[Technical Field]
[0001] The present invention relates to a peptide having an anti-fibrosis effect and a composition
including the same, and more particularly, to an anti-fibrosis composition which includes
a telomerase-derived peptide and thus is effective in inhibiting the occurrence of
fibrosis of various types of tissue cells.
[Background Art]
[0002] Fibrosis is a disease eliciting abnormal formation, accumulation and precipitation
of an extracellular matrix, caused by fibroblasts, and refers to abnormal accumulation
of a collagen matrix due to injury or inflammation that changes the structures and
functions of various types of tissue. Regardless of where fibrosis arises, most aetiology
of fibrosis includes excessive accumulation of a collagen matrix substituting normal
tissue. Particularly, fibrosis occurring in the kidney, liver, lung, heart, bone or
bone marrow, and skin induces organ failure and leads to death at worst. The fibroblast
serves to form fibrous tissue by producing an extracellular matrix precursor in a
normal state. The extracellular matrix, which is a material between cells in connective
tissue, exists in the form of a protein such as fibronectin, laminin, chondronectin
or collagen.
[0003] Meanwhile, TGF-β plays various roles in the abnormal formation and accumulation of
the extracellular matrix caused by fibroblasts, cell proliferation, inflammation,
and cancer cell metastasis, and many cellular signaling pathways and targets have
been identified. Accordingly, in many disease models, TGF-β has been studied, and
fields in which the study on TGF-β and development of related drugs are most active
may be fibrotic diseases and cancer.
[0004] In the TGF-β mechanism, generally, TGF-β binds to a TGF-β receptor to induce phosphorylation
of Smad proteins in the cytoplasm and transfers signals through interactions with
various Smad proteins. Here, Smad2 and Smad3 are usually involved, and Smad1 and Smad5
are involved in bone morphogenic protein (BMP) signaling. In addition, Smad4 is known
as a common signaling substance involved in activin and BMP, as well as TGF-β (
Heldin, CH et al. Nature, 1997, 390, 465-471;
Massague J. Annu. Rev. Biochem. 1998, 67,753-791).
[0005] As inhibition of tumor invasion and epithelial-mesenchymal transition (EMT) are regulated
by inhibition of the TGF-β signaling mechanism, excellent anticancer therapeutic effects
can be expected. Moreover, considering that TGF-β is the critical cytokine in the
regulation of cell proliferation and differentiation, it has also attracted attention
as a therapeutic method for preventing fibrosis caused by radiation, which is mentioned
as the main side effect of an anticancer treatment (
Zhang et al. JRadiat Res. 2013, 54, 630-636).
[0006] Recently, Esbriet
® (Pirfenidone) approved by the FDA (Oct. 15, 2014) as a therapeutic agent for idiopathic
pulmonary fibrosis is a TGF-β inhibitor, which is known to have inhibition of TGF-β
formation as a main action mechanism. Also, it has been reported that TGF-β is a cell
proliferation regulatory factor, which induces or suppresses cell proliferation and
thus plays an important role in pathogenesis of various diseases including cancer,
cardiac diseases, and diabetes, and various physiological activities thereof have
also been reported. For example, Esbriet
® (Pirfenidone) acts as an inhibitor against TGF-β synthesis (inhibition of forming
a cell proliferation regulatory factor), a TGF-β antagonist (disturbance of a TGF
receptor, signaling disturbance), a PDGF (platelet-derived growth factor) antagonist
(inhibition of angiogenesis inducing factor), a p38 MAP kinase inhibitor (inhibition
of cell proliferation signaling enzyme), and an anti-inflammatory agent (inhibition
of formation of TNF-alpha and MAPK). Therefore, if a new pharmaceutical composition
can be developed that is effective in directly inhibiting TGF-βor blocking a TGF-β-involved
signaling process and even has no side effect, such a pharmaceutical composition can
prevent and treat various diseases and senescence, which are caused by fibrosis.
[0007] Particularly, in a cancer environment, there are various fibrosis-causing factors
such as cancer tissue, anticancer agents, and radiation therapy, and therefore fibrosis
inhibition has more significance in the cancer environment. Today's most popular anticancer
treatments, radiation therapy and chemotherapy are known to considerably attenuate
the quality of life of a patient and severely worsen prognosis of the anticancer treatment
due to side effects caused by fibrosis and the like.
