in instances where the fatty ester is produced by an organism that can
also produce alcohol.
[0043] The carbon chains comprising the A side or B side can be of any length. In one embodiment,
the A side of the ester is at least about 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 16,
or 18 carbons in length. When the fatty ester is a fatty acid methyl ester, the A
side of the ester is 1 carbon in length. When the fatty ester is a fatty acid ethyl
ester, the A side of the ester is 2 carbons in length. The B side of the ester can
be at least about 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, or 26 carbons in length.
The A side and/or the B side can be straight or branched chain. The branched chains
can have one or more points of branching. In addition, the branched chains can include
cyclic branches. Furthermore, the A side and/or B side can be saturated or unsaturated.
If unsaturated, the A side and/or B side can have one or more points of unsaturation.
[0044] In some embodiments, the fatty acid ester is a fatty acid methyl ester (FAME) or
a fatty acid ethyl ester (FAEE). In certain embodiments, the FAME is a beta-hydroxy
(B-OH) FAME. In one embodiment, the fatty ester is produced biosynthetically. In this
embodiment, first the fatty acid is "activated." Non-limiting examples of "activated"
fatty acids are acyl-CoA, acyl ACP, and acyl phosphate. Acyl-CoA can be a direct product
of fatty acid biosynthesis or degradation. In addition, acyl-CoA can be synthesized
from a free fatty acid, a CoA, and an adenosine nucleotide triphosphate (ATP). An
example of an enzyme which produces acyl-CoA is acyl-CoA synthase.
[0045] After a fatty acid is activated, it can be readily transferred to a recipient nucleophile.
Exemplary nucleophiles are alcohols, thiols, or phosphates.
[0046] In one embodiment, the fatty ester is a wax. The wax can be derived from a long chain
alcohol and a long chain fatty acid. In another embodiment, the fatty ester is a fatty
acid thioester, for example, fatty acyl Coenzyme A (CoA). In other embodiments, the
fatty ester is a fatty acyl pantothenate, an acyl carrier protein (ACP), or a fatty
phosphate ester.
[0047] As used herein "acyl CoA" refers to an acyl thioester formed between the carbonyl
carbon of alkyl chain and the sulfydryl group of the 4'-phosphopantethionyl moiety
of coenzyme A (CoA), which has the formula R-C(O)S-CoA, where R is any alkyl group
having at least 4 carbon atoms. In some instances an acyl CoA will be an intermediate
in the synthesis of fully saturated acyl CoAs, including, but not limited to 3-keto-acyl
CoA, a 3-hydroxy acyl CoA, a delta-2-trans-enoyl-CoA, or an alkyl acyl CoA. In some
embodiments, the carbon chain will have about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 carbons. In other embodiments the acyl
CoA will be branched. In one embodiment the branched acyl CoA is an isoacyl CoA, in
another it is an anti-isoacyl CoA. Each of these "acyl CoAs" are substrates for enzymes
that convert them to fatty acid derivatives such as those described herein.
[0048] The terms "altered level of expression" and "modified level of expression" are used
interchangeably and mean that a polynucleotide, polypeptide, or hydrocarbon is present
in a different concentration in an engineered host cell as compared to its concentration
in a corresponding wild-type cell under the same conditions.
[0049] "Polynucleotide" refers to a polymer of DNA or RNA, which can be single-stranded
or double-stranded and which can contain non-natural or altered nucleotides. The terms
"polynucleotide," "nucleic acid," and "nucleic acid molecule" are used herein interchangeably
to refer to a polymeric form of nucleotides of any length, either ribonucleotides
(RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of
the molecule, and thus include double- and single-stranded DNA, and double- and single-stranded
RNA. The terms include, as equivalents, analogs of either RNA or DNA made from nucleotide
analogs and modified polynucleotides such as, though not limited to methylated and/or
capped polynucleotides. The polynucleotide can be in any form, including but not limited
to plasmid, viral, chromosomal, EST, cDNA, mRNA, and rRNA.
[0050] The term "nucleotide" as used herein refers to a monomeric unit of a polynucleotide
that consists of a heterocyclic base, a sugar, and one or more phosphate groups. The
naturally occurring bases (guanine, (G), adenine, (A), cytosine, (C), thymine, (T),
and uracil (U)) are typically derivatives of purine or pyrimidine, though it should
be understood that naturally and non-naturally occurring base analogs are also included.
The naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which
forms DNA) or ribose (which forms RNA), though it should be understood that naturally
and non-naturally occurring sugar analogs are also included. Nucleic acids are typically
linked via phosphate bonds to form nucleic acids or polynucleotides, though many other
linkages are known in the art (e.g., phosphorothioates, boranophosphates, and the
like).
[0051] Polynucleotides described herein may comprise degenerate nucleotides which are defined
according to the IUPAC code for nucleotide degeneracy wherein B is C, G, or T; D is
A, G, or T; H is A, C, or T; K is G or T; M is A or C; N is A, C, G, or T; R is A
or G; S is C or G; V is A, C, or G; W is A or T; and Y is C or T.
[0052] The terms "polypeptide" and "protein" refer to a polymer of amino acid residues.
The term "recombinant polypeptide" refers to a polypeptide that is produced by recombinant
DNA techniques, wherein generally DNA encoding the expressed protein or RNA is inserted
into a suitable expression vector that is in turn used to transform a host cell to
produce the polypeptide or RNA.
[0053] In some embodiments, the polypeptide, polynucleotide, or hydrocarbon having an altered
or modified level of expression is "overexpressed" or has an "increased level of expression."
As used herein, "overexpress" and "increasing the level of expression" mean to express
or cause to be expressed a polynucleotide, polypeptide, or hydrocarbon in a cell at
a greater concentration than is normally expressed in a corresponding wild-type cell
under the same conditions. For example, a polypeptide can be "overexpressed" in an
engineered host cell when the polypeptide is present in a greater concentration in
the engineered host cell as compared to its concentration in a non-engineered host
cell of the same species under the same conditions.
[0054] In other embodiments, the polypeptide, polynucleotide, or hydrocarbon having an altered
level of expression is "attenuated" or has a "decreased level of expression." As used
herein, "attenuate" and "decreasing the level of expression" mean to express or cause
to be expressed a polynucleotide, polypeptide, or hydrocarbon in a cell at a lesser
concentration than is normally expressed in a corresponding wild-type cell under the
same conditions.
[0055] The degree of overexpression or attenuation can be 1.5-fold or more, e.g., 2-fold
or more, 3-fold or more, 5-fold or more, 10-fold or more, or 15-fold or more. Alternatively,
or in addition, the degree of overexpression or attenuation can be 500-fold or less,
e.g., 100-fold or less, 50-fold or less, 25-fold or less, or 20-fold or less. Thus,
the degree of overexpression or attenuation can be bounded by any two of the above
endpoints. For example, the degree of overexpression or attenuation can be 1.5-500-fold,
2-50-fold, 10-25-fold, or 15-20-fold.
[0056] In some embodiments, a polypeptide described herein has "increased level of activity."
By "increased level of activity" is meant that a polypeptide has a higher level of
biochemical or biological function (e.g., DNA binding or enzymatic activity) in an
engineered host cell as compared to its level of biochemical and/or biological function
in a corresponding wild-type host cell under the same conditions. The degree of enhanced
activity can be about 10% or more, about 20% or more, about 50% or more, about 75%
or more, about 100% or more, about 200% or more, about 500% or more, about 1000% or
more, or any range therein.
[0057] A polynucleotide or polypeptide can be attenuated using methods known in the art.
In some embodiments, the expression of a gene or polypeptide encoded by the gene is
attenuated by mutating the regulatory polynucleotide sequences which control expression
of the gene. In other embodiments, the expression of a gene or polypeptide encoded
by the gene is attenuated by overexpressing a repressor protein, or by providing an
exogenous regulatory element that activates a repressor protein. In still yet other
embodiments, DNA- or RNA-based gene silencing methods are used to attenuate the expression
of a gene or polynucleotide. In some embodiments, the expression of a gene or polypeptide
is completely attenuated, e.g., by deleting all or a portion of the polynucleotide
sequence of a gene.
[0058] A polynucleotide or polypeptide can be overexpressed using methods known in the art.
In some aspects, overexpression of a polypeptide is achieved by the use of an exogenous
regulatory element. The term "exogenous regulatory element" generally refers to a
regulatory element originating outside of the host cell. However, in certain aspects,
the term "exogenous regulatory element" can refer to a regulatory element derived
from the host cell whose function is replicated or usurped for the purpose of controlling
the expression of an endogenous polypeptide. For example, if the host cell is an
E. coli cell, and the FadR polypeptide is a encoded by an endogenous
fadR gene, then expression of the endogenous
fadR can be controlled by a promoter derived from another
E. coli gene.
[0059] In some aspects, the exogenous regulatory element is a chemical compound, such as
a small molecule. As used herein, the term "small molecule" refers to a substance
or compound having a molecular weight of less than about 1,000 g/mol.
[0060] In some aspects, the exogenous regulatory element which controls the expression of
an endogenous
fadR gene is an expression control sequence which is operably linked to the endogenous
fadR gene by recombinant integration into the genome of the host cell. In certain aspects,
the expression control sequence is integrated into a host cell chromosome by homologous
recombination using methods known in the art (e.g.,
Datsenko et al., Proc. Natl. Acad. Sci. U.S.A., 97(12): 6640-6645 (2000)).
[0061] Expression control sequences are known in the art and include, for example, promoters,
enhancers, polyadenylation signals, transcription terminators, internal ribosome entry
sites (IRES), ribosome binding sites (RBS) and the like, that provide for the expression
of the polynucleotide sequence in a host cell. Expression control sequences interact
specifically with cellular proteins involved in transcription (
Maniatis et al., Science, 236: 1237-1245 (1987)). Exemplary expression control sequences are described in, for example,
Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press,
San Diego, Calif. (1990). In the methods of the invention the expression control sequence is a heterologous
promoter and/or ribosome binding site.
[0062] In the methods of the invention, an expression control sequence is operably linked
to a polynucleotide sequence. By "operably linked" is meant that a polynucleotide
sequence and an expression control sequence(s) are connected in such a way as to permit
gene expression when the appropriate molecules (e.g., transcriptional activator proteins)
are bound to the expression control sequence(s). Operably linked promoters are located
upstream of the selected polynucleotide sequence in terms of the direction of transcription
and translation. Operably linked enhancers can be located upstream, within, or downstream
of the selected polynucleotide.
[0063] In some embodiments, the polynucleotide sequence is provided to the host cell by
way of a recombinant vector, which comprises a promoter operably linked to the polynucleotide
sequence. In certain embodiments, the promoter is a developmentally-regulated, an
organelle-specific, a tissue-specific, an inducible, a constitutive, or a cell-specific
promoter.
[0064] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting
another nucleic acid, i.e., a polynucleotide sequence, to which it has been linked.
One type of useful vector is an episome (i.e., a nucleic acid capable of extra-chromosomal
replication). Useful vectors are those capable of autonomous replication and/or expression
of nucleic acids to which they are linked. Vectors capable of directing the expression
of genes to which they are operatively linked are referred to herein as "expression
vectors." In general, expression vectors of utility in recombinant DNA techniques
are often in the form of "plasmids," which refer generally to circular double stranded
DNA loops that, in their vector form, are not bound to the chromosome. The terms "plasmid"
and "vector" are used interchangeably herein, inasmuch as a plasmid is the most commonly
used form of vector. However, also included are such other forms of expression vectors
that serve equivalent functions and that become known in the art subsequently hereto.
[0065] The term "regulatory sequences" as used herein typically refers to a sequence of
bases in DNA, operably-linked to DNA sequences encoding a protein that ultimately
controls the expression of the protein. Examples of regulatory sequences include,
but are not limited to, RNA promoter sequences, transcription factor binding sequences,
transcription termination sequences, modulators of transcription (such as enhancer
elements), nucleotide sequences that affect RNA stability, and translational regulatory
sequences (such as, ribosome binding sites (e.g., Shine-Dalgarno sequences in prokaryotes
or Kozak sequences in eukaryotes), initiation codons, termination codons).
[0066] As used herein, the phrase "the expression of said nucleotide sequence is modified
relative to the wild type nucleotide sequence," means an increase or decrease in the
level of expression and/or activity of an endogenous nucleotide sequence or the expression
and/or activity of a heterologous or non-native polypeptide-encoding nucleotide sequence.
[0067] As used herein, the term "express" with respect to a polynucleotide is to cause it
to function. A polynucleotide which encodes a polypeptide (or protein) will, when
expressed, be transcribed and translated to produce that polypeptide (or protein).
As used herein, the term "overexpress" means to express or cause to be expressed a
polynucleotide or polypeptide in a cell at a greater concentration than is normally
expressed in a corresponding wild-type cell under the same conditions.
[0068] In some aspects, the recombinant vector comprises at least one sequence selected
from the group consisting of (a) an expression control sequence operatively coupled
to the polynucleotide sequence; (b) a selection marker operatively coupled to the
polynucleotide sequence; (c) a marker sequence operatively coupled to the polynucleotide
sequence; (d) a purification moiety operatively coupled to the polynucleotide sequence;
(e) a secretion sequence operatively coupled to the polynucleotide sequence; and (f)
a targeting sequence operatively coupled to the polynucleotide sequence.
[0069] The expression vectors described herein include a polynucleotide sequence described
herein in a form suitable for expression of the polynucleotide sequence in a host
cell. It will be appreciated by those skilled in the art that the design of the expression
vector can depend on such factors as the choice of the host cell to be transformed,
the level of expression of polypeptide desired, etc. The expression vectors described
herein can be introduced into host cells to produce polypeptides, including fusion
polypeptides, encoded by the polynucleotide sequences as described herein.
[0070] Expression of genes encoding polypeptides in prokaryotes, for example,
E. coli, is most often carried out with vectors containing constitutive or inducible promoters
directing the expression of either fusion or non-fusion polypeptides. Fusion vectors
