Technical Field
[0001] The present invention relates to an adeno-associated virus with site-directed mutagenesis
and site-specific modification, specifically, the present invention relates to an
adeno-associated virus with site-directed mutagenesis and site-specific modification
using non-natural amino acids and adeno-associated virus capsid protein VP1 or fragment
thereof. The present invention further relates to a preparation method and uses of
the adeno-associated virus with site-directed mutagenesis and site-specific modification.
Background Art
[0002] Adeno-associated viruses (AAVs) are nonenveloped, single-stranded DNA viruses of
the family
Panvoviridae [1] and the genus
Dependovirus that are not associated with any known disease and show great potential as gene transfer
vectors
[2]. AAVs depend on co-infection with a helper virus, such as adenovirus, herpes-virus,
or papillomavirus for productive replication
[3]. AAV has been considered as a promising vehicle for human gene therapy based on its
ability to infect both dividing and non-dividing cells, as well as establish long-term
gene expression in vivo without known pathological consequence of infection
[4-7]. The AAV type 2 (AAV2) nanoparticles constitutes the first primate AAV to be cloned,
and promising results have been obtained with this nano vector in clinical gene transfer,
including cystic fibrosis
[8], retinal degenerative disorders
[9-11] and haemophilia B
[12, 13].
[0003] In recent years, there have been intensive efforts in many laboratories to generate
targeted AAV vectors by modifying the cell-binding characteristics of these particles.
The primary strategy has been to genetically modify the AAV capsid proteins by insertion
of targeting peptide motifs that can direct nano vectors to specific cell types. This
method has been successfully employed to retarget AAV to arterial endothelium
[14], striated muscles
[15], and brain vasculature
[l6]. However, the major technical challenges in this manipulation include the low production
yield, dramatic reduction of vector titer, or significant drop of DNA packaging efficiency
[17]. The large-scale genetic engineering modifications of viral capsid may abrogate their
infectivity and even alter the innate interactions between viruses and host cells.
For this reason, it is necessary to develop a site-selective and non-destructive technique
for modifying adeno-associated viruses.
[0004] After several years of studying, comprehensive understanding of ribosome translation
mechanism of prokaryotic organisms is almost achieved, crystalline and electron microscopic
structures of many ribosomes under different functional status have been resolved;
and structures of most aminoacyl-tRNA synthases have been obtained. On the basis of
these achievements, a technology of expanding genetic code is developing in recent
years, in which an amber termination codon (TAG) is used to encode a variety of non-natural
amino acids and to perform site-specific incorporation into organisms in vivo. So
far, this technology has been successfully used to site-specifically express dozens
of non-natural amino acids in proteins of living cells, which endow these proteins
with novel physical, chemical and physiological properties. By using this method,
non-natural amino acids (including amino acids for affinity labeling and photoisomerization,
carbonylated amino acids and glycosylated amino acids) can be incorporated into proteins
(
L. Wang, et al, (2001), SCIENCE 292:498-500;
J.W. Chin, et al, 2002, Journal of the American Chemical Society 124:9026-9027;
J. W. Chin, &P. G. Schultz, 2002, ChemBioChem 11:1135-1137). These researches show that it is possible that chemical groups such as carbonyl,
alkynyl and azido can be selectively and conventionally into proteins, in which these
groups generally can effectively and selectively form stable covalent bonds, which
is advantageous for site-specific modification of proteins and improvement of properties
of proteins.
[0005] However, this technology has not been applied in site-modification of adeno-associated
virus yet.
Summary of the Invention
[0006] After intensive laboratory researches, the inventors surprisingly find that genetic
code expanding techniques can be used to incorporate an non-natural amino acid into
an adeno-associated virus capsid protein VP1 or a fragment thereof at some specific
sites, which is further expressed on adeno-associated virus, thereby implementing
the present invention.
[0007] In one embodiment of the present invention, 14 mutation sites are selected according
to structural analysis of adeno-associated virus capsid protein VP1, the codons of
amino acids corresponding to these 14 sites are mutated as TAG, and 14 VP1 protein
expression vectors are constructed.
[0008] In one embodiment of the present invention, these 14 vectors are separately used
with a vector comprising a gene encoding orthogonal amber mutant suppressor aminoacyl-tRNA
synthase/tRNA
CUA pairs to co-transfer cells, and non-natural amino acid NAEK is added in cell culture
media. Experiments confirm that non-natural amino acid NAEK can be inserted separately
at sites R447, G453, S578, N587, N587+1 and S662, while non-natural amino acid NAEK
cannot be inserted at other sites. In another embodiment of the present invention,
it is confirmed with experiments that non-natural amino acid DiZPK can be inserted
at site N587.
[0009] The mechanism of this mutation system is that mutant tRNA
Pyl, PylRS meet the following requirements: (1) tRNA
Pyl cannot use lysyl-tRNA enzymeof host cell, and can be acylated by mutant PylRS only;
(2) mutant PylRS can acylate tRNAPyl only, and cannot acylate other tRNA; that is,
mutant tRNAPyl and PylRS have an orthogonal relation between each other. This orthogonal
enzyme, and only this enzyme, can acylate an non-natural amino acid to this orthogonal
tRNA, and to only this tRNA, but cannot acylate other tRNA. The resultant orthogonal
lysyl-tRNA synthase/tRNA system makes NAEK or DiZPK, which are not 20 common amino
acids, to correspond to amber codon TAG, so that this non-natural amino acid is incorporated
into adeno capsid protein.
[0010] In one embodiment of the present invention, an adeno-associated virus with a site-specifically
inserted non-natural amino acid is obtained.
[0011] In embodiments of the present invention, an adeno-associated virus with a site-specific
mutation is equivalent to a wild-type virus in terms of viral production and transduction
ability to cell.
[0012] In embodiments of the present invention, an adeno-associated virus with a site-specific
mutation is co-incubated with a fluorescence labeling molecule, so that an non-natural
amino acid is coupled to the fluorescence labeling molecule via a click chemistry.
[0013] In one embodiment of the present invention, a motion trail of single virus can be
observed under a confocal microscopy via a fluorescence labeling molecule coupled
with an adeno-associated virus with a site-specific mutation.
[0014] In one embodiment of the present invention, an adeno-associated virus with site-specific
mutation is coupled to a targeting molecule via a click chemistry, which can improve
targeting ability of an adeno-associated virus with site-specific mutation to a cell.
[0015] In one embodiment of the present invention, an adeno-associated virus with site-specific
mutation can further express a functional protein or a nucleic acid, so that the functional
protein or the nucleic acid can exert activity in an infected cell.
[0016] More specifically, the present invention relates to the following aspects.
[0017] The first aspect of the present invention relates to a site-specifically mutated
adeno-associated virus capsid protein VP1 or a fragment thereof, in which an amino
acid at a specific site of a corresponding wild type adeno-associated virus capsid
protein VP1 or a fragment thereof is mutated as an non-natural amino acid, the specific
site is at least one site selected from sites R447, G453, S578, N587, N587+1, S662
of VP1 or fragment thereof.
[0018] In embodiments of the present invention, the VP1 has an amino acid sequence as shown
in SEQ ID NO: 1, and the VP1 has a nucleotide sequence as shown in SEQ ID NO: 2.
[0019] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the non-natural
amino acid for example can be an azido non-natural amino acid, a photo-crosslinking
non-natural amino acid, a keto non-natural amino acid, an alkynyl non-natural amino
acid, an acetyl non-natural amino acid, a phosphoryl non-natural amino acid, a methyl
non-natural amino acid. In embodiments of the present invention, the non-natural amino
acid is an azido-containing non-natural amino acid, for example,
Nε-2-azideoethyloxycarbonyl-L-lysine (NAEK),

or the non-natural amino acid is an non-natural amino acid with structure similar
to the above azido-containing non-natural amino acid, for example, DiZPK.
[0020] In one embodiment of the present invention, an amino acid at a specific site of a
wild type adeno-associated virus capsid protein VP1 or fragment thereof is mutated
as NAEK, the specific site is at least one site selected from sites R447, G453, S578,
N587, N587+1, S662 of the VP1 or fragment thereof.
[0021] In another embodiment of the present invention, an amino acid at a specific site
of a wild type adeno-associated virus capsid protein VP1 or fragment thereof is mutated
as DiZPK, the specific site is site N587 of the VP1 or fragment thereof.
[0022] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the NAEK and the
amino acid sequence of VP1 or fragment thereof are linked in a manner as shown in
Formula I:

wherein the direction from R1 to R2 is the direction from N-terminal to C-terminal
of the amino acid sequence, in which amino acid at site N is one of amino acids at
sites selected from site R447, site G453, site S578, site N587, site N587+1, site
S662, R1 is an amino acid residue at site 1 to site N-1 of the amino acid sequence
of VP1 or fragment thereof, R2 is an amino acid residue at site N+1 to C-terminal
of the amino acid sequence of VP1 or fragment thereof.
[0023] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the DiZPK and
the amino acid sequence of VP1 or fragment thereof are linked in a manner as shown
in Formula II:

wherein the direction from R1 to R2 is the direction from N-terminal to C-terminal
of the amino acid sequence, in which amino acid at site N is amino acid at site N587,
R1 is an amino acid residue at site 1 to site N-1 of the amino acid sequence of VP1
protein or fragment thereof, R2 is an amino acid residue at site N+1 to C-terminal
of the amino acid sequence of VP1 protein or fragment thereof,
R3 is

[0024] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the adeno-associated
virus is type 2 adeno-associated virus (AAV2).
[0025] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the non-natural
amino acid further links to a labeling group, such as fluorescence labeling group,
or a labeling group capable of occurring a click chemistry with azide.
[0026] In embodiments of the present invention, the labeling group is Alexa fluorescence
group, such as Alexa 488 or Alexa 555. In some specific embodiments, the labeling
group is DIBO-Alexa 488 or DIBO-Alexa 555.
[0027] In embodiments of the present invention, a DIBO-containing labeling molecule is linked
to an azido-containing non-natural amino acid via a click chemistry, especially a
copper-free click chemistry.
[0028] The adeno-associated virus capsid protein VP1 or fragment thereof according to any
one of items of the first aspect of the present invention, in which the non-natural
amino acid further links to another functional molecule, such as targeting molecule,
preferably, the targeting molecule further links to a group capable of occurring click
chemistry with an azide, such as DIBO (dibenzocyclooctyne), cyclooctyne, alkynyl.
[0029] The second aspect of the present invention relates to a site-specifically mutated
adeno-associated virus capsid protein, which comprises the adeno-associated virus
capsid protein VP1 or fragment thereof according to any one of items of the first
aspect of the present invention.
[0030] The third aspect of the present invention relates to a site-specifically mutated
adeno-associated virus, which comprises the adeno-associated virus capsid protein
VP1 or fragment thereof according to any one of items of the first aspect of the present
invention, or the adeno-associated virus capsid protein according to any one of items
of the second aspect.
[0031] The adeno-associated virus according to any one of items of the third aspect according
to the present invention, wherein the non-natural amino acid further links to a labeling
group, such as fluorescence labeling group, or a labeling group capable of occurring
a click chemistry with azide.
[0032] In embodiments of the present invention, the labeling group is Alexa fluorescence
group, such as Alexa 488 or Alexa 555. In some specific embodiments, the labeling
group is DIBO-Alexa 488 or DIBO-Alexa 555.
[0033] In embodiments of the present invention, a DIBO-containing labeling molecule is linked
to an azido-containing non-natural amino acid via a click chemistry, especially a
copper-free click chemistry.
