TECHNICAL FIELD
[0001] The present invention relates to an isoprene synthase-expressing microorganism that
exhibits improved expression of pyrophosphate phosphatase, and a method of producing
an isoprene monomer using the isoprene synthase-expressing microorganism.
BACKGROUND ART
[0002] Natural rubbers are very important raw materials in tire industries and rubber industries.
While demands for rubbers will expand in motorization mainly in developing countries
in future, increase of farm plantations is not easy due to regulation to deforestation
and competition with palms. Thus, it is predicted that the increase of natural rubber
yields is difficult to be anticipated and a balance of demands and supplies will become
tight. Synthesized polyisoprene is available as a material in place of the natural
rubber, and its raw material monomer (isoprene(2-methyl-1,3-butadiene)) is obtained
by extracting from a C5 fraction obtained by cracking of naphtha. However in recent
years, with lightening of a field of a cracker, a production amount of isoprene has
tended to decrease, and its supply has been apprehended. Also in recent years, due
to strong influence of variation in oil prices, establishment of a system for inexpensively
producing isoprene derived from non-oil resource has been required for stably securing
an isoprene monomer.
[0003] For such a request, a method of producing the isoprene monomer using a transformant
obtained by integrating an isolated isoprene synthase gene derived from kudzu or poplar
and its mutant into a bacterium for fermentation production has been disclosed (see
Patent Literature 1 to 4).
[0004] A reaction mechanism of isoprene synthase has been already demonstrated, and the
isoprene synthase acts upon DMAPP (dimethylallyl pyrophosphate) as a substrate to
form pyrophosphate and isoprene (Non-patent Literature 1). As an effect of pyrophosphate
that is a product on an activity of isoprene synthase, it has been known that an enzyme
activity of isoprene synthase derived from willow (
Salix discolor L.) is decreased by 1 mM sodium pyrophosphate (Non-patent Literature 2). It has been
known that an intracellular concentration of pyrophosphate is kept at about 0.5 mM
by a protein having a pyrophosphate phosphatase activity in wild type strains of
Escherichia coli and the like widely used as fermentative production bacteria (Non-patent Literature
3).
[0005] However, there is no finding for the concentrations of pyrophosphate in microorganisms
that produce excessive isoprene. Therefore, it has been unknown whether pyrophosphate
reduces an activity of isoprene synthase in such an microorganism. Also, it has been
unknown whether pyrophosphate has an effect on an ability to produce isoprene.
PRIOR ART REFERENCES
PATENT LITERARURES
[0006]
Patent Literature 1: Japanese Laid-Open Publication No. 2011-505841
Patent Literature 2: Japanese Laid-Open Publication No. 2011-518564
Patent Literature 3: International Publication WO2010/031076
Patent Literature 4: International Publication WO2014/052054
NON-PATENT LITERATURES
SUMMARY OF INVENTION
PROBLEM TO BE SOLVED BY THE INVENTION
[0008] It is an object of the present invention to provide a biological method that is excellent
in production of isoprene.
MEANS FOR SOLVING PROBLEM
[0009] As a result of an extensive study for solving the above problems, the present inventors
have found that an ability to produce an isoprene monomer is improved by improving
an expression amount of pyrophosphate phosphatase in an isoprene synthase-expressing
microorganism, and completed the present invention.
[0010] Namely, the present invention is as follows.
- [1] An isoprene synthase-expressing microorganism that exhibits improved expression
of pyrophosphate phosphatase.
- [2] The isoprene synthase-expressing microorganism according to [1], wherein said
microorganism is a microorganism transformed with an expression vector for isoprene
synthase.
- [3] The isoprene synthase-expressing microorganism according to [1] or [2], wherein
pyrophosphate phosphatase is homologous to said microorganism.
- [4] The isoprene synthase-expressing microorganism according to [3], wherein expression
of the pyrophosphate phosphatase is improved by modification of a promoter region
of a pyrophosphate phosphatase gene inherent to said microorganism.
- [5] The isoprene synthase-expressing microorganism according to any one of [1] to
[4], wherein the expression of the pyrophosphate phosphatase is improved by increased
copy number of the pyrophosphate phosphatase gene on a chromosome.
- [6] The isoprene synthase-expressing microorganism according to any one of [1] to
[5], wherein said microorganism is a microorganism belonging to Enterobacteriaceae.
- [7] The isoprene synthase-expressing microorganism according to any one of [1] to
[6], wherein said microorganism has an ability to synthesize dimethylallyl diphosphate
via a methylerythritol diphosphate pathway.
- [8] The isoprene synthase-expressing microorganism according to [7], wherein said
microorganism is a bacterium belonging to genus Escherichia.
- [9] The isoprene synthase-expressing microorganism according to [8], wherein said
bacterium belonging to genus Escherichia is Escherichia coli.
- [10] The isoprene synthase-expressing microorganism according to any one of [1] to
[7], wherein said microorganism has an ability to synthesize dimethylallyl diphosphate
via a mevalonate pathway.
- [11] The isoprene synthase-expressing microorganism according to any one of [1] to
[7] and [10], wherein said microorganism is a bacterium belonging to genus Pantoea.
- [12] The isoprene synthase-expressing microorganism according to [11], wherein said
bacterium belonging to genus Pantoea is Pantoea ananatis.
- [13] A method of producing an isoprene monomer, comprising producing the isoprene
monomer by culturing the isoprene synthase-expressing microorganism according to any
one of [1] to [12] in culture medium.
- [14] A method of producing an isoprene polymer, comprising
- (I) producing an isoprene monomer by the method according to [13]; and
- (II) polymerizing the isoprene monomer to produce the isoprene polymer.
- [15] A polymer derived from an isoprene monomer produced by the method according to
[13].
- [16] A rubber composition comprising the polymer according to [15].
- [17] A tire produced by using the rubber composition according to [16].
EFFECT OF THE INVENTION
[0011] The isoprene synthase-expressing microorganism of the present invention is excellent
in ability to produce isoprene, and also remarkably ameliorates a glucose yield.
[0012] In the isoprene synthase-expressing microorganism of the present invention, its growth
is also ameliorated with improvement of the expression of pyrophosphate phosphatase
(see FIG. 13).
BRIEF DESCRIPTION OF DRAWINGS
[0013]
FIG. 1 shows analysis of PPA expression by SDS-PAGE. Controls in lanes 1 and 2 denote
samples prepared from MG1655 Ptac-KKDyI strain. Ptac-ppa in lanes 3 and 4 denotes
samples prepared from MG1655 Ptac-KKDyI Ptac-ppa strain. M denotes protein molecular
weight markers;
FIG. 2 shows amounts of isoprene generated per unit weight of dry leaves from various
plants;
FIG. 3 shows amounts of isoprene generated per total protein mass extracted from leaves
of various plants;
FIG. 4 shows an outline of mevalonate pathway downstream and its surrounding region
in chromosome fixation;
FIG. 5 shows an outline of mevalonate pathway downstream and its surrounding region
controlled by a tac promoter on a chromosome;
FIG. 6 shows a map of the plasmid pAH162-Para-mvaES;
FIG. 7 shows a map of the plasmid pAH162-KKDyI-ispS(K);
FIG. 8 shows a map of pAH162-Ptac-ispS(M)-mvk(Mma);
FIG. 9 shows construction of a modified chromosome ΔampC::KKDyI-ispS(K). (A) λRed
dependent substitution of ampC gene with PCR formed DNA fragment attLphi80-kan-attRphi80.
(B) phi80 Int dependent integration of plasmid pAH162-KKDyI-ispS(K). (C) phi80Int/Xis
dependent removal of vector portion of pAH162-KKDyI-ispS(K);
FIG. 10 shows construction of a modified chromosome ΔampC::Para-mvaES. (A) λRed dependent
substitution of ampH gene with PCR formed DNA fragment attLphi80-kan-attRphi80. (B)
phi80 Int dependent integration of plasmid pAH162-Para-mvaES. (C) phi80 Int/Xis dependent
removal of vector portion of pAH162-Para-mvaES;
FIG. 11 shows construction of the modified genome Δcrt::KKDyI-ispS(K) of megaplasmid
pEA320. (A) Structure of P. ananatis crt locus arranged in megaplasmid pEA320. (B) λRed dependent substitution of crt
operon with PCR formed DNA fragment attLphi80-kan-attRphi80. (C) phi80 Int dependent
integration of plasmid pAH162-Ptac-ispS(M)-mvk(Mma). (D) phi80 Int/Xis dependent removal
of vector portion of pAH162-Ptac-ispS(M)-mvk(Mma);
FIG. 12 shows amounts of protein expression of pyrophosphate phosphatase in AG10265
strain. 21.7 kD denotes an assumed molecular weight of pyrophosphate phosphatase encoded
by a PAJ_2344(ppa-1) gene, and 19.8 kD denotes an assumed molecular weight of pyrophosphate
phosphatase encoded by a PAJ_2736(ppa-2) gene. Lane 1: soluble protein derived from
AG10265 strain, Lanes 2 to 4: soluble protein derived from AG10265 Ptac-ϕ10-ppa1 strain,
lanes 5 to 6: soluble protein derived from AG10265 Ptac-ϕ10-ppa2 strain, and M: molecular
weight markers.
FIG. 13 shows growth change of P. ananatis isoprene-producing bacterium in jar cultivation;
FIG. 14 shows amounts of isoprene produced by P. ananatis isoprene-producing bacterium in jar cultivation; The amount (mg) of isoprene produced
per batch is shown;
FIG. 15 shows a map of pAH162-mvaES;
FIG. 16 shows a plasmid pAH162-MCS-mvaES for chromosome fixation;
FIG. 17 shows a set of plasmid for chromosome fixation holding a mvaES gene under
transcription control by PphoC;
FIG. 18 shows construction of an integrative vector pAH162-λattL-KmR-λattR;
FIG. 19 shows an integrative expression vector pAH162-Ptac;
FIG. 20 shows optimization of codons in chemically synthesized operon KDyI;
FIG. 21 shows integrative plasmids (A) pAH162-Tc-Ptac-KDyI and (B) pAH162-Km-Ptac-KDyI
holding operon KDyI having optimized codons;
FIG. 22 shows an integrative plasmid holding a mevalonate kinase gene derived from
M. paludicola;
FIG. 23 shows maps of the modified genomes: (A) ΔampC:: attBphi80, (B) ΔampH:: attBphi80 and (C) Δcrt:: attBphi80;
FIG. 24 shows maps of the modified genomes: (A) Δcrt::pAH162-Ptac-mvk(X) and (B) Δcrt::Ptac-mvk(X);
FIG. 25 shows maps of the modified genomes: (A) ΔampH::pAH162-Km-Ptac-KDyI, and (B) ΔampC::pAH162-Km-Ptac-KDyI;
FIG. 26 shows maps of the modified genomes (A) ΔampH::pAH162-Para-mvaES and (B) ΔampC::pAH162-Para-mvaES;
and
FIG. 27 shows confirmation of PPA expression in SWITCH-PphoC-1(S)ΔydcT::Ptac-MG-ppa.
Cont and MG-ppa denote that a sample derived from SWITCH-PphoC-1(S)ΔydcI strain and
a sample derived from SWITCH-PphoC-1(S)ΔydcI::Ptac-MG-ppa strain were electrophoresed,
respectively.
EMBODIMENTS FOR CARRYING OUT THE INVENTION
[0014] The present invention provides an isoprene-expressing microorganism that exhibits
improved expression of pyrophosphate phosphatase.
[0015] Pyrophosphate phosphatase is an enzyme that hydrolyzes a pyrophosphoric acid into
a bimolecular phosphoric acid. Examples of the pyrophosphate phosphatase include pyrophosphate
phosphatase derived from a microorganism as a host as described below. For the pyrophosphate
phosphatase, pyrophosphate phosphatase derived from a microorganism belonging to the
family
Enterobacteriaceae, in particular, a microorganism belonging to the family
Enterobacteriaceae among microorganisms as described below, is also preferred.
[0016] Specifically, the pyrophosphate phosphatase may be a protein consisting of the amino
acid sequence of SEQ ID NO:136, SEQ ID NO:137 or SEQ ID NO:138.
[0017] Further, the pyrophosphate phosphatase may be a protein that comprises an amino acid
sequence having 70% or more amino acid sequence identity to the amino acid sequence
of SEQ ID NO:136, SEQ ID NO:137 or SEQ ID NO:138, and has a pyrophosphate phosphatase
activity. The amino acid sequence percent identity may be, for example, 75% or more,
80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98%
or more, or 99% or more. The pyrophosphate phosphatase activity refers to an activity
of hydrolyzing a pyrophosphoric acid into a bimolecular phosphoric acid.
[0018] Further, the pyrophosphate phosphatase may be a protein that comprises an amino acid
sequence having a mutation of one or several amino acid residues in the amino acid
sequence of SEQ ID NO:136, SEQ ID NO:137 or SEQ ID NO:138, and has a pyrophosphate
phosphatase activity. Examples of the mutation of the amino acid residues may include
deletion, substitution, addition and insertion of amino acid residues. The mutation
of one or several amino acid residues may be introduced into one region or multiple
different regions in the amino acid sequence. The term "one or several" indicates
a range in which a three-dimensional structure and an activity of the protein are
not impaired greatly. In the case of the protein, the number represented by "one or
several" is, for example, 1 to 50, preferably 1 to 40, more preferably 1 to 30, 1
to 20, 1 to 10, or 1 to 5.
[0019] The pyrophosphate phosphatase preferably has a pyrophosphate phosphatase activity
that is 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or
more of the pyrophosphate phosphatase activity of the protein consisting of the amino
acid sequence of SEQ ID NO:136, SEQ ID NO:137 or SEQ ID NO:138 when measured under
the same conditions (e.g., buffer, concentration, temperature, and reaction time).
[0020] The identity of the amino acid sequences can be determined, for example, using the
algorithm
BLAST (Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)) by
Karlin and Altschul, and the FASTA algorithm (Methods Enzymol., 183, 63 (1990)) by Pearson. The program referred to as BLASTP was developed based on the algorithm
BLAST (see http://www.ncbi.nlm.nih.gov). Thus, the identity of the amino acid sequences
may be calculated using this program with default setting. Also, for example, a numerical
value obtained by calculating similarity as a percentage at a setting of "unit size
to compare=2" using the full length of a polypeptide portion encoded in ORF with the
software GENETYX Ver. 7.0.9 from Genetyx Corporation employing the Lipman-Pearson
method may be used as the identity of the amino acid sequences. The lowest value among
the values derived from these calculations may be employed as the identity of the
amino acid sequences.
[0021] In the pyrophosphate phosphatase, the mutation may be introduced into sites in a
catalytic domain and sites other than the catalytic domain as long as an objective
activity is retained. The positions of amino acid residues to be mutated which are
capable of retaining the objective activity are understood by a person skilled in
the art. Specifically, a person skilled in the art can recognize a correlation between
structure and function, since a person skilled in the art can 1) compare the amino
acid sequences of multiple proteins having the same type of activity, 2) clarify regions
that are relatively conserved and regions that are not relatively conserved, and then
3) predict regions capable of playing a functionally important role and regions incapable
of playing a functionally important role from the regions that are relatively conserved
and the regions that are not relatively conserved, respectively. Therefore, a person
skilled in the art can identify the positions of the amino acid residues to be mutated
in the amino acid sequence of the pyrophosphate phosphatase.
[0022] When the mutation of the amino acid residue is substitution, the substitution of
the amino acid residue may be conservative substitution. The term "conservative substitution"
refers to substitution of a certain amino acid residue with an amino acid residue
having a similar side chain. Families of amino acid residues having similar side chains
are well-known in the art. Examples of such families may include amino acids having
a basic side chain (e.g., lysine, arginine, histidine), amino acids having an acidic
side chain (e.g., aspartic acid, glutamic acid), amino acids having a non-charged
polar side chain (e.g., asparagine, glutamine, serine, threonine, tyrosine, cysteine),
amino acids having a non-polar side chain (e.g., glycine, alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having a
branched side chain at position β (e.g., threonine, valine, isoleucine), amino acids
having an aromatic side chain (e.g., tyrosine, phenylalanine, tryptophan, histidine),
amino acids having a hydroxyl group-containing (e.g., alcoholic, phenolic) side chain
(e.g., serine, threonine, tyrosine), and amino acids having a sulfur-containing side
chain (e.g., cysteine, methionine). Preferably, the conservative substitution of the
amino acids may be the substitution between aspartic acid and glutamic acid, the substitution
among arginine, lysine and histidine, the substitution between tryptophan and phenylalanine,
the substitution between phenylalanine and valine, the substitution among leucine,
isoleucine and alanine, and the substitution between glycine and alanine.
[0023] The expression of pyrophosphate phosphatase in the isoprene synthase-expressing microorganism
can be improved by any mode in which an amount of pyrophosphate phosphatase expressed
in the isoprene synthase-expressing microorganism is increased. Pyrophosphate phosphatase,
the expression of which is to be improved in the isoprene synthase-expressing microorganism
is pyrophosphate phosphatase that is homologous or heterologous to isoprene synthase
and/or the isoprene synthase-expressing microorganism. Pyrophosphate phosphatase homologous
to the isoprene synthase-expressing microorganism may be pyrophosphate phosphatase
inherent to the isoprene synthase-expressing microorganism or foreign pyrophosphate
phosphatase. One or a plurality (e.g., 2 or 3) of pyrophosphate phosphatase, the expression
of which is to be improved in the isoprene synthase-expressing microorganism may be
available.
[0024] The expression of pyrophosphate phosphatase in the isoprene synthase-expressing microorganism
may be improved, for example, by modifying a surrounding region of a pyrophosphate
phosphatase gene inherent to the isoprene synthase-expressing microorganism, or by
transforming the isoprene synthase-expressing microorganism with a pyrophosphate phosphatase
expression vector to introduce an expression unit comprising a polynucleotide encoding
pyrophosphate phosphatase into the isoprene synthase-expressing microorganism. The
expression vector used in the present invention may further comprise one or more region
that allows for homologous recombination with genome of a host cell when introduced
into the host cell. For example, the expression vector may be designed such that an
expression unit comprising a given polynucleotide is positioned between a pair of
homologous regions (e.g., homology arm homologous to a certain sequence in host genome,
loxP, FRT). The expression unit refers to a unit that comprises a given polynucleotide
to be expressed and a promoter (homologous promoter, heterologous promoter) operably
linked thereto and allows for transcription of the polynucleotide and further production
of a polypeptide encoded by the polynucleotide. The expression unit may further comprise
elements such as a terminator, a ribosome binding site and a drug resistant gene.
[0025] Examples of the expression vector used in the present invention may include vectors
that expresses a protein in a host. The expression vector may also be a plasmid, a
viral vector, a phage or an artificial chromosome. The expression vector may further
be a DNA vector or an RNA vector. The expression vector may be an integrative vector
or a non-integrative vector. The integrative vector may be a vector of a type where
the vector is entirely integrated into genome of a host cell. Alternatively, the integrative
vector may be a vector of a type where the vector is partially (e.g., the aforementioned
expression unit) integrated into genome of a host cell.
[0026] Examples of the surrounding region to be modified in the pyrophosphate phosphatase
gene may include a promoter region, Shine-Dalgarno (SD) sequence, and a spacer region
between RBS and an initiation codon (in particular, a sequence just upstream of the
initiation codon (5'-UTR)). Examples of the modification may include one or several
(e.g., 1 to 500, 1 to 300, 1 to 200 or 1 to 100) nucleotide substitutions, insertions
or deletions in the surrounding region. Preferably, the modification in the surrounding
region is the substitution of the promoter region and if necessary the substitution
of the SD sequence. Examples of a promoter to be introduced after the substitution
may include inducible promoters such as a tac promoter (Ptac), a trc promoter (Ptrc)
and a lac promoter (Plac). Examples of a sequence to be introduced after the substitution
of the SD sequence may include RBS of a gene 10 derived from phage T7 (
Olins P. O. et al, Gene, 1988, 73, 227-235).
[0027] In the present invention, it is desirable that a copy number of the pyrophosphate
phosphatase gene on a chromosome is increased thereby enhancing an activity. It is
preferable that a plurality of copies, desirably 2 copies and more preferably 3 copies
are carried on the chromosome. Increase of the copy number can be accomplished by
introducing a plasmid carrying the pyrophosphate phosphatase gene into a host cell.
The increase of the copy number can also be accomplished by utilizing transposon or
Mu phage to transfer the pyrophosphate phosphatase gene onto the genome of the host.
[0028] The isoprene synthase-expressing microorganism is a microorganism that produces the
isoprene synthase. Preferably, the isoprene synthase-expressing microorganism is a
microorganism obtained by transforming a host cell with an isoprene synthase-expressing
vector to introduce an expression unit comprising a polynucleotide encoding the isoprene
synthase into the host cell. The expression unit and the expression vector are as
described above. It is preferable that a plurality of copies, desirably 2 copies and
more preferably 3 copies of an isoprene synthase gene are carried on the chromosome
in the isoprene synthase-expressing microorganism. Such an isoprene synthase-expressing
microorganism can be obtained by introducing an isoprene synthase-expressing vector
into a host. Also such an isoprene synthase-expressing microorganism can be obtained
by utilizing transposon or Mu phage to transfer the isoprene synthase gene onto the
genome of the host. The host cell may be homologous or heterologous to the isoprene
synthase, but is preferably heterologous. Examples of the isoprene synthase gene contained
in the isoprene synthase-expressing vector may include isoprene synthase genes derived
from kudzu (
Pueraria montana var. lobata), poplar (
Populus alba x Populus tremula), Mucuna (
Mucuna bracteata), willow (
Salix), false acacia (
Robinia pseudoacacia), wisteria (
Wisterria), eucalyptus (
Eucalyptus globules), and tea plant (
Melaleuca alterniflora) (see, e.g.,
Evolution 67 (4), 1026-1040 (2013)). The isoprene synthase-expressing vector may be an integrative vector or a non-integrative
vector. A gene encoding the isoprene synthase can be arranged under control of a constitutive
promoter or an inducible promoter (e.g., a promoter as described below which is inversely
depending on the growth promoting agent) in the expression vector. Preferably, the
gene encoding the isoprene synthase can be arranged under the control of the constitutive
promoter. Examples of the constitutive promoter may include a tac promoter, a lac
promoter, a trp promoter, a trc promoter, a T7 promoter, a T5 promoter, a T3 promoter,
and an Sp6 promoter.
[0029] In one embodiment, the isoprene synthase may be, for example, a protein as follows:
- 1) a full-length protein which may be derived from Kudzu (the amino acid sequence
of SEQ ID NO:8);
- 2) a protein obtained by deleting a chloroplast localization signal from the full-length
protein in 1) above (amino acid sequence obtained by deleting amino acid residues
at positions 1 to 45 in the amino acid sequence of SEQ ID NO:8);
- 3) a full-length protein which may be derived from Poplar (the amino acid sequence
of SEQ ID NO:11);
- 4) a protein obtained by deleting a chloroplast localization signal from the full-length
protein in 3) above (amino acid sequence obtained by deleting amino acid residues
at positions 1 to 37 in the amino acid sequence of SEQ ID NO: 11);
- 5) a full-length protein which may be derived from Mucuna (the amino acid sequence
of SEQ ID NO:7); and
- 6) a protein obtained by deleting a chloroplast localization signal from the full-length
protein in 5) above (amino acid sequence obtained by deleting amino acid residues
at positions 1 to 44 in the amino acid sequence of SEQ ID NO:146).
[0030] In a preferred embodiment, the isoprene synthase may be derived from Kudzu. In another
preferred embodiment, the isoprene synthase may be derived from Poplar. In still another
preferred embodiment, the isoprene synthase may be derived from Mucuna.