add a number of amino acids to a polypeptide encoded therein, usually to the amino-
or carboxy- terminus of the recombinant polypeptide. Such fusion vectors typically
serve one or more of the following three purposes: (1) to increase expression of the
recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide;
and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand
in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage
site is introduced at the junction of the fusion moiety and the recombinant polypeptide.
This enables separation of the recombinant polypeptide from the fusion moiety after
purification of the fusion polypeptide. Examples of such enzymes, and their cognate
recognition sequences, include Factor Xa, thrombin, and enterokinase. Exemplary fusion
expression vectors include pGEX (Pharmacia Biotech, Inc., Piscataway, NJ;
Smith et al., Gene, 67: 31-40 (1988)), pMAL (New England Biolabs, Beverly, MA), and pRITS (Pharmacia Biotech, Inc., Piscataway,
N.J.), which fuse glutathione S-transferase (GST), maltose E binding protein, or protein
A, respectively, to the target recombinant polypeptide.
[0071] Suitable expression systems for both prokaryotic and eukaryotic cells are well known
in the art; see, e.g.,
Sambrook et al., "Molecular Cloning: A Laboratory Manual," second edition, Cold Spring
Harbor Laboratory (1989). Examples of inducible, non-fusion
E. coli expression vectors include pTrc (
Amann et al., Gene, 69: 301-315 (1988)) and PET 11d (
Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, CA, pp. 60-89 (1990)). In certain embodiments, a polynucleotide sequence of the invention is operably
linked to a promoter derived from bacteriophage T5. Examples of vectors for expression
in yeast include pYepSec1 (
Baldari et al., EMBO J., 6: 229-234 (1987)), pMFa (
Kurjan et al., Cell, 30: 933-943 (1982)), pJRY88 (
Schultz et al., Gene, 54: 113-123 (1987)), pYES2 (Invitrogen Corp., San Diego, CA), and picZ (Invitrogen Corp., San Diego,
CA). Baculovirus vectors available for expression of proteins in cultured insect cells
(e.g., Sf9 cells) include, for example, the pAc series (
Smith et al., Mol. Cell Biol., 3: 2156-2165 (1983)) and the pVL series (
Lucklow et al., Virology, 170: 31-39 (1989)). Examples of mammalian expression vectors include pCDM8 (
Seed, Nature, 329: 840 (1987)) and pMT2PC (
Kaufinan et al., EMBO J., 6: 187-195 (1987)).
[0072] Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation
or transfection techniques. As used herein, the terms "transformation" and "transfection"
refer to a variety of art-recognized techniques for introducing foreign nucleic acid
(e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods
for transforming or transfecting host cells can be found in, for example, Sambrook
et al. (
supra).
[0073] For stable transformation of bacterial cells, it is known that, depending upon the
expression vector and transformation technique used, only a small fraction of cells
will take-up and replicate the expression vector. In order to identify and select
these transformants, a gene that encodes a selectable marker (e.g., resistance to
an antibiotic) can be introduced into the host cells along with the gene of interest.
Selectable markers include those that confer resistance to drugs such as, but not
limited to, ampicillin, kanamycin, chloramphenicol, or tetracycline. Nucleic acids
encoding a selectable marker can be introduced into a host cell on the same vector
as that encoding a polypeptide described herein or can be introduced on a separate
vector. Cells stably transformed with the introduced nucleic acid can be identified
by growth in the presence of an appropriate selection drug.
[0074] Similarly, for stable transfection of mammalian cells, it is known that, depending
upon the expression vector and transfection technique used, only a small fraction
of cells may integrate the foreign DNA into their genome. In order to identify and
select these integrants, a gene that encodes a selectable marker (e.g., resistance
to an antibiotic) can be introduced into the host cells along with the gene of interest.
Preferred selectable markers include those which confer resistance to drugs, such
as G418, hygromycin, and methotrexate. Nucleic acids encoding a selectable marker
can be introduced into a host cell on the same vector as that encoding a polypeptide
described herein or can be introduced on a separate vector. Cells stably transfected
with the introduced nucleic acid can be identified by growth in the presence of an
appropriate selection drug.
[0075] In some embodiments, the FadR polypeptide has the amino acid sequence of SEQ ID NO:
1.
[0076] In other embodiments, the FadR polypeptide is encoded by a
fadR gene obtained from microorganisms of the genera
Escherichia, Salmonella, Citrobacter, Enterobacter, Klebsiella, Cronobacter, Yersinia,
Serratia, Erwinia, Pectobacterium, Photorhabdus, Edwardsiella, Shewanella, or
Vibrio.
[0077] In other embodiments, the FadR polypeptide is a homologue of FadR having an amino
acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 1.
[0078] The identity of a FadR polypeptide having at least 80% identity to the amino acid
sequence of SEQ ID NO: 1 is not particularly limited, and one of ordinary skill in
the art can readily identify homologues of
E. coli MG1655 derived-FadR using the methods described herein as well as methods known in
the art.
[0079] As used herein, the terms "homolog," and "homologous" refer to a polynucleotide or
a polypeptide comprising a sequence that is at least about 50% identical to the corresponding
polynucleotide or polypeptide sequence. Preferably homologous polynucleotides or polypeptides
have polynucleotide sequences or amino acid sequences that have at least about 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 2%, 93%, 94%, 95%, 96%, 97%,
98% or at least about 99% homology to the corresponding amino acid sequence or polynucleotide
sequence. As used herein the terms sequence "homology" and sequence "identity" are
used interchangeably.
[0080] Briefly, calculations of "homology" between two sequences can be performed as follows.
The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced
in one or both of a first and a second amino acid or nucleic acid sequence for optimal
alignment and non-homologous sequences can be disregarded for comparison purposes.
The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide
positions of the first and second sequences are then compared. When a position in
the first sequence is occupied by the same amino acid residue or nucleotide as the
corresponding position in the second sequence, then the molecules are identical at
that position (as used herein, amino acid or nucleic acid "identity" is equivalent
to amino acid or nucleic acid "homology"). The percent identity between the two sequences
is a function of the number of identical positions shared by the sequences, taking
into account the number of gaps and the length of each gap, which need to be introduced
for optimal alignment of the two sequences.
[0081] The comparison of sequences and determination of percent homology between two sequences
can be accomplished using a mathematical algorithm, such as BLAST (
Altschul et al., J. Mol. Biol., 215(3): 403-410 (1990)). The percent homology between two amino acid sequences also can be determined using
the Needleman and Wunsch algorithm that has been incorporated into the GAP program
in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix,
and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3,4, 5,
or 6 (
Needleman and Wunsch, J. Mol. Biol., 48: 444-453 (1970)). The percent homology between two nucleotide sequences also can be determined using
the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap
weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. One of
ordinary skill in the art can perform initial homology calculations and adjust the
algorithm parameters accordingly. A preferred set of parameters (and the one that
should be used if a practitioner is uncertain about which parameters should be applied
to determine if a molecule is within a homology limitation of the claims) are a Blossum
62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift
gap penalty of 5. Additional methods of sequence alignment are known in the biotechnology
arts (see, e.g.,
Rosenberg, BMC Bioinformatics, 6: 278 (2005);
Altschul et al., FEBS J., 272(20): 5101-5109 (2005)).
[0082] As used herein, the term "hybridizes under low stringency, medium stringency, high
stringency, or very high stringency conditions" describes conditions for hybridization
and washing. Guidance for performing hybridization reactions can be found in
Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 - 6.3.6. Aqueous and nonaqueous methods are described in that reference and either method
can be used. Specific hybridization conditions referred to herein are as follows:
1) low stringency hybridization conditions in 6X sodium chloride/sodium citrate (SSC)
at about 45 °C, followed by two washes in 0.2X SSC, 0.1% SDS at least at 50 °C (the
temperature of the washes can be increased to 55 °C for low stringency conditions);
2) medium stringency hybridization conditions in 6X SSC at about 45 °C, followed by
one or more washes in 0.2X SSC, 0.1% SDS at 60 °C; 3) high stringency hybridization
conditions in 6X SSC at about 45 °C, followed by one or more washes in 0.2.X SSC,
0.1% SDS at 65 °C; and preferably 4) very high stringency hybridization conditions
are 0.5M sodium phosphate, 7% SDS at 65 °C, followed by one or more washes at 0.2X
SSC, 1% SDS at 65 °C. Very high stringency conditions (4) are the preferred conditions
unless otherwise specified.
[0083] In some embodiments, the polypeptide is a fragment of any of the polypeptides described
herein. The term "fragment" refers to a shorter portion of a full-length polypeptide
or protein ranging in size from four amino acid residues to the entire amino acid
sequence minus one amino acid residue. In certain embodiments of the invention, a
fragment refers to the entire amino acid sequence of a domain of a polypeptide or
protein (e.g., a substrate binding domain or a catalytic domain).
[0084] An "endogenous" polypeptide refers to a polypeptide encoded by the genome of the
parental microbial cell (also termed "host cell") from which the recombinant cell
is engineered (or "derived").
[0085] An "exogenous" polypeptide refers to a polypeptide which is not encoded by the genome
of the parental microbial cell. A variant (i.e., mutant) polypeptide is an example
of an exogenous polypeptide.
[0086] The term "heterologous" as used herein typically refers to a nucleotide sequence
or a protein not naturally present in an organism. For example, a polynucleotide sequence
endogenous to a plant can be introduced into a host cell by recombinant methods, and
the plant polynucleotide is then a heterologous polynucleotide in a recombinant host
cell.
[0087] In some embodiments, the polypeptide is a mutant or a variant of any of the polypeptides
described herein. The terms "mutant" and "variant" as used herein refer to a polypeptide
having an amino acid sequence that differs from a wild-type polypeptide by at least
one amino acid. For example, the mutant can comprise one or more of the following
conservative amino acid substitutions: replacement of an aliphatic amino acid, such
as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement
of a serine with a threonine; replacement of a threonine with a serine; replacement
of an acidic residue, such as aspartic acid and glutamic acid, with another acidic
residue; replacement of a residue bearing an amide group, such as asparagine and glutamine,
with another residue bearing an amide group; exchange of a basic residue, such as
lysine and arginine, with another basic residue; and replacement of an aromatic residue,
such as phenylalanine and tyrosine, with another aromatic residue. In some embodiments,
the mutant polypeptide has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50,
60, 70, 80, 90, 100, or more amino acid substitutions, additions, insertions, or deletions.
[0088] As used herein, the term "mutagenesis" refers to a process by which the genetic information
of an organism is changed in a stable manner. Mutagenesis of a protein coding nucleic
acid sequence produces a mutant protein. Mutagenesis also refers to changes in non-coding
nucleic acid sequences that result in modified protein activity.
[0089] As used herein, the term "gene" refers to nucleic acid sequences encoding either
an RNA product or a protein product, as well as operably-linked nucleic acid sequences
affecting the expression of the RNA or protein (e.g., such sequences include but are
not limited to promoter or enhancer sequences) or operably-linked nucleic acid sequences
encoding sequences that affect the expression of the RNA or protein (e.g., such sequences
include but are not limited to ribosome binding sites or translational control sequences).
[0090] In certain embodiments, the FadR polypeptide comprises a mutation at an amino acid
residue corresponding to amino acid 219 of SEQ ID NO: 1. In certain embodiments, the
mutation results in a substitution of the amino acid residue corresponding to amino
acid 219 of SEQ ID NO: 1 with an asparagine residue. The FadR(S219N) mutation has
been previously described (
Raman et al., J. Biol. Chem., 270: 1092-1097 (1995)).
[0091] Preferred fragments or mutants of a polypeptide retain some or all of the biological
function (e.g., enzymatic activity) of the corresponding wild-type polypeptide. In
some embodiments, the fragment or mutant retains at least 75%, at least 80%, at least
90%, at least 95%, or at least 98% or more of the biological function of the corresponding
wild-type polypeptide. In other embodiments, the fragment or mutant retains about
100% of the biological function of the corresponding wild-type polypeptide. Guidance
in determining which amino acid residues may be substituted, inserted, or deleted
without affecting biological activity may be found using computer programs well known
in the art, for example, LASERGENE™ software (DNASTAR, Inc., Madison, WI).
[0092] In yet other embodiments, a fragment or mutant exhibits increased biological function
as compared to a corresponding wild-type polypeptide. For example, a fragment or mutant
may display at least a 10%, at least a 25%, at least a 50%, at least a 75%, or at
least a 90% improvement in enzymatic activity as compared to the corresponding wild-type
polypeptide. In other embodiments, the fragment or mutant displays at least 100% (e.g.,
at least 200%, or at least 500%) improvement in enzymatic activity as compared to
the corresponding wild-type polypeptide.
[0093] It is understood that the polypeptides described herein may have additional conservative
or non-essential amino acid substitutions, which do not have a substantial effect
on the polypeptide function. Whether or not a particular substitution will be tolerated
(i.e., will not adversely affect desired biological function, such as DNA binding
or enzyme activity) can be determined as described in
Bowie et al. (Science, 247: 1306-1310 (1990)).
[0094] A "conservative amino acid substitution" is one in which the amino acid residue is
replaced with an amino acid residue having a similar side chain. Families of amino
acid residues having similar side chains have been defined in the art. These families
include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic
side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side
chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0095] Variants can be naturally occurring or created
in vitro. In particular, such variants can be created using genetic engineering techniques,
such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion
procedures, or standard cloning techniques. Alternatively, such variants, fragments,
analogs, or derivatives can be created using chemical synthesis or modification procedures.
[0096] Methods of making variants are well known in the art. These include procedures in
which nucleic acid sequences obtained from natural isolates are modified to generate