[0008] For this reason, there is a demand for developing a therapeutic agent for inhibiting
the cancer-associated TGF-βsignaling mechanism which will be useful for not only developing
anticancer vaccines but also being new therapeutic agents and methods for maximizing
effects of conventional anticancer treatment. For instance, in anticancer treatment,
fibrosis caused by cancer tissue, an anticancer agent, or radiation exposure interferes
with delivery and efficacy of a drug designed to exhibit an anticancer effect when
an anticancer agent is delivered to a cancerous region and prevents effective anticancer
treatment by blocking transfer of anticancer immune cells to the cancerous region.
Therefore, if a new pharmaceutical composition which has no side effect on a human
body and is able to inhibit fibrosis caused by cancer tissue, a chemotherapeutic agent,
or radiation exposure, anticancer treatment may be more effectively performed.
[Prior Art Documents]
[Disclosure]
[Technical Problem]
[0010] With the background described above, the inventors attempted to develop an anti-fibrosis
composition having excellent effects without a side effect and thus, completed the
present invention.
[0011] An object of the present invention is to provide an effective anti-fibrosis composition.
[Technical Solution]
[0012] In one aspect, the present invention provides an anti-fibrosis composition for use
in preventing or treating fibrosis, which includes at least one selected from the
group consisting of a peptide comprising an amino acid sequence of SEQ. ID. NO: 1
(hereinafter, referred to as "PEP1") and a variant thereof in which one, two or three
amino acids are modified by conservative amino acid substitution.
[0013] In the composition for use according to the present invention, the fibrosis may be
fibrosis induced by at least one selected from the group consisting of cancer, administration
of an anticancer agent, and exposure to radiation.
[0014] In the composition for use according to the present invention, the composition may
inhibit fibrosis of cancer cell tissue selected from the group consisting of pancreatic
cancer, colorectal cancer, stomach cancer, prostate cancer, non-small cell lung cancer,
breast cancer, melanoma and ovarian cancer.
[0015] In the composition for use according to the present invention, the composition may
be used in combination with a chemotherapeutic agent or a radiation therapy to inhibit
fibrosis of cancer tissue. The chemotherapeutic agent may be at least one selected
from deoxynucleoside analogs and fluoropyrimidines, wherein the deoxynucleoside analog
may be gemcitabine, and the fluoropyrimidine may be 5-fluorouracil or capecitabine.
[0016] In the composition for use according to the present invention, the composition may
be a pharmaceutical composition further including pharmaceutically acceptable excipients
and additives.
[0017] In the composition for use according to the present invention, the composition may
be an anti-fibrosis composition involved in a TGF-β signaling process and therefore
inhibiting fibrosis of dermal tissue.
[0018] In the composition for use according to the present invention, the composition may
further include acceptable excipients, lubricants and additives, and may be a cosmetic
composition.
[Advantageous Effects]
[0019] According to the present invention, a peptide comprising an amino acid sequence of
SEQ. ID. NO: 1, a variant thereof in which one, two or three amino acids are modified,
wherein, in the variant, the amino acids are modified by conservative amino acid substitution
, and a composition including the same, have an excellent anti-fibrosis effect without
side effects. Therefore, tissue fibrosis caused by a TGF-βsignaling process, particularly,
fibrosis caused by cancer tissue or fibrosis caused by anticancer agents or exposure
to radiation accompanied by anticancer treatment, etc. can be effectively inhibited
and is very useful in preventing and/or treating a fibrotic disease.
[Description of Drawings]
[0020]
FIG. 1 is a diagram illustrating an entire experiment process of preparing xenograft
models, in which nude mice are inoculated with AsPCI cells and then PEP1 and gemcitabine
are administered to the mice, starting 10 days later.