[0031] In another embodiment, the isoprene synthase is a protein that comprises an amino
acid sequence having 70% or more amino acid sequence identity to the amino acid sequence
of the proteins of 1) to 6) above, and has an isoprene synthase activity. The amino
acid sequence percent identity may be, for example, 75% or more, 80% or more, 85%
or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or
more. The amino acid sequence percent identity can be determined in the aforementioned
manner. The isoprene synthase activity refers to an activity of forming isoprene from
dimethylallyl diphosphate (DMAPP).
[0032] In still another embodiment, the isoprene synthase is a protein that comprises an
amino acid sequence having a mutation of one or several amino residues in the amino
acid sequence of the protein of 1) to 6) above, and has an isoprene synthase activity.
Examples of the mutation of the amino acid residues may include deletion, substitution,
addition and insertion of amino acid residues. The mutation of one or several amino
acid residues may be introduced into one region or multiple different regions in the
amino acid sequence. The term "one or several" indicates a range in which a three-dimensional
structure and an activity of the protein are not impaired greatly. In the case of
the protein, the number represented by "one or several" is, for example, 1 to 100,
preferably 1 to 80, more preferably 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 1 to 5.
[0033] The isoprene synthase preferably has an isoprene synthase activity that is 50% or
more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more of the isoprene
synthase activity of the protein of 1) to 6) above when measured under the same conditions
(e.g., buffer, concentration, temperature, and reaction time). In terms of stability,
it is also preferable that the isoprene synthase has a remaining activity that is
30% or more, 40% or more, 50% or more, 60% or more or 65% or more of the original
activity when stored in a certain buffer [e.g., a solution of 50 mM Tris-HCl (pH 8.0),
and 0.15 mM MgCl
2] at 4°C for 48 hours.
[0034] In the isoprene synthase, the mutation may be introduced into sites in a catalytic
domain and sites other than the catalytic domain as long as an objective activity
is retained. The positions of amino acid residues to be mutated which are capable
of retaining the objective activity are understood by a person skilled in the art.
Specifically, a person skilled in the art can recognize a correlation between structure
and function, since a person skilled in the art can 1) compare the amino acid sequences
of multiple proteins having the same type of activity, 2) clarify regions that are
relatively conserved and regions that are not relatively conserved, and then 3) predict
regions capable of playing a functionally important role and regions incapable of
playing a functionally important role from the regions that are relatively conserved
and the regions that are not relatively conserved, respectively. Therefore, a person
skilled in the art can identify the positions of the amino acid residues to be mutated
in the amino acid sequence of the isoprene synthase. When an amino acid residue is
mutated by substitution, the substitution of the amino acid residue may be the conservative
substitution as described above.
[0035] Preferably, the isoprene synthase-expressing microorganism may be a microorganism
that further expresses a mevalonate kinase in addition to the isoprene synthase. Therefore,
in the isoprene synthase-expressing microorganism, a mevalonate kinase expression
vector may be introduced into a host. Examples of the mevalonate kinase gene to be
introduced into the host by the mevalonate kinase expression vector may include genes
from microorganisms belonging to the genus
Methanosarcina such as
Methanosarcina mazei, the genus
Methanocella such as
Methanocella paludicola, the genus Corynebacterium such as
Corynebacterium variabile, the genus
Methanosaeta such as
Methanosaeta concilii, and the genus
Nitrosopumilus such as
Nitrosopumilus maritimus. The mevalonate kinase expression vector may be an integrative vector or a non-integrative
vector. In the expression vector, the gene encoding the mevalonate kinase may be placed
under the control of the constitutive promoter as described above or an inducible
promoter (e.g., a promoter as described below which is inversely dependent on the
growth promoting agent). Preferably, the gene encoding the mevalonate kinase may be
placed under the control of the constitutive promoter.
[0036] For the isoprene synthase-expressing microorganism (host cell) used in the present
invention, a bacterium or a fungus is preferred. The bacterium may be a gram-positive
bacterium or a gram-negative bacterium. For the isoprene synthase-expressing microorganism,
a microorganism belonging to the family
Enterobacteriaceae, in particular, a microorganism belonging to the family
Enterobacteriaceae among microorganisms as described below, is also preferred.
[0037] Examples of the gram-positive bacterium may include bacteria belonging to the genera
Bacillus, Listeria, Staphylococcus, Streptococcus, Enterococcus,
Clostridium, Corynebacterium, and
Streptomyces. Bacteria belonging to the genera
Bacillus and
Corynebacterium are preferable.
[0038] Examples of the bacteria belonging to the genus
Bacillus may include
Bacillus subtilis, Bacillus anthracis, and
Bacillus cereus. Bacillus subtilis is more preferable.
[0039] Examples of the bacteria belonging to genus the
Corynebacterium may include
Corynebacterium glutamicum, Corynebacterium efficiens, and
Corynebacterium callunae. Corynebacterium glutamicum is more preferable.
[0040] Examples of the gram-negative bacterium may include bacteria belonging to the genera
Escherichia, Pantoea, Salmonella, Vivrio,
Serratia, and
Enterobacter. The bacteria belonging to the genera
Escherichia, Pantoea and
Enterobacter are preferable.
[0041] Escherichia coli is preferable as the bacteria belonging to the genus
Escherichia.
[0042] Examples of the bacteria belonging to the genus
Pantoea may include
Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and
Pantoea citrea. Pantoea ananatis and
Pantoea citrea are preferable. Strains exemplified in
EP 0 952 221 may be used as the bacteria belonging to the genus
Pantoea. Examples of representative strains of the bacteria belonging to genus
Pantoea may include
Pantoea ananatis AJ13355 strain (FERM BP-6614) and
Pantoea ananatis AJ13356 strain (FERM BP-6615), both of which are disclosed in
EP 0 952 221, and
Pantoea ananatis SC17(0) strain. SC17(0) was deposited to Russian National Collection of Industrial
Microorganisms (VKPM), GNII Genetika (address: Russia, 117545 Moscow, 1 Dorozhny proezd.
1) as of September 21, 2005, with the deposit number of VKPM B-9246.
[0043] Examples of the bacteria belonging to the genus
Enterobacter may include
Enterobacter agglomerans and
Enterobacter aerogenes. Enterobacter aerogenes is preferable. The bacterial strains exemplified in
EP 0 952 221 may be used as the bacteria belonging to the genus
Enterobacter. Examples of representative strains of the bacteria belonging to the genus
Enterobacter may include
Enterobacter agglomerans ATCC12287 strain,
Enterobacter aerogenes TACC13048 strain, Enterobacter aerogenes NBRC12010 strain (
Biotechnol. Bioeng., 2007 Mar 27;98(2): 340-348), and
Enterobacter aerogenes AJ110637 (FERM BP-10955). The
Enterobacter aerogenes AJ110637 strain was deposited to International Patent Organism Depositary (IPOD),
National Institute of Advanced Industrial Science and Technology (AIST) (Chuo No.
6, Higashi 1-1-1, Tsukuba City, Ibaraki Pref., JP, Postal code 305-8566) as of August
22, 2007, with the deposit number of FERM P-21348 and was transferred to the international
deposition based on Budapest Treaty on March 13, 2008, and the receipt number FERM
BP-10955 was given thereto.
[0044] Examples of the fungus may include microorganisms belonging to the genera
Saccharomyces, Schizosaccharomyces, Yarrowia, Trichoderma, Aspergillus, Fusarium, and
Mucor. The microorganisms belonging to the genera
Saccharomyces, Schizosaccharomyces, Yarrowia, or
Trichoderma are preferable.
[0045] Examples of the microorganisms belonging to the genus
Saccharomyces may include
Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus,
Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, and
Saccharomyces oviformis. Saccharomyces cerevisiae is preferable.
[0046] Schizosaccharomyces pombe is preferable as a microorganism belonging to the genus
Schizosaccharomyces.
[0047] Yarrowia lypolytica is preferable as a microorganism belonging to the genus
Yarrowia.
[0048] Examples of the microorganisms belonging to the genus
Trichoderma may include
Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma
reesei, and
Trichoderma viride. Trichoderma reesei is preferable.
[0049] In the isoprene synthase-expressing microorganism of the present invention, the pathway
to synthesize dimethylallyl diphosphate (DMAPP) that is the substrate of the isoprene
synthase may be further enhanced. For such an enhancement, an expression vector that
expresses an isopentenyl-diphosphate delta isomerase having an ability to convert
isopentenyl diphosphate (IPP) into dimethylallyl diphosphate (DMAPP) may be introduced
into the isoprene synthase-expressing microorganism of the present invention. An expression
vector that expresses one or more enzymes involved in the mevalonate pathway and/or
methylerythritol phosphate pathway associated with formation of IPP and/or DMAPP may
also be introduced into the isoprene synthase-expressing microorganism of the present
invention. The expression vector for such an enzyme may be an integrative vector or
a non-integrative vector. The expression vector for such an enzyme may further express
at a time or separately a plurality of enzymes (e.g., one, two, three or four or more)
involved in the mevalonate pathway and/or the methylerythritol phosphate pathway,
and may be, for example, an expression vector for polycistronic mRNA. Origin of one
or more enzymes involved in the mevalonate pathway and/or the methylerythritol phosphate
pathway may be homologous or heterologous to the host. When the origin of the enzyme
involved in the mevalonate pathway and/or the methylerythritol phosphate pathway is
heterologous to the host, for example, the host may be a bacterium as described above
(e.g.,
Escherichia coli) and the enzyme involved in the mevalonate pathway may be derived from a fungus (e.g.,
Saccharomyces cerevisiae). In addition, when the host inherently produces the enzyme involved in the methylerythritol
phosphate pathway, an expression vector to be introduced into the host may express
an enzyme involved in the mevalonate pathway.
[0050] Examples of isopentenyl-diphosphate delta isomerase (EC: 5.3.3.2) may include Idi1p
(ACCESSION ID NP_015208), AT3G02780 (ACCESSION ID NP_186927), AT5G16440 (ACCESSION
ID NP_197148) and Idi (ACCESSION ID NP_417365). In the expression vector, a gene encoding
an isopentenyl-diphosphate delta isomerase may be placed under the control of a promoter
as described below which is inversely dependent on a growth promoting agent.
[0051] Examples of the enzymes involved in the mevalonate (MVA) pathway may include mevalonate
kinase (EC: 2.7.1.36; example 1, Erg12p, ACCESSION ID NP_013935; example 2, AT5G27450,
ACCESSION ID NP_001190411), phosphomevalonate kinase (EC: 2.7.4.2; example 1, Erg8p,
ACCESSION ID NP_013947; example 2, AT1G31910, ACCESSION ID NP_001185124), diphosphomevalonate
decarboxylase (EC: 4.1.1.33; example 1, Mvd1p, ACCESSION ID NP_014441; example 2,
AT2G38700, ACCESSION ID NP_181404; example 3, AT3G54250, ACCESSION ID NP_566995),
acetyl-CoA-C-acetyltransferase (EC: 2.3.1.9; example 1, Erg10p, ACCESSION ID NP_015297;
example 2, AT5G47720, ACCESSION ID NP_001032028; example 3, AT5G48230, ACCESSION ID
NP_568694), hydroxymethylglutaryl-CoA synthase (EC: 2.3.3.10; example 1, Erg13p, ACCESSION
ID NP_013580; example 2, AT4G11820, ACCESSION ID NP_192919; example 3, MvaS, ACCESSION
ID AAG02438), hydroxymethylglutaryl-CoA reductase (EC: 1.1.1.34; example 1, Hmg2p,
ACCESSION ID NP_013555; example 2, Hmg1p, ACCESSION ID NP_013636; example 3, AT1G76490,
ACCESSION ID NP_177775; example 4, AT2G17370, ACCESSION ID NP_179329, EC: 1.1.1.88,
example, MvaA, ACCESSION ID P13702), and acetyl-CoA-C-acetyltransferase/hydroxymethylglutaryl-CoA
reductase (EC: 2.3.1.9/1.1.1.34, example, MvaE, ACCESSION ID AAG02439). In the expression
vector, a gene encoding one or more enzymes involved in the mevalonate (MVA) pathway
(e.g., phosphomevalonate kinase, diphosphomevalonate decarboxylase, acetyl-CoA-C-acetyltransferase/hydroxymethylglutaryl-CoA
reductase, hydroxymethylglutaryl-CoA synthase) may be placed under the control of
a promoter as described below which is inversely dependent on the growth promoting
agent.
[0052] Examples of the enzymes involved in the methylerythritol phosphate (MEP) pathway
may include 1-deoxy-D-xylulose-5-phosphate synthase (EC: 2.2.1.7, example 1, Dxs,
ACCESSION ID NP_414954; example 2, AT3G21500, ACCESSION ID NP_566686; example 3, AT4G15560,
ACCESSION ID NP_193291; example 4, AT5G11380, ACCESSION ID NP_001078570), 1-deoxy-D-xylulose-5-phosphate
reductoisomerase (EC: 1.1.1.267; example 1, Dxr, ACCESSION ID NP_414715; example 2,
AT5G62790, ACCESSION ID NP_001190600), 4-diphosphocytidyl-2-C-methyl-D-erythritol
synthase (EC: 2.7.7.60; example 1, IspD, ACCESSION ID NP_417227; example 2, AT2G02500,
ACCESSION ID NP_565286), 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (EC: 2.7.1.148;
example 1, IspE, ACCESSION ID NP_415726; example 2, AT2G26930, ACCESSION ID NP_180261),
2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase (EC: 4.6.1.12; example 1, IspF,
ACCESSION ID NP_417226; example 2, AT1G63970, ACCESSION ID NP_564819), 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate
synthase (EC: 1.17.7.1; example 1, IspG, ACCESSION ID NP_417010; example 2, AT5G60600,
ACCESSION ID NP_001119467), and 4-hydroxy-3-methyl-2-butenyl diphosphate reductase
(EC: 1.17.1.2; example 1, IspH, ACCESSION ID NP_414570; example 2, AT4G34350, ACCESSION
ID NP_567965). In the expression vector, a gene encoding one or more enzymes involved
in the methylerythritol phosphate (MEP) pathway may be placed under the control of
a promoter as described below which is inversely dependent on the growth promoting
agent.
[0053] Transformation of the host cell by the expression vector in which the gene is incorporated
can be carried out using known methods. Examples of such a method may include a competent
cell method using a microbial cell treated with calcium and an electroporation method.
The gene may be introduced by infecting the microbial cell with a phage vector rather
than the plasmid vector.
[0054] Further, a gene encoding the enzyme involved in the mevalonate pathway or the methylerythritol
phosphate pathway that synthesizes dimethylallyl diphosphate that is the substrate
of the isoprene synthase may also be introduced into the isoprene synthase-expressing
microorganism of the present invention. Examples of such an enzyme may include 1-deoxy-D-xylose-5-phosphate
synthase that converts a pyruvate and D-glycelaldehyde-3-phosphate into 1-deoxy-D-xylose-5-phosphate,
and isopentyl diphosphate isomerase that converts isopentenyl diphosphate into dimethylallyl
diphosphate. In the expression vector, a gene encoding the enzyme involved in the
mevalonate pathway or the methylerythritol phosphate pathway that synthesizes dimethylallyl
diphosphate may be placed under the control of the constitutive promoters as described
above or an inducible promoter (e.g., a promoter as described below, which is inversely
dependent on the growth promoting agent).
[0055] DMAPP (dimethylallyl diphosphate) that is a substrate of isoprene synthesis has been
known to be a precursor of peptide glycan and an electron acceptor, such as menaquinone
and the like, and to be essential for growth of microorganisms (
Fujisaki et al., J. Biochem., 1986; 99: 1137-1146). In the light of efficient production of isoprene, the isoprene synthase-expressing
microorganism of the present invention may be used in the method of producing isoprene,
in which a step 1) corresponding to a growth phase of a microorganism (culturing an
isoprene-expressing microorganism in the presence of a growth promoting agent at a
sufficient concentration to grow the isoprene-expressing microorganism) and a step
3) corresponding to a formation phase of the isoprene (culturing the isoprene-expressing
microorganism to form an isoprene monomer) are separated. The method may also comprise
a step 2) corresponding to an induction phase of isoprene production for transferring
the growth phase of the microorganism to the formation phase of the isoprene (decreasing
the sufficient concentration of the growth promoting agent to induce production of
the isoprene monomer by the isoprene-expressing microorganism).
[0056] In the method of the present invention, the growth promoting agent can refer to a
factor essential for the growth of a microorganism or a factor having an activity
of promoting the growth of the microorganism, which can be consumed by the microorganism,
the consumption of which causes reduction of its amount in a culture medium, consequently
lost or reduction of the growth of the microorganism. For example, when the growth
promoting agent in a certain amount is used, a microorganism continues to grow until
the growth promoting agent in that amount is consumed, but once the growth promoting
agent is entirely consumed, the microorganism cannot grow or the growth rate can decrease.
Therefore, the degree of the growth of the microorganism can be regulated by the growth
promoting agent. Examples of such a growth promoting agent may include substances
such as oxygen (gas); minerals such as ions of iron, magnesium, potassium and calcium;
phosphorus compounds such as monophosphoric acid, diphosphoric acid and polyphosphoric
acid, or salt thereof; nitrogen compounds (gas) such as ammonia, nitrate, nitrite,
and urea; sulfur compounds such as ammonium sulfate and thiosulfuric acid; and nutrients
such as vitamins (e.g., vitamin A, vitamin D, vitamin E, vitamin K, vitamin B1, vitamin
B2, vitamin B6, vitamin B12, niacin, pantothenic acid, biotin, ascorbic acid), and
amino acids (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine,
glutamic acid, glycine, histidine, leucine, isoleucine, lysine, methionine, phenylalanine,
proline, serine, threonine, tryptophan, tyrosine, valine, selenocysteine). One growth
promoting agent may be used or two or more growth promoting agents may be used in
combination in the method of the present invention.
[0057] When the growth promoting agent is used, the isoprene-expressing microorganism of
the present invention may have an ability to grow depending on the growth promoting
agent and an ability to form isoprene depending on a promoter which is inversely dependent
on the growth promoting agent. An isoprene-producing microorganism can grow in the
presence of the growth promoting agent at concentration sufficient for the growth
of the isoprene-producing microorganism. Here, the "sufficient concentration" can
refer to that the growth promoting agent is used at concentration which is effective
for the growth of the isoprene-producing microorganism. The expression "ability to
produce an(the) isoprene depending on a promoter which is inversely depending on the
growth promoting agent" can mean that the isoprene cannot be produced or a producing
efficiency of the isoprene is low in the presence of the growth promoting agent at
relatively high concentration whereas the isoprene can be produced or the producing
efficiency of the isoprene is high in the presence of the growth promoting agent at
relatively low concentration or in the absence of the growth promoting agent. Therefore,
the isoprene-producing microorganism used in the present invention can grow well but
cannot produce the isoprene or exhibits low producing efficiency of the isoprene in
the presence of the growth promoting agent at sufficient concentration. The isoprene-producing
microorganism cannot grow well but can produce the isoprene and exhibits high producing
efficiency of the isoprene in the presence of the growth promoting agent at insufficient
concentration or in the absence of the growth promoting agent.
[0058] In such an isoprene-producing microorganism, a gene encoding the above-described
enzyme can be present under the control of a promoter which is inversely dependent
on the growth promoting agent. The expression "promoter which is inversely dependent
on the growth promoting agent" can mean a promoter not having at all or having low
transcription activity in the presence of the growth promoting agent at relatively
high concentration but having some or high transcription activity in the presence
of the growth promoting agent at relatively low concentration or in the absence of
the growth promoting agent. Therefore, the promoter which is inversely dependent on
the growth promoting agent can suppress the expression of the gene encoding the above-described
enzyme in the presence of the growth promoting agent at a concentration sufficient
for the growth of the isoprene-producing microorganism whereas it can promote the
expression of the gene encoding the above-described enzyme in the presence of the
growth promoting agent at the concentration insufficient for the growth of the isoprene-producing
microorganism or in the absence of the growth promoting agent. Preferably, the isoprene-producing
microorganism is a microorganism transformed with an expression vector comprising
the gene encoding the above-described enzyme under the control of the promoter which
is inversely dependent on the growth promoting agent.
[0059] For example, when the growth promoting agent is oxygen, a microaerobically inducible
promoter can be utilized. The microaerobically inducible promoter can refer to a promoter
that can promote the expression of a downstream gene under a microaerophilic condition.
In general, the saturated concentration of dissolved oxygen is 7.22 ppm (under the
air condition: 760 mmHg, 33°C, 20.9% oxygen and saturated water vapor). The microaerophilic
condition can refer to a condition where a (dissolved) oxygen concentration is 0.35
ppm or less. The (dissolved) oxygen concentration under the microaerophilic condition
may be 0.30 ppm or less, 0.25 ppm or less, 0.20 ppm or less, 0.15 ppm or less, 0.10
ppm or less, or 0.05 ppm or less. Examples of the microaerobically inducible promoter
may include a promoter of the gene encoding a D- or L-lactate dehydrogenase (e.g.,
11d, ldhA), a promoter of the gene encoding an alcohol dehydrogenase (e.g., adhE),
a promoter of the gene encoding a pyruvate formate lyase (e.g., pflB), and a promoter
of the gene encoding an α-acetolactate decarboxylase (e.g., budA).
[0060] When the growth promoting agent is a phosphorus compound, a phosphorus deficiency-inducible
promoter can be utilized. The expression "phosphorus deficiency-inducible promoter"
can refer to a promoter that can promote the expression of a downstream gene at low
concentration of phosphorus compound. The low concentration of phosphorus compound
can refer to a condition where a (free) phosphorus concentration is 100 mg/L or less.
The expression "phosphorus" is synonymous to the expression "phosphorus compound",
and they can be used in exchangeable manner. The (free) phosphorus concentration under
a phosphorus deficient condition may be 50 mg/L or less, 10 mg/L or less, 5 mg/L or
less, 1 mg/L or less, 0.1 mg/L or less, or 0.01 mg/L or less. Examples of the phosphorus
deficiency-inducible promoter may include a promoter of the gene encoding alkali phosphatase
(e.g., phoA), a promoter of the gene encoding an acid phosphatase (e.g., phoC), a
promoter of the gene encoding a sensor histidine kinase (phoR), a promoter of the
gene encoding a response regulator (e.g., phoB), and a promoter of the gene encoding
a phosphorus uptake carrier (e.g., pstS).
[0061] When the growth promoting agent is an amino acid, an amino acid deficiency-inducible
promoter can be utilized. The amino acid deficiency-inducible promoter can refer to
a promoter that can promote the expression of a downstream gene at low concentration
of an amino acid. The low concentration of the amino acid can refer to a condition
where a concentration of a (free) amino acid or a salt thereof is 100 mg/L or less.
The concentration of the (free) amino acid or a salt thereof under the amino acid
deficient condition may be 50 mg/L or less, 10 mg/L or less, 5 mg/L or less, 1 mg/L
or less, 0.1 mg or less or 0.01 mg/L or less. Examples of the amino acid deficiency-inducible
promoter may include a promoter of the gene encoding a tryptophan leader peptide (e.g.,
trpL) and a promoter of the gene encoding an N-acetylglutamate synthase (e.g., ArgA).
<Method of producing isoprene monomer and isoprene polymer>
[0062] The present invention provides a method of producing an isoprene monomer. The method
of producing an isoprene monomer of the present invention includes culturing an isoprene
synthase-expressing microorganism in a culture medium so as to form an isoprene monomer.
[0063] The method of producing the isoprene monomer of the present invention can be performed
by culturing the isoprene synthase-expressing microorganism of the present invention.