[0034] The adeno-associated virus according to any one of items of the third aspect according
to the present invention, wherein the non-natural amino acid further links to another
functional molecule, such as targeting molecule, preferably, the targeting molecule
further links to a group capable of occurring click chemistry with an azide, such
as DIBO (dibenzocyclooctyne), cyclooctyne, alkynyl.
[0035] In the present invention, the targeting molecules include any molecules having targeting
function known in the prior art, which are substances capable of targeting cells,
tissues or organs, for example, which may refer to substances capable of specifically
binding to proteins or nucleic acids (e.g., epidermal growth factor receptors, epidermal
growth factor receptor tyrosine kinases, vascular endothelial growth factor receptors,
leukocyte differentiation antigens, integrins, acetylcholine receptors, folate receptors)
on surface or in cellular internal (e.g., specific subcellular fractions or organelles)
of a kind or group of specific cells (e.g., tumor cells, immune cells), and the targeting
molecules can be for example antigens, ligands, signal peptides, toxins, nucleic acids,
polysaccharides, folic acids, etc. The targeting molecule can additionally promote
a fraction to which it links enters a target cell, tissue or organ.
[0036] In embodiments of the present invention, the targeting molecules refer to molecules
capable of targeting tumor cell surface proteins, such as molecules capable of binding
to integrins on tumor cell surface, for example, RGD, especially cyclic RGD.
[0037] The adeno-associated virus according to any one of items of the third aspect according
to the present invention, which carries a functional nucleic acid fragment or a nucleic
acid fragment of a labeling molecule.
[0038] In the present invention, the functional nucleic acid fragment can act as a functional
protein or nucleic acid in a cell, a tissue or an organ, wherein the functional protein
is a protein having activity on the cell, tissue or organ well known in the art, for
example, a cytotoxin, a tumor necrosis factor, an apoptosis-promoting protein, a growth
hormone, an interferon, a neurotrophic factor, and the functional nucleic acid is
a nucleic acid molecule have activity as well known in the art, for example, a RNA
molecule, such as small interfering RNA, micro-RNA, etc.
[0039] In the present invention, the labeling molecule is a molecule having labeling function
as well known in the art, for example, a fluorescence molecule, a polypeptide, an
antibody, an enzyme, a functional small molecular compound, etc.
[0040] In embodiments of the present invention, the functional nucleic acid fragment refers
to a nucleic acid fragment encoding an apoptosis-inducing ligand associated with thymidine
kinase or tumor necrosis factor.
[0041] In embodiments of the present invention, the nucleic acid fragment of the labeling
molecule refers to a nucleic acid fragment encoding GFP.
[0042] The forth aspect of the present invention relates to a nucleic acid encoding the
adeno-associated virus capsid protein VP1 or fragment thereof according to any one
of items of the first aspect of the present invention, the nucleic acid differs from
a nucleic acid encoding a corresponding wild type adeno-associated virus capsid protein
in that the codon encoding the non-natural amino acid at the specific site amino acid
is TAG.
[0043] In one embodiment of the present invention, wherein the codon encoding one amino
acid of the amino acids at sites R447, G453, S578, N587, N587+1, S662 of a wild type
adeno-associated virus capsid protein VP1 or fragment thereof is mutated as TAG.
[0044] In another embodiment of the present invention, wherein the codon encoding the amino
acid at site N587 of a wild type adeno-associated virus capsid protein VP1 or fragment
thereof is mutated as TAG.
[0045] The fifth aspect of the present invention relates to a nucleic acid vector, which
operably links to the nucleic acid molecule according to any one of items of the forth
aspect of the present invention.
[0046] The nucleic acid vector according to any one of items of the fifth aspect of the
present invention, wherein the vector is a eukaryotic expression vector or an adeno-associated
virus vector.
[0047] In one embodiment of the present invention, which is vector pCMV-VP1-Flag operably
linking to the nucleic acid molecule acid molecule according to any one of items of
the forth aspect of the present invention.
[0048] In one embodiment of the present invention, which is vector pAAV-RC in which the
codon encoding one amino acid of the amino acids at sites R447, G453, S578, N587,
N587+1, S662 of a wild type adeno-associated virus capsid protein VP1 or fragment
thereof is mutated as TAG.
[0049] The present invention further relates to a host cell, which comprises the nucleic
acid vector according to any one items of the fifth aspect of the present invention.
[0050] The host cell according to any one of items of the present invention, further comprises
a vector of gene encoding orthogonal amber mutant suppressor aminoacyl-tRNA synthase/tRNA
CUA pairs.
[0051] In embodiments of the present invention, the vector of gene encoding orthogonal amber
mutant suppressor aminoacyl-tRNA synthase/tRNA
CUA is a plasmid pACYC-tRNA/PylRS, which is obtained from pACYC-tRNA/PylRS of
Escherichia coli with deposition date of June 14, 2011 and deposition number of CGMCC No: 4951.
[0052] The host cell according to any one of items of the present invention, further comprises
a pHelper vector and a pAAV-GFP vector.
[0053] In embodiments of the present invention, the host cell is a cell of mammal, the mammal
is human, monkey, mouse, bovine, equine, caprine, etc.
[0054] In embodiments of the present invention, the host cell is AAV-293 cell.
[0055] In another embodiment of the present invention, the host cell is HeLa cell.
[0056] In another embodiment of the present invention, the host cell is U87 cell.
[0057] The present invention further relates to a method for preparing a site-specifically
mutated adeno-associated virus capsid protein VP1, VP2 or VP3, which comprises the
following steps:
- (1) cloning a gene of a wild type VP1 protein into a suitable expression vector to
obtain a recombinant expression vector;
- (2) selecting one or more specific amino acid sites from amino acid sequence of a
wild type adeno-associated virus capsid protein VP1 or fragment thereof, preferably,
selecting the specific amino acid sites from sites R447, G453, S578, N587, N587+1,
S662 of VP1 or fragment thereof;
- (3) mutating a codon in the recombination expression vector, which encodes the amino
acid of VP1 or fragment thereof at the site selected in step (2), as codon TAG by
a genetic engineering method, to obtain a mutant sequence expression vector of the
site-specifically mutated VP1 or fragment thereof;
- (4) co-transfecting a suitable host cell with the mutant sequence expression vector
as obtained in step (3) and a vector of gene encoding orthogonal amber mutant suppressor
aminoacyl-tRNA synthase/tRNACUA pairs, culturing the successfully co-transfected host cell in a culture media comprising
an non-natural amino acid, inducing expression under suitable conditions, to obtain
the site-specifically mutated adeno-associated virus capsid protein VP 1 or fragment
thereof.
[0058] In one embodiment of the present invention, the specific amino acid site is one site
selected from sites R447, G453, S578, N587, N587+1, S662 of VP1 or fragment thereof.
[0059] In another embodiment of the present invention, the specific amino acid site is site
N587 of VP1 or fragment thereof.
[0060] In embodiments of the present invention, the suitable vector is eukaryotic expression
vector, such as vector pCMV-VP1-flag.
[0061] In embodiments of the present invention, the mutant sequence expression vector is
pCMV-VP1-flag-R447, pCMV-VP1-flag-G453, pCMV-VP1-flag-5578, pCMV-VP1-flag-N587, pCMV-VP1-flag-N587+1
or pCMV-VP1-flag-5662.
[0062] In embodiments of the present invention, the vector of gene encoding orthogonal amber
mutant suppressor aminoacyl-tRNA synthase/tRNA
CUA is a plasmid pACYC-tRNA/PylRS, which is obtained from pACYC-tRNA/PylRS of
Escherichia coli with deposition date of June 14, 2011 and deposition number of CGMCC No: 4951.
[0063] In embodiments of the present invention, the vector co-transfected in step (4) further
comprises vectors pHelper and pAAV-GFP.
[0064] In embodiments of the present invention, the suitable host cell in step (4) is an
AAV-293 incasing cell.
[0065] In embodiments of the present invention, the non-natural amino acid an azido-containing
non-natural amino acid, for example, Nε-2-azideoethyloxycarbonyl-L-lysine (NAEK),
or the non-natural amino acid is an non-natural amino acid with structure similar
to the above azido-containing non-natural amino acid, for example, DiZPK.
[0066] In embodiments of the present invention, the successfully transfected host cell is
cultured in a culturing media comprising 1mM of non-natural amino acid for 48 h.
[0067] The present inventor further relates to a method for preparing a site-specifically
mutated adeno-associated virus, which comprises the following steps:
- (1) providing a plasmid pAAV-RC (which contains a gene encoding capsid protein VP1,
VP2 or VP3) for virus packaging, selecting one or more specific amino acid sites to
be mutated from amino acid sequence of a wild-type adeno-associated virus capsid protein
VP1 or fragment thereof, preferably, the specific amino acid site is at least one
site selected from sites R447, G453, S578, N587, N587+1, S662 of VP1 or fragment thereof;
- (2) using the plasmid pAAV-RC of step (1) as template, mutating a codon, which encodes
the amino acid of VP1 or fragment thereof at the site selected in step (1), as codon
TAG by a genetic engineering method, to obtain a site-specifically mutated virus packaging
plasmid;
- (3) co-transfecting a host cell with the mutant sequence expression vector obtained
in step (3) and a vector of gene encoding orthogonal amber mutant suppressor aminoacyl-tRNA
synthase/tRNACUA pairs, culturing the successfully co-transfected host cell in a culture media comprising
an non-natural amino acid, inducing expression under suitable conditions, to obtain
the site-specifically mutated adeno-associated virus.
[0068] In one embodiment of the present invention, the specific amino acid site is one site
selected from sites R447, G453, S578, N587, N587+1, S662 of VP1 or fragment thereof.
[0069] In another embodiment of the present invention, the specific amino acid site is site
N587 of VP1 or fragment thereof.
[0070] In embodiments of the present invention, the mutant sequence expression vector is
pAAV-RC-R447, pAAV-RC-G453, pAAV-RC-5578, pAAV-RC-N587, pAAV-RC-N587+1 or pAAV-RC-S662.
[0071] In embodiments of the present invention, the vector of gene encoding orthogonal amber
mutant suppressor aminoacyl-tRNA synthase/tRNA
CUA is a plasmid pACYC-tRNA/PylRS, which is obtained from pACYC-tRNA/PylRS of
Escherichia coli with deposition date of June 14, 2011 and deposition number of CGMCC No: 4951.
[0072] In embodiments of the present invention, the vector co-transfected in step (4) further
comprises vectors pHelper and pAAV-GFP.
[0073] In embodiments of the present invention, the suitable host cell in step (4) is an
AAV-293 incasing cell.
[0074] In embodiments of the present invention, the non-natural amino acid is NAEK or DiZPK.
[0075] In embodiments of the present invention, the successfully transfected host cell is
cultured in a culturing media comprising 1mM of non-natural amino acid for 72 h.
[0076] The present invention further relates to a composition (e.g., pharmaceutical composition)
or a kit, which comprises the adeno-associated virus according to any one of items
of the third aspect of the present invention, or the nucleic acid molecule according
to any one of items of the forth aspect, or the nucleic acid vector according to any
one of items of the fifth aspect, and optional pharmaceutically acceptable excipients.
[0077] The present invention further relates to a gene vaccine, which comprises the adeno-associated
virus according to any one of items of the third aspect of the present invention,
or the nucleic acid molecule according to any one of items of the forth aspect, or
the nucleic acid vector according to any one of items of the fifth aspect.