FIG. 2 is a graph showing a weight of each mouse of a control in which nude mice inoculated
with AsPC1 cells are not treated with anything, of groups in which each of PEP1 and
gemcitabine is administered to nude mice inoculated with AsPC1 cells starting 10 days
after inoculation, and of a group in which a combination of PEP1 and gemcitabine is
administered to nude mice inoculated with AsPC1 cells from 10 days after inoculation
to 24 days after administration to detect in vivo anti-cancer effects of PEP1 and gemcitabine.
FIG. 3 shows cell images of the control in which the nude mice inoculated with AsPC1
cells are not treated with anything.
FIG. 4 shows cell images of the group in which PEP1 is subcutaneously administered
to the nude mice inoculated with AsPC1 cells once a day, starting 10 days after inoculation.
FIG. 5 shows cell images of the group in which gemcitabine is intraperitoneally administered
to the nude mice inoculated with AsPC1 cells once every third day, starting 10 days
after inoculation.
FIG. 6 shows cell images of the group in which both of PEP1 (once a day, subcutaneously)
and gemcitabine (once every third day, intraperitoneally) are administered to the
nude mice inoculated with AsPC1 cells starting 10 days after inoculation.
FIG. 7 is a graph showing relative Sma2 expression, which is assessed by qRT-PCR,
in a control in which a HepG2 cell line is not treated with anything and an experiment
group in which a HepG2 cell line is not treated with anything after TGF-β1 treatment,
a positive control in which SB431542 is administered into a HepG2 cell line, and experiment
groups in which PEP1 is administered into HepG2 cell lines at different concentrations
(1, 5 and 10 µM).
FIG. 8 is a graph showing Smad2 inhibition ratios (%) in each experiment group in
which HepG2 cell lines are treated with TGF-β1 and then treated with PEP1 at different
concentrations (1, 5 and 10 µM).
FIG. 9 is a graph showing relative Smad4 expression, which is assessed by qRT-PCR,
in a control in which a HepG2 cell line is not treated with anything and an experiment
group in which a HepG2 cell line is not treated with anything after TGF-β1 treatment,
a positive control in which SB431542 is administered into a HepG2 cell line, and experiment
groups in which PEP1 is administered into HepG2 cell lines at different concentrations
(1, 5 and 10 µM).
FIG. 10 is a graph showing Smad4 inhibition ratios (%) in experiment groups in which
PEP1 is administered into HepG2 cell lines at different concentrations (1, 5 and 10
µM), after TGF-β1 treatment.
FIG. 11 is a graph showing relative fibronectin expression, which is assessed by qRT-PCR,
in a control in which a HepG2 cell line is not treated with anything and an experiment
group in which a HepG2 cell line is not treated with anything after TGF-β1 treatment,
a positive control in which SB431542 is administered to a HepG2 cell line, and experiment
groups in which PEP1 is administered to HepG2 cell lines at different concentrations
(1, 5 and 10 µM).
FIG. 12 is a graph showing fibronectin inhibition ratios (%) in a positive control
in which HepG2 cell lines are treated with SB431542 and experiment groups in which
PEP1 is administered to HepG2 cell lines at different concentrations (1, 5 and 10
µM), after TGF-β1 treatment.
FIG. 13 shows cell culture states in controls in which normal human epidermal keratinocytes
(NHEKs) are treated with a placebo (sham) and experimental groups treated with 1 mM
of PEP1 10 days after one in each group is exposed to radiation (6 Gy, ionizing radiation
(IR)) and the other one in each group is not exposed.
FIG. 14 is electrophoresis images showing GRHL2, p63, N-Cad, and P-Akt expressions
in cells of controls in which NHEKs are treated with a placebo (sham) and experiment
groups treated with 1 mM of PEP1 one day and 10 days after one in each group is exposed
to radiation (6 Gy, ionizing radiation (IR)) and the other one in each group is not
exposed.
FIG. 15 is western blotting images showing p-Smad2/3, Smad4, FN, Snail and N-Cad expressions
in cells of a control in which NHEKs are treated with a placebo (sham) and an experiment
group treated with 1 mM of PEP 1 after being exposed to radiation (6 Gy, IR).
[Modes of the Invention]
[0021] Hereinafter, the present invention will be described in further detail with reference
to exemplary embodiments. However, the present invention is not limited to specific
disclosures. For explaining the present invention, the detailed descriptions on related
technology known in the art will be omitted when it is determined that they might
obscure the gist of the present invention.