Dimethylallyl diphosphate that is a raw material of the isoprene monomer is efficiently
supplied from a carbon source in a culture medium by the isoprene synthase-expressing
microorganism of the present invention. The isoprene synthase-expressing microorganism
of the present invention produces the isoprene monomer mainly as an outgas from the
carbon source in the culture medium. Thus, the isoprene monomer is recovered by collecting
gas produced from the transformant. Dimethylallyl diphosphate that is the substrate
of the isoprene synthase is synthesized from the carbon source in the culture medium
via the mevalonate pathway or the methylerythritol phosphate pathway in the host cells.
[0064] The culture medium for culturing the isoprene synthase-expressing microorganism of
the present invention preferably contains the carbon source to be converted into isoprene.
The carbon source may include carbohydrates such as monosaccharides, disaccharides,
oligosaccharides and polysaccharides; invert sugars obtained by hydrolyzing sucrose;
glycerol; compounds having one carbon atom (hereinafter referred to as a C1 compound)
such as methanol, formaldehyde, formate, carbon monoxide and carbon dioxide; oils
such as corn oil, palm oil and soybean oil; acetate; animal fats; animal oils; fatty
acids such as saturated fatty acids and unsaturated fatty acids; lipids; phospholipids;
glycerolipids; glycerine fatty acid esters such as monoglyceride, diglyceride and
triglyceride; polypeptides such as microbial proteins and plant proteins; renewable
carbon sources such as hydrolyzed biomass carbon sources; yeast extracts, or combinations
thereof. For a nitrogen source, inorganic ammonium salts such as ammonium sulfate,
ammonium chloride and ammonium phosphate, organic nitrogen such as hydrolyzed soybeans,
ammonia gas, ammonia water, and the like can be used. It is desirable to include required
substances such as vitamin B1 and L-homoserine, or yeast extract and the like in an
appropriate amount as an organic trace nutrient source. In addition thereto, potassium
phosphate, magnesium sulfate, iron ion, manganese ion, and the like may be added in
small amounts if necessary. The culture medium used in the present invention may be
a natural medium or a synthesized medium as long as the culture medium contains a
carbon source, a nitrogen source, inorganic ions, and optionally other organic trace
ingredients.
[0065] Examples of the monosaccharides may include triose such as ketotriose (dihydroxyacetone)
and aldotriose (glyceraldehyde); tetrose such as ketotetrose (erythrulose) and aldotetrose
(erythrose, threose); pentose such as ketopentose (ribulose, xylulose), aldopentose
(ribose, arabinose, xylose, lyxose) and deoxysaccharide (deoxyribose); hexose such
as ketohexose (psychose, fructose, sorbose, tagatose), aldohexose (allose, altrose,
glucose, mannose, gulose, idose, galactose, tallose), and deoxysaccharide (fucose,
fucrose, rhamnose); and heptose such as sedoheptulose. C6 sugars such as fructose,
mannose, galactose and glucose; and C5 sugars such as xylose and arabinose are preferable.
[0066] Examples of the disaccharides may include sucrose, lactose, maltose, trehalose, turanose,
and cellobiose. Sucrose and lactose are preferable.
[0067] Examples of the oligosaccharides may include trisaccharides such as raffinose, melezitose
and maltotriose; tetrasaccharides such as acarbose and stachyose; and other oligosaccharides
such as fructooligosaccharide (FOS), galactooligosaccharide (GOS) and mannan-oligosaccharide
(MOS).
[0068] Examples of the polysaccharides may include glycogen, starch (amylose, amylopectin),
cellulose, dextrin, and glucan (β1,3-glucan). Starch and cellulose are preferable.
[0069] Examples of the microbial protein may include polypeptides obtainable from a yeast
or bacterium.
[0070] Examples of the plant protein may include polypeptides obtainable from soybean, corn,
canola, Jatropha, palm, peanut, sunflower, coconut, mustard, cotton seed, palm kernel
oil, olive, safflower, sesame and linseed.
[0071] Examples of the lipid may include substances containing one or more saturated or
unsaturated fatty acids of C4 or more.
[0072] The oil is preferably the lipid that contains one or more saturated or unsaturated
fatty acids of C4 or more and is liquid at room temperature, and examples of the oil
may include lipids obtainable from soybean, corn, canola, Jatropha, palm, peanut,
sunflower, coconut, mustard, cotton seed, Palm kernel oil, olive, safflower, sesame,
linseed, oily microbial cells, Chinese tallow tree, and a combination of two or more
thereof.
[0073] Examples of the fatty acid may include compounds represented by a formula RCOOH ("R"
represents a hydrocarbon group).
[0074] The unsaturated fatty acid is a compound having at least one double bond between
two carbon atoms in "R", and examples of the unsaturated fatty acid may include oleic
acid, vaccenic acid, linoleic acid, palmitelaidic acid and arachidonic acid.
[0075] The saturated fatty acid is a compound where the "R" is a saturated aliphatic group,
and examples of the saturated fatty acid may include docosanoic acid, eicosanoic acid,
octadecanoic acid, hexadecanoic acid, tetradecanoic acid, and dodecanoic acid.
[0076] Among them, those containing one or more C2 to C22 fatty acids are preferable as
the fatty acid, and those containing C12 fatty acid, C14 fatty acid, C16 fatty acid,
C18 fatty acid, C20 fatty acid and C22 fatty acid are more preferable.
[0077] The carbon source may include salts and derivatives of these fatty acids and salts
of these derivatives. Examples of the salt may include lithium salts, potassium salts
and sodium salts.
[0078] Examples of the carbon source may also include combinations of carbohydrate such
as glucose with the lipid(s), the oil(s), the fats, the fatty acid(s) and glycerin
fatty acid(s) ester(s).
[0079] Examples of the renewable carbon source may include hydrolyzed biomass carbon sources.
[0080] Examples of the biomass carbon source may include cellulose-based substrates such
as waste materials of woods, papers and pulps, leafy plants, and fruit pulps; and
partial plants such as stalks, grain particles, roots and tubers.
[0081] Examples of the plants to be used as the biomass carbon source may include corn,
wheat, rye, sorghum, triticale, rice, millet, barley, cassava, legumes such as peas,
potato, sweet potato, banana, sugar cane and tapioca.
[0082] When the renewable carbon source such as biomass is added to the culture medium,
the carbon source is preferably pretreated. Examples of the pretreatment may include
an enzymatic pretreatment, a chemical pretreatment, and a combination of the enzymatic
pretreatment and the chemical pretreatment.
[0083] It is preferred that the renewable carbon source is entirely or partially hydrolyzed
before being added to the culture medium.
[0084] Examples of the carbon source may also include the yeast extract and a combination
of the yeast extract with the other carbon source such as glucose. The combination
of the yeast extract with the C1 compound such as carbon dioxide and methanol is preferable.
[0085] In the method of culturing the transformant according to the present invention, it
is preferable the cell is cultured in a standard medium containing saline and nutrients.
[0086] The culture medium is not particularly limited, and examples of the culture medium
may include ready-made general media that are commercially available such as Luria
Bertani (LB) broth, Sabouraud dextrose (SD) broth, and yeast medium (YM) broth. The
medium suitable for the cultivation of the specific host can be selected appropriately
for the use.
[0087] It is desirable to include appropriate minerals, salts, supplemental elements, buffers,
and ingredients known for those skilled in the art to be suitable for the cultivation
and to facilitate the production of isoprene in addition to the appropriate carbon
source in the cell medium.
[0088] A culture condition for the isoprene synthase-expressing microorganism of the present
invention is not particularly limited as long as the isoprene formation ability by
the isoprene synthase-expressing microorganism can be improved as a result of enhancement
in the expression of the pyrophosphate phosphatase, and a standard cell culture condition
can be used.
[0089] A culture temperature is preferably 20 to 37°C, a gas composition is preferably about
6 to about 84% of CO
2 concentration, and a pH value is preferably about 5 to about 9.
[0090] It is preferable that the culturing is performed under an aerobic, oxygen-free, or
anaerobic condition depending on a nature of the host cell.
[0091] Examples of methods of culturing the transformant include a method using a known
fermentation method such as a batch cultivation method, a feeding cultivation method
or a continuous cultivation method.
[0092] In the batch cultivation method, a medium composition is added at start of the fermentation,
the host cell is inoculated in the medium composition and the transformant is cultured
while pH and an oxygen concentration are controlled.
[0093] In the cultivation of the transformant by the batch cultivation method, the growth
of the transformant starts from a mild induction phase, passes through a logarithmic
growth phase and finally goes to a stationary phase in which a growth speed is reduced
or stopped. Isoprene is produced by the transformant in the logarithmic growth phase
and the stationary phase.
[0094] In the feeding cultivation method, in addition to the above batch method, the carbon
source is gradually added according to the progress of a fermentation process. The
feeding cultivation method is effective when an amount of the carbon source is to
be restricted in the medium because metabolism of the transformant tends to be reduced
due to catabolite suppression. The feed cultivation can be performed using a restricted
amount or an excessive amount of the carbon source such as glucose.
[0095] In the continuous cultivation method, a certain amount of the medium is continuously
supplied to a bioreactor at a constant rate while the same amount of the medium is
removed. In the continuous cultivation method, the culture can be kept constantly
at high concentration and the transformant in the culture medium is generally in the
logarithmic growth phase.
[0096] The nutrition can be supplemented by entirely or partly exchanging the medium appropriately,
and accumulation of metabolic byproducts that potentially have adverse effects on
the growth of the transformant, and the accumulation of dead cells can be prevented.
[0097] Examples of the promoter possessed by the expression vector to be introduced into
the isoprene synthase-expressing microorganism of the present invention may include
the promoters as described above. When the expression vector to be introduced into
the isoprene synthase-expressing microorganism of the present invention has the inducible
promoter such as a lac promoter, the expression of protein may be induced by, for
example, adding IPTG (isopropyl-β-thiogalactopyranoside) into the culture medium.
[0098] Examples of the method of evaluating an amount of isoprene monomer produced by culturing
the isoprene synthase-expressing microorganism of the present invention may include
a method in which a gas phase is collected by a headspace method and this gas phase
is analyzed by gas chromatography.
[0099] In detail, the isoprene monomer in a headspace which is obtained by culturing the
transformant in a sealed vial with shaking the culture medium is analyzed by standard
gas chromatography. Then, an area calculated by a curve measured by gas chromatography
is converted into the amount of the isoprene monomer produced with the transformant
using a standard curve.
[0100] Examples of the method of collecting the isoprene monomer obtained by culturing the
isoprene synthase-expressing microorganism of the present invention may include gas
stripping, fractional distillation, or dissociation of the isoprene monomer adsorbed
to a solid phase by heat or vacuum, or extraction with a solvent.
[0101] In the gas stripping, isoprene gas is continuously removed from the outgas. Such
removal of the isoprene gas can be performed by various methods. Examples of the removal
may include adsorption to the solid phase, separation into a liquid phase, and a method
in which the isoprene gas is directly condensed.
[0102] The isoprene monomer can be collected by a single step or multiple steps. When the
isoprene monomer is collected by the single step, the isoprene monomer is converted
into the liquid phase simultaneously with separating the isoprene monomer from the
outgas. The isoprene monomer can also be directly condensed from the outgas to make
the liquid phase. When the isoprene monomer is collected by the multiple stages, the
isoprene monomer is separated from off-gas and subsequently converted into the liquid
phase. For example, the isoprene monomer is adsorbed to the solid phase, and extracted
from the solid phase with the solvent.
[0103] Exemplary methods of collecting the isoprene monomer may comprise further purifying
the isoprene monomer. Examples of the purification may include separation from a liquid
phase extract by distillation and various chromatographic methods.
[0104] The present invention provides further a method of producing an isoprene polymer.
The method of producing the isoprene polymer according to the present invention comprises
the following (I) and (II):
- (I) producing an isoprene monomer by the method of the present invention; and
- (II) polymerizing the isoprene monomer to form an isoprene polymer.
[0105] The step (I) can be performed in the same manner as in the method of producing the
isoprene monomer according to the present invention described above. The polymerization
of the isoprene monomer in the step (II) can be performed by any method such as addition
polymerization known in the art (e.g., synthesis methods in organic chemistry).
[0106] The rubber composition of the present invention comprises a polymer derived from
isoprene produced by a method for producing isoprene according to the present invention.
The polymer derived from isoprene may be a homopolymer (i.e., isoprene polymer) or
a heteropolymer comprising isoprene and one or more monomer units other than the isoprene
(e.g., a copolymer such as a block copolymer). Preferably, the polymer derived from
isoprene is a homopolymer (i.e., isoprene polymer) produced by a method for producing
isoprene polymer according to the present invention. The rubber composition of the
present invention may further comprise one or more polymers other than the above polymer,
one or more rubber components, and/or other components. The rubber composition of
the present invention can be manufactured using a polymer derived from isoprene. For
example, the rubber composition of the present invention can be prepared by mixing
a polymer derived from isoprene with one or more polymers other than the above polymer,
one or more rubber components, and/or other components such as a reinforcing filler,
a crosslinking agent, a vulcanization accelerator and an antioxidant.
[0107] The tire of the present invention is manufactured using the rubber composition of
the present invention. The rubber composition of the present invention may be applied
to any portion of the tire without limitation, which may be selected as appropriate
depending on the application thereof. For example, the rubber composition of the present
invention may be used in a tread, a base tread, a sidewall, a side reinforcing rubber
and a bead filler of a tire. The tire can be manufactured by a conventional method.
For example, a carcass layer, a belt layer, a tread layer, which are composed of unvulcanized
rubber, and other members used for the production of usual tires may be successively
laminated on a tire molding drum, then the drum may be withdrawn to obtain a green
tire. Thereafter, the green tire may be heated and vulcanized in accordance with an
ordinary method, to thereby obtain a desired tire (e.g., a pneumatic tire).
EXAMPLES
[0108] Subsequently, the present invention will be described in more detail with reference
to Examples, but the present invention is not limited to the following Examples.
Example 1: Enhancement of ppa gene expression in MG1655 Ptac-KKDyI strain
[0109] A strain in which a promoter inherent to an endogenous ppa gene (pyrophosphate phosphatase
gene) was substituted with another strong promoter to augment the expression of the
endogenous ppa gene in
E. coli strain was made by the following procedure.
[0110] First, competent cells of MG1655 Ptac-KKDyI strain (see Reference Example 7-4. This
strain is a transformant of
E. coli) for electroporation were prepared as follows. Cells of MG1655 Ptac-KKDyI strain
were cultured with shaking in 5 mL of LB medium at 37°C overnight. Subsequently, 50
µL of the resulting cultured medium was inoculated to new 5 mL LB medium and cultured
with shaking at 37°C until absorbance at OD600 became around 0.6. Then, the microbial
cells were collected, washed three times with ice-cooled 10% glycerol, and finally
suspended in 0.5 mL of 10% glycerol to use as the competent cells.
[0111] Next, pKD46 was introduced into the competent cells of MG1655 Ptac-KKDyI strain
by electroporation. The electroporation was carried out under the condition of an
electric field intensity of 18 kV/cm, a condenser volume of 25 µF, and a resistance
value of 200 Ω using GENE PULSER II (supplied from BioRad). Subsequently, 1 mL of
SOC medium (20 g/L of bacto tryptone, 5 g/L of yeast extract, 0.5 g/L of NaCl, 10
g/L of glucose) was added to the microbial cells having pKD46 introduced by the electroporation,
the cells were cultured with shaking at 30°C for 2 hours, and then applied onto LB
agar medium containing 100 mg/L of ampicillin. After culturing at 30°C overnight,
a grown colony was refined on the same agar medium to obtain a strain MG1655 Ptac-KKDI/pKD46.
[0112] Competent cells of the obtained strain MG1655 Ptac-KKDI/pKD46 for the electroporation
were prepared as follows. Cells of the strain MG1655 Ptac-KKDI/pKD46 were cultured
with shaking in 5 mL of LB medium containing 100 mg/L of ampicillin at 30°C overnight.
Subsequently, 50 µL of the resulting cultured medium was inoculated to 5 mL of LB
medium containing 100 mg/L of ampicillin, and the cells were cultured with shaking
at 30°C until absorbance at OD600 became around 0.6. Subsequently the microbial cells
were collected, washed three times with ice-cooled 10% glycerol, and then finally
suspended in 0.3 mL of 10% glycerol to use as the competent cells.
[0113] Next, a gene fragment for substituting a promoter region of the ppa gene on the chromosome
was prepared. A nucleotide sequence of the ppa gene and its promoter region are available
from existing database (NCBI Reference Sequences NC_000913.2, ppa gene locus tag:
b4225, Range: 4447145..4447675, complement). Substitution of the promoter region of
the ppa gene was carried out by a λ-red method. A genomic fragment having λattL-Tet-λattR-Ptac
was used as a template for PCR. This includes a tac promoter (Ptac), a tetracycline
resistant drug marker (Tet) and λattL and λattR that are attachment sites of λ phage.
These nucleotide sequences are shown in SEQ ID NO:1. A PCR was carried out using primers
consisting of the nucleotide sequences of SEQ ID NO:2 and SEQ ID NO:3. LA-Taq polymerase
sold by TaKaRa Bio was utilized as DNA polymerase, and the reaction was carried out
under a condition of 92°C for one minute, 40 cycles (92°C for 10 seconds, 54°C for
20 seconds and 72°C for 2 minutes) and 72°C for 5 minutes. A gene fragment where sequences
of upstream 60 bp and downstream 60 bp of the promoter region of the ppa gene had
been added to each outer side of λattL-Tet-λattR-Ptac, respectively was amplified
by PCR above. This gene fragment was purified using Wizard PCR Prep DNA Purification
System (supplied from Promega). Hereinafter, the resulting gene fragment was designated
as Tet-Ptac-ppa.
[0114] Next, Tet-Ptac-ppa was introduced into the competent cells of the strain MG1655 Ptac-KKDYI/pKD46
by the electroporation. The electroporation was carried out under the condition of
the electric field intensity of 18 kV/cm, the condenser volume of 25 µF, and the resistance
value of 200 Ω using GENE PULSER II (supplied from BioRad). Subsequently, 1 mL of
SOC medium was added to the competent cells, which were then cultured with shaking
at 30°C for 2 hours, and then applied onto LB agar medium containing 25 mg/L of tetracycline.
After culturing at 37°C overnight, a grown colony was refined using the same agar
medium. Subsequently, colony PCR was carried out using primers consisting of the nucleotide
sequences of SEQ ID NO:4 and SEQ ID NO:5 to confirm that the promoter region of the
ppa gene was substituted with the tac promoter. The strain where the promoter region
of the ppa gene had been substituted with the tac promoter was designated as a strain
MG1655 Ptac-KKDyI Ptac-ppa.
Example 2: Analysis of PPA expression in MG1655 Ptac-KKDyI Ptac-ppa strain
[0115] An expression amount of a protein of the pyrophosphate phosphatase (PPA) in MG1655
Ptac-KKDyI Ptac-ppa strain was confirmed by SDS-PAGE. Cells of MG1655 Ptac-KKDyI strain
and MG1655 Ptac-KKDyI Ptac-ppa strain were cultured with shaking in 5 mL of LB medium
at 37°C overnight. The microbial cells after being collected were washed three times
with ice-cooled 50 mM Tris buffer (Tris-HCl, pH 8.0), and disrupted using a sonicator
(Bio-ruptor: ON for 30 seconds and OFF for 30 seconds for 20 minutes). The disrupted
cell solution was centrifuged at 15,000 rpm for 10 minutes to remove cell debris.
The resulting supernatant fraction was used as a soluble protein fraction. The soluble
protein fraction was quantified by Bradford method, and 5 µg of the soluble protein
was electrophoresed on SDS-PAGE (NuPAGE: SDS-PAGE Gel System supplied from Invitrogen).
Subsequently, CBB staining and decoloration were carried out according to standard
methods. A photograph of a gel showing bands around a PPA protein mass was shown in
FIG. 1. As a result, increase of the expression amount of a protein presumed to be
PPA was confirmed in MG1655 Ptac-KKDyI Ptac-ppa strain (FIG. 1). The expression amount
of the protein presumed to be PPA in MG1655 Ptac-KKDyI Ptac-ppa strain was estimated
to be about 2 to 5 folds larger than that of the original bacterial strain (control)
from density of the bands on SDS-PAGE after the electrophoresis.
Example 3: Construction of MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK/pMW-Para-mvaES
strain
[0116] Competent cells of MG1655 Ptac-KKDyI Ptac-ppa strain for electroporation were prepared
as follows. Cells of MG1655 Ptac-KKDyI Ptac-ppa strain were cultured with shaking
in 5 mL of LB medium at 37°C overnight. Subsequently, 50 µL of the resulting cultured
medium was inoculated to new 5 mL LB medium and cultured with shaking at 37°C until
absorbance at OD600 became around 0.6. Then, the microbial cells were collected, washed
three times with ice-cooled 10% glycerol, and finally suspended in 0.5 mL of 10% glycerol
to use as the competent cells.
[0117] An isoprene synthase-expressing plasmid derived from kudzu, pSTV28-Ptac-ispSK (see
Reference Example 3-5) was introduced into the competent cells of MG1655 Ptac-KKDyI
Ptac-ppa strain by the electroporation under the above condition. Subsequently, 1
mL of SOC medium was added to the competent cells, which were then cultured at 30°C
for 2 hours, and then applied onto LB agar medium containing 60 mg/mL of chloramphenicol.
After culturing at 37°C overnight, a grown colony was refined in the same agar medium
to obtain MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK strain having introduced pSTV28-Ptac-ispSK.
[0118] Subsequently, pMW-Para-mvaES-Ttrp (see Reference Example 7-3) was introduced into
MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK strain. As with above, competent cells
of MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK strain were prepared, and then pMW-Para-mvaES-Ttrp
was introduced by the electroporation under the above condition. Subsequently, 1 mL
of SOC medium was added to the competent cells, which were then cultured with shaking
at 30°C for 2 hours, and then applied onto LB agar medium containing 60 mg/mL of chloramphenicol
and 100 mg/L of kanamycin. After culturing at 37°C overnight, a grown colony was refined
in the same agar medium to obtain MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK/pMW-Para-mvaES-Ttrp
strain having introduced pMW-Para-mvaES-Ttrp. Hereinafter, MG1655 Ptac-KKDyI Ptac-ppa/pSTV28-Ptac-ispSK/pMW-Para-mvaES-Ttrp
strain where the expression of the ppa gene was enhanced is described as a ppa expression-enhanced
strain.
Example 4: Evaluation of jar cultivation of ppa expression-enhanced strain
[0119] Jar cultivation of the ppa expression-enhanced strain and a control strain (MG1655
Ptac-KKDyI/pSTV28-Ptac-ispSK/pMW-Para-mvaES-Ttrp) was evaluated. Cells were applied
onto the LB agar medium containing 60 mg/mL of chloramphenicol and 100 mg/L of kanamycin,
and cultured at 34°C for 16 hours. Subsequently, 0.3 L of glucose medium described
in Table 1 was placed in a 1 L volume fermenter, and the microbial cells sufficiently
grown on one plate were inoculated thereto and cultured. A culture condition was pH
7.0 (controlled with ammonia gas), 30°C, ventilation of 150 mL/minute, and stirring
such that an oxygen concentration in the medium was 5% or higher. After absorbance
at OD600 reached around 20, L-arabinose at final concentration of 20 mM was added
to the medium, and the cultivation was carried out for 45 hours. During the cultivation,
a glucose solution prepared at 500 g/L was appropriately added such that a glucose
concentration in the medium was kept at 10 g/L or higher. Evolved gas was collected
in a 1 L gas bag with time, and a concentration of isoprene gas contained in the evolved
gas was measured. An analysis condition for the isoprene gas was described below.
An analysis condition for gas chromatography is the same as described in Reference
Example 4-3.