nucleic acids that encode polypeptides having characteristics that enhance their value
in industrial or laboratory applications. In such procedures, a large number of variant
sequences having one or more nucleotide differences with respect to the sequence obtained
from the natural isolate are generated and characterized. Typically, these nucleotide
differences result in amino acid changes with respect to the polypeptides encoded
by the nucleic acids from the natural isolates.
[0097] For example, variants can be prepared by using random and site-directed mutagenesis
(see, e.g.,
Arnold, Curr. Opin. Biotech., 4: 450-455 (1993)). Random mutagenesis can be achieved using error prone PCR (see, e.g.,
Leung et al., Technique, 1: 11-15 (1989); and
Caldwell et al., PCR Methods Applic., 2: 28-33 (1992)). Site-directed mutagenesis can be achieved using oligonucleotide-directed mutagenesis
to generate site-specific mutations in any cloned DNA of interest (see, e.g.,
Reidhaar-Olson et al., Science, 241: 53-57 (1988)). Other methods for generating variants include, e.g., assembly PCR (see, e.g.,
U.S. Patent 5,965,408), sexual PCR mutagenesis (see, e.g.,
Stemmer, Proc. Natl. Acad. Sci., U.S.A., 91: 10747-10751 (1994) and
U.S. Patents 5,965,408 and
5,939,250), recursive ensemble mutagenesis (see, e.g.,
Arkin et al., Proc. Natl. Acad. Sci., U.S.A., 89: 7811-7815 (1992)), and exponential ensemble mutagenesis (see, e.g.,
Delegrave et al., Biotech. Res, 11: 1548-1552 (1993).
[0098] Variants can also be created by
in vivo mutagenesis. In some embodiments, random mutations in a nucleic acid sequence are
generated by propagating the sequence in a bacterial strain, such as an
E. coli strain, which carries mutations in one or more of the DNA repair pathways. Such "mutator"
strains have a higher random mutation rate than that of a wild-type strain. Propagating
a DNA sequence (e.g., a polynucleotide sequence encoding a PPTase) in one of these
strains will eventually generate random mutations within the DNA. Mutator strains
suitable for use for
in vivo mutagenesis are described in, for example, International Patent Application Publication
No.
WO 1991/016427.
[0099] Variants can also be generated using cassette mutagenesis. In cassette mutagenesis,
a small region of a double-stranded DNA molecule is replaced with a synthetic oligonucleotide
"cassette" that differs from the native sequence. The oligonucleotide often contains
a completely and/or partially randomized native sequence.
[0100] As used herein, a "host cell" is a cell used to produce a product described herein
(e.g., a fatty aldehyde or a fatty alcohol). In any of the aspects of the disclosure
described herein, the host cell can be selected from the group consisting of a mammalian
cell, plant cell, insect cell, fungus cell (e.g., a filamentous fungus cell or a yeast
cell), and bacterial cell. In the present invention, the host cell is a bacterial
cell. A host cell is referred to as an "engineered host cell" or a "recombinant host
cell" if the expression of one or more polynucleotides or polypeptides in the host
cell are altered or modified as compared to their expression in a corresponding wild-type
host cell under the same conditions.
[0101] In some embodiments, the host cell is a Gram-positive bacterial cell. In other embodiments,
the host cell is a Gram-negative bacterial cell.
[0102] In some aspects, the host cell is selected from the genus
Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma,
Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora,
Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Stenotrophamonas,
Schizosaccharomyces, Yarrowia, or
Streptomyces.
[0103] In other embodiments, the host cell is a
Bacillus lentus cell, a
Bacillus brevis cell, a
Bacillus stearothermophilus cell, a
Bacillus lichen formis cell, a
Bacillus alkalophilus cell, a
Bacillus coagulans cell, a
Bacillus circulans cell, a
Bacillus pumilis cell, a
Bacillus thuringiensis cell, a
Bacillus clausii cell, a
Bacillus megaterium cell, a
Bacillus subtilis cell, or a
Bacillus amyloliquefaciens cell.
[0104] In other aspects, the host cell is a
Trichoderma koningii cell, a
Trichoderma viride cell, a
Trichoderma reesei cell, a
Trichoderma longibrachiatum cell, an
Aspergillus awamori cell, an
Aspergillus fumigates cell, an
Aspergillus foetidus cell, an
Aspergillus nidulans cell, an
Aspergillus niger cell, an
Aspergillus oryzae cell, a
Humicola insolens cell, a
Humicola lanuginose cell, a
Rhodococcus opacus cell, a
Rhizomucor miehei cell, or a
Mucor michei cell.
[0105] In yet other embodiments, the host cell is a
Streptomyces lividans cell or a
Streptomyces murinus cell.
[0106] In yet other embodiments, the host cell is an
Actinomycetes cell.
[0107] In some aspects, the host cell is a
Saccharomyces cerevisiae cell. In some aspects, the host cell is a
Saccharomyces cerevisiae cell.
[0108] In still other aspects, the host cell is a CHO cell, a COS cell, a VERO cell, a BHK
cell, a HeLa cell, a Cvl cell, an MDCK cell, a 293 cell, a 3T3 cell, or a PC12 cell.
[0109] In other aspects, the host cell is a cell from a eukaryotic plant, algae, cyanobacterium,
green-sulfur bacterium, green non-sulfur bacterium, purple sulfur bacterium, purple
non-sulfur bacterium, extremophile, yeast, fungus, an engineered organism thereof,
or a synthetic organism. In some aspects, the host cell is light-dependent or fixes
carbon. In some aspects, the host cell has autotrophic activity. In some aspects,
the host cell has photoautotrophic activity, such as in the presence of light. In
some aspects, the host cell is heterotrophic or mixotrophic in the absence of light.
In certain aspects, the host cell is a cell from
Avabidopsis thaliana, Panicum virgatum, Miscanthus giganteus, Zea mays, Botryococcuse
braunii, Chlamydomonas reinhardtii, Dunaliela salina, Synechococcus Sp. PCC 7002,
Synechococcus Sp. PCC 7942, Synechocystis Sp. PCC 6803, Thermosynechococcus elongates
BP-1, Chlorobium tepidum, Chlorojlexus auranticus, Chromatiumm vinosum, Rhodospirillum
rubrum, Rhodobacter capsulatus, Rhodopseudomonas palusris, Clostridium ljungdahlii,
Clostridiuthermocellum, Penicillium chrysogenum, Pichia pastoris, Saccharomyces cerevisiae,
Schizosaccharomyces pombe, Pseudomonasjluorescens, or Zymomonas mobilis.
[0110] In certain preferred embodiments, the host cell is an
E. coli cell. In some embodiments, the E. coli cell is a strain B, a strain C, a strain K,
or a strain W E. coli cell.
[0111] In other embodiments, the host cell is a
Pantoea citrea cell.
[0112] As used herein, the term "conditions permissive for the production" means any conditions
that allow a host cell to produce a desired product, such as a fatty acid or a fatty
acid derivative. Similarly, the term "conditions in which the polynucleotide sequence
of a vector is expressed" means any conditions that allow a host cell to synthesize
a polypeptide. Suitable conditions include, for example, fermentation conditions.
Fermentation conditions can comprise many parameters, such as temperature ranges,
levels of aeration, and media composition. Each of these conditions, individually
and in combination, allows the host cell to grow. Exemplary culture media include
broths or gels. Generally, the medium includes a carbon source that can be metabolized
by a host cell directly. In addition, enzymes can be used in the medium to facilitate
the mobilization (e.g., the depolymerization of starch or cellulose to fermentable
sugars) and subsequent metabolism of the carbon source.
[0113] As used herein, the phrase "carbon source" refers to a substrate or compound suitable
to be used as a source of carbon for prokaryotic or simple eukaryotic cell growth.
Carbon sources can be in various forms, including, but not limited to polymers, carbohydrates,
acids, alcohols, aldehydes, ketones, amino acids, peptides, and gases (e.g., CO and
CO
2). Exemplary carbon sources include, but are not limited to, monosaccharides, such
as glucose, fructose, mannose, galactose, xylose, and arabinose; oligosaccharides,
such as fructo-oligosaccharide and galacto-oligosaccharide; polysaccharides such as
starch, cellulose, pectin, and xylan; disaccharides, such as sucrose, maltose, and
turanose; cellulosic material and variants such as methyl cellulose and sodium carboxymethyl
cellulose; saturated or unsaturated fatty acid esters, succinate, lactate, and acetate;
alcohols, such as ethanol, methanol, and glycerol, or mixtures thereof. The carbon
source can also be a product of photosynthesis, such as glucose. In certain preferred
embodiments, the carbon source is biomass. In other preferred embodiments, the carbon
source is glucose. In still other preferred embodiments, the carbon source is sucrose.
[0114] As used herein, the term "biomass" refers to any biological material from which a
carbon source is derived. In some embodiments, a biomass is processed into a carbon
source, which is suitable for bioconversion. In other embodiments, the biomass does
not require further processing into a carbon source. The carbon source can be converted
into a biofuel. An exemplary source of biomass is plant matter or vegetation, such
as corn, sugar cane, or switchgrass. Another exemplary source of biomass is metabolic
waste products, such as animal matter (e.g., cow manure). Further exemplary sources
of biomass include algae and other marine plants. Biomass also includes waste products
from industry, agriculture, forestry, and households, including, but not limited to,
fermentation waste, ensilage, straw, lumber, sewage, garbage, cellulosic urban waste,
and food leftovers. The term "biomass" also can refer to sources of carbon, such as
carbohydrates (e.g., monosaccharides, disaccharides, or polysaccharides).
[0115] As used herein, the term "clone" typically refers to a cell or group of cells descended
from and essentially genetically identical to a single common ancestor, for example,
the bacteria of a cloned bacterial colony arose from a single bacterial cell.
[0116] As used herein, the term "culture" typical refers to a liquid media comprising viable
cells. In one embodiment, a culture comprises cells reproducing in a predetermined
culture media under controlled conditions, for example, a culture of recombinant host
cells grown in liquid media comprising a selected carbon source and nitrogen.
[0117] "Culturing" or "cultivation" refers to growing a population of recombinant host cells
under suitable conditions in a liquid or solid medium. In particular embodiments,
culturing refers to the fermentative bioconversion of a substrate to an end-product.
Culturing media are well known and individual components of such culture media are
available from commercial sources, e.g., under the Difco™ and BBL™ trademarks. In
one non-limiting example, the aqueous nutrient medium is a "rich medium" comprising
complex sources of nitrogen, salts, and carbon, such as YP medium, comprising 10 g/L
of peptone and 10 g/L yeast extract of such a medium.
[0118] To determine if conditions are sufficient to allow production of a product or expression
of a polypeptide, a host cell can be cultured, for example, for about 4, 8, 12, 24,
36, 48, 72, or more hours. During and/or after culturing, samples can be obtained
and analyzed to determine if the conditions allow production or expression. For example,
the host cells in the sample or the medium in which the host cells were grown can
be tested for the presence of a desired product. When testing for the presence of
a fatty acid or fatty acid derivative, assays, such as, but not limited to, MS, thin
layer chromatography (TLC), high-performance liquid chromatography (HPLC), liquid
chromatography (LC), GC coupled with a flame ionization detector (FID), GC-MS, and
LC-MS can be used. When testing for the expression of a polypeptide, techniques such
as, but not limited to, Western blotting and dot blotting may be used.
[0119] In the methods of the invention, the production and isolation of fatty acids and
fatty acid derivatives can be enhanced by optimizing fermentation conditions. In some
embodiments, fermentation conditions are optimized to increase the percentage of the
carbon source that is converted to hydrocarbon products. During normal cellular lifecycles,
carbon is used in cellular functions, such as producing lipids, saccharides, proteins,
organic acids, and nucleic acids. Reducing the amount of carbon necessary for growth-related
activities can increase the efficiency of carbon source conversion to product. This
can be achieved by, for example, first growing host cells to a desired density (for
example, a density achieved at the peak of the log phase of growth). At such a point,
replication checkpoint genes can be harnessed to stop the growth of cells. Specifically,
quorum sensing mechanisms (reviewed in
Camilli et al., Science 311: 1113 (2006);
Venturi, FEMS Microbiol. Rev., 30: 274-291 (2006); and
Reading et al., FEMS Microbiol. Lett., 254: 1-11 (2006)) can be used to activate checkpoint genes, such as
p53, p21, or other checkpoint genes.
[0120] Genes that can be activated to stop cell replication and growth in
E. coli include
umuDC genes. The overexpression of
umuDC genes stops the progression from stationary phase to exponential growth (
Murli et al., J. Bacteriol., 182: 1127-1135 (2000)). UmuC is a DNA polymerase that can carry out translesion synthesis over non-coding
lesions which commonly result from ultraviolet (UV) and chemical mutagenesis. The
umuDC gene products are involved in the process of translesion synthesis and also serve
as a DNA sequence damage checkpoint. The
umuDC gene products include UmuC, UmuD, umuD', UmuD'
2C, UmuD'
2, and UmuD
2. Simultaneously, product-producing genes can be activated, thereby minimizing the
need for replication and maintenance pathways to be used while a fatty aldehyde or
fatty alcohol is being made. Host cells can also be engineered to express
umuC and
umuD from
E. coli in pBAD24 under the
prpBCDE promoter system through
de novo synthesis of this gene with the appropriate end-product production genes.
[0121] The host cell can be additionally engineered to express a recombinant cellulosome,
which can allow the host cell to use cellulosic material as a carbon source. Exemplary
cellulosomes suitable for use in the methods of the invention include, e.g, the cellulosomes
described in International Patent Application Publication
WO 2008/100251. The host cell also can be engineered to assimilate carbon efficiently and use cellulosic
materials as carbon sources according to methods described in
U.S. Patents 5,000,000;
5,028,539;
5,424,202;
5,482,846; and
5,602,030. In addition, the host cell can be engineered to express an invertase so that sucrose
can be used as a carbon source.
[0122] In some embodiments of the fermentation methods of the invention, the fermentation
chamber encloses a fermentation that is undergoing a continuous reduction, thereby
creating a stable reductive environment. The electron balance can be maintained by
the release of carbon dioxide (in gaseous form). Efforts to augment the NAD/H and
NADP/H balance can also facilitate in stabilizing the electron balance. The availability
of intracellular NADPH can also be enhanced by engineering the host cell to express
an NADH:NADPH transhydrogenase. The expression of one or more NADH:NADPH transhydrogenases
converts the NADH produced in glycolysis to NADPH, which can enhance the production
of fatty aldehydes and fatty alcohols.
[0123] For small scale production, the engineered host cells can be grown in batches of,
for example, about 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced
to express a desired polynucleotide sequence, such as a polynucleotide sequence encoding
a PPTase. For large scale production, the engineered host cells can be grown in batches
of about 10 L, 100 L, 1000 L, 10,000 L, 100,000 L, 1,000,000 L or larger; fermented;
and induced to express a desired polynucleotide sequence.
[0124] The fatty acids and derivatives thereof produced by the methods of invention generally
are isolated from the host cell. The term "isolated" as used herein with respect to
products, such as fatty acids and derivatives thereof, refers to products that are