[0022] Telomere, which is a repetitive genetic material located at each terminus of a chromosome,
is known to prevent damage to a corresponding chromosome or coupling to a different
chromosome. The telomere is gradually shortened with cell divisions, becoming very
short after a certain number of cell divisions, and the cell eventually stops being
divided and dies. On the other hand, the elongation of telomeres is known to extend
the life span of a cell. As an example, it has been known that, in cancer cells, an
enzyme called telomerase is secreted to prevent the shortening of telomeres, resulting
in steady proliferation of the cancer cells, without death. The inventors identified
that a peptide derived from telomerase is effective in inhibiting fibrosis and thus
completed the present invention.
[0023] In one aspect of the present invention, a peptide of SEQ. ID. NO: 1 or a variant
thereof in which one, two or three amino acids are modified, wherein, in the variant,
the amino acids are modified by conservative amino acid substitution includes telomerase,
particularly, a peptide derived from
Homo sapiens telomerase.
[0024] The following paragraph is not a part of the invention but it is disclosed in the
specification that the peptide may include a peptide having 80% or higher, 85% or
higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher,
or 99% or higher sequence homology. Also, the peptide disclosed in the specification
may include a peptide of SEQ. ID. NO: 1, a fragment thereof, and a peptide in which
at least one, two, three, four, five, six, or seven amino acids are modified.
[0025] The following paragraph is not a part of the invention but it is disclosed in the
specification that some amino acids in a peptide that makes physicochemical characteristics
of the peptide of SEQ. ID. NO: 1 changed may be modified within the scope of the present
invention. For example, amino acids may be modified to allow the peptide to have enhanced
thermal stability, changed substrate specificity, and shifted optimal pH.
[0026] The term "amino acid" used herein includes not only the 22 standard amino acids that
are naturally integrated into peptide but also the D-isomers and transformed amino
acids. Therefore, in one aspect of the present invention, a peptide herein includes
a peptide having D-amino acids. On the other hand, in another aspect of the present
invention, a peptide may include non-standard amino acids such as those that have
been post-translationally modified. Examples of post-translational modification include
phosphorylation, glycosylation, acylation (including acetylation, myristorylation,
and palmitoylation), alkylation, carboxylation, hydroxylation, glycation, biotinylation,
ubiquitinylation, a transformation of chemical properties (e.g. β-removing deimidation,
deamidation), and a structural transformation (e.g. formation of a disulfide bridge).
The post-translational modification also include changes of amino acids occurring
due to chemical reactions when coupling with crosslinkers to form a peptide conjugate,
for example, a change of an amino acid occurring at an amino group, a carboxyl group
or a side chain.
[0027] The peptide disclosed herein may be a wild-type peptide identified and isolated from
a natural source. Meanwhile, the peptide disclosed in the specification may be an
artificial variant comprising an amino acid sequence in which one or more amino acids
are substituted, deleted, and/or inserted, compared with the fragments of the peptide
of SEQ. ID. NO: 1. The changing of amino acids in the wild-type polypeptide, as well
as the artificial variant, is the substitution of conservative amino acids, which
does not have a significant influence on folding and/or activity of a protein. The
conservative substitution may be carried out in the range of the group consisting
of basic amino acids (arginine, lysine and histidine), acidic amino acid (glutamic
acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic
amino acids (leucine, isoleucine, valine and methionine), aromatic amino acids (phenylalanine,
tryptophan and tyrosine), and small amino acids (glycine, alanine, serine and threonine).
Generally, amino acid substitution that does not change a specific activity is known
in the art. The most frequently-occurring exchange takes place between Ala/Ser, Val/Ile,
Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg,
Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly, and vice versa. Other examples of
the conservative substitution are shown in Table 1 below.