Table 1. Composition of glucose medium
| Group A |
Final concentration |
| Glucose |
80 g/L |
| MgSO4.7aq |
2.0 g/L |
| |
|
| Group B |
|
| (NH4) 2SO4 |
2.0 g/L |
| KH2PO4 |
2.0 g/L |
| FeSO4.7aq |
20 mg/L |
| MnSO4.5aq |
20 mg/L |
| Yeast Extract |
4.0 g/L |
[0120] After preparing 0.15 L of Group A and 0.15 L of Group B, they were heated and sterilized
at 115°C for 10 minutes. After cooling, Group A and Group B were mixed, and 60 mg/mL
of chloramphenicol and 100 mg/L of kanamycin were added thereto to use as the medium.
[0121] An amount of isoprene per jar (mg/B) and a glucose consumption rate (%) after the
cultivation for 45 hours in the control strain and the ppa expression-enhanced strain
were described in Table 2. Both the amount of isoprene produced per jar (mg/B) and
the glucose consumption rate (%) could be confirmed to be higher in the ppa expression-enhanced
strain than in the control strain.
Table 2
| Strain name |
Amount of isoprene produced per jar (mg/B) |
Glucose consumption rate (%) |
| Control strain |
436 |
2.87 |
| ppa Expression-enhanced strain |
657 |
4.59 |
Reference Example 1: Evaluation of ability to produce isoprene in plants
1-1) Measurement of amount of isoprene formed per unit weight of dry leaves
[0122] First, an amount of isoprene formed per 1 g of dry leaves in the plant was measured
for evaluating an ability to produce isoprene in plants. Mucuna (
Mucuna bracteata), Weeping willow (
Salix babylonica), American sweetgum (
Liquidambar styraciflua), Myrtle (
Myrtus communis), and Kudzu (
Pueraria lobata) were used as the plants.
[0123] In the measurement of an amount of formed isoprene, a gas replaceable desiccator
(trade name: Vacuum Desiccator, manufactured by AS ONE Corporation) was housed in
an incubator (trade name: Growth Chamber MLR-351H, manufactured by SANYO), and the
incubator was set to a high temperature induction condition (an illuminance of 100
µmol E/m
2/s at 40°C) while a fan for stirring the gas, which was provided in the gas replaceable
desiccator, was driven to stir an atmosphere in space in the gas replaceable desiccator.
After the temperature of the atmosphere in the gas replaceable desiccator reached
40°C, a plant body of Mucuna planted in a planter was housed therein and kept for
3 hours in a state where the gas replaceable desiccator was sealed. Then, a gas component
released from Mucuna was aspirated from the space in the gas replaceable desiccator
by an aspiration pump through a silicon tube, an adsorption tube and a gas collection
tube. Thereby, water vapor (water content) contained in the gas component released
from Mucuna was adsorbed and separated in the adsorption tube, the gas component from
which the water vapor had been separated was led to the gas collection tube, and the
gas component was collected in the gas collection tube. Subsequently, isoprene contained
in the gas component collected in the gas collection tube was quantitatively analyzed
using gas chromatograph (trade name: GC-FID6890, manufactured by Agilent).
[0124] For the weight of dry leaves, a leaf area of a fresh individual leaf, and a dry weight
when the fresh individual leaf is dried by a dryer at 80°C for 8 hours establish a
very good positive correlation. Thus, a formula for converting from the leaf area
to the dry weight was derived, and the dry weight was estimated from the entire leaf
area from the plant body of Mucuna used for the measurement of an amount of formed
isoprene.
[0125] The amount of formed isoprene per 1 g of the dry leaf was obtained by dividing the
amount of formed isoprene from the entire plant body of Mucuna by the estimated weight
of the entire plant body.
[0126] As a result, it was demonstrated that Mucuna was excellent in amount of formed isoprene
per unit weight of the dry leaf (FIG. 2).
1-2) Measurement of amount of formed isoprene per amount of total protein
[0127] Then, the amount of formed isoprene per amount of total protein extracted from leaves
of various plants was measured. Mucuna (samples 1 and 2), Weeping willow, American
sweetgum, Myrtle, and Kudzu were used as the plants.
[0128] For extraction of the protein, a buffer solution (50 mM Tris-HCl, 20 mM MgCl, 5%
glycerol, 0.02% Triton-X100, pH 8.0) was made, and 10% Polyclar AT, 20 mM DTT, protease
complete tablet (one tablet/50 mL), and 1 mM benzamidine HCl (final concentrations,
each) were added just before the use, and was used as a protein extraction buffer.
50 mL of the protein extraction buffer was added to 5 g of the sample, then the mixture
was ground well in a cold mortar on ice and filtrated though doubly overlapped Miracloth.
A filtrate was centrifuged at 12,000 G for 20 minutes and 40,000 G for 40 minutes
to obtain a supernatant, and the supernatant was used as a crude extract.
[0129] Subsequently, this crude extract was fractionated with ammonium sulfate. Proteins
precipitated in a range of 40% to 55% of final concentrations of ammonium sulfate
were centrifuged at 40,000 G for 40 minutes, and an obtained pellet was re-dissolved
in the protein extraction buffer to obtain an ammonium sulfate fraction.
[0130] A total (ammonium sulfate fraction) protein mass was calculated by measuring the
ammonium sulfate fraction using Bradford assay. A Bradford reagent was reacted with
the standard protein, bovine serum albumin, and absorbance at a wavelength of 595
nm was measured using a spectrophotometer. A standard curve for the protein was made
using the obtained absorbance values. The absorbance at a wavelength of 595 nm was
also measured in the ammonium sulfate fraction diluted to 50 times, and the amount
of the total (ammonium sulfate fraction) protein was estimated from the standard curve
for the standard protein.
[0131] In the measurement of the amount of formed isoprene, 100 µL of the crude extract
or 100 µL of a crude enzyme solution boiled at 100°C was placed in a 4 mL glass vial,
and then 2 µL of a 0.5 M MgCl
2 solution and 5 µL of a 0.2 M DMAPP solution were added thereto. The vial was tightly
closed with a screw cap with a septum, and then the vial was gently vortexed and set
in an incubator at 40°C. After 0.5, 1 and 2 hours, 0.5 to 2 mL of a gas layer in a
headspace was sampled by a gas-tight syringe, and the amount of formed isoprene was
measured using gas chromatograph (trade name: GC-FID6890, manufactured by Agilent).
The amount of formed isoprene using the crude enzyme after 0.5, 1 and 2 hours was
calculated by subtracting a measured value in the case of using the crude enzyme solution
boiled at 100°C from a measured value in the case of using the crude enzyme. An enzymatic
activity per 1 mg of the total protein (specific activity) was calculated from the
amount of the formed isoprene per one hour. The amount of formed isoprene was measured
with keeping the amount of DMAPP that was the substrate of the isoprene synthase constant.
[0132] As a result, it was demonstrated that Mucuna was excellent in amount of formed isoprene
per amount of total protein (FIG. 3, Table 3). As described above, it was shown that
Mucuna was excellent in ability to produce isoprene.
Table 3. Amount of formed isoprene per amount of total protein (index numbers relative
to case of Kudzu)
| |
0 hour* |
0.5 hour* |
1 hour* |
2 hours* |
Specific activity index (Value from Kudzu was set to 1) |
| Mucuna 1 |
0 |
16.947 |
61.895 |
160.632 |
16.87842808 |
| Mucuna 2 |
0 |
0 |
183.587 |
449.514 |
47.23274141 |
| American sweetgum |
0 |
0 |
22.063 |
46.132 |
4.847325838 |
| Weeping willow |
0 |
0 |
9.756 |
24.39 |
2.562782389 |
| Myrtle |
0 |
0 |
0 |
27.451 |
2.884417358 |
| Kudzu |
0 |
0 |
6.662 |
9.517 |
1 |
| *Unit is pg isoprene/mg protein |
Reference Example 2: Cloning of isoprene synthase gene derived from Mucuna
2-1) Evaluation of sampling time
[0133] Isoprene gas released from leaves of Mucuna illuminated with light for 1, 2, 3 and
5 hours at temperature of 40°C was sampled and the amount of produced isoprene was
quantified by gas chromatography described later, and production of 4, 8, 12 and 10
µg of isoprene/g DW leaf was confirmed. Thus, it was confirmed that an optimal light
illumination time was 3 hours.
2-2) Extraction of total RNA lysis solution
[0134] A total RNA was extracted from leaves of Mucuna with total RNA lysis solution according
to the following procedures.
- (1) The leaves of Mucuna illuminated with light for 3 hours at temperature of 40°C
were sampled.
- (2) 100 mg of leaf tissue was pulverized in a mortar with rapidly freezing the leaf
tissue with liquid nitrogen, then the leaf tissue together with the liquid nitrogen
was dispensed in an RNA-free 2 mL Eppendorf tube, and the liquid nitrogen was gasified.
- (3) To this Eppendorf tube, 450 µL of a dissolution buffer RLT (containing 2-mercaptoethanol)
attached to RNeasy Plant Kit (manufactured by Qiagen), and mixed vigorously with Vortex
to obtain a leaf tissue lysate.
- (4) This leaf tissue lysate was applied to QIAshredder spin column attached to RNeasy
Plant Kit, and centrifuged at 15,000 rpm for 2 minutes.
- (5) A supernatant alone of a column eluate was transferred to a new RNA-free 2 mL
Eppendorf tube, then special grade ethanol in a half volume of the supernatant was
added to the supernatant, and the obtained solution was mixed by pipetting to obtain
about 650 µL of a solution.
- (6) This solution was applied to RNeasy spin column attached to RNeasy Plant Kit,
centrifuged at 10,000 rpm for 15 seconds, and a filtrate was discarded.
- (7) 700 µL of RW1 buffer attached to RNeasy Plant Kit was added to this RNeasy spin
column, centrifuged at 10,000 rpm for 15 seconds, and a filtrate was discarded.
- (8) 500 µL of BPE buffer attached to RNeasy Plant Kit was added to this RNeasy spin
column, centrifuged at 10,000 rpm for 15 seconds, and a filtrate was discarded.
- (9) 500 µL of BPE buffer was again added to this RNeasy spin column, centrifuged at
10,000 rpm for 2 minutes, and a filtrate was discarded.
- (10) This RNeasy spin column was set to a 2 mL collective tube attached to RNeasy
Plant Kit, centrifuged at 15,000 rpm for one minute, and a filtrate was discarded.
- (11) This RNeasy spin column was set to a 1.5 mL collective tube attached to RNeasy
Plant Kit.
- (12) RNA-free distilled water attached to RNeasy Plant Kit was directly added to a
membrane of this RNeasy spin column using a Pipetman, centrifuged at 10,000 rpm for
one minute, and total RNA was collected. This step was repeated twice to obtain about
100 µg of total RNA.
2-3) Analysis of nucleotide sequence of isoprene synthase gene derived from Mucuna
[0135] Quality of RNA in the extracted total RNA solution was checked using nano-chips for
RNA provided by BioAnalyzer (Agilent Technologies, Inc.), and it was confirmed that
the solution was not contaminated with genomic DNA and RNA was not decomposed in the
solution.
[0136] This total RNA was converted into a double strand using reverse transcriptase, and
then fragmented using a nebulizer. Nucleotide sequences of 198,179 fragments having
a poly A sequence at a 3' end were analyzed using 454 titanium FLX high performance
sequencer (manufactured by Roche Applied Science). Overlapped sequences in the obtained
fragment sequences were aligned to obtain 13,485 contig sequences. BLAST search was
performed for these contig sequences, and 6 contig sequences having the homology (identity
of nucleotide sequences) to registered and known isoprene synthase gene sequences
from Kudzu and Poplar were extracted. These sequences were further analyzed in detail,
and 3 sequences in these 6 contig sequences were found to be derived from the same
gene. Thus, a partial sequence of the isoprene synthase gene derived from Mucuna was
obtained. 5' RACE was performed based on this partial sequence to obtain a full length
nucleotide sequence of the isoprene synthase cDNA derived from Mucuna, which was represented
by SEQ ID NO:6.
Reference Example 3: Preparation of expression plasmid for isoprene synthase derived
from various plants 3-1) Chemical synthesis of isoprene synthase derived from Pueraria montana var. lobata (Kudzu)
[0137] The nucleotide sequence and the amino acid sequence of the isoprene synthase cDNA
derived from
Pueraria montana var. lobata were already known (ACCESSION: AAQ84170: P.
montana var. lobata isoprene synthase (IspS)). The amino acid sequence of the IspS protein derived from
P. montana and the nucleotide sequence of its cDNA are represented by SEQ ID NO:8 and SEQ ID
NO:9, respectively. The IspS gene was optimized for codon usage frequency in
E. coli in order to efficiently express the IspS gene in
E. coli, and further designed to cut off the chloroplast localization signal. The designed
gene was designated as IspSK. A nucleotide sequence of IspSK is represented by SEQ
ID NO:10. The IspSK gene was chemically synthesized, then cloned into pUC57 (manufactured
by GenScript), and the resulting plasmid was designated as pUC5-IspSK.
3-2) Chemical synthesis of isoprene synthase derived from Populus alba x Populus tremula (Poplar)
[0138] The nucleotide sequence of the isoprene synthase cDNA and the amino acid sequence
of the isoprene synthase derived from
P.
alba x P.
tremula were already known (ACCESSION: CAC35696:
P. alba x P. tremula (Poplar) isoprene synthase). The amino acid sequence of the IspS protein derived
from
P.
alba x P. tremula and the nucleotide sequence of its cDNA are represented by SEQ ID NO:11 and SEQ ID
NO:12, respectively. An IspS gene that was optimized for the codon usage frequency
in
E. coli in the same manner as above and in which the chloroplast localization signal was
cut off was designed and designated as IspSP. A nucleotide sequence of IspSP is represented
by SEQ ID NO:13. The IspSP gene was chemically synthesized, then cloned into pUC57
(manufactured by GenScript), and the resulting plasmid was designated as pUC57-IspSP.
3-3) Chemical synthesis of isoprene synthase derived from Mucuna bracteata (Mucuna)
[0139] Based on the nucleotide sequence of the isoprene synthase cDNA derived from
Mucuna bracteata, an IspS gene that was optimized for the codon usage frequency in
E. coli was designed in the same manner as above. One in which the chloroplast localization
signal had been conferred was designated as IspSM (L), and one in which the chloroplast
localization signal had been cut off was designated as IspSM. Nucleotide sequences
for IspSM (L) and IspSM are represented by SEQ ID NO:14 and SEQ ID NO:15, respectively.
The IspSM gene and the IspSM (L) gene were chemically synthesized, then cloned into
pUC57 (manufactured by GenScript), and the resulting plasmids were designated as pUC57-IspSM
and pUC57-IspSM (L).
3-4) Construction of expression plasmid, pSTV28-Ptac-Ttrp
[0140] An expression plasmid pSTV28-Ptac-Ttrp for expressing IspS derived from various plants
in
E. coli was constructed. First, a DNA fragment comprising a tac promoter (synonym: Ptac)
region (
deBoer, et al.,(1983) Proc. Natl. Acad. Sci. U.S.A., 80, 21-25) and a terminator region of tryptophan operon (synonym: Ttrp) derived from
E. coli (
Wu et al., (1978) Proc. Natl. Acad. Sci. U.S.A., 75, 442-5446) and having a
KpnI site at a 5' terminus and a
BamHI site at a 3' end was synthesized chemically (the nucleotide sequence of Ptac-Ttrp
is represented by SEQ ID NO:16). The resulting Ptac-Ttrp DNA fragment was digested
with
KpnI and
BamHI, and ligated to pSTV28 (manufactured by Takara Bio Inc.) similarly digested with
KpnI and
BamHI by a ligation reaction with DNA ligase. The resulting plasmid was designated as
pSTV28-Ptac-Ttrp (its nucleotide sequence is represented by SEQ ID NO:17). This plasmid
can amplify the expression of the IspS gene by cloning the IspS gene downstream of
Ptac.
3-5) Construction of plasmid for expressing IspS gene derived from various plants
[0141] Plasmids for expressing the IspSK gene, the IspSP gene, the IspSM gene and the IspSM
(L) gene in
E. coli were constructed by the following procedure. PCR was performed with Prime Star polymerase
(manufactured by Takara Bio Inc.) using synthesized oligonucleotides consisting of
the nucleotide sequences of SEQ ID NOs:18 and 19 as primers with pUC57-IspSK as a
template, synthesized oligonucleotides consisting of the nucleotide sequences of SEQ
ID NOs:20 and 21 as primers with pUC57-IspSP as a template, synthesized oligonucleotides
consisting of the nucleotide sequences of SEQ ID NOs:22 and 23 as primers with pUC57-IspSM
as a template, or further synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NOs:24 and 25 as primers with pUC57-IspSM (L) as a template. A
reaction solution was prepared according to a composition attached to the kit, and
a reaction at 98°C for 10 seconds, 54°C for 20 seconds and 68°C for 120 seconds was
performed in 40 cycles. As a result, a PCR product containing the IspSK gene, the
IspSP gene, the IspSM gene or the IspSM (L) gene was obtained. Likewise, PCR was performed
with Prime Star polymerase (manufactured by Takara Bio Inc.) using synthesized oligonucleotides
consisting of the nucleotide sequences of SEQ ID NOs:26 and 27 as primers with pSTV28-Ptac-Ttrp
as a template. A reaction solution was prepared according to a composition attached
to the kit, and a reaction at 98°C for 10 seconds, 54°C for 20 seconds and 68°C for
210 seconds was performed in 40 cycles. As a result, a PCR product containing pSTV28-Ptac-Ttrp
was obtained. Subsequently, the purified IspSK gene, IspSP gene, IspSM gene, and IspSM
(L) gene fragments were ligated to the PCR product for pSTV28-Ptac-Ttrp using In-Fusion
HD Cloning Kit (manufactured by Clontech). The resulting plasmids for expressing the
IspSK gene, the IspSP gene, IspSM gene and IspSM (L) gene were designated as pSTV28-Ptac-IspSK,
pSTV28-Ptac-IspSP, pSTV28-Ptac-IspSM, and pSTV28-Ptac-IspSM (L), respectively.
Reference Example 4: Measurement of enzymatic activity of isoprene synthase derived
from various plants using crude enzyme extract derived from E. coli
4-1) Construction of E. coli MG1655 strain having ability to produce isoprene
[0142] Competent cells of
E. coli MG1655 strain (ATCC 700926) were prepared, and then pSTV28-Ptac-Ttrp, pSTV28-Ptac-IspSK,
pSTV28-Ptac-IspSP, pSTV28-Ptac-IspSM, or further pSTV28-Ptac-IspSM (L) was introduced
therein by an electroporation method. A suspension of the cells was evenly applied
onto an LB plate containing 60 mg/L of chloramphenicol, and cultured at 37°C for 18
hours. Subsequently, transformants that were resistant to chloramphenicol were obtained
from the resulting plate. A strain in which pSTV28-Ptac-Ttrp, pSTV28-Ptac-IspSK, pSTV28-Ptac-IspSP,
pSTV28-Ptac-IspSM, or further pSTV28-Ptac-IspSM (L) was introduced into
E. coli MG1655 strain were designated as MG1655/pSTV28-Ptac-Ttrp, MG1655/pSTV28-Ptac-IspSK,
MG1655/pSTV28-Ptac-IspSP, MG1655/pSTV28-Ptac-IspSM, or further MG1655/pSTV28-Ptac-IspSM
(L) strain, respectively.
4-2) Method of preparing crude enzyme extract
[0143] Microbial cells of MG1655/pSTV28-Ptac-Ttrp, MG1655/pSTV28-Ptac-IspSK, MG1655/pSTV28-Ptac-IspSP,
MG1655/pSTV28-Ptac-IspSM, or MG1655/pSTV28-Ptac-IspSM (L) strain were evenly applied
onto the LB plate containing 60 mg/L of chloramphenicol, and cultured at 37°C for
18 hours. The microbial cells corresponding to 1/6 of the resulting plate were inoculated
to a Sakaguchi flask in which 20 mL of LB containing 60 mg/L of chloramphenicol had
been added, and cultured at 37°C for 6 hours. The microbial cells from the culture
medium were centrifuged at 5000 rpm at 4°C for 5 minutes, and washed twice with ice-cold
isoprene synthase buffer (50 mM Tris-HCl, pH 8.0, 20 mM MgCl
2, 5% glycerol). The washed microbial cells were suspended in 1.8 mL of the same buffer.
About 0.9 mL of beads for disruption (YBG01, diameter 0.1 mm) and 0.9 mL of the microbial
cell suspension were placed in a 2 mL tube specific for a multibead shocker, and the
microbial cells were disrupted using the multibead shocker manufactured by Yasui Kikai
Corporation at 2500 rpm at 4°C for 3 cycles of ON for 30 seconds/OFF for 30 seconds.
After the disruption, the tube was centrifuged at 20,000 g at 4°C for 20 minutes,
and a supernatant was used as a crude enzyme extract.
4-3) Measurement of isoprene synthase activity
[0144] The crude enzyme extract from MG1655/pSTV28-Ptac-Ttrp, MG1655/pSTV28-Ptac-IspSK,
MG1655/pSTV28-Ptac-IspSP, MG1655/pSTV28-Ptac-IspSM, or MG1655/pSTV28-Ptac-IspSM (L)
strain (containing 2 mg as amount of total protein) together with the isoprene buffer
in a total volume of 0.5 mL was placed in a headspace vial (22 mL CLEAR CRIMP TOP
VIAL (cat #B0104236) manufactured by Perkin Elmer), then 0.025 mL of a 0.5 M MgCl
2 solution and 0.01 mL of a 0.2 M DMAPP (manufactured by Cayman, catalog No. 63180)
solution were added thereto, and the mixture was lightly vortexed. Then immediately,
the vial was tightly sealed with a cap with a butyl rubber septum for the headspace
vial (CRIMPS (cat #B0104240) manufactured by Perkin Elmer), and kept at 37°C for 2
hours.
[0145] After completion of the reaction, a concentration of isoprene in the headspace of
the vial was measured by gas chromatography. An analysis condition for the gas chromatography
will be described below.
Headspace sampler (manufactured by Perkin Elmer, Turbo Matrix 40)
[0146]
Temperature for keeping vial warm: 40°C
Time period for keeping vial warm: 30 minutes Pressurization time: 3.0 minutes
Injection time: 0.02 minute
Needle temperature: 70°C
Transfer temperature: 80°C
Carrier gas pressure (high purity helium): 124 kPa
Gas chromatography (manufactured by Shimadzu Corporation, GC-2010 Plus AF)
[0147]
Column (Rxi (registered trademark)-1 ms: length 30 m, internal diameter 0.53 mm, liquid
phase film thickness 1.5 µm, cat #13370)
Column temperature: 37°C
Pressure: 24.8 kPa
Column flow: 5 mL/minute
Influx method: Split 1:0 (actually measured 1:18) Transfer flow: 90 mL
GC injection volume: 1.8 mL (transfer flow × injection time)
Injection volume of sample into column: 0.1 mL
Inlet temperature: 250°C
Detector: FID (hydrogen 40 mL/minute, air 400 mL/minute, makeup gas helium 30 mL/minute)
Detector temperature: 250°C
Preparation of isoprene standard sample
[0148] A reagent isoprene (specific gravity 0.681) was diluted to 10, 100, 1000, 10000 and
100000 times with cold methanol to prepare standard solutions for addition. Subsequently,
1 pL of each standard solution for addition was added to a headspace vial in which
1 mL of water had been added, and used as a standard sample.
[0149] The amount of formed isoprene after the reaction of each microbial strain for 2 hours
is described in Table 5.