separated from cellular components, cell culture media, or chemical or synthetic precursors.
The fatty acids and derivatives thereof produced by the methods described herein can
be relatively immiscible in the fermentation broth, as well as in the cytoplasm. Therefore,
the fatty acids and derivatives thereof can collect in an organic phase either intracellularly
or extracellularly. The collection of the products in the organic phase can lessen
the impact of the fatty acid or fatty acid derivative on cellular function and can
allow the host cell to produce more product.
[0125] In some embodiments, the fatty acids and fatty acid derivatives produced by the methods
of invention are purified. As used herein, the term "purify," "purified," or "purification"
means the removal or isolation of a molecule from its environment by, for example,
isolation or separation. "Substantially purified" molecules are at least about 60%
free (e.g., at least about 70% free, at least about 75% free, at least about 85% free,
at least about 90% free, at least about 95% free, at least about 97% free, at least
about 99% free) from other components with which they are associated. As used herein,
these terms also refer to the removal of contaminants from a sample. For example,
the removal of contaminants can result in an increase in the percentage of a fatty
aldehyde or a fatty alcohol in a sample. For example, when a fatty aldehyde or a fatty
alcohol is produced in a host cell, the fatty aldehyde or fatty alcohol can be purified
by the removal of host cell proteins. After purification, the percentage of a fatty
acid or derivative thereof in the sample is increased.
[0126] As used herein, the terms "purify," "purified," and "purification" are relative terms
which do not require absolute purity. Thus, for example, when a fatty acid or derivative
thereof is produced in host cells, a purified fatty acid or derivative thereof is
a fatty acid or derivative thereof that is substantially separated from other cellular
components (e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other hydrocarbons).
[0127] Additionally, a purified fatty acid preparation or a purified fatty acid derivative
preparation is a fatty acid preparation or a fatty acid derivative preparation in
which the fatty acid or derivative thereof is substantially free from contaminants,
such as those that might be present following fermentation. In some embodiments, a
fatty acid or derivative thereof is purified when at least about 50% by weight of
a sample is composed of the fatty acid or fatty acid derivative. In other embodiments,
a fatty acid or derivative thereof is purified when at least about 60%, e.g., at least
about 70%, at least about 80%, at least about 85%, at least about 90%, at least about
92% or more by weight of a sample is composed of the fatty acid or derivative thereof.
Alternatively, or in addition, a fatty acid or derivative thereof is purified when
less than about 100%, e.g., less than about 99%, less than about 98%, less than about
95%, less than about 90%, or less than about 80% by weight of a sample is composed
of the fatty acid or derivative thereof. Thus, a purified fatty acid or derivative
thereof can have a purity level bounded by any two of the above endpoints. For example,
a fatty acid or derivative thereof can be purified when at least about 80%-95%, at
least about 85%-99%, or at least about 90%-98% of a sample is composed of the fatty
acid or fatty acid derivative.
[0128] The fatty acid or derivative thereof may be present in the extracellular environment,
or it may be isolated from the extracellular environment of the host cell. In certain
embodiments, a fatty acid or derivative thereof is secreted from the host cell. In
other embodiments, a fatty acid or derivative thereof is transported into the extracellular
environment. In yet other embodiments, the fatty acid or derivative thereof is passively
transported into the extracellular environment. A fatty acid or derivative thereof
can be isolated from a host cell using methods known in the art, such as those disclosed
in International Patent Application Publications
WO 2010/042664 and
WO 2010/062480.
[0129] The methods described herein can result in the production of homogeneous compounds
wherein at least about 60%, at least about 70%, at least about 80%, at least about
90%, or at least about 95%, of the fatty acids or fatty acid derivatives produced
will have carbon chain lengths that vary by less than 6 carbons, less than 5 carbons,
less than 4 carbons, less than 3 carbons, or less than about 2 carbons. Alternatively,
or in addition, the methods described herein can result in the production of homogeneous
compounds wherein less than about 98%, less than about 95%, less than about 90%, less
than about 80%, or less than about 70% of the fatty acids or fatty acid derivatives
produced will have carbon chain lengths that vary by less than 6 carbons, less than
5 carbons, less than 4 carbons, less than 3 carbons, or less than about 2 carbons.
Thus, the fatty acids or fatty acid derivatives can have a degree of homogeneity bounded
by any two of the above endpoints. For example, the fatty acid or fatty acid derivative
can have a degree of homogeneity wherein about 70%-95%, about 80%-98%, or about 90%-95%
of the fatty acids or fatty acid derivatives produced will have carbon chain lengths
that vary by less than 6 carbons, less than 5 carbons, less than 4 carbons, less than
3 carbons, or less than about 2 carbons. These compounds can also be produced with
a relatively uniform degree of saturation.
[0130] As a result of the methods of the present invention, one or more of the titer, yield,
or productivity of the fatty acid or derivative thereof produced by the engineered
host cell having an altered level of expression of a FadR polypeptide is increased
relative to that of the corresponding wild-type host cell.
[0131] The term "titer" refers to the quantity of fatty acid or fatty acid derivative produced
per unit volume of host cell culture. In any aspect of the compositions and methods
described herein, a fatty acid or a fatty acid derivative such as a terminal olefin,
a fatty aldehyde, a fatty alcohol, an alkane, a fatty ester, a ketone or an internal
olefins is produced at a titer of about 25 mg/L, about 50 mg/L, about 75 mg/L, about
100 mg/L, about 125 mg/L, about 150 mg/L, about 175 mg/L, about 200 mg/L, about 225
mg/L, about 250 mg/L, about 275 mg/L, about 300 mg/L, about 325 mg/L, about 350 mg/L,
about 375 mg/L, about 400 mg/L, about 425 mg/L, about 450 mg/L, about 475 mg/L, about
500 mg/L, about 525 mg/L, about 550 mg/L, about 575 mg/L, about 600 mg/L, about 625
mg/L, about 650 mg/L, about 675 mg/L, about 700 mg/L, about 725 mg/L, about 750 mg/L,
about 775 mg/L, about 800 mg/L, about 825 mg/L, about 850 mg/L, about 875 mg/L, about
900 mg/L, about 925 mg/L, about 950 mg/L, about 975 mg/L, about 1000 g/L, about 1050
mg/L, about 1075 mg/L, about 1100 mg/L, about 1125 mg/L, about 1150 mg/L, about 1175
mg/L, about 1200 mg/L, about 1225 mg/L, about 1250 mg/L, about 1275 mg/L, about 1300
mg/L, about 1325 mg/L, about 1350 mg/L, about 1375 mg/L, about 1400 mg/L, about 1425
mg/L, about 1450 mg/L, about 1475 mg/L, about 1500 mg/L, about 1525 mg/L, about 1550
mg/L, about 1575 mg/L, about 1600 mg/L, about 1625 mg/L, about 1650 mg/L, about 1675
mg/L, about 1700 mg/L, about 1725 mg/L, about 1750 mg/L, about 1775 mg/L, about 1800
mg/L, about 1825 mg/L, about 1850 mg/L, about 1875 mg/L, about 1900 mg/L, about 1925
mg/L, about 1950 mg/L, about 1975 mg/L, about 2000 mg/L, or a range bounded by any
two of the foregoing values. In other embodiments, a fatty acid or fatty acid derivative
is produced at a titer of more than 2000 mg/L, more than 5000 mg/L, more than 10,000
mg/L, or higher, such as 50 g/L, 70 g/L, 100 g/L, 120 g/L, 150 g/L, or 200 g/L.
[0132] As used herein, the "yield of fatty acid derivative produced by a host cell" refers
to the efficiency by which an input carbon source is converted to product (i.e., fatty
alcohol or fatty aldehyde) in a host cell. Host cells engineered to produce fatty
acid derivatives according to the methods of the invention have a yield of at least
3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%,
at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%,
at least 16%, at least 17%, at least 18%, at least 19%, at least 20 %, at least 21%,
at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%,
at least 28%, at least 29%, or at least 30% or a range bounded by any two of the foregoing
values. In other embodiments, a fatty acid derivative or derivatives is produced at
a yield of more than 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. Alternatively, or
in addition, the yield is about 30% or less, about 27% or less, about 25% or less,
or about 22% or less. Thus, the yield can be bounded by any two of the above endpoints.
For example, the yield of a fatty acid derivative or derivatives produced by the recombinant
host cell according to the methods of the invention can be 5% to 15%, 10% to 25%,
10% to 22%, 15% to 27%, 18% to 22%, 20% to 28%, or 20% to 30%. The yield may refer
to a particular fatty acid derivative or a combination of fatty acid derivatives produced
by a given recombinant host cell culture.
[0133] In one approach, the term "productivity of the fatty acid or derivative thereof produced
by a host cell" refers to the quantity of fatty acid or fatty acid derivative produced
per unit volume of host cell culture per unit density of host cell culture. In any
aspect of the compositions and methods described herein, the productivity of a fatty
acid or a fatty acid derivative such as an olefin, a fatty aldehyde, a fatty alcohol,
an alkane, a fatty ester, or a ketone produced by an engineered host cells is at least
about at least about 3 mg/L/OD
600, at least about 6 mg/L/OD
600, at least about 9 mg/L/OD
600, at least about 12 mg/L/OD
600, or at least about 15 mg/L/OD
600. Alternatively, or in addition, the productivity is about 50 mg/L/OD
600 or less, about 40 mg/L/OD
600 or less, about 30 mg/L/OD
600 or less, or about 20 mg/L/OD
600 or less. Thus, the productivity can be bounded by any two of the above endpoints.
For example, the productivity can be about 3 to about 30 mg/L/OD
600, about 6 to about 20 mg/L/OD
600, or about 15 to about 30 mg/L/OD
600.
[0134] In another approach, the term "productivity" refers to the quantity of a fatty acid
derivative or derivatives produced per unit volume of host cell culture per unit time.
In any aspect of the compositions and methods described herein, the productivity of
a fatty acid derivative or derivatives produced by a recombinant host cell is at least
100 mg/L/hour, at least 200 mg/L/hour0, at least 300 mg/L/hour, at least 400 mg/L/hour,
at least 500 mg/L/hour, at least 600 mg/L/hour, at least 700 mg/L/hour, at least 800
mg/L/hour, at least 900 mg/L/hour, at least 1000 mg/L/hour, at least 1100 mg/L/hour,
at least 1200 mg/L/hour, at least 1300 mg/L/hour, at least 1400 mg/L/hour, at least
1500 mg/L/hour, at least 1600 mg/L/hour, at least 1700 mg/L/hour, at least 1800 mg/L/hour,
at least 1900 mg/L/hour, at least 2000 mg/L/hour, at least 2100 mg/L/hour, at least
2200 mg/L/hour, at least 2300 mg/L/hour, at least 2400 mg/L/hour, or at least 2500
mg/L/hour. Alternatively, or in addition, the productivity is 2500 mg/L/hour or less,
2000 mg/L/OD600 or less, 1500 mg/L/OD600 or less, 120 mg/L/hour, or less, 1000 mg/L/hour
or less, 800 mg/L/hour, or less, or 600 mg/L/hour or less. Thus, the productivity
can be bounded by any two of the above endpoints. For example, the productivity can
be 3 to 30 mg/L/hour, 6 to 20 mg/L/hour, or 15 to 30 mg/L/hour. For example, the productivity
of a fatty acid derivative or derivatives produced by a recombinant host cell according
to the methods of the may be from 500 mg/L/hour to 2500 mg/L/hour, or from 700 mg/L/hour
to 2000 mg/L/hour. The productivity may refer to a particular fatty acid derivative
or a combination of fatty acid derivatives produced by a given recombinant host cell
culture.
[0135] In the methods of the invention, the production and isolation of a desired fatty
acid or derivative thereof (e.g., acyl-CoA, fatty acids, terminal olefins, fatty aldehydes,
fatty alcohols, alkanes, alkenes, wax esters, ketones and internal olefins) can be
enhanced by altering the expression of one or more genes involved in the regulation
of fatty acid, fatty ester, alkane, alkene, olefin fatty alcohol production, degradation
and/or secretion in the engineered host cell.
[0136] FadR is known to modulate the expression and/or activity of numerous genes, including
fabA,
fabB, iclR, fadA, fadB, fadD, fadE, fadI, fadJ, fadL, fadM, uspA, aceA, aceB, and
aceK. In some embodiments of the methods described herein, the engineered host cell further
comprises an altered level of expression of one or more genes selected from the group
consisting of
fabA, fabB, iclR, fadA, fadB, fadD, fadE, fadI, fadJ, fadL, fadM, uspA, aceA, aceB, and
aceK as compared to the level of expression of the selected gene(s) in a corresponding
wild-type host cell. Exemplary accession numbers for polypeptides encoded by the FadR
target genes include
fabA (NP_415474),
fabB (BAA16180), (NP_418442),
fadA (YP_026272.1),
fadB (NP_418288.1),
fadD (AP_002424),
fadE (NP_414756.2),
fadI (NP_416844.1),
fadJ (NP_416843.1),
fadL (AAC75404),
fadM (NP_414977.1),
uspA (AAC76520),
aceA (AAC76985.1),
aceB (AAC76984.1), and
aceK (AAC76986.1).
[0137] Exemplary enzymes and polypeptides for use in practicing the invention are listed
in FIG. 1. One of ordinary skill in the art will understand that depending upon the
purpose (e.g., desired fatty acid or fatty acid derivative product), specific genes
(or combinations of genes) listed in FIG. 1 may be overexpressed, modified, attenuated
or deleted in an engineered host cell which has an altered level of expression of
a FadR polypeptide.
[0138] In some embodiments, the method comprises modifying the expression of a gene encoding
one or more of a thioesterase (e.g., TesA), a decarboxylase, a carboxylic acid reductase
(CAR; e.g., CarB), an alcohol dehydrogenase (aldehyde reductase); an aldehyde decarbonylase,
a fatty alcohol forming acyl-CoA reductase (FAR), an acyl ACP reductase (AAR), an
ester synthase, an acyl-CoA reductase (ACR1), OleA, OleCD and OleBCD.
[0139] In certain embodiments of the invention, the engineered host cell having an altered
level of expression of a FadR polypeptide may be engineered to further comprise a
polynucleotide sequence encoding a polypeptide: (1) having thioesterase activity (EC
3.1.2.14), wherein the engineered host cell synthesizes fatty acids; (2) having decarboxylase
activity, wherein the engineered host cell synthesizes terminal olefins; (3) having
carboxylic acid reductase activity, wherein the engineered host cell synthesizes fatty
aldehydes; (4) having carboxylic acid reductase and alcohol dehydrogenase activity
(EC 1.1.1.1), wherein the engineered host cell synthesizes fatty alcohols; (5) having
carboxylic acid reductase and aldehyde decarbonylase activity (EC 4.1.99.5), wherein
the engineered host cell synthesizes alkanes; (6) having acyl-CoA reductase activity
(EC 1.2.1.50), wherein microorganism synthesizes fatty aldehydes; (7) having acyl-CoA
reductase activity (EC 1.2.1.50) and alcohol dehydrogenase activity (EC 1.1.1.1),
wherein the engineered host cell synthesizes fatty alcohols; (8) having acyl-CoA reductase
activity (EC 1.2.1.50) and aldehyde decarbonylase activity (EC 4.1.99.5), wherein
the engineered host cell synthesizes alkanes; (9) having alcohol forming acyl CoA
reductase activity wherein the engineered host cell synthesizes fatty aldehydes and
fatty alcohols; (10) having carboxylic acid reductase activity, wherein the engineered
host cell synthesizes fatty aldehydes; (11) having acyl ACP reductase activity, wherein
the engineered host cell synthesizes fatty aldehydes; (12) having acyl ACP reductase
activity and alcohol dehydrogenase activity(EC 1.1.1.1), wherein engineered host cell
synthesizes fatty alcohols; (13) having acyl ACP reductase activity and aldehyde decarbonylase