[Table 1]
| Original amino acid |
Exemplary residue substitution |
Preferred residue substitution |
| Ala (A) |
val; leu; ile |
Val |
| Arg (R) |
lys; gln; asn |
Lys |
| Asn (N) |
gln; his; asp, lys; arg |
Gln |
| Asp (D) |
glu; asn |
Glu |
| Cys (C) |
ser; ala |
Ser |
| Gln (Q) |
asn; glu |
Asn |
| Glu (E) |
asp; gln |
Asp |
| |
| Gly (G) |
Ala |
Ala |
| His (H) |
asn; gln; lys; arg |
Arg |
| Ile (I) |
leu; val; met; ala; phe; norleucine |
Leu |
| Leu (L) |
norleucine; ile ; val; met; ala; phe |
Ile |
| Lys (K) |
arg; gln; asn |
Arg |
| Met (M) |
leu; phe; ile |
Leu |
| Phe (F) |
leu; val; ile; ala; tyr |
Tyr |
| Pro (P) |
Ala |
Ala |
| Ser (S) |
thr |
Thr |
| Thr (T) |
Ser |
Ser |
| Trp (W) |
tyr; phe |
Tyr |
| Tyr (Y) |
trp; phe ; thr; ser |
Phe |
| Val (V) |
ile; leu; met; phe; ala; norleucine |
Leu |
[0028] In terms of biological properties of the peptide, a substantial modification is performed
by selecting a substitution part which has a considerably different effect in (a)
maintaining the backbone structure, for example, a sheet- or helix-like three-dimensional
structure, of the polypeptide in a substituted region, (b) maintaining charge or hydrophobicity
of the molecule at a target site, or (c) maintaining the bulk of a side chain. Natural
residues are classified into the following groups, based on general properties of
the side chain:
- (1) Hydrophobic: norleucine, met, ala, val, leu, ile;
- (2) Neutral hydrophilic: cys, ser, thr;
- (3) Acidic: asp, glu;
- (4) Basic: asn, gln, his, lys, arg;
- (5) Residues affecting chain conformation: gly, pro; and
- (6) Aromatic: trp, tyr, phe.
[0029] Not according to the invention but disclosed herein are non-conservative substitutions
performed by exchanging a member of one of the groups to that of another group. Any
cysteine residue, which is not associated with maintaining the proper three-dimensional
structure of the peptide, may typically be substituted into serine, thus increasing
the oxidative stability of the molecule and preventing improper crosslinks, and, conversely,
enhanced stability can be achieved by adding cysteine bond(s) to the peptide.
[0030] Not according to the invention but disclosed herein are a different type of amino
acid variant of the peptide is made by changing a glycosylation pattern of an antibody.
The term "change" used herein refers to deletion of one or more carbohydrate residues
that are found on the peptide and/or addition of one or more glycosylation sites which
do not exist in the peptide.
[0031] Glycosylation in peptides are typically N- or O-linked glycosylation. The term "N-linked
glycosylation" used herein refers to attachment of carbohydrate residues to side chains
of asparagine residues. As tripeptide sequences, asparagine-X-serine and asparagine-X-threonine
(where the X is any amino acid, excluding proline) are recognition sequences for enzymatically
attaching a carbohydrate residue to a side chain of an asparagine. Therefore, when
one of these tripeptide sequences is present in a polypeptide, a potential glycosylation
site is created. The "O-linked glycosylation" used herein refers to the attachment
of one of the saccharides, for example, N-acetylgalactosamine, galactose, or xylose,
to hydroxyamino acids and, most typically, to serine or threonine, but 5-hydroxyproline
or 5-hydroxylysine may also be used.
[0032] Not according to the invention but disclosed herein are addition of a glycosylation
site to the peptide conveniently performed by changing the amino acid sequence to
contain the tripeptide sequence described above (for an N-linked glycosylation site).
Such a change may be made by addition of one or more serine or threonine residues
to the first antibody sequence or by substitution into one of these residues (for
an O-linked glycosylation site).
[0033] Not according to the invention but disclosed herein is the finding that the peptide
comprising the sequence of SEQ. ID. NO: 1 or a fragment thereof, or a peptide having
80% or higher sequence homology with the peptide sequence has low cytotoxicity and
high
in vivo stability. In the present invention, SEQ. ID. NO: 1 represents the telomerase-derived
peptide, which consists of 16 amino acids as follows.