Table 5. Amount of formed isoprene after reaction for 2 hours
| Name of microbial strain |
Amount of formed isoprene (mg/L) |
| MG1655/pSTV28-Ptac-Ttrp |
0.10 ± 0.01 |
| MG1655/pSTV28-Ptac-IspSK |
0.45 ± 0.02 |
| MG1655/pSTV28-Ptac-IspSM |
28.93 ± 6.04 |
| MG1655/pSTV28-Ptac-IspSM(L) |
5.06 ± 0.13 |
| MG1655/pSTV28-Ptac-IspSP |
0.10 ± 0.01 |
[0150] From the result in Table 5, the amount of formed isoprene was larger in order of
MG1655/pSTV28-Ptac-IspSM, MG1655/pSTV28-Ptac-IspSM (L) and MG1655/pSTV28-Ptac-IspSK
strains, and was almost equal in MG1655/pSTV28-Ptac-IspSP and MG1655/pSTV28-Ptac-Ttrp
strains. From the above result, the crude enzyme extract from the strain introduced
with the isoprene synthase derived from Mucuna exhibited the highest activity to form
isoprene.
Reference Example 5: Effects of introduction of isoprene synthase derived from various
plants on E. coli MG1655 strain
[0151] From the result of the crude enzymatic activity in Reference Example 4, the highest
activity was confirmed in the isoprene synthase derived from Mucuna that deleted the
chloroplast localization signal. Thus, an ability to produce isoprene from glucose
was compared in all isoprene synthase-introduced strains in which the chloroplast
localization signal had been deleted. Microbial cells of MG1655/pSTV28-Ptac-Ttrp,
MG1655/pSTV28-Ptac-IspSK, MG1655/pSTV28-Ptac-IspSP, or MG1655/pSTV28-Ptac-IspSM strain
were evenly applied onto the LB plate containing 60 mg/L of chloramphenicol, and cultured
at 37°C for 18 hours. One loopful of the microbial cells from the resulting plate
was inoculated to 1 mL of M9 glucose medium in a headspace vial. The vial was tightly
sealed with the cap with the butyl rubber septum for the headspace vial (CRIMPS (cat
#B0104240) manufactured by Perkin Elmer), and the microbial cells were cultured at
30°C for 24 hours using a reciprocal shaking cultivation apparatus (120 rpm). A composition
of the M9 glucose medium is as described in Table 6.
Table 6. Composition of M9 glucose medium
| Glucose |
1.0 g/L |
| Na2HPO4 |
6.0 g/L |
| KH2PO4 |
3.0 g/L |
| NaCl |
0.5 g/L |
| NH4Cl |
1.0 g/L |
| 1 M MgSO4 (autoclaved) |
1.0 mL |
| 1 M CaCl2 (autoclaved) |
0.1 mL |
[0152] Further, chloramphenicol was added at a final concentration of 60 mg/L. The volume
was adjusted to 1 L and the medium was then sterilized by filtration.
[0153] After completion of the cultivation, the concentration of isoprene in the headspace
in the vial was measured by the gas chromatography. An OD value was also measured
at 600 nm using a spectrophotometer (HITACHI U-2900). The concentration of isoprene
and the OD value in each microbial strain at the time of completing the cultivation
are described in Table 7.
Table 7. OD value, and amount (µg/L) of isoprene produced by MG1655/pSTV28-Ptac-Ttrp,
MG1655/pSTV28-Ptac-IspSK, MG1655/pSTV28-Ptac-IspSP and MG1655/pSTV28-Ptac-IspSM strains
at the time of completing cultivation
| Name of microbial strain |
OD value |
Amount (µg/L) of formed isoprene |
| MG1655/pSTV28-Ptac-Ttrp |
1.68±0.04 |
ND |
| MG1655/pSTV28-Ptac-IspSK |
1.60±0.09 |
43±6 |
| MG1655/pSTV28-Ptac-IspSM |
1.45±0.03 |
56±7 |
| MG1655/pSTV28-Ptac-IspSP |
1.59±0.07 |
26±3 |
[0154] From the results in Table 7, it was found that the amount of produced isoprene was
larger in order of MG1655/pSTV28-Ptac-IspSM, MG1655/pSTV28-Ptac-IspSK, MG1655/pSTV28-Ptac-IspSP
and MG1655/pSTV28-Ptac-Ttrp strains. From the above results, the strain introduced
with the isoprene synthase derived from Mucuna exhibited the highest activity to produce
isoprene in the wild strains.
Reference Example 6: Effects of introduction of isoprene synthase derived from various
plants on E. coli MG1655 strain in which MEP (methylerythritol) pathway is enhanced 6-1) Construction
of plasmid for expressing dxs gene (pMW219-dxs)
[0155] It was already reported that the amount of formed isoprene was enhanced (
Appl. Microbiol. Biotechnol., (2011) 90, 1915-1922), when the expression of a dxs (1-deoxy-D-xylulose-5-phosphate synthase) gene that
constitutes the MEP pathway was enhanced in
E. coli strain in which the isoprene synthase was introduced. Thus, it was confirmed whether
an ability to produce isoprene was also different due to an origin of the isoprene
synthase in the strain in which the expression of the dxs gene was enhanced. The entire
genomic nucleotide sequence of
E. coli K-12 strain was already shown (GenBank Accession No. U00096) (
Science, (1997) 277, 1453-1474). pMW219 (manufactured by Nippon Gene Co., Ltd.) was used for amplifying the gene.
This plasmid can increase an expression level of an objective gene when isopropyl-β-thiogalactopyranoside
(IPTG) is added by introducing the objective gene into a multicloning site. Synthesized
oligonucleotides were synthesized from the nucleotide sequences of SEQ ID NOs:28 and
29 based on the nucleotide sequence of the dxs gene in the genomic nucleotide sequence
of
E.
coli. Subsequently, PCR was performed with Prime Star polymerase (manufactured by Takara
Bio Inc.) using the synthesized oligonucleotides consisting of the nucleotide sequences
of SEQ ID NOs:28 and 29 as the primers with MR1655 strain genomic DNA as the template.
A reaction solution was prepared according to the composition attached to the kit,
and a reaction at 98°C for 10 seconds, 54°C for 20 seconds and 68°C for 120 seconds
was performed in 40 cycles. As a result, a PCR product containing the dxs gene was
obtained. Likewise, PCR was performed with Prime Star polymerase (manufactured by
Takara Bio Inc.) using the synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NOs:30 and 31 as the primers with pMW219 as the template. A reaction
solution was prepared according to the composition attached to the kit, and a reaction
at 98°C for 10 seconds, 54°C for 20 seconds and 68°C for 240 seconds was performed
in 40 cycles. As a result, a PCR product containing pMW219 was obtained. Subsequently,
the purified dxs gene fragment was ligated to the PCR product of pMW219 using In-Fusion
HD Cloning Kit (manufactured by Clontech). The resulting plasmid for expressing the
dxs gene was designated as pMW219-dxs.
Table 8. Primer sequences used for construction of plasmid for expressing dxs gene
| Sequence name |
Sequence (5'-) |
| dxs-F |
CAGGAAACAGCTATGAGTTTTGATATTGCCAAATACCCGAC (SEQ ID NO:28) |
| dxs-R |
GCTGCCACTCCTGCTATACTCGTCATAC (SEQ ID NO:29) |
| pMW219-F |
CATAGCTGTTTCCTGTGTGAAATTGTTATC (SEQ ID NO:30) |
| pMW219-R |
AGCAGGAGTGGCAGCGAATTCGAGCTCGGTACCCGGGGAT (SEQ ID NO:31) |
6-2) Introduction of pMW219-dxs into E. coli MG1655 strain having ability to produce isoprene
[0156] Competent cells of MG1655/pSTV28-Ptac-Ttrp, MG1655/pSTV28-Ptac-IspSK, MG1655/pSTV28-Ptac-IspSM,
or further MG1655/pSTV28-Ptac-IspSP strain were prepared, and pMW219-dxs was introduced
therein by an electroporation method. The cells were evenly applied onto the LB plate
containing 60 mg/L of chloramphenicol and 50 mg/L of kanamycin hydrochloride, and
the cells were cultured at 37°C for 18 hours. Transformants that were resistant to
chloramphenicol and kanamycin were obtained from the resulting LB plates. Strains
in which pMW219-dxs had been introduced into MG1655/pSTV28-Ptac-Ttrp, MG1655/pSTV28-Ptac-IspSK,
MG1655/pSTV28-Ptac-IspSM, or further MG1655/pSTV28-Ptac-IspSP strain were designated
as MG1655/pSTV28-Ptac-Ttrp/pMW219-dxs, MG1655/pSTV28-Ptac-IspSK/pMW219-dxs, MG1655/pSTV28-Ptac-IspSM/pMW219-dxs,
or further MG1655/pSTV28-Ptac-IspSP/pMW219-dxs strain, respectively.
6-3) Effects of introduction of isoprene synthase derived from various plants on E. coli MG1655 strain in which expression of DXS is enhanced
[0157] MG1655/pSTV28-Ptac-Ttrp/pMW219-dxs, MG1655/pSTV28-Ptac-IspSK/pMW219-dxs, MG1655/pSTV28-Ptac-IspSM/pMW219-dxs,
or further MG1655/pSTV28-Ptac-IspSP/pMW219-dxs strain were evenly applied onto the
LB plate containing 60 mg/L of chloramphenicol and 50 mg/L of kanamycin hydrochloride,
and were cultured at 37°C for 18 hours. Subsequently, the cultivation in the headspace
vial was evaluated as described in Reference Example 5. The amount (µg/L) of produced
isoprene and the OD value upon completion of the cultivation are described in Table
9.
Table 9. Amount (µg/L) of produced isoprene and OD value when the cultivation was
completed in various strains having enhanced isoprene synthase which are prepared
from
E.
coli MG1655 strain having enhanced DXS as host
| Name of microbial strain |
OD value |
Amount (pg/L) of produced isoprene |
| MG1655/pSTV28-Ptac-Ttrp/pMW219-dxs |
1.46±0.04 |
ND |
| MG1655/pSTV28-Ptac-IspSK/pMW219-dxs |
1.13±0.02 |
101±28 |
| MG1655/pSTV28-Ptac-IspSM/pMW219-dxs |
1.76±0.06 |
126±23 |
| MG1655/pSTV28-Ptac-IspSP/pMW219-dxs |
2.21±0.12 |
42±17 |
[0158] From the results in Table 9, the amount of produced isoprene was larger in order
of MG1655/pSTV28-Ptac-IspSM/pMW219-dxs, MG1655/pSTV28-Ptac-Ptac-IspSK/pMW219-dxs,
MG1655/pSTV28-Ptac-IspSP/pMW219-dxs and MG1655/pSTV28-Ptac-Ttrp/pMW219-dxs strains.
From the above results, the strain introduced with the isoprene synthase derived from
Mucuna also exhibited the highest ability to produce isoprene in the MEP pathway-enhanced
strains.
Reference Example 7: Effects of introduction of isoprene synthase derived from various
plants on E. coli MG1655 strain in which MVA (mevalonate) pathway is introduced 7-1) Cloning gene downstream
of mevalonate pathway which is derived from yeast
[0159] A downstream region of the mevalonate pathway was obtained from
Saccharomyces cerevisiae (
WO2009076676,
Saccharomyces Genome database http://www.yeastgenome.org/#
Nucleic Acids Res., Jan 2012; 40: D700-D705). An ERG12 gene encoding mevalonate kinase, an ERG8 gene encoding phosphomevalonate
kinase, an ERG19 gene encoding diphosphomevalonate decarboxylase, and an IDI1 gene
encoding isopentenyl-diphosphate delta isomerase were amplified by PCR with genomic
DNA of
S.
cerevisiae as the template using the primer shown below (Table 10). Prime Star Max Premix sold
by Takara Bio Inc. was used for a PCR enzyme, and the reaction was performed at 98°C
for 2 minutes and for 30 cycles of 98°C for 10 seconds, 55°C for 5 seconds and 72°C
for 5 seconds/kb. Cloning and construction of an expression vector were performed
by introducing the PCR fragment into the pSTV28-Ptac-Ttrp vector (SEQ ID NO:17) treated
with the restriction enzyme
SmaI by an in-fusion cloning method.
E. coli DH5α was transformed with the expression vector, clones having assumed sequence length
from each gene were selected, a plasmid was extracted according to standard methods,
and its sequence was confirmed. The nucleotide sequences of these amplified genes
and the amino acid sequences of the enzymes encoded by these genes are available on
Saccharomyces Genome database http://www.yeastgenome.org/#.
7-2) Construction of artificial operon downstream of mevalonate pathway
[0160] A sequence in which the gene encoding the mevalonate kinase and the gene encoding
the phosphomevalonate kinase were arranged in straight was constructed by the in-fusion
cloning method. The ERG12 gene encoding the mevalonate kinase and the ERG8 gene encoding
the phosphomevalonate kinase were amplified by PCR with genomic DNA from
Saccharomyces cerevisiae as the template using the primers shown in Table 11. KOD plus sold by Toyobo was
used for the PCR enzyme, and the reaction was performed at 94°C for 2 minutes and
for 30 cycles of 94°C for 15 seconds, 45°C for 30 seconds and 68°C for 1 minute/kb.
The cloning and the construction of an expression vector were performed by inserting
the PCR fragment into pUC118 vector treated with the restriction enzyme
SmaI by the in-fusion cloning method.
E. coli JM109 was transformed with the expression vector, clones having assumed sequence
length of each gene were selected, a plasmid was extracted according to standard methods,
and its sequence was confirmed. The produced plasmid was designated as pUC-mvk-pmk.
The nucleotide sequence of pUC-mvk-pmk is represented by SEQ ID NO:40.
Table 11. Primer sequences used for ligating mevalonate kinase and phosphomevalonate
kinase
| Amplified gene |
Sequence name |
Sequence (5'-) |
| ERG12 |
KKS1-6038-2-1 |
TCGAGCTCGGTACCCATGTCATTACCGTTCTTAACTTCT |
(SEQ ID NO:41) |
| ERG12 |
KKA1-6038-2-2 |
 |
| ERG8 |
KKS2-6083-2-3 |
 |
| ERG8 |
KKA2-6083-2-4 |
CTCTAGAGGATCCCCTTATTTATCAAGATAAGTTTCCGG |
(SEQ ID NO:44) |
[0161] A sequence in which a gene encoding diphosphomevalonate decarboxylase and a gene
encoding isopentenyl-diphosphate delta isomerase were arranged in straight was constructed
by the in-fusion cloning method. The ERG19 gene encoding the diphosphomevalonate decarboxylase
and the IDI1 gene encoding the isopentenyl-diphosphate delta isomerase were amplified
by PCR with genomic DNA of
Saccharomyces cerevisiae as the template using the primers shown in Table 12. KOD plus sold by Toyobo was
used for the PCR enzyme, and the reaction was performed at 94°C for 2 minutes and
for 30 cycles of 94°C for 15 seconds, 45°C for 30 seconds and 68°C for 1 minute/kb,
and then at 68°C for 10 minutes. The cloning and the construction of an expression
vector were performed by inserting the PCR fragment into TWV228 vector treated with
the restriction enzyme
SmaI by the in-fusion cloning method.
E. coli DH5α was transformed with the expression vector, clones having assumed sequence length
of each gene were selected, a plasmid was extracted according to standard methods,
and its sequence was confirmed. The produced plasmid was designated as pTWV-dmd-yidi.
The nucleotide sequence of pTWV-dmd-yidi is represented by SEQ ID NO:45.
[0162] A sequence in which the gene encoding the mevalonate kinase, the gene encoding the
phosphomevalonate kinase, the gene encoding the diphosphomevalonate decarboxylase
and the gene encoding the isopentenyl-diphosphate delta isomerase were arranged in
straight was constructed by the in-fusion cloning method. An expression vector in
which these four enzyme genes were arranged in straight was constructed by amplifying
the gene encoding the mevalonate kinase and the gene encoding the phosphomevalonate
kinase by PCR with pUC-mvk-pmk as the template using the primers shown in Table 13
and amplifying the gene encoding the diphosphomevalonate decarboxylase and the gene
encoding the isopentenyl-diphosphate delta isomerase by PCR with pTWV-dmd-yidi as
the template using the primers shown in Table 13, followed by cloning the amplified
products into pTrcHis2B vector by the in-fusion cloning method. Prime Star HS DNA
polymerase sold by Takara Bio Inc. was used for the PCR enzyme, and the reaction was
carried out at 98°C for 2 minutes followed by in 30 cycles of 98°C for 10 seconds,
52°C for 5 seconds and 72°C for 1 minute/kb, and then at 72°C for 10 minutes. The
PCR fragment was inserted into pTrcHis2B vector treated with the restriction enzymes
NcoI and PstI to construct the expression vector.
E. coli JM109 was transformed with the expression vector, clones having an objective sequence
length were selected, a plasmid was extracted according to standard methods, and its
sequence was confirmed. The constructed expression vector was designated as pTrc-KKDyI
(β). The nucleotide sequence of pTrc-KKDyI (β) is represented by SEQ ID NO:50.
7-3) Fixation of downstream region of mevalonate pathway on chromosome
[0163] The sequence in which the gene encoding the mevalonate kinase, the gene encoding
the phosphomevalonate kinase, the gene encoding the diphosphomevalonate decarboxylase
and the gene encoding the isopentenyl-diphosphate delta isomerase were arranged in
straight was expressed on a chromosome. A glucose isomerase promoter was used for
the expression of the gene, and a transcription termination region of aspA gene in
E. coli was used for the termination of the transcription (
WO2010031062). A translocation site of Tn7 was used as a chromosomal site to be fixed (
Mol Gen Genet., 1981; 183 (2): 380-7). A cat gene was used as a drug marker after the fixation of the chromosome. A Tn7
downstream region in the chromosome region to be fixed was amplified by PCR with genomic
DNA of
E. coli as the template using the primers shown in Table 14. Prime Star HS DNA polymerase
sold by Takara Bio Inc. was used for the PCR enzyme, and the reaction was carried
out at 98°C for 2 minutes followed by in 30 cycles of 98°C for 10 seconds, 52°C for
5 seconds and 72°C for 1 minute/kb, and then at 72°C for 10 minutes. A cat gene region
containing a λ phage attachment site was amplified by PCR with pMW118-attL-Cm-attR
plasmid as the template using the primers shown in Table 14 (
WO2010-027022). Prime Star HS DNA polymerase sold by Takara Bio Inc. was used for the PCR enzyme,
and the reaction was carried out at 95°C for 3 minutes followed by in 2 cycles of
95°C for 1 minute, 34°C for 30 seconds and 72°C for 40 seconds, 2 cycles of 95°C for
30 seconds, 50°C for 30 seconds and 72°C for 40 seconds, and then at 72°C for 5 minutes.
A sequence downstream of the mevalonate pathway to which a promoter and a transcription
termination region had been added (hereinafter abbreviated as KKDyI) was amplified
with pTrc-KKDyI (β) as the template using the primers shown in Table 14. Prime Star
HS DNA polymerase sold by Takara Bio Inc. was used for the PCR enzyme, and the reaction
was carried out at 98°C for 2 minutes followed by in 30 cycles of 98°C for 10 seconds,
52°C for 5 seconds and 72°C for 1 minute/kb, and then at 72°C for 10 minutes. A vector
was constructed using these PCR products and pMW219 treated with the restriction enzyme
SmaI by the in-fusion cloning method.
E.
coli JM109 was transformed with the expression vector, clones having an objective sequence
length were selected, a plasmid was extracted according to standard methods, and its
sequence was confirmed. The resulting plasmid was designated as pMW219-KKDyI-TaspA.
The nucleotide sequence of pMW219-KKDyI-TaspA is represented by SEQ ID NO:55.
[0164] Subsequently, a Tn7 upstream region in the chromosome region to be fixed was amplified
by PCR with the genomic DNA of
E. coli as the template using the primers shown in Table 14. Prime Star HS DNA polymerase
sold by Takara Bio Inc. was used for the PCR enzyme, and the reaction was carried
out at 98°C for 2 minutes followed by in 30 cycles of 98°C for 10 seconds, 52°C for
5 seconds and 72°C for 1 minute/kb, and then at 72°C for 10 minutes. A vector was
constructed using the PCR product and pMW219-KKDyI-TaspA treated with the restriction
enzyme
SalI by the in-fusion cloning method.
E. coli JM109 was transformed with the expression vector, clones having an objective sequence
length were selected, a plasmid was extracted according to standard methods, and its
sequence was confirmed. The resulting plasmid was designated as pMW-Tn7-Pgi-KKDyI-TaspA-Tn7.
The sequence of the constructed plasmid is represented by SEQ ID NO:56.
[0165] Subsequently, a chromosome having a region including the chloramphenicol resistance
gene, the glucose isomerase promoter, the operon downstream of the mevalonate pathway,
and the aspA gene transcription termination region was fixed using λ-Red method. A
fragment for chromosome fixation was prepared by extracting the plasmid pMW-Tn7-Pgi-KKDyI-TaspA-Tn7
and then treating it with the restriction enzymes
PvuI and
SalI followed by purifying it.
E. coli MG1655 containing a plasmid pKD46 having a temperature-sensitive replication capacity
(hereinafter referred to as MG1655/pKD46) was used for the electroporation. The plasmid
pKD46 [
Proc. Natl. Acad. Sci. USA, 2000, vol. 97, No.12, p6640-6645] contains a DNA fragment of total 2154 nucleotides (GenBank/EMBL Accession No. J02459,
31088th to 33241st) of λ phage containing λ Red system genes (λ, β, exo genes) controlled
by an arabinose-inducible ParaB Promoter. After the electroporation, a colony that
had acquired the resistance to chloramphenicol was obtained, subsequently genomic
DNA was extracted, and it was confirmed by PCR using the primers shown in Table 16
that the objective region was fixed on the chromosome. Further, the sequence of the
objective region was confirmed by confirming the sequence of the PCR fragment. The
nucleotide sequence of the mevalonate pathway downstream and its proximal region fixed
on the chromosome is represented by SEQ ID NO:57, and its construction outline is
shown in FIG. 4. The resulting mutant was designated as MG1655 cat-Pgi-KKDyI.
[0166] The drug marker in MG1655 cat-Pgi-KKDyI was removed by the following procedure. Competent
cells of MG1655 cat-Pgi-KKDyI was made, and then pMW-int-xis was introduced therein.
pMW-int-xis is a plasmid containing a gene encoding integrase (Int) of the λ phage
and a gene encoding excisionase (Xis) of the λ phage and having the temperature-sensitive
replication capacity (
WO2007/037460,
JP Publication No. 2005-058827).
[0167] The chloramphenicol-resistant gene located in a region sandwiched with attL and attR
that are the attachment site of the λ phage is dropped off from the chromosome by
introducing pMW-int-xis. As a result, it is known that the host loses the resistance
to chloramphenicol. And, a chloramphenicol-sensitive strain was obtained from the
resulting colony, and subsequently cultured on the LB medium at 42°C for 6 hours.
The cultured microbial cells were applied onto the LB plate medium to allow colonies
to appear. A colony that had lost the resistance to ampicillin was selected from these
colonies to remove the drug resistance. The mutant obtained as above was designated
as MG1655 Pgi-KKDyI.