activity (EC 4.1.99.5), wherein engineered host cell synthesizes alkanes; (14) having
ester synthase activity (EC 3.1.1.67), wherein the engineered host cell synthesizes
fatty esters; (15) having ester synthase activity (EC 3.1.1.67) and (a) carboxylic
acid reductase activity, (b) acyl-CoA reductase activity, (c) acyl ACP reductase activity,
or (d) alcohol dehydrogenase activity (EC 1.1.1.1), wherein the engineered host cell
synthesizes wax esters; (16) having OleA activity, wherein the engineered host cell
synthesizes 2-alkyl-3-keto-acyl CoA and ketones; or (17) having OleCD or OleBCD activity,
wherein the engineered host cell synthesizes internal olefins.
[0140] In some embodiments, the method further comprises modifying the expression of a gene
encoding a fatty acid synthase in the host cell. As used herein, "fatty acid synthase"
means any enzyme involved in fatty acid biosynthesis. In certain embodiments, modifying
the expression of a gene encoding a fatty acid synthase includes expressing a gene
encoding a fatty acid synthase in the host cell and/or increasing the expression or
activity of an endogenous fatty acid synthase in the host cell. In alternate embodiments,
modifying the expression of a gene encoding a fatty acid synthase includes attenuating
a gene encoding a fatty acid synthase in the host cell and/or decreasing the expression
or activity of an endogenous fatty acid synthase in the host cell. In some embodiments,
the fatty acid synthase is a thioesterase (EC 3.1.1.5 or EC 3.1.2.14). In particular
embodiments, the thioesterase is encoded by
tesA, tesA without leader sequence,
tesB, fatB, fatB2, fatB3, fatA, or
fatA1.
[0141] In other embodiments, the host cell is genetically engineered to express an attenuated
level of a fatty acid degradation enzyme relative to a wild-type host cell. As used
herein, the term "fatty acid degradation enzyme" means an enzyme involved in the breakdown
or conversion of a fatty acid or fatty acid derivative into another product, such
as, but not limited to, an acyl-CoA synthase. In some embodiments, the host cell is
genetically engineered to express an attenuated level of an acyl-CoA synthase relative
to a wild-type host cell. In particular embodiments, the host cell expresses an attenuated
level of an acyl-CoA synthase encoded by
fadD, fadK, BH3103, yhfl, PJI-4354, EAV15023, fadD1, fadD2, RPC_4074,
fadDD35,
fadDD22,
faa3p, or the gene encoding the protein YP_002028218. In certain embodiments, the genetically
engineered host cell comprises a knockout of one or more genes encoding a fatty acid
degradation enzyme, such as the aforementioned acyl-CoA synthase genes.
[0142] The fatty acid biosynthetic pathway in host cells uses the precursors acetyl-CoA
and malonyl-CoA. The steps in this pathway are catalyzed by enzymes of the fatty acid
biosynthesis (
fab) and acetyl-CoA carboxylase (
acc) gene families (see, e.g.,
Heath et al., Prog. Lipid Res. 40(6): 467-97 (2001)). Acetyl-CoA is carboxylated by acetyl-CoA carboxylase (EC 6.4.1.2), which is a
multisubunit enzyme encoded by four separate genes (
accA, accB, accC, and
accD) in most prokaryotes, to form malonyl-CoA. In some bacteria, such as
Corynebacterium glutamicus, acetyl-CoA carboxylase is consisted two subunits, AccDA [YP_225123.1] and AccBC [YP_224991],
encoded by accDA and accBC, respectively. Depending upon the desired fatty acid or
fatty acid derivative product, specific
fab and/or
acc genes (or combinations thereof) may be overexpressed, modified, attenuated or deleted
in an engineered host cell.
[0143] In some embodiments, an acetyl-CoA carboxylase complex is overexpressed in the engineered
host cell. In certain embodiments, the acetyl-CoA carboxylase subunit genes are obtained
from one or more of
Corynebacterium glutamicum, Escherichia coli, Lactococcus lactis, Kineococcus radiotolerans,
Desulfovibrio desulfuricans, Erwinia amylovora, Rhodospirillum rubrum, Vibrio furnissii,
Stenotrophomonas maltophilia,
Synechocystis sp. PCC6803, and
Synechococcus elongatus.
[0144] Biotin protein ligase (EC 6.3.4.15) is an enzyme that catalyzes the covalent attachment
of biotin to the biotin carboxyl carrier protein (BCCP) subunit of acetyl-CoA carboxylase.
In some embodiments of the present invention, a biotin protein ligase is expressed
or overexpressed in the engineered host cell. In certain embodiments, the biotin protein
ligase is birA from
Corynebacterium glutamicum (YP_225000) or bpll from
Saccharomyces cerevisiae (NP_010140).
[0145] The production of fatty acid esters such as FAMEs or FAEEs in a host cell can be
facilitated by expression or overexpression of an ester synthase (EC 2.3.1.75 or EC
3.1.1.67) in an engineered host cell. In some embodiments, the ester synthase is ES9
from
Marinobacter hydrocarbonoclasticus (SEQ ID NO: 2), ES8 from
Marinobacter hydrocarbonoclasticus (SEQ ID NO: 3), AtfA1 from
Alcanivorax borkumensis SK2 (SEQ ID NO: 4), AtfA2 from
Alcanivorax borkumensis SK2 (SEQ ID NO: 5), diacylglycerol O-acyltransferase from
Marinobacter aquaeolei VT8 (SEQ ID NO: 6 or SEQ ID NO: 7), a wax synthase, or a bifunctional wax ester synthase/acyl-CoA:diacylglycerol
acyltransferase (wax-dgaT).
[0146] In certain embodiments, a gene encoding a fatty aldehyde biosynthetic polypeptide
is expressed or overexpressed in the host cell. Exemplary fatty aldehyde biosynthetic
polypeptides suitable for use in the methods of the invention are disclosed, for example,
in International Patent Application Publication
WO 2010/042664. In preferred embodiments, the fatty aldehyde biosynthetic polypeptide has carboxylic
acid reductase (EC 6.2.1.3 or EC 1.2.1.42) activity, e.g., fatty acid reductase activity.
[0147] In the methods of the invention, the polypeptide having carboxylic acid reductase
activity is not particularly limited. Exemplary polypeptides having carboxylic acid
reductase activity which are suitable for use in the methods of the present invention
are disclosed, for example, in International Patent Application Publications
WO 2010/062480 and
WO 2010/042664. In some embodiments, the polypeptide having carboxylic acid reductase activity is
CarB from
M. smegmatis (YP_889972) (SEQ ID NO: 8). In other embodiments, the polypeptide having carboxylic
acid reductase activity is CarA [ABK75684] from
M. smegmatis, FadD9 [AAK46980] from
M. tuberculosis, CAR [AAR91681] from
Nocardia sp. NRRL 5646, CAR [YP-001070587] from
Mycobacterium sp. JLS, or CAR [YP-118225] from
Streptomyces griseus. The terms "carboxylic acid reductase," "CAR," and "fatty aldehyde biosynthetic polypeptide"
are used interchangeably herein.
[0148] In certain embodiments, a thioesterase and a carboxylic acid reductase are expressed
or overexpressed in the engineered host cell.
[0149] In some embodiments, a gene encoding a fatty alcohol biosynthetic polypeptide is
expressed or overexpressed in the host cell. Exemplary fatty alcohol biosynthetic
polypeptides suitable for use in the methods of the invention are disclosed, for example,
in International Patent Application Publication
WO 2010/062480. In certain embodiments, the fatty alcohol biosynthetic polypeptide has aldehyde
reductase or alcohol dehydrogenase activity (EC 1.1.1.1). Exemplary fatty alcohol
biosynthetic polypeptides include, but are not limited to AlrA of
Acenitobacter sp. M-1 (SEQ ID NO: 9) or AlrA homologs and endogenous
E. coli alcohol dehydrogenases such as YjgB, (AAC77226) (SEQ ID NO: 10), DkgA (NP_417485),
DkgB (NP_414743), YdjL (AAC74846), YdjJ (NP_416288), AdhP (NP_415995), YhdH (NP_417719),
YahK (NP_414859), YphC (AAC75598), YqhD (446856) and YbbO [AAC73595.1].
[0150] As used herein, the term "alcohol dehydrogenase" is a peptide capable of catalyzing
the conversion of a fatty aldehyde to an alcohol (e.g., fatty alcohol). One of ordinary
skill in the art will appreciate that certain alcohol dehydrogenases are capable of
catalyzing other reactions as well. For example, certain alcohol dehydrogenases will
accept other substrates in addition to fatty aldehydes, and these non-specific alcohol
dehydrogenases also are encompassed by the term "alcohol dehydrogenase." Exemplary
alcohol dehydrogenases suitable for use in the methods of the invention are disclosed,
for example, in International Patent Application Publication
WO 2010/062480.
[0151] In some embodiments, a thioesterase, a carboxylic acid reductase, and an alcohol
dehydrogenase are expressed or overexpressed in the engineered host cell. In certain
embodiments, the thioesterase is tesA (SEQ ID NO: 11), the carboxylic acid reductase
is carB (SEQ ID NO: 8), and the alcohol dehydrogenase is YjgB (SEQ ID NO: 10) or AlrAadp1
(SEQ ID NO: 9).
[0152] Phosphopantetheine transferases (PPTases) (EC 2.7.8.7) catalyze the transfer of 4'-phosphopantetheine
from CoA to a substrate.
Nocardia CAR and several of its homologues contain a putative attachment site for 4'-phosphopantetheine
(PPT) (
He et al., Appl. Environ. Microbiol., 70(3): 1874-1881 (2004)). In some embodiments of the invention, a PPTase is expressed or overexpressed in
an engineered host cell. In certain embodiments, the PPTase is EntD from
E. coli MG1655 (SEQ ID NO: 12).
[0153] In some embodiments, a thioesterase, a carboxylic acid reductase, a PPTase, and an
alcohol dehydrogenase are expressed or overexpressed in the engineered host cell.
In certain embodiments, the thioesterase is tesA (SEQ ID NO: 11), the carboxylic acid
reductase is carB (SEQ ID NO: 8), the PPTase is entD (SEQ ID NO: 12), and the alcohol
dehydrogenase is yjgB (SEQ ID NO: 10) or alrAadp1 (SEQ ID NO: 9).
[0154] The disclosure also provides a fatty acid or a fatty derivative produced by any of
the methods described herein. A fatty acid or derivative thereof produced by any of
the methods described herein can be used directly as fuels, fuel additives, starting
materials for production of other chemical compounds (e.g., polymers, surfactants,
plastics, textiles, solvents, adhesives, etc.), or personal care additives. These
compounds can also be used as feedstock for subsequent reactions, for example, hydrogenation,
catalytic cracking (e.g., via hydrogenation, pyrolisis, or both), to make other products.
[0155] In some aspects, the disclosure provides a biofuel composition comprising the fatty
acid or derivative thereof produced by the methods described herein. As used herein,
the term "biofuel" refers to any fuel derived from biomass. Biofuels can be substituted
for petroleum-based fuels. For example, biofuels are inclusive of transportation fuels
(e.g., gasoline, diesel, jet fuel, etc.), heating fuels, and electricity-generating
fuels. Biofuels are a renewable energy source. As used herein, the term "biodiesel"
means a biofuel that can be a substitute of diesel, which is derived from petroleum.
Biodiesel can be used in internal combustion diesel engines in either a pure form,
which is referred to as "neat" biodiesel, or as a mixture in any concentration with
petroleum-based diesel. Biodiesel can include esters or hydrocarbons, such as alcohols.
In certain aspects, the biofuel is selected from the group consisting of a biodiesel,
a fatty alcohol, a fatty ester, a triacylglyceride, a gasoline, or a jet fuel.
[0156] Fuel additives are used to enhance the performance of a fuel or engine. For example,
fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity,
viscosity, oxidative stability, ignition quality, octane level, and/or flash point
of a fuel. In the United States, all fuel additives must be registered with Environmental
Protection Agency (EPA). The names of fuel additives and the companies that sell the
fuel additives are publicly available by contacting the EPA or by viewing the EPA's
website. One of ordinary skill in the art will appreciate that a biofuel produced
according to the methods described herein can be mixed with one or more fuel additives
to impart a desired quality.
[0157] The disclosure also provides a surfactant composition or a detergent composition
comprising a fatty alcohol produced by any of the methods described herein. One of
ordinary skill in the art will appreciate that, depending upon the intended purpose
of the surfactant or detergent composition, different fatty alcohols can be produced
and used. For example, when the fatty alcohols described herein are used as a feedstock
for surfactant or detergent production, one of ordinary skill in the art will appreciate
that the characteristics of the fatty alcohol feedstock will affect the characteristics
of the surfactant or detergent composition produced. Hence, the characteristics of
the surfactant or detergent composition can be selected for by producing particular
fatty alcohols for use as a feedstock.
[0158] A fatty alcohol-based surfactant and/or detergent composition described herein can
be mixed with other surfactants and/or detergents well known in the art. In some aspects,
the mixture can include at least about 10%, at least about 15%, at least about 20%,
at least about 30%, at least about 40%, at least about 50%, at least about 60%, or
a range bounded by any two of the foregoing values, by weight of the fatty alcohol.
In other examples, a surfactant or detergent composition can be made that includes
at least about 5%, at least about 10%, at least about 20%, at least about 30%, at
least about 40%, at least about 50%, at least about 60%, at least about 70%, at least
about 80%, at least about 85%, at least about 90%, at least about 95%, or a range
bounded by any two of the foregoing values, by weight of a fatty alcohol that includes
a carbon chain that is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22
carbons in length. Such surfactant or detergent compositions also can include at least
one additive, such as a microemulsion or a surfactant or detergent from nonmicrobial
sources such as plant oils or petroleum, which can be present in the amount of at
least about 5%, at least about 10%, at least about 15%, at least about 20%, at least
about 30%, at least about 40%, at least about 50%, at least about 60%, at least about
70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%,
or a range bounded by any two of the foregoing values, by weight of the fatty alcohol.
[0159] Bioproducts (e.g., fatty acids, acyl-CoAs, hydrocarbons, fatty aldehydes, fatty alcohols,
fatty esters, surfactant compositions, and biofuel compositions) produced according
to the methods of the invention can be distinguished from organic compounds derived
from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting or
14C dating. Additionally, the specific source of biosourced carbon (e.g., glucose vs.
glycerol) can be determined by dual carbon-isotopic fingerprinting (see, e.g.,
U.S. Patent 7,169,588).
[0160] The ability to distinguish bioproducts from petroleum-based organic compounds is
beneficial in tracking these materials in commerce. For example, organic compounds
or chemicals comprising both biologically-based and petroleum-based carbon isotope
profiles may be distinguished from organic compounds and chemicals made only of petroleum-based
materials. Hence, the materials prepared in accordance with the inventive methods
may be followed in commerce on the basis of their unique carbon isotope profile.
[0161] Bioproducts can be distinguished from petroleum-based organic compounds by comparing
the stable carbon isotope ratio (
13C/
12C) in each fuel. The
13C/
12C ratio in a given bioproduct is a consequence of the
13C/
12C ratio in atmospheric carbon dioxide at the time the carbon dioxide is fixed. It
also reflects the precise metabolic pathway. Regional variations also occur. Petroleum,
C
3 plants (the broadleaf), C
4 plants (the grasses), and marine carbonates all show significant differences in
13C/
12C and the corresponding δ
13C values. Furthermore, lipid matter of C
3 and C
4 plants analyze differently than materials derived from the carbohydrate components
of the same plants as a consequence of the metabolic pathway.
[0162] The
13C measurement scale was originally defined by a zero set by Pee Dee Belemnite (PDB)
limestone, where values are given in parts per thousand deviations from this material.
The "δ
13C" values are expressed in parts per thousand (per mil), abbreviated, %o, and are
calculated as follows:

[0163] In some aspects, a bioproduct produced according to the methods of the invention
has a δ
13C of about -30 or greater, about -28 or greater, about -27 or greater, about -20 or
greater, about -18 or greater, about -15 or greater, about -13 or greater, or about
-10 or greater. Alternatively, or in addition, a bioproduct has a δ
13C of about -4 or less, about -5 or less, about -8 or less, about -10 or less, about
-13 or less, about -15 or less, about -18 or less, or about -20 or less. Thus, the
bioproduct can have a δ
13C bounded by any two of the above endpoints. For example, the bioproduct can have
a δ
13C of about -30 to about -15, about -27 to about -19, about -25 to about -21, about
-15 to about -5, about -13 to about -7, or about -13 to about -10. In some embodiments,
the bioproduct can have a δ
13C of about -10, -11, -12, or -12.3. In other aspects, the bioproduct has a δ
13C of about -15.4 or greater. In yet other aspects, the bioproduct has a δ
13C of about -15.4 to about -10.9, or a δ
13C of about -13.92 to about -13.84.
[0164] Bioproducts can also be distinguished from petroleum-based organic compounds by comparing
the amount of
14C in each compound. Because
14C has a nuclear half life of 5730 years, petroleum based fuels containing "older"
carbon can be distinguished from bioproducts which contain "newer" carbon (see, e.g.,
Currie, "Source Apportionment of Atmospheric Particles", Characterization of Environmental
Particles, J. Buffle and H. P. van Leeuwen, Eds., Vol. I of the IUPAC Environmental
Analytical Chemistry Series, Lewis Publishers, Inc., pp. 3-74 (1992)).
[0165] 14C can be measured by accelerator mass spectrometry (AMS), with results given in units
of "fraction of modern carbon" (f
M). f
M is defined by National Institute of Standards and Technology (NIST) Standard Reference
Materials (SRMs) 4990B and 4990C. As used herein, "fraction of modem carbon" or f
M has the same meaning as defined by National Institute of Standards and Technology
(NIST) Standard Reference Materials (SRMs) 4990B and 4990C, known as oxalic acids
standards HOxI and HOxII, respectively. The fundamental definition relates to 0.95
times the
14C/
12C isotope ratio HOxI (referenced to AD 1950). This is roughly equivalent to decay-corrected
pre-Industrial Revolution wood. For the current living biosphere (plant material),
f
M is approximately 1.1.
[0166] In some aspects, a bioproduct produced according to the methods of the invention
has a f
M14C of at least about 1, e.g., at least about 1.003, at least about 1.01, at least about
1.04, at least about 1.111, at least about 1.18, or at least about 1.124. Alternatively,
or in addition, the bioproduct has an f
M14C of about 1.130 or less, e.g., about 1.124 or less, about 1.18 or less, about 1.111
or less, or about 1.04 or less. Thus, the bioproduct can have a f
M14C bounded by any two of the above endpoints. For example, the bioproduct can have
a f
M14C of about 1.003 to about 1.124, a f
M14C of about 1.04 to about 1.18, or a f
M14C of about 1.111 to about 1.124.
[0167] Another measurement of
14C is known as the percent of modem carbon, i.e., pMC. For an archaeologist or geologist
using
14C dates, AD 1950 equals "zero years old." This also represents 100 pMC. "Bomb carbon"
in the atmosphere reached almost twice the normal level in 1963 at the peak of thermo-nuclear
weapons testing. Its distribution within the atmosphere has been approximated since
its appearance, showing values that are greater than 100 pMC for plants and animals
living since AD 1950. It has gradually decreased over time with today's value being
near 107.5 pMC. This means that a fresh biomass material, such as corn, would give
a
14C signature near 107.5 pMC. Petroleum-based compounds will have a pMC value of zero.
Combining fossil carbon with present day carbon will result in a dilution of the present
day pMC content. By presuming 107.5 pMC represents the
14C content of present day biomass materials and 0 pMC represents the
14C content of petroleum-based products, the measured pMC value for that material will
reflect the proportions of the two component types. For example, a material derived
100% from present day soybeans would have a radiocarbon signature near 107.5 pMC.
If that material was diluted 50% with petroleum-based products, the resulting mixture
would have a radiocarbon signature of approximately 54 pMC.
[0168] A biologically-based carbon content is derived by assigning "100%" equal to 107.5
pMC and "0%" equal to 0 pMC. For example, a sample measuring 99 pMC will provide an
equivalent biologically-based carbon content of 93%. This value is referred to as
the mean biologically-based carbon result and assumes that all of the components within
the analyzed material originated either from present day biological material or petroleum-based
material.
[0169] In some aspects, a bioproduct produced according to the methods of the invention
has a pMC of at least about 50, at least about 60, at least about 70, at least about
75, at least about 80, at least about 85, at least about 90, at least about 95, at
least about 96, at least about 97, or at least about 98. Alternatively, or in addition,
the bioproduct has a pMC of about 100 or less, about 99 or less, about 98 or less,
about 96 or less, about 95 or less, about 90 or less, about 85 or less, or about 80
or less. Thus, the bioproduct can have a pMC bounded by any two of the above endpoints.
For example, a bioproduct can have a pMC of about 50 to about 100; about 60 to about
100; about 70 to about 100; about 80 to about 100; about 85 to about 100; about 87
to about 98; or about 90 to about 95. In other aspects, a bioproduct described herein
has a pMC of about 90, about 91, about 92, about 93, about 94, or about 94.2.
[0170] The following examples further illustrate the invention.
EXAMPLE 1
[0171] This example demonstrates a method to identify engineered host cells which display
enhanced production of fatty acids and derivatives thereof.
[0172] ALC310 is a previously characterized
E. coli strain having the genotype MG1655
(Δ
fadE::FRT Δ
fhuA::FRT fabB[A329V] Δ
entD::P
T5-entD) which carries the plasmid ALC310 (pCL1920_P
TRC_carBopt_13G04_alrA_sthA) (SEQ ID NO: 13) and produces fatty acids and derivatives
thereof. To identify strains which display an improved titer or yield of fatty acids
or derivatives thereof, transposon mutagenesis of ALC310 was performed followed by
high-throughput screening.
[0173] The transposon DNA was prepared by cloning a DNA fragment into the plasmid EZ-Tn5™
pMOD™<R6K ori/MCS> (Epicentre Biotechnologies, Madison, WI). The DNA fragment contains
a T5 promoter and a chloramphenicol resistance gene (
cat) flanked by loxP sites. The resulting plasmid was named p100.38 (SEQ ID NO: 14).
The p100.38 plasmid was optionally digested with PshAI restriction enzyme, incubated
with EZ-Tn5™ Transposase enzyme (Epicentre Biotechnologies, Madison, WI), and electroporated
into electrocompetent ALC310 cells as per the manufacturer's instructions. The resulting
colonies contained the transposon DNA inserted randomly into the chromosome of ALC31
0.
[0174] Transposon clones were then subjected to high-throughput screening to measure production
of fatty alcohols. Briefly, colonies were picked into deep-well plates containing
Luria-Bertani (LB) medium. After overnight growth, each culture was inoculated into
fresh LB. After 3 hours growth, each culture was inoculated into fresh FA-2 media.
Spectinomycin (100 µg/mL) was included in all media to maintain selection of the 7P36
plasmid. FA-2 medium is M9 medium with 3% glucose supplemented with antibiotics, 10
µg/L iron citrate, 1 µg/L thiamine, 0.1 M Bis-Tris buffer (pH 7.0), and a 1:1000 dilution
of the trace mineral solution described in Table 1.
TABLE 1
| Trace mineral solution (filter sterilized) |
| |
| 2 g/L ZnCl · 4H2O |
| 2 g/L CaCl2 · 6H2O |
| 2 g/L Na2MoO4 · 2H2O |
| 1.9 g/L CuSO4 · 5H2O |
| 0.5 g/L H3BO3 |
| 100 mL/L concentrated HCl |
| q.s. Milli-Q water |
[0175] After 20 hours growth in FA-2, the cultures were extracted with butyl acetate. The
crude extract was derivatized with BSTFA (N,O-bis[Trimethylsilyl]trifluoroacetamide)
and total fatty species (e.g., fatty alcohols, fatty aldehydes, and fatty acids) were
measured with GC-FID as described in International Patent Application Publication
WO 2008/119082.
[0176] Clones that produced 15% more total fatty species than ALC310 were subjected to further
verification using a shake-flask fermentation. Briefly, the clones were grown in 2
mL of LB medium supplemented with spectinomycin (100 mg/L) at 37 °C. After overnight
growth, 100 µL of culture was transferred into 2 mL of fresh LB supplemented with
antibiotics. After 3 hours growth, 2 mL of culture was transferred into a 125 mL-flask
containing 18 mL of FA-2 medium supplemented with spectinomycin (100 mg/L). When the
OD
600 of the culture reached 2.5, 1 mM of IPTG was added to each flask. After 20 hours
of growth at 37 °C, a 400 µL sample from each flask was removed, and total fatty species
were extracted with 400 µL butyl acetate. The crude extracts were analyzed directly
with GC-FID as described above.
[0177] A transposon clone (termed D288) was identified which displayed increased titers
of total fatty species as compared to the parental ALC310 strain (FIG. 2).
[0178] The results of this example demonstrate a method to identify engineered host cells
which display enhanced production of fatty acids and derivatives thereof as compared
to a corresponding wild-type host cell.
EXAMPLE 2
[0179] This example demonstrates that an engineered host cell with a transposon insertion
in the
nhaB gene displays enhanced production of fatty acids and derivatives thereof as compared
to a corresponding wild-type host cell.
[0180] Sequence analysis was performed to identify the location of the transposon insertion
in the D288 strain identified in Example 1. To do so, genomic DNA was purified from
a 3-mL overnight LB culture of D288 cells using the ZR Fungal/Bacterial DNA MiniPrep™
kit (Zymo Research) according to the manufacturer's instructions. The purified genomic
DNA was sequenced outward from the transposon using the primers DG150 (GCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACGCCTG)
(SEQ ID NO: 15) and DG153 (CCCAGGGCTTCCCGGTATCAACAGGGACACCAGG) (SEQ ID NO: 16), internal
to the transposon.
[0181] The D288 strain was determined to have a transposon insertion in the
nhaB gene (FIG. 3).
[0182] The results of this example demonstrate an engineered
E. coli host cell with a transposon insertion in the
nhaB gene displays enhanced production of fatty acids and derivatives thereof as compared
to a corresponding wild-type
E. coli host cell.
EXAMPLE 3
[0183] This example demonstrates that engineered host cells having an altered level of production
of FadR display enhanced production of fatty acids and derivatives thereof.
[0184] The
nhaB gene is proximal to the gene encoding the fatty acid degradation regulator, FadR
(FIG. 3). To determine if altering the expression of FadR affects the production of
fatty acids or derivatives thereof in host cells, a FadR expression library was cloned
and screened.
[0185] To clone the expression library, the wild-type
fadR gene was amplified from genomic DNA of
E. coli MG1655 by PCR using primers DG191 (SEQ ID NO: 17) and DG192 (SEQ ID NO: 18). A mutant
fadR gene containing amino acid change S219N was also amplified from
E. coli MG1655
fadR[S219N] genomic DNA using the DG191 and DG192 primer set. The primers used in this
example are listed in Table 2.
[0186] A gene cassette encoding for kanamycin resistance (
kan) was PCR amplified from plasmid pKD13 using primers SL03 (SEQ ID NO: 19) and SL23
(SEQ ID NO: 20). Each
fadR cassette (i.e., wild-type and S219N mutant) was separately joined with the kanamycin
resistance cassette using splicing by overlap extension (SOE) PCR using primers SL23
and DG193 (SEQ ID NO: 21). The DG193 primer contained degenerate nucleotides for the
generation of expression variants.
[0187] Plasmid p100.487 (pCL1920_P
TRC_carBopt_13G04_alrA_fabB[A329G]) (SEQ ID NO: 22) was linearized via restriction digestion
with enzymes SwaI and XhoI. Each of the two SOE PCR
fadR-kan products were separately cloned into linearized plasmid p100.487 using the INFUSION™
system (Clontech, Mountain View, CA), and then the plasmids were transformed into
chemically competent NEB TURBO™ cells (New England Biolabs, Ipswich, MA). Transformants
were plated on LB agar containing 50 µg/mL kanamycin.
[0188] Thousands of colonies were obtained for fadR and fadR [S219N]. Colonies were scraped
from plates and the plasmids were isolated by miniprepping according to standard protocols.
The resulting pool of plasmids was transformed into an
E. coli EG149 strain having a genotype of MG1655 (
ΔfadE::FRT Δ
fhuA::FRT fabB[A329V] Δ
entD::P
T5-
entD)), and selected on LB plates containing 100 µg/mL spectinomycin.
[0189] Transformants were then screened for production of total fatty species (e.g., fatty
acids, fatty aldehydes, and fatty alcohols) using the deep-well procedure described
in Example 1. Numerous strains were identified which displayed enhanced production
of total fatty species as compared to the control ALC487 strain (EG149 strain carrying
plasmid p100.487) (FIG. 4). Strains expressing either wild-type fadR or fadR [S219N]
displayed enhanced production of total fatty species as compared to the ALC487 strain,
although the highest titers were observed in strains expressing wild-type FadR (FIG.
4).
[0190] Several of the top producing strains expressing wild-type FadR identified in the