[0034] The peptide set forth in SEQ. ID. NO: 1 is shown in Table 2. The "name" in the Table
2 below is given to distinguish one peptide from another. In one aspect of the present
invention, the peptide set forth in SEQ. ID. NO: 1 represents the whole peptide of
human telomerase. In another aspect of the present invention, the peptide comprising
the sequence of SEQ. ID. NO: 1 or a variant thereof in which one, two or three amino
acids are modified, wherein, in the variant, the amino acids are modified by conservative
amino acid substitution, includes a "synthetic peptide" synthesized from a peptide
present at a corresponding location that has been selected from the peptides included
in telomerase. SEQ. ID. NO: 2 represents the full-length amino acid sequence of the
telomerase.
[Table 2]
| SEQ. ID. NO: |
Name |
Position on telomerase |
Sequence |
Length |
| 1 |
pep1 |
[611-626] |
EARPALLTSRLRFIPK |
16 aa |
| 2 |
|
[1-1132] |
 |
1132 aa |
| |
|
|
 |
|
[0035] In one aspect, the present invention provides a pharmaceutical composition, which
includes a peptide with an anti-fibrosis effect, for example, a peptide comprising
an amino acid sequence of SEQ. ID. NO: 1 or a variant thereof in which one, two or
three amino acids are modified, wherein, in the variant, the amino acids are modified
by conservative amino acid substitution, as an active ingredient.
[0036] The anti-fibrosis pharmaceutical composition according to an aspect of the present
invention may include a peptide comprising an amino acid sequence of SEQ. ID. NO:
1 or a variant thereof in which one, two or three amino acids are modified, wherein,
in the variant, the amino acids are modified by conservative amino acid substitution,
at a content of 0.01 mg/kg to 0.1 mg/kg, 1 mg/kg, or 10 mg/kg, and when there is a
difference in effect according to content, the content may be suitably adjusted. When
the composition includes the peptide in the above range or a smaller range, it is
suitable for exhibiting an effect intended by the present invention and is able to
satisfy both stability and safety requirements of the composition. Moreover, the above
range may be appropriate in terms of cost-effectiveness.
[0037] In one aspect, the present invention provides a use of a peptide comprising an amino
acid sequence of SEQ. ID. NO: 1 or a variant thereof in which one, two or three amino
acids are modified, wherein, in the variant, the amino acids are modified by conservative
amino acid substitution, to prepare any one of the compositions for inhibiting fibrosis
described above.
[0038] The composition according to an aspect of the present invention may be applied to
all types of animals including humans, dogs, chickens, pigs, cows, sheep, guinea pigs,
and monkeys.
[0039] In one aspect of the present invention, the composition may be a pharmaceutical composition
including a peptide having an anti-fibrosis effect, wherein the peptide consists of
the amino acid sequence of SEQ. ID. NO: 1 or is a variant thereof in which one, two
or three amino acids are modified, wherein, in the variant, the amino acids are modified
by conservative amino acid substitution.. The pharmaceutical composition according
to an aspect of the present invention may be for administration orally, rectally,
percutaneously, intravenously, intramuscularly, intraperitoneally, intramedullaryly,
intrathecally or subcutaneously.
[0040] Dosage form for oral administration may be, but not limited to, tablets, pills, soft
or hard capsules, granules, a powder, a solution, or an emulsion. Dosage form for
parenteral administration may be, but not limited to, injections, drips, lotions,
ointments, gels, creams, suspensions, emulsions, a suppository, a patch, or a spray.
[0041] The pharmaceutical composition according to one aspect of the present invention,
as necessary, may include additives such as diluents, excipients, lubricants, binders,
disintegrants, buffers, dispersants, surfactants, coloring agents, flavorings, or
sweeteners. The pharmaceutical composition according to one aspect of the present
invention may be prepared by a conventional method used in the art.
[0042] The active ingredient of the pharmaceutical composition according to one aspect of
the present invention may vary according to the patient's age, sex, weight, pathological
condition and severity, administration route, or a prescriber's judgment. Administration
doses are determined based on these factors by one of ordinary skill in the art, and
a daily dose of the pharmaceutical composition may be, for example, 0.1 µg/kg/day
to 1 g/kg/day, specifically, 1 µg/kg/day to 100 mg/kg/day, more specifically, 10 µg/kg/day
to 10 mg/kg/day, and further more specifically, 50 µg/kg/day to 1 mg/kg/day, but when
there is a difference in effect according to dose, the dose may be suitably adjusted.