[0078] The present invention further relates to a use of the adeno-associated virus according
to any one of items of the third aspect of the present invention, or the nucleic acid
molecule according to any one of items of the forth aspect, or the nucleic acid vector
according to any one of items of the fifth aspect, in manufacture of a preparation
for obtaining adeno-associated virus binding protein, or in manufacture of a medicament
for gene therapy, or in manufacture of a DNA vaccine.
[0079] The present invention further relates to a use of the adeno-associated virus according
to any one of items of the third aspect of the present invention as a tool adeno-associated
virus.
[0080] In the present invention, the adeno-associated virus can be used as a tool viral
vector, which can carry a functional gene corresponding to specific requirement or
couple to a functional molecule on surface thereof, and be used for fundamental researches,
gene therapy or manufacture of DNA vaccine.
[0081] The present invention further relates to a gene therapeutic method, the method comprising
administering a subject in need with an effective amount of the adeno-associated virus
according to any one of items of the third aspect of the present invention, or the
nucleic acid molecule according to any one of items of the forth aspect, or the nucleic
acid vector according to any one of items of the fifth aspect.
[0082] In embodiments of the present invention, a targeting molecule is coupled to surface
of adeno-associated virus with site-specific mutation and modification, and the adeno-associated
virus also expresses functional protein at the same time, the adeno-associated virus
can be targeted to a specific cell by using the targeting molecule, the functional
protein specifically exerts activity to the specific cell, so as to fulfill gene therapy.
[0083] In embodiments of the present invention, a targeting molecule cyclic RGD is coupled
to surface of adeno-associated virus with site-specific mutation and modification,
and the adeno-associated virus also expresses functional protein TNF-related apoptosis-inducing
ligand or thymidine kinase at the same time, the adeno-associated virus can be targeted
to a tumor cell expressing high level of integrin by using the targeting molecule,
the functional protein specifically exerts activity to the tumor cell, so as to fulfill
gene therapy.
[0084] In the present invention, the adeno-associated virus can be adeno-associated viruses
of various serotypes, for example, can be AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9.
In embodiments of the present invention, the adeno-associated virus is AAV2. When
using adeno-associated virus of other serotypes, those skilled in the art well know
that a plasmid comprising an encoding sequence of corresponding capsid protein can
be selected for a different viral capsid protein.
[0085] In the present invention, the adeno-associated virus and adeno-associated virus vector
have the same meaning.
[0086] In the present invention, the mutated amino acid sites of VP1 are all based on VP1
of type AAV2 adeno-associated virus standard strain (which amino acid sequence is
shown in SEQ ID NO:1); if adenoviruses of other types are used, those skilled in the
art can obtain sites corresponding to mutation sites R447, G453, S578, N587, N587+1,
S662 of the present invention according to amino acid sequences of other types adenovirus
VP1.
[0087] In the present invention, the fragment of VP1 refers to a protein formed with part
of sequence of VP1, especially a protein formed with its C-terminal sequence, for
example, which refers to capsid protein VP2 or capsid protein VP3; wherein VP2 is
a protein formed with 598 amino acids at C-terminal of VP1, VP3 is a protein formed
with 533 amino acids at C-terminal of VP 1.
[0088] In the present invention, the amino acid sites of the fragment of VP1 are defined
like those of VP1; for example, the amino acid at site R447 of VP2 as mentioned in
the present invention corresponds to the amino acid at actual site R310 of VP2.
[0089] In the present invention, when adeno-associated virus VP1 or fragment thereof is
mentioned, it is described by the sequence as shown in SEQ ID NO: 1. For example,
expression "amino acid at site R447 of VP1 or fragment thereof" refers to the amino
acid residue at site R447 of the polypeptide as shown in SEQ ID NO: 1. However, those
skilled in the art would understand that the amino acid sequence of adeno-associated
virus VP1 may have naturally generated or artificially introduced mutations or variations
(including, but not being limited to, replacement, deficiency and/or addition, for
example, various serotypes or chimeric serotypes of adeno-associated virus VP1 or
fragments thereof or mutants thereof), with proviso that its biological functions
are not influenced. Hence, in the present invention, the term "VP1 or fragment thereof"
should include all of these sequences, for example, include the sequence as shown
in SEQ ID NO: 1 and its natural or artificial variants. In addition, when fragment
of VP1 sequence is mentioned, it not only includes the fragments of SEQ ID NO: 1,
but also includes corresponding fragments of sequences of natural or artificial variants
of VP 1. For example, the expression "amino acid at site R447 of VP1" refers to the
amino acid residue at site R447 of SEQ ID NO: 1, and corresponding amino acid residues
of its (natural or artificial) variants. According to the present invention, the expression
"corresponding site" refers to sites at equivalent positions of sequences in an optimum
comparison for obtaining the highest percentage of identity.
[0090] In the present invention, the algorithm used for determine sequence identity and
sequence similarity is for example, BLAST or BLAST 2.0 algorithm, they are separately
described by
Altschul, et al, (1977) Nucl. Acid. Res. 25: 3389-3402, and
Altschul, et al, (1990) J. Mol. Biol. 215: 403-410. When using parameters of the references or default parameters, BLAST and BLAST 2.0
can be used to determine the identity percentage of amino acid sequence of the present
invention. The software for executing BLAST analysis can be obtained by public from
the National Center of Biotechnology Information.
[0091] In the present invention, the amino acid sequences having at least 90% sequence identity
in comparison with the amino acid sequence include polypeptide sequences substantively
identical to the amino acid sequence. For example, when the method of the present
invention (e.g., BLAST analysis with standard parameters) is used, these sequences
have at least 90% sequence identity, preferably at least 91%, 92 %, 93 %, 94 %, 95
%, 96 %, 97 %, 98 % or 99 % or higher sequence identity, in comparison with the polypeptide
sequence of the present invention.
[0092] In embodiments of the present invention, the type AAV2 adeno-associated virus refers
to a type AAV2 adeno-associated virus standard strain, which has an amino acid sequence
of VP1 as shown in SEQ ID NO: 1.
[0093] In the present invention, the adeno-associated virus capsid protein is encoded by
adeno-associated virus
cap gene, which separately encodes 3 structural proteins VP1, VP2 and VP3, with molecular
weights of 87, 73, 61kDa, respectively.
[0094] In the present invention, the non-natural amino acid can be any non-natural amino
acids known in the prior art, for example, an azido non-natural amino acid, a photo-crosslinking
non-natural amino acid, a keto non-natural amino acid, an alkynyl non-natural amino
acid, an acetyl non-natural amino acid, a phosphoryl non-natural amino acid, a methyl
non-natural amino acid, which meanings can be seen in references [21], [22].
[0095] In the present invention, the gene therapy refers to a method in which an exogenous
gene is inserted in a suitable target cell by gene transfer techniques so that a product
generated by the exogenous gene can be used to treat a disease. Generally, the gene
therapy may further comprise means and techniques used under DNA levels for treatment
of some diseases.
[0096] In the present invention, the DNA vaccine is also called as nucleic acid vaccine
or gene vaccine, and refers to a eukaryotic expression plasmid DNA (may also be RNA
in some cases) or viral expression vector (e.g., adeno-associated virus vector) encoding
an immunogen or an immunogen-associated protein, which can enter an animal body via
a certain route, after being uptaking by host cells, transcript and translate to express
the immunogen or immunogen-associated protein, and the protein can stimulate the body
to generate non-specific and/or specific immune response, thereby exerting immune
protection function.
[0097] In the present invention, the N587+1 refers to inserting an non-natural amino acid
between N587 and R588; when constructing the expression plasmid, TAG is inserted between
codons of N587 and R588; N450+1, N385+1 have similar meanings.
[0098] In the present invention, the adeno-associated viruses with specific mutation and
modification of non-natural amino acids are equivalent to wild-type adeno-associated
virus in terms of production, transfection, movement and transportation, and it is
confirmed that they can be used to improve transduction efficiency and normally carry
a functional gene by further coupling the non-natural amino acids to other functional
molecules such as targeting molecules, which indicates that the site-specifically
mutated adeno-associated viruses can be used as tool adeno-associated viruses, and
used for finding adeno-associated virus binding proteins or as targeting gene therapy
carriers as well as in various fields relating to adeno-associated viruses.
Brief Description of the Drawings
[0099]
Fig.1 shows a schematic process for modifying an adeno-associated virus on basis of
click chemistry;
A refers to that AAV2 particle can be site-specifically modified by genetically coded
azido-containing amino acid NAEK; B refers to that it can be tagged with a fluorescence
molecule via biological orthogonal reaction.
Fig.2 shows that NAEK can be effectively and genetically inserted in AAV capsid protein
VP1;
- A, selection of site for inserting NAEK into VP1;
- B, amber termination codon-carrying NAEK-dependent VP1 expression separately at 14
sites;
- C, Coomassie brilliant blue stain and intramicellar fluorescein stain of DIBO-Alexa488-tagged
VP1 protein, in which coupling depends on NAEK presentation on VP1 surface.
- D, MS/MS fragment spectrum of purified and trypsinized VP1G453NAEK, in which the site of NAEK is labeled with g.
Fig.3 shows that AAV2 particle can be site-specifically tagged with a genetically
encoded azido label;
- A shows a diagrammatic figures of main capsid protein and viral capsid of AAV2 obtained
by atomic structure (from protein database) of Xie, et al, in which the inserted Arg447
site (red) is labeled;
- B shows GFP expression results detected after 48 h of transfection with virus extracts
of AAV-293 incasing cells which are cultured by transfecting HT-1080 cells then adding
(+) or not adding (-) NAEK, in which proportional scale is equivalent to 100µm;
- C shows calculated virus titers of HT-1080 cells transfected with a series of diluted
rAAVr, in which error bar represents a standard deviation of mean of 3 tests, and
ordinate represents functional titer (×107 virus particles/ml).
Fig.4 shows NAEK is successfully inserted at different sites of AAV2 capsid;
Mutant virus generated on basis of NAEK are co-cultured with HT-1080 cells for 48
h, and GFP expression is reported if the mutant virus is successfully transferred into HT-1080
cells; the results show that R447-AAV2 and S568-AAV2 are substantially equivalent
to wild-type virus in viral infectivity.
Fig.5 shows NAEK cannot be inserted into AAV2 at some sites.
Fig.6 shows AAV2-GFP virus particles can be site-specifically tagged by a genetically
encoded NAEK label.
A and B show mode patterns of main AAV2 capsid protein and AAV2 virus particles; AAV2-GFP
can be successfully mutated at sites R447, G453, S578, N587, S662 with an amino acid-carrying
adize compound (NAEK).
C and D show that AAV2-GFP cannot be mutated at sites S261, N381, Y444, S458, S492,
Y500, F534, T573.
E shows the calculated viral titers of HT-1080 cells transduced with a serially diluted
AAV2-GFP, in which error bar represents a standard deviation of mean of 3 repeated
tests.
F shows GFP quantitation via Q-PCR using genome titers of AAV2-GFP incorporated at
different sites with NAEK.
Fig.7 shows viral surface is successfully modified with Alexa 488;
- A shows fluorescence tagged NAEK; wild-type virus (WT AAV2), NAEK-tagged virus (R447-AAV2)
particles and S578-AAV2 virus particles are co-cultured at 37°C for 30 min with Hela
cells in which DIBO-Alexa 488 (green) is added or not, then fixed, permeabilized,
and immune stained (red) with mouse monoclonal antibody (A20 clone) for integral AAV2;
the azido tag (green) and R447-AAV2 particles (red) for labeling are co-localized;
overlapped green and red signals show a yellow color of fused images; AAV2 in first
row is not co-cultured with A20 antibody, and used as negative control; and proportional
scale is equivalent to 10µm.