initial screen were assigned strain IDs and validated in a shake flask fermentation.
Briefly, each strain was streaked for single colonies, and three separate colonies
from each strain were grown in three separate flasks according to the shake flask
fermentation protocol described in Example 1. Total fatty species were measured using
GC-FID as described in Example 1. All of the strains expressing wild-type FadR displayed
higher total fatty species titers as compared to the control ALC487 strain (FIG. 5).
[0191] Several of the top producing strains expressing wild-type FadR were then further
characterized in order to determine the yield of fatty species. To do so, a shake
flask fermentation was performed as described above, except that (i) the temperature
was held at 32 °C, (ii) additional glucose was added after 18 hours and 43 hours,
and (iii) extraction was performed at 68.5 hours. The total fatty species produced
was divided by the total glucose consumed to calculate the fatty species yield. All
of the strains expressing wild-type FadR displayed a higher yield of total fatty species
as compared to the control ALC487 strain (FIG. 6).
[0192] The D512 strain was then further characterized by evaluating total fatty species
titer and yield following fermentation in a 5 L bioreactor. At a glucose feed rate
of 10 g/L/hr glucose, the D512 strain produced higher titers of fatty acids and fatty
alcohols as compared to the control ALC487 strain (FIG. 7). In addition, the total
yield on all fatty species increased in the D512 strain as compared to the ALC487
strain (FIG. 7). At a higher glucose feed rate of 15 g/L/hr, the D512 strain produced
approximately 68.5 g/L total fatty species at a yield of approximately 20% (FIG. 7).
The D512 strain produced a higher total fatty species titer and yield at 15 g/L/hr
as compared to 10 g/L/hr (FIG. 7).
[0193] Plasmid DNA was isolated from the D512 strain and sequenced according to standard
protocols. The plasmid obtained from the D512 strain, termed pDG109, was determined
to have the sequence corresponding to SEQ ID NO: 23.
[0194] The results of this example demonstrate that engineered host cells having an altered
level of expression of FadR produce higher titers and yields of fatty acids and derivatives
thereof as compared to corresponding wild-type host cells.
EXAMPLE 4
[0195] This example demonstrates a method to produce high titers of fatty acids in engineered
host cells having an altered level of expression of FadR.
[0196] The
E. coli EG149 strain utilized in Example 3 overexpresses the
entD gene, which encodes a phosphopantetheine transferase (PPTase) involved in the activation
of the CarB enzyme that catalyzes the reduction of fatty acids to fatty aldehydes
and fatty alcohols.
[0197] To assess the effect of entD expression on fatty acid and fatty alcohol production
in the D512 strain, a D512 variant was generated which contained a deletion of the
entD gene (D512 Δ
entD). Shake flask fermentations were performed with the D512 strain and the D512 ΔentD
strain as described in Example 1. The D512 strain produced high titers of fatty alcohols
and comparatively lower titers and yields of fatty acids (FIG. 7). In contrast, the
D512 ΔentD strain produced high titers and yields of fatty acids, and relatively low
titers of fatty alcohols (FIG. 8). The titers of total fatty species were similar
between the D512 strain and the D512 ΔentD strain (FIG. 8).
[0198] The results of this example demonstrate that engineered host cells having an altered
level of FadR expression produce high titers of fatty acids when the
entD gene is deleted.
EXAMPLE 5
[0199] This example demonstrates a method to identify engineered host cells which display
enhanced production of fatty acids and derivatives thereof.
[0200] To further assess the effect of altered FadR expression on the production of fatty
acids and derivatives thereof, ribosome binding site (RBS) libraries of FadR (S219N)
and wild-type FadR were prepared and screened in
E. coli host cells.
[0201] An RBS library was inserted upstream of the
fadR (S219N) gene in pDS57 as follows. The genomic DNA of a strain containing the fadR(S219N)
allele Moniker stEP005; id: s26z7 was amplified by PCR using the DG191 (SEQ ID NO:
17) and fadR (S219N)_pme319rc (SEQ ID NO: 24) primer set. The primers used in this
example are listed in Table 3.
[0202] After the fadR (S219N) template was made, the RBS was added by PCR using the 377-rbs-fadR
(S219N)f (SEQ ID NO: 25) and fadR (S219N)-pme319rc (SEQ ID NO: 24) primer set. The
377-rbs- fadR (S219N)f primer contained degenerate nucleotides to introduce variability
into the RBS library. The RBS- fadR (S219N) was ligated with a pDS57 vector backbone
(described in Example 5), using the commercial available CLONEZ™ kit from Genscript
(Piscataway, NJ) with the NH246 (SEQ ID NO: 26) and 377-3r (SEQ ID NO: 27) primer
set.
[0203] An RBS library also was inserted upstream of the wild-type
fadR gene in pDS57 using s similar protocol, except that the wild-type fadR gene was amplified
by PCR using
E. coli DV2 genomic DNA.
[0204] The ligated pDS57-rbs- fadR (S219N) and pDS57-rbs- fadR constructs were transformed
separately into an
E. coli DAM1 strain by electroporation. Strain DAM1 was produced as a derivative of strain
DV2 (MG1655 Δ
fadE, Δ
fhuA), where the lacI
q- P
Trc-tesA-fadD genes were integrated into the chromosome using the Tn7-based delivery
system present in plasmid pGRG25 (described in
McKenzie et al., BMC Microbiology 6: 39 (2006)). After transformation, the cells were recovered for 1 hour at 37 °C followed by
plating on LB agar containing spectinomycin. After overnight incubation at 37 °C,
single colonies were picked to screen in 96 deep well-plates containing 300 µL/well
LB with spectinomycin. The plates were incubated in a 32 °C shaker with 80% humidity
and shaking at 250 RPM for approximately 5 hours. After 5 hours of growth, 30 µL/well
of LB culture was transferred to 300 µL/well FA2 (2 g/L nitrogen) medium containing
spectinomycin. Plates were incubated again in a 32 °C shaker with 80% humidity and
shaking at 250 RPM overnight. 30 µL/well of the overnight culture was inoculated into
300 µL/well FA2 (1 g/L nitrogen) medium containing spectinomycin, ImM IPTG, and 2%
methanol. One replicate plate was incubated in 32 °C shaker and another was incubated
in a 37 °C shaker with 80% humidity and shaking at 250 RPM overnight. The recipe for
FA2 medium is listed in Table 4.
TABLE 4
| Reagent |
mL Reagent per 1000 mL FA2 |
| 5X Salt Solution |
200 |
| Thiamine (10 mg/mL) |
0.1 |
| 1M MgSO4 |
1 |
| 1M CaCl2 |
0.1 |
| 50% glucose |
60 |
| TM2 (trace minerals no iron) |
1 |
| 10 g/L ferric citrate |
1 |
| 2M Bis-Tris buffer |
50 |
| NH4Cl* |
10 |
| Water |
q.s. to 1000 mL |
| * eliminated for FA2 (1 g/L nitrogen) medium |
[0205] After approximately 24 hours of incubation, the plates were extracted by adding 40
µL/well 1M HCl and 300 µL/well butyl acetate. The plates were shaken for 15 minutes
at 2000 RPM, and then centrifuged for 10 minutes at 4500 RPM at room temperature.
50 µL of the organic layer per well was transferred to a shallow well 96-well plate
containing 50 µL/well BSTFA (Sigma Aldrich, St. Louis, MO), and the extracts were
analyzed by GC-FID.
[0206] Several clones of
E. coli DAM1 transformed with pDS57-rbs- fadR were identified as producing substantially
higher titers of FAMEs and free fatty acids as compared to control
E. coli DAM1 transformed with pDS57 alone. In general, the FadR variants produced low C14
to C16 ratios and displayed overall higher titers at 32 °C as compared to 37 °C.
[0207] Numerous clones of
E. coli DAM1 transformed with pDS57-rbs-FadR(S219N) also were identified as producing substantially
higher titers of FAMEs and free fatty acids as compared to control
E. coli DV2 or
E. coli DAM1 transformed with pDS57 alone.
[0208] Two of the clones transformed with pDS57-rbs-FadR(S219N) identified in the initial
screen (designated as P1A4 and P1G7) were further characterized in shake flask fermentations.
Briefly, each colony was inoculated into 5 mL of LB containing spectinomycin and incubated
at 37 °C with shaking at approximately 200 RPM for about 5 hours. 1.5 mL of the LB
culture was transferred into 13.5 mL FA2 (2 g/L nitrogen) medium containing 0.05%
Triton X-100 and spectinomycin in a 125 mL baffled flask. The flask cultures were
incubated overnight at 32 °C, 80% humidity and 250 RPM. 1.5 mL of the overnight culture
was transferred into a new 125 mL baffled flask that contained 13.5 mL FA2 (1 g/L
nitrogen) medium containing 0.05% Triton X-100, ImM IPTG, 2% methanol, and spectinomycin.
The flask cultures were then incubated at 32 °C, 80% humidity and 250 RPM. After 56
hours of incubation, 500 µL samples were taken out from each flask. 100 µL of each
sample was diluted with 900 µL water to measure the OD of the culture, 100 µL of each
sample was diluted with 900 µL water to measure remaining glucose, and 300 µL of each
sample was extracted and analyzed using GC-FID as described above.
[0209] Both of the two FadR variants (i.e., P1A4 and P1G7) produced higher titers and yields
of total fatty species as compared to the control strain transformed with pDS57 alone
in the shake flask fermentation (FIG. 9).
[0210] Production of fatty species by P1A4 and P1G7 was also measured in large scale fermentations.
To do so, cells from a frozen stock were grown in LB media for a few hours and then
transferred to a defined media consisting of 3 g/L KH
2PO
4, 6 g/L Na
2HPO
4 dihydrate, 2 g/L NH
4Cl, 0.24 g/L MgSO
4 x 7 H
2O, 20 g/L glucose, 200 mM Bis-Tris buffer (pH 7.2), 1.0 ml/L trace metals solution,
and 1.0 mg/L thiamine, and cultured overnight. The trace metals solution was composed
of 27 g/L FeCl
3 x 6 H
2O, 2 g/L ZnCl
2 x 4H
2O, 2 g/L CaCl
2 x 6 H
2O, 2 g/L Na
2MoO
4 x 2H
2O, 1.9 g/L CuSO
4 x 5 H
2O, 0.5 g/L H
3BO
3, and 40 mL/L of concentrated HCl.
[0211] 50 mL of each overnight culture was inoculated into 1 liter of production medium
in a fermentor with temperature, pH, agitation, aeration and dissolved oxygen control.
The medium composition was as follows: 1 g/L KH
2PO
4, 0.5 g/L (NH
4)
2SO
4, 0.5 g/L MgSO
4 x 7 H
2O, 5 g/L Bacto casaminoacids, 0.034 g/L ferric citrate, 0.12 ml/L 1M HCl, 0.02 g/L
ZnCl
2 x 4 H
2O, 0.02 g/L CaCl
2 x 2H
2O, 0.02 g/L Na
2MoO
4 x 2H
2O, 0.019 g/L CuSO
4 x 5 H
2O, 0.005 g/L H
3BO
3 and 1.25 mL/L of a vitamin solution. The vitamin solution contained 0.06 g/L riboflavina,
5.40 g/L pantothenic acid, 6.0 g/L niacine, 1.4 g/L piridoxine and 0.01 g/L folic
acid.
[0212] The fermentations were performed at 32°C, pH 6.8, and dissolved oxygen (DO) equal
to 25% of saturation. pH was maintained by addition of NH
4OH, which also served as nitrogen source for cell growth. When the initial 5 g/L of
glucose had been almost consumed, a feed consisting of 500 g/L glucose, 1.6 g/L of
KH
2PO
4, 3.9 g/L MgSO
4.7H
2O, 0.13 g/L ferric citrate, and 30 ml/L of methanol was supplied to the fermentor.
[0213] In the early phase of growth, the production of FAME was induced by the addition
of 1 mM IPTG and 20 ml/L of pure methanol. After most of the cell growth was completed,
the feed rate was maintained at a rate of 7.5 g glucose/L/hour. After induction, methanol
was continuously supplied with the glucose feed. The fermentation was continued for
a period of 3 days, and samples were taken at several timepoints for analysis of fatty
species as described above.
[0214] P1A4 and P1G7 produced higher titers of total fatty species (FAMEs and free fatty
acids) as compared to the control strain transformed with pDS57 alone in the large
scale fermentations (FIG. 10). In addition, P1A4 and P1G7 produced higher yields of
total fatty species as compared to the control strain in the large scale fermentations
(FIG. 11).
[0215] The results of this example demonstrate methods to produce engineered host cells
having altered FadR expression which display enhanced titers and yields of FAMEs and
fatty acids as compared to corresponding wild-type cells.
[0216] The use of the terms "a" and "an" and "the" and similar referents in the context
of describing the invention (especially in the context of the following claims) are
to be construed to cover both the singular and the plural, unless otherwise indicated
herein or clearly contradicted by context. The terms "comprising," "having," "including,"
and "containing" are to be construed as open-ended terms (i.e., meaning "including,
but not limited to,") unless otherwise noted. Recitation of ranges of values herein
are merely intended to serve as a shorthand method of referring individually to each
separate value falling within the range, unless otherwise indicated herein, and each
separate value is incorporated into the specification as if it were individually recited
herein. All methods described herein can be performed in any suitable order unless
otherwise indicated herein or otherwise clearly contradicted by context. The use of
any and all examples, or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not pose a limitation
on the scope of the invention unless otherwise claimed. No language in the specification
should be construed as indicating any non-claimed element as essential to the practice
of the invention.
SEQUENCE LISTING
[0217]
<110> LS9, INC.
<120> METHODS AND COMPOSITIONS FOR IMPROVED PRODUCTION OF FATTY ACIDS AND DERIVATIVES
THEREOF
<130> LS00034 PCT
<140>
<141>
<150> 61/470,989
<151> 2011-04-01
<160> 23
<170> PatentIn version 3.5
<210> 1
<211> 239
<212> PRT
<213> Escherichia coli
<400> 1