Table 15. Primers for making PCR fragments used for construction of pMW-Tn7-Pgi-KKDyI-TaspA-Tn7
| Template DNA |
Amplified region |
Sequence name |
Sequence (5'-) |
| E. coli genome |
Tn7 upstream |
Tn7upSv02_6038 -24-1 |
 |
| E. coli genome |
Tn7 upstream |
Tn7upAv02_6038 -24-2 |
 |
Table 16. PCR primers for confirming chromosome fixation of mevalonate pathway downstream
| Sequence name |
Sequence (5'-) |
| Tn7v02-F_6038-22-5 |
ACGAACTGCTGTCGAAGGTT |
(SEQ ID NO:66) |
| Tn7v02-R_6038-22-6 |
GGTGTACGCCAGGTTGTTCT |
(SEQ ID NO: 67) |
7-4) Substitution of promoter downstream of mevalonate pathway on chromosome
[0168] The promoter of the operon downstream of the mevalonate pathway on the chromosome
was substituted by the λ-red method. A genomic fragment having attL-Tet-attR-Ptac
was used as the template for PCR. This is one in which the tac promoter, and attL
and attR that are the attachment sites for a tetracycline resistant drug marker and
the λ phage are aligned. This sequence is represented by SEQ ID NO:68. A PCR fragment
was prepared using the promoter shown in Table 17. LA-Taq polymerase sold by Takara
Bio Inc. was used for the PCR enzyme, and the reaction was carried out at 92°C for
1 minute, then for 40 cycles of 92°C for 10 seconds, 50°C for 20 seconds and 72°C
for 1 minute/kb, and further at 72°C for 7 minutes. The PCR product was purified.
MG1655 Pgi-KKDyI containing the plasmid pKD46 (hereinafter referred to as MG1655 Pgi-KKDyI/pKD46)
having the temperature-sensitive replication capacity was used for the electroporation.
The plasmid pKD46 [
Proc. Natl. Acad. Sci. USA, 2000, vol. 97, No.12, p6640-6645] contains a DNA fragment of total 2154 nucleotides (GenBank/EMBL Accession No. J02459,
31088th to 33241st) of λ phage containing λ Red system genes (λ, β, exo genes) controlled
by an arabinose-inducible ParaB Promoter. The plasmid pKD46 is required for incorporating
the PCR product into MG1655 Pgi-KKDyI.
[0169] Competent cells for the electroporation were prepared as follows. MG1655 Pgi-KKDyI/pKD46
cultured in the LB medium containing 100 mg/L of ampicillin at 30°C overnight were
diluted to 100 times with 5 mL of LB medium containing ampicillin and L-arabinose
(1 mM). The resulting cells in diluted suspension were grown until OD600 reached about
0.6 with ventilating at 30°C, and subsequently washed three times with ice-cold 10%
glycerol solution to use for the electroporation. The electroporation was performed
using 50 µL of the competent cells and about 100 ng of the PCR product. The cells
after the electroporation in 1 mL of SOC medium [
Molecular Cloning: Laboratory Manuals, 2nd Edition, Sambrook, J. et al., Cold Spring
Harbor Laboratory Press (1989)] were cultured at 37°C for one hour, and subjected to a plate culture on LB agar
medium at 37°C to select a chloramphenicol-resistant transformant. Subsequently, in
order to remove the pKD46 plasmid, the transformant was subcultured on the LB agar
medium containing tetracycline at 37°C. The ampicillin resistance was examined in
the obtained colonies, and an ampicillin-resistant strain having no pKD46 was obtained.
A mutant containing the tac promoter substitution that could be distinguished by the
tetracycline-resistant gene was obtained. The obtained mutant was designated as MG1655
tet-Ptac-KKDyI.
[0170] The antibiotic marker was removed by the following procedure. Competent cells of
MG1655 tet-Ptac-KKDyI were made, and then pMW-int-xis was introduced therein. pMW-int-xis
is a plasmid containing the genes encoding integrase (Int) and excisionase (Xis) of
the λ phage and having the temperature-sensitive replication capacity (
WO2007/037460,
JP Publication No. 2005-058827). The tetracycline-resistant gene located in a region sandwiched with attL and attR
that are the attachment site of the λ phage is dropped off from the chromosome by
introducing pMW-int-xis. As a result, it is known that the host loses the resistance
to tetracycline. Thus, a tetracycline-sensitive strain was obtained from the resulting
colonies. Cells of this strain were cultured on the LB medium at 42°C for 6 hours,
and the cultured cells were applied onto the LB plate medium to allow colonies to
appear. A clone that had lost the resistance to ampicillin was selected to remove
the drug resistance. The resulting mutant was designated as MG1655 Ptac-KKDyI. The
nucleotide sequence of the mevalonate pathway downstream and its proximal region controlled
by the tac promoter on the chromosome is represented by SEQ ID NO:69, and its outline
is shown in FIG. 5.
Table 17. Primers for making PCR fragments for promoter substitution
| Sequence name |
Sequence (5'-) |
| APtacKKDyIv03_6038 -36-5 |
 |
| SPtacKKDyIv02_6038 -36-3 |
 |
7-5) Introduction of isoprene synthase derived from various plants into MG1655 Ptac-KKDyI
strain
[0171] Competent cells of MG1655 Ptac-KKDyI strain were prepared, and then pSTV28-Ptac-Ttrp,
pSTV28-Ptac-IspSK, pSTV28-Ptac-IspSM, or further pSTV28-Ptac-SP was introduced therein.
The cells were evenly applied onto the LB plate containing 60 mg/L of chloramphenicol,
and the cells were cultured at 37°C for 18 hours. Transformants that exhibited the
chloramphenicol resistance were obtained from the resulting plate. A strain in which
pSTV28-Ptac-Ttrp, pSTV28-Ptac-IspSK, pSTV28-Ptac-IspSM, or pSTV28-Ptac-IspSP had been
introduced into MG1655 Ptac-KKDyI strain was designated as MG1655 Ptac-KKDyI/pSTV28-Ptac-Ttrp,
MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSK, MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSM, or MG1655
Ptac-KKDyI/pSTV28-Ptac-IspSP, respectively.
7-6) Effects of introduction of isoprene synthase derived from various plants on MG1655
strain in which MVA pathway is enhanced
[0172] Microbial cells of MG1655 Ptac-KKDyI/pSTV28-Ptac-Ttrp, MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSK,
MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSM, or further MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSP
strain were evenly applied onto the LB plate containing 60 mg/L of chloramphenicol,
and the cells were cultured at 37°C for 18 hours. One loopful of the microbial cells
from the resulting LB plate was inoculated to 1 mL of M9 glucose (containing mevalonic
acid) medium in a headspace vial (22 mL CLEAR CRIMP TOP VIAL (cat #B0104236) manufactured
by Perkin Elmer), and subsequently the cultivation was evaluated according to the
method described in Reference Example 2. A composition of the M9 glucose (containing
mevalonic acid) medium is described in Table 18. The amount of produced isoprene and
the OD value upon completion of the cultivation are described in Table 19.
Table 18. Composition of M9 glucose (containing mevalonic acid) medium
| Glucose |
2.0 g/L |
| Na2HPO4 |
6.0 g/L |
| KH2PO4 |
3.0 g/L |
| NaCl |
0.5 g/L |
| NH4Cl |
1.0 g/L |
| Mevalonic acid (manufactured by ADEKA) |
1.0 g/L |
| 1 M MgSO4 (autoclaved) |
1.0 mL |
| 1 M CaCl2 (autoclaved) |
0.1 mL |
[0173] Chloramphenicol was added at a final concentration of 60 mg/L.
[0174] A total volume was adjusted to 1 L, and the medium was sterilized by filtration.
Table 19. Amount (mg/L) of produced isoprene and OD value when cultivation of MG1655
Ptac-KKDyI/pSTV28-Ptac-Ttrp, MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSK, MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSM,
or further MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSP was completed
| Name of microbial strain |
OD value |
Amount (mg/L) of produced isoprene |
| MG1655 Ptac-KKDyI/pSTV28-Ptac-Ttrp |
2.08 ± 0.07 |
0.07 ± 0.01 |
| MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSK |
2.48 ± 0.13 |
30.96 ± 3.04 |
| MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSM |
2.48 ± 0.09 |
57.13 ± 15.00 |
| MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSP |
1.95 ± 0.09 |
0.52 ± 0.01 |
[0175] From the results in Table 19, the amount of produced isoprene was larger in order
of MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSM, MG1655 Ptac-KKDyI/pSTV28-Ptac-IspSK, MG1655
Ptac-KKDyI/pSTV28-Ptac-IspSP, and MG1655 Ptac-KKDyI/pSTV28-Ptac-Ttrp strains. From
the above results, the strain introduced with the isoprene synthase derived from Mucuna
also exhibited the highest ability to produce isoprene in the strains introduced with
the MVA pathway.
Example 5: Construction of P. ananatis AG10265
(5-1) Construction of pMW-Para-mvaES-Ttrp
(5-1-1) Chemical synthesis of mvaE gene derived from Enterococcus faecalis
[0176] The nucleotide sequence and amino acid sequence of mvaE derived from
Enterococcus faecalis and encoding acetyl-CoA acetyltransferase and hydroxymethlglutaryl-CoA reductase
have been already known (ACCESSION number of nucleotide sequence: AF290092.1 (1479..3890),
ACCESSION number of amino acid sequence: AAG02439) (
J. Bacteriol. 182(15), 4319-4327(2000)). The amino acid sequence of the mvaE protein derived from
Enterococcus faecalis and the nucleotide sequence of its gene are shown in SEQ ID NO:72 and SEQ ID NO:73,
respectively. In order to efficiently express the mvaE gene in
E. coli, a mvaE gene in which codon usage was optimized for
E. coli was designed and designated as EFmvaE. Its nucleotide sequence is shown in SEQ ID
NO:74. This mvaE gene was chemically synthesized, cloned into pUC57 (supplied from
GenScript), and the resulting plasmid was designated as pUC57-EFmvaE.
(5-1-2) Chemical synthesis of mvaS gene derived from Enterococcus faecalis
[0177] The nucleotide sequence and amino acid sequence of mvaS derived from
Enterococcus faecalis and encoding hydroxymethylglutaryl-CoA synthase have been already known (ACCESSION
number of nucleotide sequence: AF290092.1, complement(142..1293), ACCESSION number
of amino acid sequence: AAG02438) (
J. Bacteriol. 182(15), 4319-4327 (2000)). The amino acid sequence of the mvaS protein derived from
Enterococcus faecalis and the nucleotide sequence of its gene are shown in SEQ ID NO:75 and SEQ ID NO:76,
respectively. In order to efficiently express the mvaS gene in
E. coli, a mvaS gene in which codon usage was optimized for
E. coli was designed and designated as EFmvaS. Its nucleotide sequence is shown in SEQ ID
NO:77. This mvaS gene was chemically synthesized, cloned into pUC57 (supplied from
GenScript), and the resulting plasmid was designated as pUC57-EFmvaS.
(5-1-3) Construction of arabinose-inducible mvaES expression vector
[0178] An arabinose-inducible expression vector for a gene upstream of a mevalonate pathway
was constructed by the following procedure. A PCR fragment comprising Para composed
of araC and araBAD promoter sequences derived from
E. coli was obtained by PCR using the plasmid pKD46 as a template and using synthesized oligonucleotides
represented by SEQ ID NO:78 and SEQ ID NO:79 as primers. A PCR fragment comprising
the EFmvaE gene was obtained by PCR using the plasmid pUC57-EFmvaE as the template
and using synthesized oligonucleotides represented by SEQ ID NO:80 and SEQ ID NO:81
as the primers. A PCR fragment comprising the EFmvaS gene was obtained by PCR using
the plasmid pUC57-EFmvaS as the template and using synthesized oligonucleotides represented
by SEQ ID NO:82 and SEQ ID NO:83 as the primers. A PCR fragment comprising a Ttrp
sequence was obtained by PCR using the plasmid pSTV-Ptac-Ttrp as the template and
using synthesized oligonucleotides represented by SEQ ID NO:84 and SEQ ID NO:85 as
the primers. PrimeStar polymerase (supplied from TaKaRa Bio) was used for PCR for
obtaining these 4 PCR fragments. A reaction solution was prepared according to a composition
attached to the kit, and the reaction by a cycle of 98°C for 10 seconds, 55°C for
5 seconds and 72°C for one minute/kb was repeated 30 times. Using the purified PCR
product comprising Para and the purified PCR product comprising the EFmvaE gene as
the template, PCR was carried out using the synthesized oligonucleotides represented
by SEQ ID NO:78 and SEQ ID NO:81 as the primers. Using the purified PCR product comprising
the EFmvaS gene and the purified PCR product comprising Ttrp as the template, PCR
was carried out using the synthesized oligonucleotides represented by SEQ ID NO:82
and SEQ ID NO:85 as the primers. As a result, the PCR product comprising Para and
the EFmvaE gene and the PCR product comprising the EFmvaS gene and Ttrp were obtained.
A plasmid pMW219 (supplied from Nippon Gene) was digested with
SmaI according to the standard method. After digestion with
SmaI
, pMW219, the purified PCR product comprising Para and the EFmvaE gene and the purified
PCR product comprising the EFmvaS gene and Ttrp were ligated using In-Fusion HD Cloning
Kit (supplied from Clontech). The resulting plasmid was designated as pMW-Para-mvaES-Ttrp.
(5-2) Construction of pTrc-KKDyI-ispS(K)
[0179] First, an expression vector comprising a sequence where mevalonate kinase, phosphomevalonate
kinase, diphosphomevalonate decarboxylase and isopentenyl diphosphate delta isomerase
were aligned in line was constructed by In-fusion cloning. Sequences of mevalonate
kinase and phosphomevalonate kinase were amplified by PCR using pUC-mvk-pmk (see Reference
Example 7-2) (SEQ ID NO:40) as the template and using primers consisting of the nucleotide
sequences of SEQ ID NOs:86 to 89. Sequences of diphosphomevalonate decarboxylase and
isopentenyl diphosphate delta isomerase were amplified by PCR using pTWV-dmd-yidi
(see Reference Example 7-2) ((SEQ ID NO:45) as the template and using primers consisting
of the nucleotide sequences of SEQ ID NOs:86 to 89. Subsequently, the expression vector
where these four enzyme genes was aligned in line was constructed by cloning them
into pTrcHis2B vector using the in-fusion cloning method. PrimeStar HS DNA polymerase
sold by TaKaRa Bio was used for PCR, and the reaction was carried out under the condition
of 98°C for 2 minutes, 30 cycles (98°C for 10 seconds, 52°C for 5 seconds and 72°C
for one minute/kb) and 72°C for 10 minutes. The resulting PCR fragment was inserted
into the pTrcHis2B vector digested with restriction enzymes
NcoI and PstI using the in-fusion cloning method to construct the expression vector.
E. coli JM109 was transformed with this expression vector, a clone having an objective length
was selected, subsequently the plasmid was extracted according to the standard methods,
and its sequence was confirmed. The constructed expression vector was designated as
pTrc-KKDyI(α). A nucleotide sequence of pTrc-KKDyI(α) is shown in SEQ ID NO:90.
[0180] Then, a plasmid pTrc-KKDyI-ispS(K) where IspS(K) was added to the obtained expression
vector pTrc-KKDyI(α) (SEQ ID NO:90) was constructed by the following procedure.
[0181] pTrc-KKDyI(α) was digested with the restriction enzyme PstI (supplied from TaKaRa
Bio) to obtain pTrc-KKDyI(α)/PstI. Using pUC57-ispSK as the template, PCR was carried
out using pTrcKKDyIkSS_6083-10-1 (SEQ ID NO:91) and pTrcKKDyIkSA_6083-10-2 (SEQ ID
NO:92) as the primers and using PrimeStar polymerase (supplied from TaKaRa Bio). A
reaction solution was prepared according to the composition attached to the kit, and
the reaction of a cycle of 98°C for 10 seconds, 54°C for 20 seconds and 68°C for 120
seconds was repeated 30 times. As a result, a PCR product comprising an IspSK gene
was obtained. Subsequently, the purified IspSK gene fragment and pTrc-KKDyI(α)/PstI
were ligated using In-Fusion HD Cloning Kit (supplied from Clontech). The resulting
plasmid was designated as pTrc-KKDyI-ispS(K) (SEQ ID NO:93).
(5-3) Construction of pSTV-Ptac-ispS-Mmamvk
(5-3-1) Chemical synthesis of mevalonate kinase derived from Methanosarcina mazei
[0182] The nucleotide sequence and amino acid sequence of mevalonate kinase derived from
Methanosarcina mazei Go1 have been already known (ACCESSION number of nucleotide sequence: NC_003901.1
(2101873..2102778, LOCUS TAG MM_1762, ACCESSION number of amino acid sequence: NP_633786.1)).
The amino acid sequence of the MVK protein derived from
Methanosarcina mazei and the nucleotide sequence of its gene are shown in SEQ ID NO:94 and SEQ ID NO:95,
respectively. In order to efficiently express the MVK gene in
E. coli, the MVK gene in which the codon usage was optimized for
E. coli was designed and designated as Mmamvk. A nucleotide sequence of Mmamvk is shown in
SEQ ID NO:96. The Mmamvk gene was chemically synthesized, cloned into pUC57 (supplied
from GenScript), and the resulting plasmid was designated as pUC57-Mmamvk.
(5-3-2) Construction of plasmid for expressing isoprene synthase gene derived from
Pueraria montana var. lobata (kudzu) and MVK gene
[0183] A plasmid for expressing the IspSK gene and the Mmamvk gene in
E. coli was constructed by the following procedure. Using pUC57-IspSK as the template, PCR
was carried out using synthesized oligonucleotide consisting of the nucleotide sequences
of SEQ ID NO:97 and SEQ ID NO:98 as the primers and using PrimeStar polymerase (supplied
from TaKaRa Bio). A reaction solution was prepared according to the composition attached
to the kit, and the reaction of a cycle of 98°C for 10 seconds, 54°C for 20 seconds
and 68°C for 120 seconds was repeated 40 times. As a result, a PCR product comprising
the IspSK gene was obtained. Likewise, using pSTV28-Ptac-Ttrp as the template, PCR
was carried out using synthesized oligonucleotide consisting of the nucleotide sequences
of SEQ ID NO:99 and SEQ ID NO:100 as the primers and using PrimeStar polymerase (supplied
from TaKaRa Bio). A reaction solution was prepared according to the composition attached
to the kit, and the reaction of a cycle of 98°C for 10 seconds, 54°C for 20 seconds
and 68°C for 210 seconds was repeated 40 times. As a result, a PCR product comprising
pSTV28-Ptac-Ttrp was obtained. Subsequently, the IspSK gene fragment and the PCR product
comprising pSTV28-Ptac-Ttrp were ligated using In-Fusion HD Cloning Kit (supplied
from Clontech). The resulting plasmid for expressing the IspSK gene was designated
as pSTV28-Ptac-IspSK. Then, using pUC57-Mmamvk as the template, PCR was carried out
using synthesized oligonucleotide consisting of the nucleotide sequences of SEQ ID
NO:101 and SEQ ID NO:102 as the primers and using PrimeStar polymerase (supplied from
TaKaRa Bio). A reaction solution was prepared according to the composition attached
to the kit, and the reaction of a cycle of 98°C for 10 seconds, 55°C for 5 seconds
and 72°C for one minute/kb was repeated 30 times. As a result, a PCR product comprising
the Mmamvk gene was obtained. Likewise, using pSTV28-Ptac-IspSK as the template, PCR
was carried out using synthesized oligonucleotide consisting of the nucleotide sequences
of SEQ ID NO:103 and SEQ ID NO:104 as the primers and using PrimeStar polymerase (supplied
from TaKaRa Bio). A reaction solution was prepared according to the composition attached
to the kit, and the reaction of a cycle of 98°C for 10 seconds, 55°C for 5 seconds
and 72°C for one minute/kb was repeated 30 times. As a result, a PCR product comprising
pSTV28-Ptac-IspSK was obtained. Subsequently, the purified Mmamvk gene and the PCR
product comprising pSTV28-Ptac-IspSK were ligated using In-Fusion HD Cloning Kit (supplied
from Clontech). The resulting plasmid for expressing the IspSK gene and the Mmamvk
gene was designated as pSTV28-Ptac-IspSK-Mmamvk.
(5-4) Construction of pMW-Ptac-Mclmvk-Ttrp
[0184] Next, a plasmid for expressing MVK (PMW-Ptac-mvk-Ttrp) was constructed.
[0185] Using pUC57-Mclmvk as the template, PCR was carried out using synthesized oligonucleotides
consisting of the nucleotide sequences of Mcl_mvk_N (SEQ ID NO:105) and Mcl_mvk_C
(SEQ ID NO:106) as the primers and using PrimeStar polymerase (supplied from TaKaRa
Bio). A reaction solution was prepared according to the composition attached to the
kit, and the reaction of a cycle of 98°C for 10 seconds, 55°C for 5 seconds and 72°C
for one minute/kb was repeated 30 times. As a result, a PCR product comprising the
Mclmvk gene was obtained. Likewise, using pMW219-Ptac-Ttrp (see
WO2013069634A1) as the template, PCR was carried out using synthesized oligonucleotides consisting
of the nucleotide sequences of PtTt219f (SEQ ID NO:107) and PtTt219r (SEQ ID NO:108)
as the primers and using PrimeStar polymerase (supplied from TaKaRa Bio). A reaction
solution was prepared according to the composition attached to the kit, and the reaction
of a cycle of 98°C for 10 seconds, 55°C for 5 seconds and 72°C for one minute/kb was
repeated 30 times. As a result, a PCR product comprising pMW219-Ptac-Ttrp was obtained.
Subsequently, the purified Mclmvk gene and the PCR product comprising pMW219-Ptac-Ttrp
were ligated using In-Fusion HD Cloning kit (supplied from Clontech). The resulting
plasmid for expressing the Mclmvk gene was designated as pMW-Ptac-Mclmvk-Ttrp.
(5-5) Integrative conditional replication plasmid having upstream gene and downstream
gene of mevalonate pathway
[0187] A KpnI-SalI fragment of pMW-Para-mvaES-Ttrp was cloned into a recognition site for
SphI
-SalI in pAH162-λattL-TcR-λattR. As a result, a plasmid pAH162-Para-mvaES possessing an
operon mvaES derived from
E. faecalis under the control of the Para promoter and a repressor gene AraC from
E. coli was constructed (FIG. 6).
[0188] An Ecl136II-SalI fragment of a plasmid pTrc-KKDyI-ispS(K) comprising a mevalonate
kinase gene, a phosphomevalonate kinase gene, a diphosphomevalonate decarboxylase
gene and an IPP isomerase gene derived from
S.
cerevisiae and a coding portion of the ispS gene derived from kudzu was subcloned into a
SphI
-SalI site of pAH162-λattL-TcR-λattR, and the resulting plasmid was designated as pAH162-KKDyI-ispS(K)
(FIG. 7).
[0189] A BglII-EcoRI fragment of pSTV28-Ptac-ispS-Mmamvk comprising the ispS gene (Mucuna)
and the mvk gene (M.
mazei) under the control of Ptac was subcloned into a recognition site for BamHI-Ecl136II
in the integrative vector pAH162-λattL-TcR-λattR. The resulting plasmid pAH162-Ptac-ispS(M)-mvk(Mma)
is shown in FIG. 8.