- B and C show that AAV reacted or unreacted with DIBO-Alexa 488 is detected by SDS-PAGE,
in which Alexa 488 (C) is detected by 488 nm transmission light, and then gel is stained
with Coomassie brilliant blue (B).
Fig.8 shows results of confocal microscopy that Alexa 555 is also successfully links
to AAV2 via NAEK at sites R447 and S578 of capsid protein.
Fig.9 shows quantitative analysis of viral movement of Alexa 488-tagged AAV2 in cells.
A, B and C show typical trace of movement of Alexa 488-tagged AAV2 in Hela cells;
Hela cells are co-cultured with Alexa 488-tagged AAV2 at 4°C for 30 min, then confocal
real time imagery is recorded, in which A shows a fluorescence picture, B shows a
white-light picture, C shows a picture of overlapped A and B, D shows an enlarged
view of selected typical movements.
D shows typical movements of Alexa 488-tagged AAV2, in which 1 is fast and directed
movement; 2 is fast and undirected movement; 3 is slow and undirected movement; and
E, F, G show time trace of viral speeds.
H shows the trace of Alexa 488-AAV2 are classified as "slow undirected", "fast undirected",
and "fast directed", in which "slow undirected" represents slow and undirected movement,
"fast undirected" represents fast and undirected movement, "fast directed" represents
fast and directed movement, error bar represents standard deviation of mean of 3 tests
(195 trace in total), and proportional scale is equivalent to 10µm.
Fig.10 shows a real-time monitored endocytosis process of Alexa488-AAV2 through clathrin
coated pit.
After transfection for 24h, cells and Alexa488-tagged AAV2 (green) are co-incubated
at 4°C for 30 min, then heated to 37°C to start viral endocytosis, and confocal delayed
imagery is recorded. It shows representative trace of Alexa488-AAV2 in Hela cells
with expression of mRFP-clathrin (A), and selected read-time imaging frame (B). C
shows three dimensional trace (green) of single AAV2 in Hela cells with expression
of mRFP-clathrin.
Fig.11 shows gene transduction mediated by cRGD-modified AAV2-GFP vector;
A and B show chemical formulas of RAD-DIBO and RGD-DIBO;
C and D shows expression of integrin separately in Hela cells (left) and U87 cells
(right) analyzed by flow cytometry techniques (FACS); expression of αvβ3 integrin
is determined by antibody LM609; Alexa488-tagged anti-mouse antibody is used as second
antibody for FACS detection (black line); hatchures are results of the negative control.
E and F show that cRGD-tagged vectors have higher gene transduction abilities separately
to Hela cells and U87 cells; vectors without RAD/RGD labels and vectors with RAD/RGD
labels in same amount are separately incubated with cells at 4°C for 2h; after removing
unbound viruses, fresh culture media was added, and expression of GFP is analyzed
after 48 h with FACS; the data represent percentage of transgenic cells with expression
of eGFP, and the data are represented with mean and standard derivation of 3 repeated
tests.
Fig.12 show that RAD/RGD is successfully tagged on surface of AAV2-GFPcapsid protein
via "click" reaction between NAEK and DIBO.
- A shows that AAV2 N587+1/azido (AAV2 is tagged with NAEK between N587 and R588) in dosage of 300 genome copies/cell
are separately co-incubated with RAD, RGD, DIBO, RAD-DIBO, RGD-DIBO or a combination
thereof at 4°C for 2 h; redundant unreacted molecules are removed by using 100kD Millipore
Amicon Ultra-100; after dialysis, the viruses and U87 cells are incubated at 4°C for
2 h; after unbound viruses are removed, fresh culture media is added, and GFP expression
is analyzed by FACS after 48 h.
- B shows competitive effects of integrin targeted transduction as mediated by AAV2
N587+1/azido +RGD; U87 cells and AAV2 N587+1/azido +RGD (RGD-modified AAV2) or AAV2 N587+1/azido (non-RGD-modified AAV2) are co-incubated at 4°C for 2 h, in dosage of 700 genome
copies/cell; after unbound viruses are removed, fresh culture media is added, and
GFP expression is analyzed by FACS after 48 h; for the competitive tests, the binding
between virus and cells is detected under conditions of 400 µg/ml RAD or RGD peptide,
control or LM609 antibody (1:100 dilution), or combination of RGD peptide and LM609
antibody.
Fig.13 show a comparison of transduction efficiencies of different viruses for Hela
and U87 tumor cells;
WT AAV2 (wild-type AAV2), AAV2 N587+1/azido (NAEK tag is inserted between sites587 and 588 on surface of AAV2 capsid protein),
AAV2 N587+RAD (RAD peptide is inserted between sites 587 and 588 on surface of AAV2 capsid protein),
AAV2 N587+RGD (RGD peptide is inserted between sites 587 and 588 on surface of AAV2 capsid protein),
AAV2 N587+1/azido+RAD (AAV2 is chemically linked to cRAD via NAEK and DIBO), and AAV2 N587+1/azido +RGD (AAV2 is chemically linked to cRGD via NAEK and DIBO) and Hela cells (A) or
U87 cells (B) are incubated at 4°C for 2 h, in dosage of 700 genome copies/cell; after
unbound viruses are removed, fresh culture media is added, and GFP expression is analyzed
by fluorescence microscope and FACS after 48 h; the results show that all viruses
contain eGFP gene.
Fig.14 shows binding force analysis of vector particles to Hela cells and U87 cells;
Virus vectors in same amount and cells are incubated at 4°C for 2h, then washed with
PBS to remove unbound vector particles; the vector particles bound to Hela cells (A)
or U87 cells (B) are detected by anti-AAV monoclonal antibody A20 and FACS.
Fig.15 show killing effects of AAV2-TK (thymidine kinase) with different modifications
on Hela cells and U87 cells.
A, C, E and G show dose dependent cytotoxicity of Gancyclovir (GCV) on Hela/TK cells
in vitro; AAV2-GFP (wild-type AAV2 containing GFP reporter gene), AAV2-TK (wild-type
AAV2 containing thymidine kinase gene), and AAV2 N587+1/azido-TK (AAV2-TK integrated with NAEK at site N587+1), AAV2 N587+1/azido+RAD-TK (AAV2-TK is chemically coupled with cRAD via NAEK and DIBO), and AAV2 N587+1/azido +RGD-TK (AAV2-TK is chemically coupled with cRGD via NAEK and DIBO), AAV2 N587+RAD-TK (AAV2-TK is fused with RAD peptide between its capsid protein surface sites 587
and 588), AAV2 N587+RGD-TK (AAV2-TK is fused with RGD between its capsid protein surface sites 587 and 588)
are incubated with U87 cells, in dosage of 500 genome copies/cell; these cells are
incubated with GCV in different doses for 48h, then cell survival rates are quantified
by cell Titer-Glo (promega); MEM culture media is used as negative control.
B, D, F and G shows toxicity and dose-dependency of GCV on U87/TK cells in vitro;
AAV2-GFP, AAV2-TK, and AAV2 N587+1/azido-TK, AAV2 N587+1/azido+RAD-TK and AAV2 N587+1/azido +RGD-TK, AAV2 N587+RAD-TK, AAV2 N587+RGD -TK are incubated with U87 cells, in dosage of 500 genome copies/cell; these cells
are incubated with GCV in different doses for 48h, then cell survival rates are quantified
by cell Titer-Glo (promega); MEM culture media is used as negative control.
Fig.16 shows killing effects of AAV2-TRAIL with different modifications on Hela cells
and U87 cells;
Different AAV2 vectors containing TRAIL (TNF-related apoptosis-inducing ligand, tumor
necrosis factor-related apoptosis-inducing ligand) gene are incubated with Hela cells
(A) and U87 cells (B), in dosage of 500 genome copies/cell; after 48h, cell survival
rates are quantified by cell Titer-Glo (promega); MEM culture media is used as negative
control.
Fig.17 shows imaging results of inserting DiZPK into different sites of AAV2 capsid.
Specific Models for Carrying Out the Invention
[0100] The present invention is illustrated in details in conjunction with following examples,
but those skilled in the art would understand these examples are used to illustrate
the present invention only, rather than to limit the scope of the present invention.
If specific conditions are not given in the examples, conventional conditions or conditions
recommended by manufacturers are used. If reagents or instruments are not indicated
with their manufacturers, they are all commercially available conventional products.
Experimental Materials and Methods
Cell lines, antibodies and reagents
[0101] Culture media for AAV-293, HT-1080 and Hela cells are DMEM culture media (Zhongkemaichen
Beijing Science and Technology Co., Ltd.) containing 10% fetal calf serum (PAA, Austria)
and 2mM L-glutamine (Zhongkemaichen Beijing Science and Technology Co., Ltd.), and
cultured under condition of 5% CO
2. Anti-intact-AAV2 mouse monoclonal antibody (A20 clone) is obtained from ARP Company
(American Research Products, Belmont, MA). DIBO-Alexa 488, DIBO-Alexa 555 stains are
purchased from Invitrogen.
Synthesis of Nε-2-azidoethyloxycarbonyl-L-lysine (NAEK):
[0102]

[0103] 2-Bromoethanol (8g,64mmol) and sodium azide (6.24g, 96mmol) were added at room temperature
into acetone (60ml) and water (30ml). The reaction mixture solution was refluxed at
60°C for 10h, cooled to room temperature, vacuum evaporated to remove acetone. The
residue was extracted with diethyl ether. The organic layer was washed with saline
twice, then dried with Na
2SO
4, filtered, distilled, to obtain 2-azido-ethanol (Compound 2), yield 99% (5.5g, 63.2mmol),
which is not further purified.
[0104] Compound 2 (5.5g, 63.2mmol) was dissolved in dichloromethane (120ml), the resultant
solution was slowly added at -3°C into a suspension of N,N'-carbonyldiimidazole (15.36g,
94.8mmol) dissolved in dichloromethane (55ml). The reaction was carried out under
stirring condition for 12 h. Subsequently, 200mL of water was added, the organic layer
was washed with saline twice, then dried with Na
2SO
4, filtered and vacuum concentrated, the residue was further purified by silica gel
chromatography, eluted with PE/EtOAc (1:1), to obtain Compound 3 in colorless oil
form (10.7g, 59mmol), yield 93%.
[0105] Compound 3 (10.7g, 59mmol) was dissolved in dichloromethane (100ml), the resultant
solution is added at room temperature into Boc-Lys-OH (12.2g, 49.2mmol) in 1M NaOH
aqueous solution (50ml), then added with TBAB (0.16g, 0.01eq). The reaction mixture
solution was stirred and reacted for 12 h, cooled to 0°C, then regulated with ice-bathed
1M HCl aqueous solution to have a pH value of 2-3. The water phase was extracted with
DCM, and the organic layer was washed with saline twice. Subsequently, the organic
layer was dried with Na
2SO
4, filtered and vacuum concentrated. The residue was purified by silica gel chromatography,
eluted with PE/EtOAc/HAc (100:100:1), to obtain Compound 4 in colorless oil form (15.1g,
41.94mmol), yield 85%.