The pharmaceutical composition according to one aspect of the present invention may
be for administration once to three times a day, but the present invention is not
limited thereto.
[0043] According to the present invention, the composition is an anti-fibrosis composition,
which includes a peptide comprising an amino acid sequence of SEQ. ID. NO: 1 or a
variant thereof in which one, two or three amino acids are modified, wherein, in the
variant, the amino acids are modified by conservative amino acid substitution, as
an active ingredient.
[0044] In one aspect of the present invention, the composition may be a composition for
inhibiting fibrosis, which is caused by cancer tissue, particularly, pancreatic cancer,
stomach cancer, renal cell carcinoma, prostate cancer, larynx cancer, esophageal cancer,
thyroid cancer, lung cancer, breast cancer, large and small intestine cancer, uterine
cancer, cervical cancer, cancer of uterine body, urinary bladder cancer, genitourinary
cancer, bladder cancer, and skin cancer tissue.
[0045] The composition according to one aspect of the present invention may be prepared
in the form of a tablet, a granule, a powder, a liquid, or a solid. For each form,
ingredients, other than an active ingredient, that are conventionally used in the
corresponding field, may be easily mixed depending on the form or the purpose of use
by one of ordinary skill in the art and may have a synergistic effect when simultaneously
applied with a different base material.
[0046] Administration doses of the active ingredient are determined by one of ordinary skill
in the art, a daily dose of the pharmaceutical composition may be, for example, specifically
1 µg/kg/day to 100 mg/kg/day, more specifically 10 µg/kg/day to 10 mg/kg/day, and
further more specifically 50 µg/kg/day to 1 mg/kg/day, and, when there is a difference
in effect according to a content, the dose may be suitably adjusted and may vary depending
on various factors including a subject's age, health condition, complications, etc.
[0047] The terms used in the specification are used only to explain specific examples and
not to limit the present invention. Nouns without a number in front thereof do not
limit quantity and indicate that at least one article describe by the noun exists.
The terms "include", "have" and "contain" are construed as open terms (that is, means
that "includes but is not limited").
[0048] The mention of a value range is simply because it is an easy way to substitute an
alternative to each value included in the range. Unless particularly disclosed otherwise,
each value is incorporated herein as if it is individually referred to the specification.
End values in all ranges are included in each of the ranges and can be independently
combined. All of the methods mentioned herein may be performed in suitable order unless
disclosed otherwise or clearly contradicted by the context. The use of any or all
of the embodiments or exemplary language (e.g., "such as") is not only to describe
better the present invention, but also to limit the scope of the present invention.
No language in the specification should be construed indicating that a non-claimed
component is essential for implementation of the present invention. Unless defined
otherwise, a technical or scientific term used herein has the same meaning as that
usually understood by one of ordinary skill in the art.
[0049] Exemplary embodiments of the present invention include the best mode known to the
inventors in order to implement the present invention. Variations of the exemplary
embodiments may be clearly understood by those of ordinary skill in the art by reading
the above descriptions. The inventors expect those of ordinary skill in the art to
suitably utilize such variations, and further expect that the present invention is
implemented in modes that are different from that described in the specification.
Moreover, all combinations of the components mentioned in all possible variations
are included in the present invention unless disclosed otherwise or is clearly contradictory
to the context.
[0050] Hereinafter, the configuration and effect of the present invention will be described
in further detail with reference to examples and experimental examples. While the
examples and experimental examples below are merely provided to help in understanding
the present invention, the category and scope of the present invention are not limited
thereto.