(5-6) Construction of P. ananatis SC17(0) derivative possessing attB site of phi80 phage at different site in genome
[0190] A
P.
ananatis SC17(0) derivative possessing an attB site of phi80 phage that substituted an ampC
gene, an ampH gene or a crt operon was constructed (annotated complete genome sequence
of
P. ananatis AJ13355 is available as PRJDA162073 or GenBank accession number AP01232.1 and AP012033.1).
In order to obtain these strains, λRed dependent integration of a PCR-amplified DNA
fragment possessing attLphi80-kan-attRphi80 flanking to a 40 bp region homologous
to a target site in the genome was carried out according to the previously reported
technique (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). After the electroporation, cells were cultured on L-agar containing 50 mg/L of
kanamycin. DNA fragments used for the substitution of the ampC gene and the ampH gene
and the crt operon with attLphi80-kan-attRphi80 were amplified by the reaction using
oligonucleotides 1 and 2, 3 and 4, and 5 and 6 (Table 20), respectively. A plasmid
PMWattphi (
Minaeva NI et al., BMC Biotechnol. 2008; 8:63) was used as the template in these reactions. The resulting integrants were designated
as SC17(0)ΔampC::attLphi80-kan-attRphi80, SC17(0)ΔampH::attLphi80-kan-attRphi80, and
SC17(0)Δcrt::attLphi80-kan-attRphi80. Oligonucleotides 7 and 8, 9 and 10, and 11 and
12 (Table 20) were used for PCR validation of SC17(0)ΔampC::attLphi80-kan-attRphi80,
SC17(0)ΔampH::attLphi80-kan-attRphi80, and SC17(0)Δcrt::attLphi80-kan-attRphi80, respectively.
Maps of the resulting modified genomes ΔampC::attLphi80-kan-attRphi80, ΔampH::attLphi80-kan-attRphi80
and Δcrt::attLphi80-kan-attRphi80 are shown in FIG. 9A, FIG, 10A and FIG. 11A, respectively.
[0191] Curing of the constructed strains from a kanamycin resistant marker was carried out
using a helper plasmid pAH129-cat according to the previously reported technique (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1):55-60). Oligonucleotides 7 and 8, 9 and 10, and 11 and 12 (Table 20) were used for PCR
validation of the resulting strains SC17(0)ΔampC::attBphi80, C17(0)ΔampH::attBphi80,
and SC17(0)Δcrt::attBphi80, respectively.
(5-7) Construction of ISP3-S strain
[0192] The plasmid pAH162-KKDyI-ispS(K) described in (5-5) was integrated in SC17(0)ΔampC::attBphi80
described in (5-6) using a helper plasmid pAH123-cat according to the previously reported
technique (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1):55-60). An oligonucleotide pair 13-7 and 14-8 (Table 20) were used for PCR validation of
the resulting integrant. The resulting SC17(0)ΔampC::pAH162-KKDyI-ispS(K) was cured
from a vector portion of pAH162-KKDyI-ispS(K) using a helper plasmid pMWintxis-cat
possessing an int gene and a xis gene of λ phage according to the previously reported
technique (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). As a result, a strain SC17(0)ΔampC:: KKDyI-ispS(K) was obtained. Oligonucleotides
7 and 15 (Table 20) were used for PCR validation of the kanamycin sensitive derivative.
The construction of SC17(0)ΔampC:: KKDyI-ispS(K) is shown in FIG. 9.
[0193] Genomic DNA isolated from the above strain SC17(0)ΔampH::attLphi80-kan-attRphi80
using GeneElute Bacterial genome DNA Kit (Sigma) was electroporated into SC17(0)ΔampH::KKDyI-ispS(K)
according to the method of chromosome electroporation previously reported (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). Transfer of the mutation ΔampH::attLphi80-kan-attRphi80 was confirmed by PCR using
the primers 9 and 10.
[0194] The final strain was cured from the kanamycin resistant marker using phi80 Int/Xis
dependent technique (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1):55-60). The modified genome ΔampH::KKDyI-ispS(K) was verified in obtained KmS integrants
by PCR using the primers 7 and 15, and subsequently a strain SC17(0)ΔampC::KKDyI-ispS(K)
ΔampH::attBphi80 was selected.
[0195] The above plasmid pAH162-Para-mvaES was integrated into SC17(0)ΔampC::KKDyI-ispS(K)
ΔampH::attBphi80 using the helper plasmid pAH123-cat (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1):55-60). Oligonucleotides 13 and 9 and oligonucleotides 14 and 10 (Table 20) were used for
validation of the resulting integrant by PCR. This integrant was cured from a vector
portion of pAH162-Para-mvaES using phage λ Int/Xis-dependent technique (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). Removal of the vector from the chromosome was confirmed by PCR using the primers
9 and 16. As a result, SC17(0) ΔampC::KKDyI-ispS(K)ΔampH::Para-mvaES containing no
marker was obtained. A construct of the modified chromosome ΔampH::Para-mvaES is shown
in FIG. 10.
[0196] The plasmid pAH162-Ptac-ispS(K)-mvk(Mma) described in (5-5) was integrated into genome
of SC17(0)Δcrt::attBphi80 using the protocol described in the previous report (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1): 55-60). The integration of the plasmid was confirmed by the polymerase chain reaction using
the primers 11-13 and 12-14.
[0197] The modified chromosome SC17(0)Δcrt::pAH162-Ptac-ispS(K)-mvk(Mma) thus constructed
was transferred into strain SC17(0)ΔampC::KKDyI-ispS(K)ΔampH::Para-mvaES using the
electroporation by genomic DNA in the previous report (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). The resulting integrant was cured from a vector portion of pAH162-Ptac-ispS(K)-mvk
(Mma) using phage λ Int/Xis-dependent technique (
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). The structure of a final construct Δcrt::Ptac-ispS(K)-mvk(Mma) (FIG. 11) was confirmed
by PCR using the primers 11 and 17.
[0198] An integrative expression cassette introduced into this final strain was verified
by PCR, and it was found that some of a 5' portion of KKDyI operon comprising the
MVK, PMK, MVD and y1dI genes derived from
S.
cerevisiae were unexpectedly rearranged. In order to repair this cassette, this strain was electroporated
with genomic DNA isolated from strain SC17(0)ΔampC::pAH162-KKDyI-ispS(K) using GeneElute
Bacterial Genome DNA Kit (Sigma) according to the technique in the previous report
(
Katashkina JI et al., BMC Mol Biol. 2009; 10:34). The resulting strain contained all genes required for the production of isoprene.
[0199] After curing from a vector portion of pAH162-KKDyI-ispS(K) (see the above) using
phage λ Int/Xis dependency, strain ISP3-S (
P. ananatis SC17(0) ΔampC::attLphi80-KKDyI-ispS(K)-attRphi80 ΔampH::attLphi80-Para-mvaES-attRphi80
Δcrt::attLphi80-Ptac-ispS(K)-mvk(Mma)-attRphi80) containing no marker was obtained.
(5-8) Construction of integrative plasmid possessing different mevalonate kinase gene
[0200] A KpnI-BamHI fragment of pMW-Ptac-Mclmvk-Ttrp was subcloned into a recognition site
for KpnI-Ecl136II in the integrative vector pAH162-λattL-TcR-λattR. As a result, a
plasmid pAH162-Ptac-Mclmvk possessing the MVK gene derived from
M. concilii and under the control of the tac promoter was constructed.
(5-9) Construction of AG10265 strain
[0202] The modified chromosome Δcrt::pAH123-Ptac-mvk (M. paludicola) was transferred into
the strain ISP3-S (5-7) via the electroporation of genomic DNA isolated from Δcrt::pAH162-Ptac-Mclmvk.
The resulting integrant was designated as AG10265 (
P.
ananatis SC17(0) ΔampC::attLphi80-KKDyI-ispS(K)-attRphi80 ΔampH::attLphi80-Para-mvaES-attRphi80
Δcrt::attLphi80-λattL-TcR-λattR-Ptac-Mclmvk-attRphi80).
Example 6: Preparation of Pantoea strain having improved expression of ppa gene and production of isoprene by cultivation
using the same
[0203] A strain where a promoter inherent to an endogenous ppa gene (pyrophosphate phosphatase
gene) was substituted with another strong promoter to augment the expression of the
endogenous ppa gene in
P ananatis strain was made by the following procedure.
(6-1) Enhancement of ppa gene expression in AG10265 strain
(6-1-1) Preparation of strain having substituted ppa gene promoter in wild type SC17(0)
[0204] There are two genes encoding pyrophosphate phosphatase, PAJ_2344 (ppa-1) and PAJ_2736(ppa-2)
in
P. ananatis. In order to enhance the expression of the PAJ_2344(ppa-1) gene and the PAJ_2736(ppa-2)
gene, a strain where a promoter sequence and an SD sequence of the PAJ_2344 (ppa-1)
gene and the PAJ_2736(ppa-2) gene were substituted with Ptac and ϕ10, respectively
in P. ananatis SC17(0) was prepared by the λRed method. The λRed method was carried
out according to the method described in
BMC Mol Biol. 2009; 10:34. Annotated genome sequence information for
P.
ananatis AJ13355 is available as GenBank accession numbers AP012032.1 and AP012033.1.
[0205] Genomic DNA was extracted from
P. ananatis SC17(0) strain Ptac-lacZ (
RU application 2006134574,
WO2008/090770,
US2010062496), and used as the template for PCR. λttL-Km
r-λattR-Ptac where the Ptac promoter was ligated downstream of λattL-Km
r-λattR has been integrated upstream of the lacZ gene in
P.
ananatis SC17(0) strain Ptac-lacZ (see
WO2011/87139 A1).
[0206] PCR was carried out using synthesized oligonucleotides consisting of the nucleotide
sequences of PAJ_2344-F and PAJ_2344-R as the primers in order to substitute the promoter
region of PAJ_2344 (ppa-1) gene, using synthesized oligonucleotides consisting of
the nucleotide sequences of PAJ_2736-F and PAJ_2736-R as the primers in order to substitute
the promoter region of PAJ 2736 (ppa-2) gene, and using PrimeStar MAX DNA polymerase
(supplied from TaKaRa Bio) A reaction solution was prepared according to the composition
attached to the kit, and the reaction of a cycle of 98°C for 10 seconds, 55°C for
5 seconds, 72°C for 20 seconds was repeated 30 times. As a result, a fragment comprising
λattL-Km
r-λattR-ϕ10 for substituting the promoter was obtained.
[0207] A plasmid RSF-Red-TER (
US7919284B2) was introduced into SC17(0) by the electroporation according to the standard method.
The resulting strain was designated as SC17(0)/RSF-Red-TER. Competent cells of SC17(0)/RSF-Red-TER
were prepared and then the purified fragment comprising λattL-Km
r-λattR-ϕ10 for substituting the promoter was introduced thereto by the electroporation.
After the electroporation, a colony that had acquired kanamycin resistance was obtained.
[0208] Next, by PCR using two synthesized DNA primers represented by ppa_p1-R (Table 21)
and ppa_p1-F (Table 21) or ppa_p2-R (Table 21) and ppa_p2-F (Table 21), it was confirmed
that a sequence derived from a PCR fragment had been inserted into an upstream region
of PAJ_2344 (ppa-1) gene or an upstream region of PAJ_2736 (ppa-2) gene. Bacterial
strains where the insertion of the fragment had been confirmed were obtained. The
bacterial strains thus obtained were designated as
P. ananatis SC17 ( 0) Ptac-ϕ10-ppal and
P.
ananatis SC17 (0) Ptac-ϕ10-ppa2.
(6-1-2) Preparation of AG10265 strain with ppa gene having substituted promoter
[0209] Genomic DNA was extracted from SC17(0)Ptac-ϕ10-ppa1 using PurElute Bacterial Genomic
kit (EdgeBio). Using this as the template, a fragment from 1 kb upstream of to 1 kb
downstream of the PAJ_2344 (ppa-1) gene was amplified by PCR using synthesized nucleotides
consisting of the nucleotide sequences of ppa-1-g1000-F and ppa-1-g1000-R primer (Table
21) as the primers. Also, using genomic DNA extracted from SC17(0)Ptac-ϕ10-ppa2 as
the template, a fragment from 1 kb upstream of to 1 kb downstream of the PAJ_2736
(ppa-2) gene was amplified by PCR using synthesized nucleotides consisting of the
nucleotide sequences of ppa-2-g1000-F and ppa-2-g1000-R primer (Table 21) as the primers.
PCR was carried out using PrimeStar GXL DNA polymerase (supplied from TaKaRa Bio),
a reaction solution was prepared according to the composition attached to the kit,
and the reaction of a cycle of 98°C for 10 seconds, 60°C for 15 seconds, 68°C for
5 minutes was repeated 40 times. As a result, the fragment comprising from 1 kb upstream
of to 1 kb downstream of the PAJ_2344 (ppa-1) gene or the PAJ_2736 (ppa-2) gene was
obtained. The resulting fragment was purified, 600 ng of the PCR product was introduced
into AG10265 by electroporation to perform transformation, and colonies that had acquired
the kanamycin resistance were obtained.
[0210] By colony PCR using synthesized nucleotides consisting of the nucleotide sequences
of Ppa_p1-F and Ppa_p1-R in Table 21 as the primers, it was confirmed that the promoter
of the PAJ_2344 (ppa-1) gene was substituted in the resulting transformant. Likewise,
by colony PCR using synthesized nucleotides consisting of the nucleotide sequences
of Ppa_p2-F and Ppa_p2-R in Table 21 as the primers, it was confirmed that the promoter
of the PAJ_2736 (ppa-2) gene was substituted. In these strains, the promoter region
of the PAJ_2344 (ppa-1) gene or the PAJ_2736 (ppa-2) gene has been substituted with
Ptac-ϕ10. Of these, each one clone was selected, and designated as AG10265 Ptac-ϕ10-ppa1,
or AG10265 Ptac-ϕ10-ppa2.
(6-1-3) Confirmation of amount of expressed pyrophosphate phosphatase
[0211] An amount of an expressed protein of pyrophosphate phosphatase (PPA) in the AG10265
Ptac-ϕ10-ppal strain and the AG10265 Ptac-ϕ10-ppa2 strain was confirmed by SDS-PAGE.
Cells of the AG10265 strain, the AG10265 Ptac-ϕ10-ppal strain and AG10265 Ptac-ϕ10-ppa2
strain were cultured with shaking in 3 mL of LB medium containing 50 mg/L of kanamycin
at 30°C overnight. The microbial cells were collected, then washed twice with ice-cooled
50 mM Tris buffer (Tris-HCl, pH 8.0), and disrupted using a multibead shocker (Yasui
Kikai, Japan, 4°C, 5 cycles of ON for 60 seconds and OFF for 60 seconds, 2500 rpm).
A solution of the disrupted microbial cells was centrifuged at 14,000 rpm for 20 minutes
to remove cell debris. The resulting supernatant fraction was handled as a soluble
protein fraction. The soluble protein fraction was quantified by the BCA method, and
5 µg of the soluble protein was electrophoresed on SDS-PAGE (supplied from Invitrogen,
NuPAGE: SDS-PAGE Gel System). Subsequently, CBB staining and decoloration were carried
out according to the standard methods. A photograph of a gel around a mass of the
PPA protein was shown in FIG. 12. As a result, increase of the expression amount of
the protein each presumed to be PPA was confirmed in the AG10265 Ptac-ϕ10-ppal strain
and the AG10265 Ptac-ϕ10-ppa2 strain. From density of bands on SDS-PAGE after the
electrophoresis, the expression amount of the protein each presumed to be PPA in the
AG10265 Ptac-ϕ10-ppal strain and the AG10265 Ptac-ϕ10-ppa2 strain was estimated to
be about 1.5 to 2.0 folds higher than that in the original strain (AG10265).
(6-1-4) Introduction of plasmid for expression of isoprene synthase
[0212] Electrocells of the AG10265 strain, the AG10265 Ptac-ϕ10-ppal strain and the AG10265
Ptac-ϕ10-ppa2 strain were prepared, and pSTV28-Ptac-IspSM (see Reference Example 3-5)
was introduced thereto by the electroporation. The resulting isoprene-producing bacterial
strains were designated as AG10265 (Control), AG10265 PPA1 and AG10265 PPA2, respectively.
(6-2) Conditions for Jar cultivation of P. ananatis isoprene-producing bacteria
[0213] A one liter volume fermenter was used for the cultivation of
P. ananatis isoprene-producing bacteria. Glucose medium was prepared as the composition shown
in Table 22. Microbial cells of the isoprene-producing bacterial strain were applied
onto an LB plate containing 60 mg/L of chloramphenicol and cultured at 34°C for 16
hours. 0.3 L of the glucose medium was placed in the 1 L volume fermenter, and microbial
cells sufficiently grown on one plate were inoculated thereto to start the cultivation.
A culture condition was pH 7.0 (controlled with ammonia gas), 30°C, ventilation of
150 mL/minute, and stirring such that an oxygen concentration in the medium was 5%
or higher. During the cultivation, a glucose solution adjusted to 500 g/L was continuously
added to the medium such that a glucose concentration in the medium was 10 g/L or
higher. Finally, AG10265 (Control), AG10265 PPA1 and AG10265 PPA2 consumed 92.2g,
95.8 g and 85.7 g of glucose in the cultivation for 71 hours.
Table 22. Composition of glucose medium
| Group A |
(Final concentration) |
| Glucose |
80 g/L |
| MgSO4.7aq |
2.0 g/L |
| Group B |
|
| (NH4)2SO4 |
2.0 g/L |
| KH2PO4 |
2.0 g/L |
| FeSO4.7aq |
20 mg/L |
| MnS04.5aq |
20 mg/L |
| Yeast Extract |
4.0 g/L |
[0214] After preparing 0.15 L of Group A and 0.15 L of Group B, they were heated and sterilized
at 115°C for 10 minutes. After cooling, Group A and Group B were mixed, and chloramphenicol
(60 mg/L) was added thereto to use as the medium.
(6-3) Method of inducing to isoprene-producing phase
[0215] Since
P. ananatis isoprene-producing bacterial strain expresses a gene upstream of the mevalonate pathway
with an arabinose-inducible promoter, a production amount of isoprene is remarkably
improved in the presence of L-arabinose (Wako Pure Chemical Industries). For inducing
to an isoprene-producing phase, broth in the fermenter was analyzed with time, and
when absorbance at 600 nm became 16, L-arabinose at a final concentration of 20 mM
was added.
(6-4) Method of measuring isoprene gas concentration in fermentation gas
[0216] From immediately after starting the cultivation, evolved gas was collected in a 1
L gas bag with time, and a concentration of the isoprene gas contained in the evolved
gas was measured using gas chromatography based on the condition described in Reference
Example 4-3.
(6-5) Amount of isoprene formed in jar cultivation
[0217] Microbial cells of AG10265 (control), AG10265 PPA1 and AG10265 PPA2 were cultured
under the above jar cultivation condition, and an amount of formed isoprene was measured.
Profiles of growth of the microbial cells and amounts of isoprene produced until 71
hours after starting the cultivation are shown in FIG. 13 and FIG. 14, respectively.
The descending order of the production amount of total isoprene was AG10265 PPA2,
AG10265 PPA1, then AG10265 Control (FIG. 3). The amounts of total isoprene produced
by AG10265 PPA2, AG10265 PPA1, and AG10265 (Control) were 2478 mg, 2365 mg and 2013
mg, respectively. This has indicated that the
P. ananatis isoprene-producing bacterial strain where the expression amount of pyrophosphate
phosphatase was enhanced exhibited the more excellent ability to produce isoprene
than
P. ananatis isoprene-producing bacterial strain where the expression amount of pyrophosphate
phosphatase was not enhanced.
Reference Example 8: Preparation of SWITCH-PphosC-1(S) strain
<1. Preparation of plasmid for upstream of MVA pathway for chromosome fixation >
[0218] A plasmid for upstream of MVA pathway for chromosome fixation, pAH162-PphoC-mvaES
was constructed as follows.
(1-1) Construction of arabinose-inducible plasmid for expressing mevalonate pathway
upstream gene (mvaES [Enterococcus faecalis (E. faecalis)]) derived from E. faecalis, pMW-Para-mvaES-Ttrp
(1-1-1) Chemical synthesis and cloning of mvaES (E. faecalis) gene
[0219] A nucleotide sequence (GenBank/EMBL/DDBJ accession ID AF290092.1) and an amino acid
sequence (mvaS, GenPept accession ID AAG02438.1, mvaE, GenPept accession ID AAG02439.1)
of the mvaES gene encoding the mevalonate pathway upstream gene (mvaES [
Enterococcus faecalis (
E. faecalis)]) derived from
E. faecalis are known publicly (see
Wilding, EI et al., J. Bacteriol. 182 (15), 4319-4327 (2000)). Based on these information, a mvaE gene and a mvaS gene in which their codon usages
had been optimized for
E. coli were designed and designated as EFmvaE and EF mvaS, respectively. Nucleotide sequences
of EFmvaE and EFmvaS are shown in SEQ ID NO:139 and SEQ ID NO:140, respectively. DNA
sequences of EFmvaE and EFmvaS prepared by chemical synthesis were cloned into a plasmid
for expression pUC57 (supplied from GenScript), and designated as pUC57-EFmvaE and
pUC57-EFmvaS, respectively. Nucleotide sequences of pUC57-EFmvaE and pUC57-EFmvaS
are shown in SEQ ID NO:141 and SEQ ID NO:142, respectively.
(1-1-2) Construction of plasmid pMW-Ptrc-mvaES-Ttrp used for In-Fusion method
[0220] A plasmid pMW-P
trc-mvaES-T
trp used for the In-fusion method was constructed according to the following procedure.
[0221] A plasmid pMW219 (supplied from Nippon Gene, Part number: 310-02571) was digested
with
SmaI, and this digested plasmid was purified. The resulting plasmid was designated as
pMW219/SmaI.
[0222] In order to obtain a gene of a trc promoter (P
trc) region, PCR was carried out using a plasmid pTrcHis2B having the P
trc region as the template and using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:143 and SEQ IDNO:144 as primers.
[0223] In order to obtain a mvaE gene portion, PCR was carried out using the plasmid pUC57-EFmvaE
as the template and using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:145 and SEQ IDNO:146 as the primers.
[0224] In order to obtain a mvaS gene portion, PCR was carried out using the plasmid pUC57-EFmvaS
as the template and using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:146 and SEQ IDNO:147 as the primers.
[0225] In order to obtain a gene of a trp terminator (T
trp) region, PCR was carried out using a plasmid pSTV-P
tac-T
trp having the T
trp region as the template and using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:148 and SEQ IDNO:149 as the primers.
[0226] In the above four PCR cases, PrimeStar polymerase (supplied from TaKaRa Bio) was
used as the enzyme, a reaction solution was prepared according to instructions provided
by the supplier of the enzyme, and the reaction of a cycle of 98°C for 10 seconds,
55°C for 5 seconds and 72°C for 60 seconds/kb was repeated 30 times. As a result,
the PCR product comprising the gene of the P
trc region, the mvaE gene, the mvaS gene and the gene of the T
trp region was obtained.
(1-1-3) Construction of plasmid pMW-Ptrc-mvaES-Ttrp used for In-fusion method
[0227] Subsequently, PCR was carried out using the purified PCR product comprising P
trc and the purified PCR product comprising the mvaE gene as the template and using synthesized
oligonucleotides consisting of SEQ ID NO:143 and SEQ IDNO:146 as the primers. Also
PCR was carried out using the purified PCR product comprising the mvaS gene and the
purified PCR product comprising T
trp as the template and using synthesized oligonucleotides consisting of SEQ ID NO:147
and SEQ IDNO:150 as the primers.
[0228] As a result, the PCR product comprising the gene of the P
trc region and the mvaE gene, and the PCR product comprising the mvaS gene and the gene
of the T
trp region were obtained.
[0229] Subsequently, the PCR product comprising the gene of the P
trc region and the mvaE gene, the PCR product comprising the mvaS gene and the gene of
the T
trp region, and the plasmid pMW219/SmaI digested above were ligated using In-Fusion HD
Cloning Kit (supplied from Clontech). The resulting plasmid was designated as pMW-P
trc-mvaES-T
trp. A sequence of obtained pMW-P
trc-mvaES-T
trp is shown in SEQ ID NO:151.
(1-1-4) Construction of plasmid pMW-Para-mvaES-Ttrp
[0230] The arabinose-inducible plasmid for expression of a mevalonate pathway upstream gene,
pMW-P
ara-mvaES-Ttrp was constructed according to the following procedure.