[0106] Compound 4 (15.1g, 41.94mmol) was dissolved in dichloromethane (80ml), then slowly
added with trifluoroacetic acid (20ml). The reaction solution was stirred and reacted
at room temperature for 0.5 h, then vacuum evaporated to remove solvent. The residue
was re-dissolved in methanol (5ml), and precipitated in ethyl ether. The precipitate
was collected and vacuum dried to obtain Compound 5 in white solid form (6.63g, 25.58mmol),
i.e., NAEK, yield 61%.
Synthesis and identification of non-natural amino acid DiZPK:
[0107] The reaction scheme for chemical synthesis of non-natural amino acid DiZPK is as
follows:

[0108] As shown in the scheme, 15 mL of raw material 1 (5-hydroxy-2-pentanone) and 40mL
of liquid ammonia were stirred and reacted at -40°C for 5h, then cooled to -60°C,
slowly added dropwise with NH
2OSO
3H (20 g) in methanol solution, after addition, heated to room temperature, reacted
overnight, filtered to remove precipitate. The supernatant was added with triethylamine,
slowly added with I
2 under ice-bath condition, until the reaction solution became dark and did nog generate
bubbles. After the end of reaction, the solvent was removed by distillation, the product
was extracted with ethyl ether and then dried. After ethyl ether ws removed by distillation,
the residual liquid was evaporated under reduced pressure to obtain 25.4 g of Product
2 in colorless viscous liquid form.
[0109] The Product 2 was dissolved in pyridine, added at 0°C under stirring with 11 g of
TsCl, reacted overnight. After the end of reaction, the reaction solution was poured
into a mixture solution of concentrated hydrochloride acid and ice-water, extracted
with ethyl ether, the ether layer was washed with 1N hydrochloric acid and 1N NaOH
separately. The organic phase was separated by a drying column to obtain 11.8g of
Product 3 in colorless viscous liquid form.
[0110] The above Product 3 was dissolved in DMF, added with NaN
3 and reacted at room temperature overnight. After the end of reaction, a large amount
of water was added, extracted with ethyl ether. After removal of ethyl ether by distillation,
the residual product was dissolved in THF:water (9:1), added with triphenyl phosphine,
reacted at room temperature. After the end of reaction, 1N HCl was added and mixed
homogeneously, then THF was rotationally dried, unreacted raw materials, PPh
3 and O=PPh
3 were washed off with dichloromethane, the liquid phase was added with 1N NaOH to
regulate pH at 12, extracted with dichloromethane to obtain 4.0 g of Product 4.
[0111] 5.2 g of raw material 5 (Boc-Lys-OMe) reacted with carbonyldiimidazole to prepare
5.9 g of Compound 6. Subsequently, Compound 6 was coupled to Product 4 (4.0 g) to
obtain Compound 7, which was finally subjected to two-step deprotection to remove
Boc and methyl ester, so as to obtain 4.5 g of Product 8, i.e., DiZPK. Results of
spectroscopy are as follows:
1H NMR (400 MHz, D
2O): δ3.10 (1H, t,
J = 6.3 Hz), 2.96 (4H, m), 1.25 (10H, m), 0.90 (3H, s);
13C NMR (100 MHz, D
2O): 183.63, 160.66, 56.00, 39.80, 39.30, 34.49, 30.84, 29.20, 26.75, 23.92, 22.43,
18.80; HREIMS m/z 308.16937 [M+1]
+ (calcd for C
12H
22N
5NaO
3, 308.16931), which confirm that the obtained DiZPK has correct structure.
Culture of incasing cells
[0112] AAV-293 cells (Stratagene) were used to produce recombination infective AAV particles.
In the present invention, only AAV2 serotype was prepared and used. AAV-293 cells
represented human fetal renal cells with stably transfected type 5 adenovirus DNA,
and had adenovirus e1 gene for in vitro preparation of rAAV. In order to prepare rAAV,
ADENO-ASSOCIATED VIRUS-293 cells were cultured in DMEM culture media, and added with
10% fetal calf serum, 4mM L-glutamine and 4.5 g/L glucose, the culture conditions
were 37°C, 5%CO
2. After the cells were cultured to spread 60-70% area, triple co-transfection of AAV
plasmid started.
Plasmid construction
[0113] Expression plasmid vectors pAAV-RC, pHelper and pAAV-GFP (Agilent, Santa Clara, CA)
were used in the experiment. The construct contained AAV and adenovirus genes for
preparing infectious AAV particles. The pAAV-RC provided rep gene and cap gene separately
for encoding AAV replication and capsid protein. The pHelper vector contained adenovirus
E2A, E4 and VA genes, and the pAAV-GFP contained GFP reporter gene. This reporter
vector represents ITR-containing plasmid, and the plasmid had
cmv promoter. The pAAV-RC-R447 plasmid was prepared by using Quik Change Lightning Site-Directed
Mutagenesis Kit (Agilent), in which the genetic code of arginine residue at site 447
of AAV capsid protein VP1 is mutated as TAG. Other mutant plasmids were constructed
by same methods.
[0115] The plasmid pACYC-tRNA/PylRS was obtained from
Escheoichia coli pACYC-tRNA / PylRS (a gift of Professor CHEN Peng of College of Chemistry of Peking
University), which contained plasmid pACYC-tRNA / PylRS and named as
Eschenichia coli, and deposited in China General Microbiological Culture Collection Center (Address:
NO.1 West Beichen Road, Chaoyang District, Beijing 100101, Institute of Microbiology,
Chinese Academy of Sciences) on June 14, 2011 with a deposition number of CGMCC No:
4951. The plasmid could be used to express tRNA and tRNA synthase for specifically
identifying non-natural amino acids DiZPK and NAEK, the deposition information thereof
had been disclosed in the patent application with publication number of
CN102838663A.
Preparation and purification of AAV
[0116] In AAV Helper-Free System, azido-tagged AAV2 infectious particles (e.g., R447-AAV2
vector) was prepared, and assistant adenovirus or herpes virus were not used in infection.
AAV2 plasmid vector pAAV-RC, pHelper, pAAV-GFP and vector pACYC-tRNA / PylRS (molar
ratio = 1:1:1:2) were used for transient co-transfection of AAV-293 incasing cells
by calcium phosphate precipitation method. After 6 h of transfection, the cell culture
media was replaced with a fresh culture media containing 1mM NAEK. After 72h, infected
cells were collected. In order to release rAAV virus particles, the infected cells
were lysed by freeze-thaw method. Separation and purification processes were carried
out by referring to the operations of Ping Guo, et al (
Guo P, El-Gohary Y, Prasadan K, Shiota C, Xiao X, Wiersch J, Paredes J, Tulachan S,
Gittes GK: Rapid and simplified purification of recombinant adeno-associated virus.
J Virol Methods, 183(2):139-146).
Determination of viral titer
[0117] AAV-HT1080 cells were cultured in 6-well tissue culture plate, each well had 2ml
of DMEM culture media, and cell density was 3 × 10
5/well. Culture was carried out at 37°C overnight. The cells were culture to spread
about 50% area. Virus storing solution was diluted by 10 times. On the basis of 10
times dilution, dilution by 5 times was performed in volume of 5 ml, and concentrations
ranged from 2 × 10
-2 to 8 × 10
-4. The diluted solutions in volume of 1ml were added into wells of the 6-well plate,
3 wells for each titer. In the meantime, the well without adding virus storing solution
was used as negative control. Incubation was performed at 37°C for 1-2 h. During incubation,
the culture plate was gently vortex shaken at intervals of 30 min. Subsequently, each
well was added with 1 ml of pre-heated H-DMEM and cultured at 37°C for 40-48h. The
pAAV-hrGFP AAV infected cells were detected by FACS.
Quantification of genome copies by using real-time quantitative PCR (qPCR)
[0118] The genome copies of vectors were quantified by using Mx3000P real-time PCR meter
(Agilent Technologies, La Jolla, CA, USA), in which the GFP gene-specific primer pair
was: 5'-AAGCAGCACGACTTCTTCAAGTC-3' (SEQ ID NO: 31) (forward) and 5'-TCGCCCTCGAACTTCACCTC-3'
(SEQ ID NO: 32) (reverse). The detail of method can be seen in the published operation
guide
[20].
Fluorescence probe ligation
[0119] For fluorescence labeling of AAV2-azido, the purified virus particles were incubated
with Alexa488-DIBO or Alexa 555 (500 µM) at room temperature at pH7.0 for 2 h. 100kD
Millipore Amicon Ultra-100 was used to remove unreacted stains.
[0120] The method for linking targeting molecule cRGD was similar to that for fluorescence
probe ligation.
Confocal imaging
[0121] Alexa488-tagged AAV2 and Hela cells were co-cultured in a glass bottom culture dish
at 37°C for 30min, then the cells were fixed with phosphate buffer solution (pH 7.0)
(PBS) containing 4% paraformaldehyde for 15 min. Subsequently, the cells were permeabilized
in PBS solution containing 0.5% Triton X-100 for 10 min, and sealed with PBS containing
3% bovine serum albumin (BSA) for 60 min. Subsequently, the cells were incubated with
anti-intact AAV2 mouse monoclonal antibody (A20) at 4°C overnight, and then incubated
at room temperature for 1 h with a second antibody (life technology) that links to
Alexa594. The cell nucleus were stained with DAPI (Sigma). Imagery was performed by
confocal laser-scanning microscopy (SP8 Series, Leica, Germany).
Imagery of living cells
[0122] In order to real-time observe movement of Alexa488-AAV2, Hela cells were inoculated
in glass bottom culture dish, cultured at 37°C overnight. Subsequently, Alexa488-tagged
AAV2 and Hela cells were co-cultured at 4°C for 30 min, and then confocal real-time
imagery was recorded by using a living cell imaging system (PerkinElmer, MA, USA).
[0123] Example 1: Mutation site selection and mutant primer design for adeno-associated
virus capsid protein
(1) Selection of mutation sites
[0124] In the adeno-associated virus capsid protein VP1, the mutation sites as shown in
Table 1 were selected, wherein the amino acid sequence of VP1 protein was as follows:

the nucleotide sequence for VP1 protein was as follows:
Table 1: Mutation sites
| Amino acid site |
Amino acid |
Codon before mutation |
Codon after mutation |
| 261 |
S |
TCC |
TAG |
| 381 |
N |
AAC |
| 444 |
Y |
TAC |
| 447 |
R |
AGA |
| 453 |
G |
GGA |
| 458 |
S |
TCA |
| 492 |
S |
TCT |
| 500 |
Y |
TAC |
| 534 |
F |
TTT |
| 573 |
T |
ACG |
| 578 |
S |
TCT |
| 587 |
N |
AAC |
| 662 |
S |
AGT |
[0125] The sites in Table 1 are sites in VP1 protein.
(2) Design of mutant primers
[0126] In order to site-specifically mutate the sites in Table 1, the mutant primers in
Table 2 were designed (which could be also used as sequencing primers).