<210> 2
<211> 473
<212> PRT
<213> Marinobacter hydrocarbonoclasticus
<400> 2



<210> 3
<211> 455
<212> PRT
<213> Marinobacter hydrocarbonoclasticus
<400> 3



<210> 4
<211> 457
<212> PRT
<213> Alcanivorax borkumensis
<400> 4



<210> 5
<211> 451
<212> PRT
<213> Alcanivorax borkumensis
<400> 5



<210> 6
<211> 455
<212> PRT
<213> Marinobacter aquaeolei
<400> 6



<210> 7
<211> 473
<212> PRT
<213> Marinobacter aquaeolei
<400> 7



<210> 8
<211> 1173
<212> PRT
<213> Mycobacterium smegmatis
<400> 8





<210> 9
<211> 341
<212> PRT
<213> Acinetobacter baylyi
<400> 9



<210> 10
<211> 339
<212> PRT
<213> Escherichia coli
<400> 10


<210> 11
<211> 208
<212> PRT
<213> Escherichia coli
<400> 11


<210> 12
<211> 209
<212> PRT
<213> Escherichia coli
<400> 12


<210> 13
<211> 12397
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic polynucleotide"
<400> 13








<210> 14
<211> 3227
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic polynucleotide"
<400> 14



<210> 15
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic primer"
<400> 15
gcagttattg gtgcccttaa acgcctggtt gctacgcctg 40
<210> 16
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic primer"
<400> 16
cccagggctt cccggtatca acagggacac cagg 34
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<221> source

<221> modified_base
<222> (16)..(16)
<223> a, c, t, g, unknown or other
<220>
<221> modified_base
<222> (21)..(21)
<223> a, c, t, g, unknown or other
<220>
<221> modified_base
<222> (27) .. (27)
<223> a, c, t, g, unknown or other
<220>
<221> modified_base
<222> (34)..(40)
<223> a, c, t, g, unknown or other
<400> 21

<210> 22
<211> 12206
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic polynucleotide"
<400> 22








<210> 23
<211> 14893
<212> DNA
<213> Artificial Sequence
<220>
<221> source
<223> /note="Description of Artificial Sequence: Synthetic polynucleotide"
<400> 23