[0231] PCR was carried out using the plasmid pMW-P
trc-mvaES-T
trp prepared in (1-1-3) as the template and using synthesized oligonucleotides consisting
of the nucleotide sequences of SEQ ID NO:152 and SEQ IDNO:153 as the primers.
[0232] PCR was carried out using a plasmid pKD46 (see
Proc. Natl. Acad. Sci. USA, 2000, vol.97, No.12, p6640-6645) comprising a gene of a P
arac region, an araC gene and a gene of a P
araBAD region (hereinafter also collectively referred to as a "gene of a P
ara region") as the template and using synthesized oligonucleotides consisting of the
nucleotide sequences of SEQ ID NO:154 and SEQ IDNO:155 as the primers.
[0233] As a result, the PCR product comprising the plasmid pMW and the mvaES gene and the
PCR product comprising the gene of the Para region were obtained. Purified these PCR
products were ligated using In-Fusion HD Cloning Kit (supplied from Clontech). The
resulting arabinose-inducible plasmid for expression of the mevalonate pathway upstream
gene derived from
E. faecalis (mvaES (
E. faecalis)) was designated as PMW-P
ara-mvaES-Ttrp. A nucleotide sequence of PMW-P
ara-mvaES-Ttrp is shown in SEQ ID NO:156.
(1-2) Construction of integrative conditional replication plasmid possessing mevalonate
pathway upstream
[0235] In order to obtain a promoter deletion mutant of an operon, an Ecl136II-SalI fragment
of PMW-Para-mvaES-Ttrp was subcloned into the vector pAH162-λattL-TcR-λattR. A map
of the resulting plasmid is shown in FIG. 15.
[0236] A set of plasmids for chromosome fixation holding the mvaES gene under the control
of a different promoter was constructed. For this purpose, a polylinker comprising
recognition sites for I-
SceI,
XhoI
, PstI and
SphI was inserted into only one recognition site for
HindIII located upstream of the mvaES gene. In order to accomplish this purpose, annealing
was carried out using synthesized oligonucleotides consisting of the nucleotide sequences
of SEQ ID NO:157 and SEQ ID NO:158 and polynucleotide kinase, and the resulting fragment
was inserted into a plasmid pAH162-mvaES cleaved with
HindIII by a ligation reaction. The resulting plasmid pAH162-MCS-mvaES (FIG. 16) is convenient
for cloning a promoter while keeping a desired orientation before the mvaES gene.
A DNA fragment holding a regulatory region of a phoC gene was formed by PCR using
Genomic DNA from
P. ananatis SC17(0) strain (
Katashkina JI et al. BMC Mol Biol. 2009; 10:34) as the template and using oligonucleotides consisting of the nucleotide sequences
of SEQ ID NO:159 and SEQ ID NO:160, and the resulting fragment was cloned into a recognition
site for an appropriate restriction enzyme in pAH162-MCS-mvaES. The resulting plasmid
is shown in FIG. 17. The cloned promoter fragment was sequenced, and confirmed to
precisely correspond to a predicted nucleotide sequence. The resulting plasmid was
designated as pAH162-PphoC-mvaES.
<2. Preparation of plasmid for MVA pathway downstream for chromosome fixation>
[0237] An integrative plasmid pAH162-Km-Ptac-KDyI was constructed as follows, as a plasmid
for MVA pathway downstream for chromosome fixation.
[0239] The P
tac promoter was inserted into a recognition site for
HindIII-
SphI in the integrative vector pAH162-λattL-Tc
R-λattR (
Minaeva NI et al. BMC Biotechnol. 2008; 8:63). As a result, an integrative vector pAH162-P
tac was constructed. The cloned promoter fragment was sequenced. A map of pAH162-P
tac is shown in FIG. 19.
[0240] A DNA fragment chemically synthesized by ATG Service Gene (Russia) and holding the
PMK gene, the MVD gene and the yldI gene derived from
S. cerevisiae having substituted rare codons (FIG. 20) was subcloned into a recognition site for
SphI-KpnI restriction endonuclease in the integrative plasmid pAH162-Ptac. A chemically
synthesized DNA sequence comprising a KDyI operon is shown in SEQ ID NO:184. The resulting
plasmid pAH162-Tc-Ptac-KDyI holding an expression cassette Ptac-KDyI is shown in FIG.
21A. Subsequently, a NotI-KpnI fragment of pAH162-Tc-Ptac-KDyI holding a tetAR gene
was substituted with a corresponding fragment of pAH162-λattL-KmR-λattR. As a result,
a plasmid pAH162-Km-Ptac-KDyI having a kanamycin resistant gene kan as a marker was
obtained (FIG. 21B).
<3. Preparation of plasmid integrating MVA gene>
[0241] A chemically synthesized DNA fragment comprising a coding portion of a presumed mvk
gene derived from SANAE [for complete genome sequence, see GenBank Accession Number
AP011532] that was
Methanocella paludicola and ligated to a classical SD sequence was cloned into a recognition site for PstI-KpnI
in the above integrative expression vector pAH162-P
tac.
[0242] A map of the integrative plasmid holding the mvk gene is shown in FIG. 22.
<4. Construction of recipient strain SC17(0) ΔampC: : attBphi80 ΔampH:: attBphi80 Δcrt::Ptac-mvk(M. paludicola)>
[0243] Chromosomal modifications ΔampH::attB
phi80 and ΔampC:::attBp
hi80 were introduced into
P. ananatis SC17 (0) stepwise using two step technique comprising λRed dependent integration
of a PCR-amplified DNA fragment comprising the gene kan flanking to attL
phi80 and attR
phi80 and a 40 bp sequence homologous to a target chromosome site (
Katashkina JI et al. BMC Mol Biol. 2009; 10:34), followed by phage phi80 Int/Xis dependent cleavage of the kanamycin resistant marker
(
Andreeva IG et al. FEMS Microbiol Lett. 2011; 318(1):55-60). SC17(0) is a λRed resistant derivative of
P. ananatis AJ13355 (
Katashkina JI et al. BMC Mol Biol. 2009; 10:34); an annotated complete genome sequence of
P. ananatis AJ13355 is available as PRJDA162073 or GenBank Accession Numbers AP012032.1 and AP012033.1.
DNA fragments each used for the integration into ampH and ampC genes, respectively
were formed by PCR using a plasmid pMWattphi [
Minaeva NI et al. BMC Biotechnol. 2008; 8:63] as the template and using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:163 (primer 13) and SEQ ID NO:164 (primer 14) and synthesized
oligonucleotides consisting of the nucleotide sequences of SEQ ID NO:165 (primer 15)
and SEQ ID NO:166 (primer 16) as the primers. The resulting chromosomal modification
was verified by PCR using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:167 (primer 17) and SEQ ID NO:168 (primer 18) and synthesized
oligonucleotides consisting of the nucleotide sequences of SEQ ID NO:169 (primer 19)
and SEQ ID NO:170 (primer 20) as the primers.
[0244] In parallel, a derivative of
P. ananatis SC17(0) holding an attB site of the phage phi80 in place of an operon crt (positioned
on a megaplasmid pEA320 320kb that is a portion of the genome of
P. ananatis AJ13355) was constructed. In order to obtain this strain, the λRed dependent integration
of a PCR-amplified DNA fragment holding attL
phi80-kan-attR
phi80 flanking to a 40 bp region homologous to a target site in the genome was carried
out according to the previously described technique (
Katashkina JI et al. BMC Mol Biol. 2009; 10:34). A DNA fragment used for substitution of the operon crt with attL
phi80-kan-attR
phi80 was amplified by PCR using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:171 (primer 21) and SEQ ID NO:172 (primer 22). The plasmid
pMWattphi (
Minaeva NI et al. BMC Biotechnol. 2008; 8:63) was used as the template in this reaction. The resulting integrant was designated
as SC17 (0) Δcrt::attL
phi80-kan-attR
phi80. A chromosomal structure of SC17(0)Δcrt::attLphi80-kan-attR
phi80 was verified by PCR using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:173 (primer 23) and SEQ ID NO:174 (primer 24). The kanamycin
resistant marker was removed from the constructed strain using the helper plasmid
pAH129-cat according to the previously reported technique (
Andreeva IG et al. FEMS Microbiol Lett. 2011; 318(1):55-60). The resulting strain SC17(0) Δcrt::attB
phi80 was verified by PCR using synthesized oligonucleotides consisting of the nucleotide
sequences of SEQ ID NO:173 (primer 23) and SEQ ID NO:174 (primer 24). Maps of the
resulting modified genomes ΔampC::attB
phi80, ΔampH::attB
phi80 and Δcrt::attB
phi80 are shown in FIGs. 23A, 7B and 7C, respectively.
[0245] The above plasmid pAH162-Ptac-mvk (
M. paludicola) was integrated into genome of SC17(0) Δcrt::attB
phi80 according to the previously reported protocol (
Andreeva IG et al. FEMS Microbiol Lett. 2011; 318(1):55-60). The integration of the plasmid was confirmed by the polymerase chain reaction using
synthesized oligonucleotides consisting of the nucleotide sequences of SEQ ID NO:171
(primer 21), SEQ ID NO:173 (primer 23), SEQ ID NO:172 (primer 22) and SEQ ID NO:174
(primer 24). As a result, a strain SC17(0)Δcrt::pAH162-P
tac-mvk (
M.
paludicola) was obtained. A map of the modified genome Δcrt::pAH162-P
tac-mvk (
M. paludicola) is shown in FIG. 24A.
[0246] Subsequently, transfer from SC17(0)Δcrt::pAH162-P
tac-mvk
(M. paludicola) toSC17(0) ΔampC::attB
phi80 ΔampH::attB
phi80 was carried out via the electroporation of genomic DNA (
Katashkina JI et al. BMC Mol Biol. 2009; 10: 34). The resulting strain was cured from a vector portion of the integrative plasmid
pAH162-Ptac-mvk (
M.
paludicola) using the previously reported helper plasmid pMW-intxis-cat (
Katashkina JI et al. BMC Mol Biol. 2009; 10: 34). As a result, the marker-deleted strain SC17(0) ΔampH::attB
ϕ80 ΔampC: : :attB
ϕ80 Δcrt::P
tac-mvk (
M. paludicola) was obtained. A map of the modified genome Δcrt::P
tac-mvk (
M.
paludicola) is shown in FIG. 24B.
<5. Construction of strain SWITCH-PphoC>
[0247] The plasmid pAH162-Km-Ptac-KDyI was integrated into a chromosome of the strain SC17
(0) ΔampH::attB
ϕ80 ΔampC: : attB
ϕ80 Δcrt:: P
tac-mvk (
M. paludicola) /pAH123-cat according to the previously reported protocol (
Andreeva IG et al. FEMS Microbiol Lett. 2011; 318(1): 55-60). After electrophoresis, cells were seeded on the LB agar containing 50 mg/L of kanamycin.
Grown Km
R clones were tested by the polymerase chain reactions using synthesized oligonucleotides
consisting of the nucleotide sequences of SEQ ID NO:163 (primer 13) and SEQ ID NO:167
(primer 17), and SEQ ID NO:163 (primer 13) and SEQ ID NO:169 (primer 19) as the primers.
A strain holding the plasmid pAH162-Km-Ptac-KDyI integrated into ΔampC::attB
ϕ80 or pC:: attB
ϕ80m was selected. Maps of the modified chromosomals ΔampH:: pAH162-Km-Ptac-KDyI and
ΔampC:: pAH162-Km-Ptac-KDyI are shown in FIG. 25 (A and B).
[0248] pAH162-PphoC-mvaES was inserted into a chromosome of recipient strains SC17(0) ΔampC::pAH162-Km-P
tac-KDyI ΔampH::attB
phi80 Δcrt::P
tac-mvk (
M. paludicola) and SC17(0) ΔampC::attB
phi80 ΔampH::pAH162-Km-P
tac-KDyI Δcrt::P
tac-mvk (
M. paludicola) using the helper plasmid pAH123-cat according to the previously reported protocol
(
Andreeva IG et al. FEMS Microbiol Lett. 2011; 318(1): 55-60). As a result, two sets of strains designated asSWITCH-PphoC-1 and SWITCH-PphoC-2
were obtained. Maps of the modified chromosomes ΔampH::pAH162-PphoC-mvaES and ΔampC::pAH162-PphoC-mvaES
are shown in FIG. 26.
[0249] The tetracycline resistant marker and the kanamycin resistant marker were removed
from SWITCH-PphoC-1 by the phage phi80 Int/Xis dependent removal according to the
previously reported technique (
Katashkina JI et al. BMC Mol. Biol. 2009; 10: 34). The resulting strain was designated as strain SWITCH-PphoC-1(S).
Example 7: Preparation of Pantoea strain in which ppa gene of E. coli MG1655 (b4226) is expressed at high level in strain SWITCH-PphoC-1(S) and production
of isoprene by cultivation using the same
[0250] A strain in which the expression of the ppa gene (pyrophosphate phosphatase gene)
of
E. coli MG1655 (b4226) was augmented by a strong promoter in
P. ananatis strain was made by the following procedure.
(7-1) Construction of pAH162-Ptac-MG-ppa
[0251] The ppa gene (b4226) was isolated by PCR using genomic DNA isolated from
E. coli strain MG1655 as the template and using synthesized oligonucleotides consisting of
the nucleotide sequences of SEQ ID NO:175 and SEQ ID NO:176 as the primers. The ppa
gene isolated by PCR was introduced into a site cleaved with the restriction enzyme
SmaI in the vector pSTV28-Ptac-Ttrp (Reference Example 3) using the in-fusion method
to construct a plasmid pSTV28-Ptac-MG-ppa-Ttrp. Then, a region comprising the Tac
promoter, the ppa gene and the Trp terminator was isolated using this plasmid as the
template and using synthesized oligonucleotides consisting of the nucleotide sequences
of SEQ ID NO:177 and SEQ ID NO:178 as the primers, and introduced into a site cleaved
with the restriction enzymes BamHI and EcoRI in the vector pAH162-Km-attLR using In-Fusion
HD Cloning Kit (supplied from Clontech) to construct a plasmid pAH162-Ptac-MG-ppa.
(7-2) Construction of isoprene-producing strain in which expression of ppa gene derived
from E. coli MG1655 is enhanced and construction of control strain
[0252] First, a derivative of
P. ananatis SC17(0) possessing the attB site of phi80 that substituted a ydcI gene (PAJ_1320,
Hara Y et al., The complete genome sequence of Pantoea ananatis AJ13355, an organism
with great biotechnological potential. Appl. Microbiol. Biotechnol. 2012 Jan:93(1):331-41) was constructed. In order to obtain this strain, a PCR-amplified DNA fragment possessing
attLphi80-kan-attRphi80 was obtained at a site flanking to a 40 bp region homologous
to a ydcI target site in the genome using synthesized oligonucleotides consisting
of the nucleotide sequences of SEQ ID NO:179 and SEQ ID NO:180 as the primers and
using the genome of
P. ananatis SC17(0) as the template. Subsequently, the λRed dependent integration of the DNA
fragment was carried out according to previously reported technique (
Katashkina JI et al., BMC Mol Biol. 2009; 10: 34). After the electroporation, cells were cultured on the LB agar containing 50 mg/L
of kanamycin. The substitution of the ydcI gene with attLphi80-kan-attRphi80 was confirmed
using the primers consisting of the nucleotide sequences of SEQ ID NO:181 and SEQ
ID NO:182. Then, a strain SC17(0)AydcI::Ptac-MG-ppa having the integrated plasmid
pAH162-Ptac-MG-ppa using the helper plasmid pAH123 cat was made according to the previously
reported technique (
Andreeva IG et al., FEMS Microbiol Lett. 2011; 318(1): 55-60). Genomic DNA isolated from this strain was electroporated into the strain SWITCH-PphoC-1(S)
according to the previously reported method of chromosome electroporation (
Katashkina JI et al., BMC Mol Biol. 2009; 10: 34). That the modified genome ΔydcI::Ptac-MG-ppa had been integrated into the chromosome
of the strain SWITCH-PphoC-1(S) was verified by PCR using the primers consisting of
the nucleotide sequences of SEQ ID NO:182 and SEQ ID NO:183. The strain SWITCH-PphoC-1(S)ΔydcI::Ptac-MG-ppa
that was the isoprene-producing strain in which the ppa gene derived from
E. coli MG1655 had been introduced was obtained in this way.
[0253] Then, genomic DNA was isolated from the
P. ananatis SC17(0) derivative possessing the attB site of phi80 that substituted the ydcI gene,
and electroporated into the strain SWITCH-PphoC-1(S) according to the electroporation
method of chromosomes previously reported (
Katashkina JI et al., BMC Mol Biol. 2009; 10: 34). The modified genome ΔydcI was verified by PCR using the primers consisting of the
nucleotide sequences of SEQ ID NO:181 and SEQ ID NO:182, and then, an isoprene-producing
strain SWITCH-PphosC-1(S) ΔydcI for control was chosen.
(7-3) Confirmation of expression amount of pyrophosphate phosphatase
[0254] An expression amount of a protein of pyrophosphate phosphatase (PPA) in the strain
SWITCH-PphoC-1(S)ΔydcI::Ptac-MG-ppa was confirmed on SDS-PAGE. Microbial cells from
this strain were cultured with shaking in 3 mL of LB medium containing 50 mg/L of
kanamycin at 30°C overnight. The microbial cells were collected, subsequently washed
twice with ice-cooled 50 mM Tris buffer (Tris-HCl, pH 8.0), and disrupted using the
multibead shocker (Yasui Kikai, Japan, 4°C, On for 60 seconds and OFF for 60 seconds,
2500 rpm, 5 cycles). A solution of the disrupted cells was centrifuged at 14,000 rpm
for 20 minutes to remove cell debris. The resulting supernatant fraction was handled
as a soluble protein fraction. The soluble protein fraction was quantified by the
BCA method, and 5 µg of the soluble protein was electrophoresed on SDS-PAGE (supplied
from Invitrogen, NuPAGE: SDS-PAGE Gel System). Subsequently, CBB staining and decoloration
were carried out according to the standard methods. A photograph of a gel showing
around the mass of the PPA protein was shown in FIG. 27. As a result, the increase
of the expression amount of the protein presumed to be PPA was confirmed in the strain
SWITCH-PphoC-1(S)AydcI::Ptac-MG-ppa.
(7-4) Introduction of isoprene synthase-expressing plasmid
[0255] Electrocells of the strains SWITCH-PphoC-1(S) ΔydcI::Ptac-MG-ppa and SWITCH-PphoC-1(S)
ΔydcI (control) were prepared according to the standard method, pSTV28-Ptac-ispSM
(
US2014113344A1) was introduced thereto, and the cells were evenly applied onto the LB plate containing
60 mg/L of chloramphenicol and cultured 37°C for 18 hours. Subsequently, transformants
that exhibited resistance to chloramphenicol were obtained from the resulting plates.
The resulting isoprene-producing bacterial strains were designated as SWITCH-PphoC-1(S)ydcI::MG-PPA/ispSM
and SWITCH-PphoC-1(S)ΔydcI/ispSM (Control), respectively.
(7-5) Measurement of isoprene synthase activity
[0256] Microbial cells of the strains SWITCH-PphoC-1(S)ydcI::MG-PPA/ispSM and SWITCH-PphoC-1(S)ΔydcI/ispSM
(Control) were evenly applied onto each LB plate containing chloramphenicol, and cultured
at 34°C for 16 to 24 hours. On loopful of the microbial cells from the resulting plate
was inoculated to 1 mL of PS medium in a headspace vial (supplied from Perkin Elmer,
22mL CLEAR CRIMP TOP VIAL cat #B0104236), then tightly sealed with a cap for the headspace
vial with butyl rubber septum (supplied from Perkin Elmer, CRIMPS cat#B0104240), and
cultured in a reciprocal shaking cultivation apparatus (120 rpm) at 30°C for 48 hours.
[0257] Compositions of the PS medium are as described in Table 23.
Table 23. Composition of PS medium
| Glucose |
4 g/L |
| MgSO4 7H2O |
1 g/L |
| (NH4)2SO4 |
10 g/L |
| Yeast Extract |
50 mg/L |
| FeSO4 7H2O |
5 mg/L |
| MnSO4 5H2O |
5 mg/L |
| KH2PO4 |
10 mM |
| MES |
20 mM pH7.0 |
[0258] After termination of the cultivation, a concentration of isoprene in the headspace
in the vial was measured by gas chromatography
Table 24. Amounts of isoprene formed after cultivation for 48 hours.
| Bacterial strain name |
Amount of formed isoprene (mg/L) |
| SWITCH-PphoC-1(S)ΔydcI/ispSM (Control) |
80.2±7.4 |
| SWITCH-PphoC-1(S)ydcI::MG-PPA/ispSM |
128.0±5.9 |
[0259] From the result in Table 24, the strain SWITCH-PphoC-1(S)ydcI::MG-PPA/ispSM having
the introduced ppa gene of
E. coli MG1655 exhibited the higher activity of forming isoprene than the strain SWITCH-PphoC-1(S)ΔydcI/ispSM
(Control).
Example 8: Production of polyisoprene
[0260] Isoprene is collected with a trap cooled with liquid nitrogen by passing the fermentation
exhaust. Collected isoprene is mixed with 35 g of hexane (Sigma-Aldrich) and 10 g
of silica gel (Sigma-Aldrich, catalog No. 236772) and 10 g of alumina (Sigma-Aldrich,
catalog No. 267740) under a nitrogen atmosphere in 100 mL glass vessel that is sufficiently
dried. Resulting mixture is left at room temperature for 5 hours. Then supernatant
liquid is skimmed and is added into 50 ml glass vessel that is sufficiently dried.
[0261] Meanwhile, in a glove box under a nitrogen atmosphere, 40.0 µmol of Tris[bis(trimethylsilyl)amido]gadolinium,
150.0 µmol of tributylaluminium, 40.0 µmol of Bis[2-(diphenylphosphino)phenyl]amine,
40.0 µmol of triphenylcarbonium tetrakis(pentafluorophenyl)borate (Ph3CBC6F5)4) are
provided in a glass container, which was dissolved into 5 mL of toluene (Sigma-Aldrich,
catalog No. 245511), to thereby obtain a catalyst solution. After that, the catalyst
solution is taken out from the glove box and added to the monomer solution, which
is then subjected to polymerization at 50°C for 120 minutes.
[0262] After the polymerization, 1 mL of an isopropanol solution containing, by 5 mass %,
2,2'-methylene-bis(4-ethyl-6-t-butylphenol) (NS-5), is added to stop the reaction.
Then, a large amount of methanol is further added to isolate the polymer, and the
polymer is vacuum dried at 70°C to obtain a polymer.
Example 9: Production of rubber compound
[0263] The rubber compositions formulated as shown in Table 25 are prepared, which are vulcanized
at 145°C for 35 minutes.
Table 25: Rubber compositions of Example 6
| |
Parts by mass |
| Polyisoprene |
100 |
| Stearic Acid |
2 |
| Carbon Black (HAF class) |
50 |
| Antioxidant (*1) |
1 |
| Zinc Oxide |
3 |
| Cure Accelerator (*2) |
0.5 |
| Sulfur |
1.5 |
*1 N-(1,3-dimethylbutyl)-N'-p-phenylenediamine
*2 N-cyclohexyl-2-benzothiazolesulfenamide |
[0264] While the invention has been described in detail with reference to preferred embodiments
thereof, it will be apparent to the person skilled in the art that various changes
can be made, and equivalents employed, without departing from the scope of the invention.
All the cited references herein are incorporated by reference as a part of this application.
INDUSTRIAL APPLICABILITY