Table 2: List of mutant primers
| SEQ ID NO |
Mutation site |
Primer direction |
Primer sequence |
| 3 |
VP1Y444 |
#1 |
CTCATCGACCAGTACCTGTATTAGTTGAGCAGAACAAACAC |
| 4 |
VP1Y444 |
#2 |
GTGTTTGTTCTGCTCAACTAATACAGGTACTGGTCGATGAG |
| 5 |
VP1G453 |
#1 |
GCAGAACAAACACTCCAAGTTAGACCACCACGCAGTCAAGGC |
| 6 |
VP1G453 |
#2 |
GCCTTGACTGCGTGGTGGTCTAACTTGGAGTGTTTGTTCTGC |
| 7 |
VP1S458 |
#1 |
CAAGTGGAACCACCACGCAGTAGAGGCTTCAGTTTTCTC |
| 8 |
VP1S458 |
#2 |
GAGAAAACTGAAGCCTCTACTGCGTGGTGGTTCCACTTG |
| 9 |
VP1S492 |
#1 |
CAGCAGCGAGTATCAAAGACATAGGCGGATAACAACAACAGTG |
| 10 |
VP1S492 |
#2 |
CACTGTTGTTGTTATCCGCCTATGTCTTTGATACTCGCTGCTG |
| 11 |
VP1Y500 |
#1 |
GGATAACAACAACAGTGAATAGTCGTGGACTGGAGCTACC |
| 12 |
VP1Y500 |
#2 |
GGTAGCTCCAGTCCACGACTATTCACTGTTGTTGTTATCC |
| 13 |
VP1S578 |
#1 |
GGCTACGGAGCAGTATGGTTAGGTATCTACCAACCTCC |
| 14 |
VP1S578 |
#2 |
GGAGGTTGGTAGATACCTAACCATACTGCTCCGTAGCC |
| 15 |
VP1N587+1 |
#1 |
CCAACCTCCAGAGAGGCAACTAGAGACAAGCAGCTACCGC |
| 16 |
VP1N587+1 |
#2 |
GCGGTAGCTGCTTGTCTCTAGTTGCCTCTCTGGAGGTTGG |
| 17 |
VP1S662 |
#1 |
CGAATCCTTCGACCACCTTCTAGGCGGCAAAGTTTGCTTCC |
| 18 |
VP1S662 |
#2 |
GGAAGCAAACTTTGCCGCCTAGAAGGTGGTCGAAGGATTCG |
| 19 |
VP1 S261 |
#1 |
CACCTCTACAAACAAATTTAGAGCCAATCAGGAGCCTCGAAC |
| 20 |
VP1 S261 |
#2 |
GTTCGAGGCTCCTGATTGGCTCTAAATTTGTTTGTAGAGGTG |
| 21 |
VP1 N381 |
#1 |
CAGTATGGATACCTCACCCTGTAGAACGGGAGTCAGGCAG |
| 22 |
VP1 N381 |
#2 |
CTGCCTGACTCCCGTTCTACAGGGTGAGGTATCCATACTG |
| 23 |
VP1 R447 |
#1 |
CAGTACCTGTATTACTTGAGCTAGACAAACACTCCAAGTGGAACC |
| 24 |
VP1 R447 |
#2 |
GGTTCCACTTGGAGTGTTTGTCTAGCTCAAGTAATACAGGTACTG |
| 25 |
VP1 F534 |
#1 |
GGACGATGAAGAAAAGTTTTAGCCTCAGAGCGGGGTTCTCATC |
| 26 |
VP1 F534 |
#2 |
GATGAGAACCCCGCTCTGAGGCTAAAACTTTTCTTCATCGTCC |
| 27 |
VP1 T573 |
#1 |
GGACAACCAATCCCGTGGCTTAGGAGCAGTATGGTTCTG |
| 28 |
VP1 T573 |
#2 |
CAGAACCATACTGCTCCTAAGCCACGGGATTGGTTGTCC |
| 29 |
VP1 N587 |
#1 |
CTACCAACCTCCAGAGAGGCTAGAGACAAGCAGCTACC |
| 30 |
VP1 N587 |
#2 |
GGTAGCTGCTTGTCTCTAGCCTCTCTGGAGGTTGGTAG |
[0127] In Table 2, #1 represents forward primer, #2 represents reverse primer; 587+1 represents
an non-natural amino acid was inserted after site 587, i.e., the non-natural amino
acid was inserted between site 587 and site 588.
Example 2: Expression and detection of adeno-associated virus VP1 mutant protein
[0128] Firstly, we observed the compatibility of orthogonal amber mutant suppresser aminoacyl-tRNA
synthase/tRNA
CUA system in AAVcapsid protein VP1 expression. VP1 gene was cloned into vector pCMV-FLAG
(FLAG tag at C-terminal), to obtain VP1 coding vector pCMV-VP1-FLAG. By using Quik
Change Lightning Site-Directed Mutagenesis Kit (Agilent) according to its instruction,
the codons in the vector that encode residues S261, N381, Y444, R447, G453, S458,
S492, Y500, F534, T573, S578, N587, N587+1, S662 were mutated as amber termination
codon (TAG) by using pCMV-VP1-FLAG plasmid as template and using the mutant primers
as listed in Table 2. The sequencing results show that these mutations had been successfully
introduced. The plasmid obtained by mutation at site R447 was named as pCMV-VP1-FLAG-R447,
which represented that the genetic codon of arginine residue at site 447 of AAVcapsid
protein VP1 was mutated as TAG, and other plasmids obtained after mutation were named
according to the same principle.
[0129] Subsequently, it was verified whether the mutant plasmid could correctly exhibit
NAEK in 293T cells via co-expression of NAEK-specific orthogonal tRNA/aaRS vector.
The results of Western blotting showed that when the 293T cells were cultured in a
culture media containing NAEK, all mutant VP1 proteins could be detected by using
anti-FLAG antibody; the expression levels of mutant VP1 were about 10-100% that of
wild-type protein upon different mutation sites (Fig.2A, 2B). If the 293T cells were
cultured under conditions without NAEK, VP1 proteins could be detected. Further, NAEK
was inserted at site G453 of VP1 and the exhibition of NAEK was confirmed by MS/MS
sequencing (Fig.2D).
[0130] In addition, the orthogonal reactions with DIBO-Alexa488 (a fluorescence tag of single
virus) under moderate conditions also confirmed that NAEK was inserted in VP1 protein
(Fig.2C), and bright green fluorescence was observed when mutant VP1 protein and fluorescence
group were co-incubated at 4°C for 1 h. With regard to wild-type VP1 protein or mutant
VP1 proteins without being treated with fluorescence group, green signal was not observed
(Fig.2C). The experimental results indicated that NAEK was successfully tagged on
VP1 protein, and other molecules could be further coupled via NAEK.
Example 3: Site-specifically mutated adeno-associated virus and detection thereof
[0131] In the present invention, genetic code expanding techniques were used to site-specifically
tag AAV2 by introducing azido-containing amino acid NAEK into virus capsid.
[0132] By using Quik Change Lightning Site-Directed Mutagenesis Kit (Agilent) according
to its instruction, mutations were fulfilled by using pAAV-RC plasmid as template
and using the mutant primers as listed in Table 2. The sequencing results showed that
these mutations were successfully introduced. The plasmid obtained by mutation at
site R447 was named as pAAV-RC-R447, which represented that the genetic codon of arginine
residue at site 447 of AAV capsid protein VP1 was mutated as TAG, and other plasmids
obtained after mutation were named according to the same principle.
[0133] As shown in Fig.3A, the present invention used genetic methods to insert azido-containing
non-natural amino acid at amino acid site 447 of VP1/VP2/VP3 zones where cap gene
was located. Correspondingly, the genetic codon of AAV2 capsid protein encoding plasmid
pAAV-RC was mutated, i.e., mutated as amber terminal codon TAG. Subsequently, in the
presence of NAEK, mutant plasmid pAAV-RC-R447 was used for passage of azido-containing
AAV2 (R447-AAV2) particles by co-expression of NAEK specific orthogonal tRNA/aaRS
pair (pACYC-tRNA / PylRS vector), pHelper vector and pAAV-GFP vector in AAV-293 incasing
cells (see details in section of "Materials and Methods"). After 72 h, cell lysate
was collected, diluted by 10 times and added to HT-1080 cells, and fluorescence microscopy
was used to detect whether mutant viruses were produced.
[0134] The NAEK-containing cell lysate obtained after mutant plasmid transfection was used
to transfect HT-1080 cells, and we found very strong green fluorescence in HT-1080
cells after HT-1080 cells were transfected for 48 h, which was almost equivalent to
that of wild-type, but shoed no significant difference from NAEK (see Fig.3B, 3C).
[0135] Specific experimental methods could be seen in "Preparation and purification of AAV"
in section of materials and methods.
[0136] NAEK could be inserted at sites G453, S578, N587, N587+1, S662, besides site R447
(see Fig.4, Fig.6A, Fig.6B). However, sites S261, N381, Y444, S458, S492, Y500, F534,
T573 could not be tagged with NAEK (see Fig.5, Fig.6C, Fig.6D). The specific experimental
method were the same as above.
[0137] This indicated that due to the presence of NAEK, it was successful to use mutant
AAV2 capsid to package ADENO-ASSOCIATED VIRUS. In addition, both of modified or untagged
AAV2 carrying GFP reporter gene were used to infect HT-1080 cells, and to detect viral
titer, and qPCR was used to detect viral genome titer. The functional titer values
of R447-AAV2 and S578-AAV2 (transfection unit/ml) were equivalent to that of WT-AAV2
(see: Fig.6E, Fig.6F), which showed that introducing azido tag had very small influence
on production and transfection ability of AAV2 particles.
Example 4: Fluorescence modification of AAV2 site-specifically labeled with NAEK
[0138] In Example 3, we obtained the AAV2 that was site-specifically labeled with NAEK,
the azido tag in NAEK label on AAV2 could be used together with DIBO-fluorescence
molecule to site-specifically couple a fluorescence group to surface of viral particles
via copper-free click chemistry (see Fig. 1).
[0139] Copper-free click chemistry is a means of achieving click reactions while maintaining
cell viability through the introduction of cyclooctynes, wherein the strain in eight-membered
ring allows the reaction with azides to occur in the absence of catalysts. One of
such reagents is comprised of the so-called DIBO compounds
[18]. Azide-modified macromolecules can now be labeled without a metal catalyst, which
not only is useful in studying living cells but also prevents damage of proteins.
[0140] To determine whether an azido tag could bioorthogonally react with Alexa 488 under
facile and mild conditions (25°C for 2 hours), the purified wild-type AAV2 (WT-AAV2)
and azido-tagged AAV2 particles (R447-AAV2 and S578-AAV2) were produced and reacted
with DIBO-Alexa 488 at room temperature for 2 hours, and the reaction buffer was replaced
by PBS using 100kD Millipore Amicon Ultra-100. Subsequently, the viral particle-containing
solutions were overlaid onto HeLa cells and immunostained with an antibody specific
for intact AAV2 particles. The specific experimental methods could be seen in "fluorescence
probe ligation: and "confocal imaging" of the section of Experimental materials and
methods.
[0141] Most of the hydrazide signals were co-localized with the AAV2 signals (see: Fig.7A),
whereas no significant hydrazide signals were observed for viral particles lacking
the azido tag (see: Fig.7A), indicating that azido groups were efficiently expressed
on the surface of AAV2. The label of green fluorescence on AAV2 capsid proteins VP1/VP2/VP3
was further confirmed by SDS-PAGE image, whereas no signal was detected in WT-AAV2
(see: Fig.7B, Fig.7C).
[0142] Clearly, NAEK was site-specifically displayed on the mutant viruses and fluorophore
was indeed coupled to mutant virus via NAEK. Not only R447-AAV2, but also S578-AAV2
was indeed successfully coupled with Alexa 488 (see: Fig.7A, 7B, 7C).
[0143] Furthermore, another fluorophore, Alexa 555, could also be ligated to AAV2 via NAEK
(see: Fig.8) by the same method as above. The above results demonstrated that this
azido tag enabled covalent attachment of fluorescent probes to AAV2 particles in a
site-specific manner.
[0144] It should be noticed that bioorthogonal reaction of viruses with Alexa 488 or 555
had very little, if any, effect on the infectivity of fluorescence-labeled viruses,
clearly due to the facile and mild condition (incubated at 25°C for 2 hours) and also
the small size of the probe, NAEK-DIBO-Alexa 488 or 555. It estimates that the probe
was approximately 2.6868 nm according to Chem 3D software, just around 1% the size
of a single AAV2.
Example 5: Observing single virus movement using fluorescently-labeled AAV2
[0145] Having established the approach for site-specific labeling of AAV2 with Alexa 488,
the present invention tested whether such labeling could be used for single virus
tracking.
[0146] The mutant virus carrying Alexa 488 at site 447 were added to HeLa cells. After incubation
at 4°C for 30 min to synchronize the binding, these viruses were monitored under confocal
microscopy by real-time imaging, in which specific experimental methods could be seen
in "Confocal imaging" in the section of experimental materials and methods. Various
types of intracellular movements of viral particles were observed during imaging,
and representative trace of Alexa 488-labeled AAV2 in HeLa cells were shown in Fig.9
(see: Fig.9A, 9B, 9C).
[0147] Based on the two dimensional data analysis of the three dimensional AAV2 particle
movements, we found that many particles exhibited relatively slow movements (e.g.,
the pink trace in Fig.9D), while some particles showed fast and directed transport
(e.g., orange trace in Fig.9D)
[19]. Fig.9D, 9E and 9F showed time trace of viral speeds.
[0148] In our analysis, the trace having a peak speed ≥0.002µm/s and containing unidirectional
movement in more than 5 consecutive frames were defined as directed transport, trace
with fast (≥0.002µm/s) but undirectional movement were defined as fast undirected
transport, and trace with slow (≤0.002µm/s) and undirectional movements were defined
as slow undirected transport.
[0149] Using these definitions, 16.3% of Alexa-AAV2 trace were fast and directed, 24.7%
of Alexa-AAV2 trace were fast but undirected, whereas the remaining were slow undirected
transport (Fig.9H).
[0150] In order to real-time monitoring the interaction between AAV2 and clathrin, Alexa
488-tagged viruses were co-incubated with Hela cells in which clathrin fused with
red fluorescence protein was expressed, and living cell imaging was carried out by
using a time-lapse spinning confocal microscopy. The representative trace and pictures
of Alexa 488-AAV2 were shown in Fig.10A. Viral particles (green) firstly were co-localized
with clathrin signal (red). This co-localization were continued for about 10 seconds,
then the clathrin signal disappeared rapidly, indicating viruses were dissociated
from uncoated clathrin vesicles (Fig.10B). In the first 10s of co-localization of
viral particles and clathrin signals, the instantaneous diffusion coefficients of
viral particles were significantly lower than that after dissociation of clathrin
signals (Fig.10C), indicating the viral particles entered cells via the regions defined
by clathrin-coated pit.
Example 6: Enhancement effects of conjugation of AAV2 and targeting ligand on cell
transduction
[0151] Based on the above experiments, we coupled tumor-targeted motif (cyclic RGD) to AAV2
capsid protein so as to perform targeting delivery of genes. Integrin was was receptor
of RGD peptide, and highly expressed in many tumors. Thus, RGD could be used for coating
AAV vector to improve delivery efficiency and selectivity of targeted integrin αvβ3
(highly expressed in tumor cells). RAD was a mutant motif of RGD in which glycine
was mutated as alanine, and could be used as negative control.
[0152] As shown in Fig.11, the obtained vectors were used to transfect U87 cells (integrin
αvβ3 positive cells) and Hela cells (used as negative control). We found that AAV
vectors to which RGD coupled at different sites showed different influences on transduction
efficiency of U87. At site N587+1, it was observed that transduction efficiency was
elevated significantly, by almost 10 times in comparison with the AAV vector that
carried RAD and contained azide (control), whereas such elevation was not observed
when RGD was coupled to sites 447, 587 and 662. Significant decrease was observed
when RGD was coupled to sites 453, 578. As a control, coupling RAD, rather than RGD,
to AAV vector had not influence on transduction efficiencies of these sites, indicating
RGD played a key role in elevating transduction efficiency. Hence, it was an efficient
approach for elevating transduction efficiency of cells that could hardly be transduced
to couple RGD to AAV vector at a suitable site, rather than arbitrary sites. As for
Hela cells, the conduction efficiency was elevated by only about 20% when RGD was
coupled to AAV vector at site 587+1, which might be due to the low expression of integrin
αvβ3 on surface of cells (Fig.11C). The results showed that coupling RGD in such site-selective
manner was an efficient approach for regulating tendency of AAV vector and elevating
gene delivery efficiency.
[0153] In order to further verify that cRGD-labeled AAV2 capsid protein was obtained via
"click" reaction between DIBO and NAEK, RAD, RGD, DIBO, RAD-DIBO, RGD-DIBO or a combination
thereof was separately incubated with AAV2
N587+1 azido. As shown in Fig.12A, only DIBO-RGD group exhibited an enhanced viral transduction
efficiency, and only DIBO molecule could competitively inhibit DIBO-RGD. These results
indicated that the RGD peptide as tagged on AAV2 capsid protein was linked via only
"click" chemistry between NAEK and DIBO.
[0154] In order to verify the above conclusion from another hand, we carried out experiments
of using these vectors to competitively inhibit AAV mediated gene delivery. We used
a synthesized RGD polypeptide and an anti-integrin antibody to check whether they
could inhibit transduction. As shown in Fig.12B, the GFP expression in U87 cells as
mediated by AAV
2N587+1 azido+RGD vector could be significantly inhibited by the synthesized RGD polypeptide and
anti-integrin antibody. These results showed that the interaction between cell surface
RGD and integrin was specific.
[0155] Subsequently, we wanted to know whether cRGD-chemically modified AAV2 had better
effects than RGD fused on AAV2 surface. As shown in Fig.13, when the cRGD-chemically
modified AAV2 and the RGD fused on AAV2 surface were compared with unmodified AAV2
(wild-type AAV2), they both could significantly improve viral transduction efficiency.
However, the viral transduction efficiency of the cRGD-chemically modified AAV2 was
1.5 times of that of the RGD fused on AAV2 surface. These results indicated that the
method for site-specifically modifying AAV2 in the present invention was superior
to the method for virus-targeting AAV2 surface modification.
[0156] In order to reveal why the cRGD chemical modification of AAV2 was superior to the
RGD surface fusion of AAV2, we analyzed binding ability of virus to cells. Different
kinds of virus with same amount were incubated with U87 cells at 4°C for 2h, then
analysis was carried out by using anti-AAV monoclonal A20 and FACS. As shown in Fig.14,
in comparison with the unmodified AAV2 or linear RAD modified AAV2, both of the cRGD
chemically modified AAV2 and the RGD fusion modified AAV2 showed significant improvement
of virus binding ability. However, the binding ability of the cRGD chemically modified
AAV2 was still 1.5 times of that of the RGD fusion modified AAV2. The results showed
that the cRGD chemically coupled AAV2 had cell binding ability significantly superior
to that of the RGD fusion modified AAV2, and thus had better virus targeting effect.
[0157] In the above works, we packaged GFP reporter gene in viral capsid to facilitate researches.
If GFP gene was replaced with a therapeutic gene, did virus still exhibit the above
features? In the experiments, we packaged herpes simplex virus thymidine kinase (HSV-tk)
gene and tumor necrosis factor-associated apoptosis ligand (TRAIL) gene, which had
cell killing function, into NAEK labeled virus, and cRGD molecule was coupled via
NAEK, so as to prepare RGD chemically free modified virus AAV
N587+1/azido+RGD-TK/TRAIL. The experimental results showed that AAV
N587+1/azido+RGD-TK/TRAIL virus had a tumor cell killing effect superior to those of WT-AAV and
RGD fusion modified AAV
N587+RGD-TK/TRAIL virus. However, their killing effects on Hela cells with low expression
of integrin showed no significant difference. This indicated that the cRGD chemical
free modification not only enhanced the killing effects of virus, but also improved
the targeting capacity of virus (Fig. 15, 16).
Example 7: Preparation of photocrosslinking non-natural amino acid (DiZPK) site-specifically
labeled AAV2
[0158] By using the method same as above, photocrosslinking non-natural amino acid (DiZPK)
was site-specifically introduced to AAV2 capsid surface, which could capture new interacted
proteins via photocrosslinking during the process that virus entered cells, thereby
finding new receptors of virus. As shown in Fig.17, trials had been carried out at
sites S261, R447, F534, T573, N587, and it was so far found that DiZPK could be successfully
introduced at site N587.
[0159] In view of research results, at site R447, NAEK could be introduced, but DiZPK could
not be incorporated, while at site N587, both of these two non-natural amino acids
could be incorporated. The reason for this could be that each amino acid residue site
of protein molecule had different spatial structure, and required different structure
of non-natural amino acid to be introduced.
[0160] Although the present invention have been described in details in the specific models
for carrying out the invention, those skilled in the art would understand that these
details could be modified and replaced according all disclosed teachings, and all
of these changes fall within the protection scope of the present invention. The whole
scope of the present invention is given by the affixed claims and any equivalents
thereof.
References:
[0161]
- 1. Atchison RW, Casto BC, Hammon WM: Adenovirus-Associated Defective Virus Particles.
Science 1965, 149(3685):754-756.
- 2. Gray SJ, Samulski RJ: Optimizing gene delivery vectors for the treatment of heart
disease. Expert Opin Biol Ther 2008, 8(7):911-922.
- 3. Grimm D, Kay MA: From virus evolution to vector revolution: use of naturally occurring
serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy.
Curr Gene Ther 2003, 3(4):281-304.
- 4. Mueller C, Flotte TR: Clinical gene therapy using recombinant adeno-associated virus
vectors. Gene Ther 2008, 15(11):858-863.
- 5. Choi KJ, Kim JH, Lee YS, Kim J, Suh BS, Kim H, Cho S, Sohn JH, Kim GE, Yun CO: Concurrent
delivery of GM-CSF and B7-1 using an oncolytic adenovirus elicits potent antitumor
effect. Gene Ther 2006, 13(13):1010-1020.
- 6. Wu Z, Asokan A, Samulski RJ: Adeno-associated virus serotypes: vector toolkit for
human gene therapy. Mol Ther 2006, 14(3):316-327.
- 7. Fisher KJ, Jooss K, Alston J, Yang Y, Haecker SE, High K, Pathak R, Raper SE, Wilson
JM: Recombinant adeno-associated virus for muscle directed gene therapy. Nat Med 1997,
3(3):306-312.
- 8. Moss RB, Rodman D, Spencer LT, Aitken ML, Zeitlin PL, Waltz D, Milla C, Brody AS,
Clancy JP, Ramsey B et al: Repeated adeno-associated virus serotype 2 aerosol-mediated
cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with
cystic fibrosis: a multicenter, double-blind, placebo-controlled trial. Chest 2004,
125(2):509-521.
- 9. Mingozzi F, High KA: Therapeutic in vivo gene transfer for genetic disease using AAV:
progress and challenges. Nat Rev Genet, 12(5):341-355.
- 10. Bainbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, Balaggan K, Viswanathan
A, Holder GE, Stockman A, Tyler N et al: Effect of gene therapy on visual function
in Leber's congenital amaurosis. N Engl J Med 2008, 358(21):2231-2239.
- 11. Hauswirth WW, Aleman TS, Kaushal S, Cideciyan AV, Schwartz SB, Wang L, Conlon TJ,
Boye SL, Flotte TR, Byrne BJ et al: Treatment of leber congenital amaurosis due to
RPE65 mutations by ocular subretinal injection of adeno-associated virus gene vector:
short-term results of a phase I trial. Hum Gene Ther 2008, 19(10):979-990.
- 12. Manno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJ, Ozelo MC, Hoots K, Blatt
P, Konkle B et al: Successful transduction of liver in hemophilia by AAV-Factor IX
and limitations imposed by the host immune response. Nat Med 2006, 12(3):342-347.
- 13. Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR, Tai SJ, Ragni MV,
Thompson A, Ozelo M et al: AAV-mediated factor IX gene transfer to skeletal muscle
in patients with severe hemophilia B. Blood 2003, 101(8):2963-2972.
- 14. White SJ, Nicklin SA, Buning H, Brosnan MJ, Leike K, Papadakis ED, Hallek M, Baker
AH: Targeted gene delivery to vascular tissue in vivo by tropism-modified adeno-associated
virus vectors. Circulation 2004, 109(4):513-519.
- 15. Yu CY, Yuan Z, Cao Z, Wang B, Qiao C, Li J, Xiao X: A muscle-targeting peptide displayed
on AAV2 improves muscle tropism on systemic delivery. Gene Ther 2009, 16(8):953-962.
- 16. Work LM, Buning H, Hunt E, Nicklin SA, Denby L, Britton N, Leike K, Odenthal M, Drebber
U, Hallek M et al: Vascular bed-targeted in vivo gene delivery using tropism-modified
adeno-associated viruses. Mol Ther 2006, 13(4):683-693.
- 17. Douar AM, Poulard K, Danos O: Deleterious effect of peptide insertions in a permissive
site of the AAV2 capsid. Virology 2003, 309(2)203-208.
- 18. Ning X, Guo J, Wolfert MA, Boons GJ: Visualizing metabolically labeled glycoconjugates
of living cells by copper-free and fast huisgen cycloadditions. Angew Chem Int Ed
Engl 2008, 47(12):2253-2255.
- 19. Joo KI, Fang Y, Liu Y, Xiao L, Gu Z, Tai A, Lee CL, Tang Y, Wang P: Enhanced real-time
monitoring of adeno-associated virus trafficking by virus-quantum dot conjugates.
ACS Nano, 5(5):3523-3535.
- 20. Rohr, U. P.; Wulf, M. A.; Stahn, S.; Steidl, U.; Haas, R.; Kronenwett, R. J Virol
Methods 2002, 106, 81-8.
- 21. Travis S. Young and Peter G. Schultz: Beyond the Canonical 20 Amino Acids: Expanding
the Genetic Lexicon. J. Biol. Chem. 2010, 285:17039-11044.
- 22. Jianming Xie and Peter G Schultz: Adding amino acids to the genetic repertoire. Current
Opinion in Chemical Biology 2005, 9:548-554.

1. A site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof, wherein an amino acid at a specific site of a corresponding wild type adeno-associated
virus capsid protein VP1 or a fragment thereof is mutated as an non-natural amino
acid, and the specific site is at least one site selected from sites R447, G453, S578,
N587, N587+1, S662 of VP1 or fragment thereof.
2. The site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof according to claim 1, wherein the non-natural amino acid is selected from
an azido non-natural amino acid, a photo-crosslinking non-natural amino acid, a keto
non-natural amino acid, an alkynyl non-natural amino acid, an acetyl non-natural amino
acid, a phosphoryl non-natural amino acid, and a methyl non-natural amino acid.
3. The site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof according to claim 1, wherein the non-natural amino acid is an azido-containing
non-natural amino acid, for example,
Nε-2-azideoethyloxycarbonyl-L-lysine (NAEK),

or the non-natural amino acid is an non-natural amino acid with structure similar
to the above azido-containing non-natural amino acid, for example, DiZPK.
4. The site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof according to claim 3, wherein the NAEK and the amino acid sequence of VP1
or fragment thereof are linked in a manner as shown in Formula I:

wherein the direction from R1 to R2 is the direction from N-terminal to C-terminal
of the amino acid sequence, in which amino acid at site N is one of amino acids at
sites selected from site R447, site G453, site S578, site N587, site N587+1, site
S662, R1 is an amino acid residue at site 1 to site N-1 of the amino acid sequence
of VP1 or fragment thereof, R2 is an amino acid residue at site N+1 to C-terminal
of the amino acid sequence of VP1 or fragment thereof;
wherein the DiZPK and the amino acid sequence of VP1 or fragment thereof are linked
in a manner as shown in Formula II:

wherein the direction from R1 to R2 is the direction from N-terminal to C-terminal
of the amino acid sequence, in which amino acid at site N is one of amino acids at
sites selected from site R447, site G453, site S578, site N587, site N587+1, site
S662, R1 is an amino acid residue at site 1 to site N-1 of the amino acid sequence
of VP1 protein or fragment thereof, R2 is an amino acid residue at site N+1 to C-terminal
of the amino acid sequence of VP1 protein or fragment thereof,
R3 is
5. The site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof according to claim 1, wherein the adeno-associated virus is type II adeno-associated
virus.
6. The site-specifically mutated adeno-associated virus capsid protein VP1 or a fragment
thereof according to claim 1, wherein the non-natural amino acid further links to
a labeling group, such as fluorescence labeling group, or a labeling group capable
of occurring a click chemistry with azide; or the non-natural amino acid further links
to a targeting molecule, preferably, the targeting molecule further links to a group
capable of occurring a click chemistry with azide.
7. A site-specifically mutated adeno-associated virus capsid protein, comprising the
adeno-associated virus capsid protein VP1 or fragment thereof according any one of
claims 1-5.
8. A site-specifically mutated adeno-associated virus, comprising the adeno-associated
virus capsid protein VP1 or fragment thereof according to any one of claims 1-5 or
the adeno-associated virus capsid protein according to claim 7.
9. The adeno-associated virus according to claim 8, wherein the non-natural amino acid
further links to a labeling group, such as a fluorescence labeling group, or a labeling
group capable of occurring a click chemistry with azide.
10. The adeno-associated virus according to claim 8, wherein the non-natural amino acid
further links to a targeting molecule, preferably, the targeting molecule further
links to a group capable of occurring a click chemistry with azide.
11. The adeno-associated virus according to claim 8, which carries a functional nucleic
acid fragment or a nucleic acid fragment of a labeling molecule.
12. A nucleic acid encoding the adeno-associated virus capsid protein VP1 or fragment
thereof according to any one of claims 1-5, wherein the nucleic acid differs from
a nucleic acid encoding a corresponding wild type adeno-associated virus capsid protein
in that a codon encoding the non-natural amino acid at the specific site amino acid
is TAG.
13. A nucleic acid vector, which operably links to the nucleic acid molecule according
to claim 12.
14. The nucleic acid vector according to claim 13, which is vector pAAV-RC in which a
codon encoding a specific site amino acid of a wild type adeno-associated virus capsid
protein VP1 or fragment thereof is mutated as TAG, and the specific site is at least
one selected from sites R447, G453, S578, N587, N587+1, S662 of the VP1 or fragment
thereof.
15. A host cell, which comprises the nucleic acid vector according to claim 13 or 14.
16. The host cell according to claim 15, which further comprises a vector of gene encoding
orthogonal amber mutant suppressor aminoacyl-tRNA synthase/tRNACUA, for example, is plasmid pACYC-tRNA / PylRS.
17. A method for preparing a site-specifically mutated adeno-associated virus capsid protein
VP1 or fragment thereof, which comprises the following steps:
(1) cloning a gene of a wild type VP1 or fragment thereof into a suitable expression
vector to obtain a recombinant expression vector;
(2) selecting one or more specific amino acid sites from an amino acid sequence of
a wild type adeno-associated virus capsid protein VP1 or fragment thereof, preferably,
the specific amino acid sites are at least one site selected from sites R447, G453,
S578, N587, N587+1, S662 of the VP1 or fragment thereof;
(3) mutating a codon in the recombination expression vector, which encodes the amino
acid of VP1 or fragment thereof at the site selected in step (1), as codon TAG by
a genetic engineering method, to obtain a mutant sequence expression vector of the
site-specifically mutated VP1 or fragment thereof;
(4) co-transfecting a suitable host cell with the mutant sequence expression vector
as obtained in step (3) and a vector of gene encoding orthogonal amber mutant suppressor
aminoacyl-tRNA synthase/tRNACUA, culturing the successfully co-transfected host cell in a culture media comprising
an non-natural amino acid, inducing expression under suitable conditions, to obtain
the site-specifically mutated adeno-associated virus capsid protein VP1 or fragment
thereof;
preferably, the vector of gene encoding orthogonal amber mutant suppressor aminoacyl-tRNA
synthase/tRNACUA is a plasmid pACYC-tRNA/PylRS, which is obtained from pACYC-tRNA/PylRS of Escherichia coli with deposition date of June 14, 2011 and deposition number of CGMCC No: 4951;
preferably, the non-natural amino acid is an azido-containing non-natural amino acid,
for example, Nε-2-azideoethyloxycarbonyl-L-lysine (NAEK),

or

or the non-natural amino acid is an non-natural amino acid with structure similar
to the above azido-containing non-natural amino acid, for example, DiZPK.
18. The method for preparing site-specifically mutated adeno-associated virus, which comprises
the following steps:
(1) providing a plasmid pAAV-RC for virus packaging, selecting one or more specific
amino acid sites to be mutated from an amino acid sequence of a wild-type adeno-associated
virus capsid protein VP1 or fragment thereof, preferably, the specific amino acid
site is at least one site selected from sites R447, G453, S578, N587, N587+1, S662
of VP1 or fragment thereof;
(2) using the plasmid pAAV-RC of step (1) as template, mutating a codon, which encodes
the amino acid of VP1 or fragment thereof at the site selected in step (1), as codon
TAG by a genetic engineering method, to obtain a site-specifically mutated virus packaging
plasmid;
(3) co-transfecting a host cell with the mutant sequence expression vector obtained
in step (3) and a vector of gene encoding orthogonal amber mutant suppressor aminoacyl-tRNA
synthase/tRNACUA, culturing the successfully co-transfected host cell in a culture media comprising
an non-natural amino acid, inducing expression under suitable conditions, to obtain
the site-specifically mutated adeno-associated virus;
preferably, co-transfecting the suitable host cell with vectors pHelper and pAAV-GFP
as well in step (3), and the suitable host cell in step (3) is AAV-293 incasing cell.
19. A composition or kit, which comprises the adeno-associated virus according any one
of claims 8-11, or the nucleic acid according to claim 12, or the nucleic acid vector
according to claim 13 or 14.
20. A gene vaccine, which comprises the adeno-associated virus according any one of claims
8-11, or the nucleic acid according to claim 12, or the nucleic acid vector according
to claim 13 or 14.
21. A use of the adeno-associated virus according any one of claims 8-11, or the nucleic
acid according to claim 12, or the nucleic acid vector according to claim 13 or 14
in manufacture of a preparation for obtaining adeno-associated virus binding protein,
or in manufacture of a medicament for gene therapy, or in manufacture of a DNA vaccine.
22. A use of the adeno-associated virus according any one of claims 8-11 as a tool adeno-associated
virus.
23. A gene therapeutic method, the method comprising administering a subject in need with
an effective amount of the adeno-associated virus according any one of claims 8-11,
or the nucleic acid according to claim 12, or the nucleic acid vector according to
claim 13 or 14.