[Modes of the Invention]
Example 1: Synthesis of peptides
1. Synthesis of peptides
[0051] A peptide of SEQ. ID. NO: 1 (hereinafter, referred to as "PEP1") was prepared according
to conventionally known solid peptide synthesis. Specifically, peptides were synthesized
by coupling amino acids one by one from the C-terminus through a Fmoc solid phase
peptide synthesis (SPPS) using ASP48S (Peptron, Inc., Daejeon, Korea). Resins to which
the first amino acid at the C-terminus of peptides is attached, which were used herein,
are as follows:
NH2-Lys(Boc)-2-chloro-Trityl Resin
NH2-Ala-2-chloro-Trityl Resin
NH2-Arg(Pbf)-2-chloro-Trityl Resin
[0052] In all amino acid components used in the peptide synthesis, the N-terminus was protected
by Fmoc, and all residues were protected by Trt, Boc, t-butylester (t-Bu), or 2,2,4,6,7-pentamethyl
dihydro-benzofuran-5-sulfonyl (Pbf), which were removed from acids. Such amino acid
components are as follows:
Fmoc-Ala-OH, Fmoc-Arg(Pbf)-OH, Fmoc-Glu(OtBu)-OH, Fmoc-Pro-OH, Fmoc-Leu-OH, Fmoc-Ile-OH,
Fmoc-Phe-OH, Fmoc-Ser(tBu)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Lys(Boc)-OH, Fmoc-Gln(Trt)-OH,
Fmoc-Trp(Boc)-OH, Fmoc-Met-OH, Fmoc-Asn(Trt)-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Ahx-OH, Trt-Mercaptoacetic
acid.
[0053] As coupling reagents, 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetamethylaminium hexafluorophosphate
(HBTU)/N-Hydroxxybenzotriazole (HOBt)/4-Methylmorpholine (NMM) were used. For Fmoc
deprotection, 20% piperidine in DMF was used. For separation from the synthesized
peptide from the resin and removal of the protection group of the residue, a cleavage
cocktail [TFA (trifluoroacetic acid)/TIS (triisopropylsilane)/EDT (ethanedithiol)/H
2O=92.5/2.5/2.5/2.5] was used.
[0054] Each peptide was synthesized by repeating a process of protecting corresponding amino
acids with an amino acid protection group-coupled start amino acid coupled to a solid
phase scaffold, washing with a solvent, and deprotection. After cutting off the synthesized
peptide from the resin, the peptide was purified by HPLC, assessed by MS to verify
the synthesis, and then lyophilized.
[0055] As assessed by high performance liquid chromatography, all peptides used in the example
had a purity of 95% or higher.
[0056] Detailed procedures for preparing the peptide PEP1 were as follows.
1) Coupling
[0057] Protected amino acid (8 equivalents) and coupling agents HBTU (8 equivalents)/HOBt
(8 equivalents)/NMM (16 equivalents) dissolved in DMF were added to the NH
2-Lys(Boc)-2-chloro-Trityl resin, and the reaction mixture was reacted at room temperature
for 2 hours and then sequentially washed with DMF, MeOH, and DMF.
2) Fmoc deprotection
[0058] Following the addition of 20% piperidine in DMF, the reaction mixture was reacted
at room temperature for 5 minutes two times, and then sequentially washed with DMF,
MeOH, and DMF.
3) The reactions 1 and 2 were repeatedly performed to prepare the basic backbone of
a peptide, for example, NH2-E(OtBu)-A-R(Pbf)-P-A-L-L-T(tBu)-S(tBu)-R(Pbf)L-R(Pbf)-F-I-P-K(Boc)-2-chloro-trityl
resin.
4) Cleavage: A cleavage cocktail was added to the previously synthesized peptide resin
to separate a peptide from the resin.
5) Following the addition of cooling diethyl ether to the obtained mixture, the peptide
obtained by centrifugation was precipitated.
6) Following purification by Prep-HPLC, the peptide was analyzed by LC/MS to check
molecular weight and lyophilized to obtain a powder.
Example 2: Fibrosis inhibition by PEP1 in AsPC1 cell xenograft model
[0059] To verify
in vivo anticancer effects of PEP1 and gemcitabine on pancreatic cancer, xenograft experiments
were performed using AsPC1 cell lines. A xenografting method used herein is as follows.
Preparation of reagents and materials
[0060] Reagents and materials used for the experiment are as follows. After powdery PEP1
was dissolved in 0.2 µm filtered sterile water, aliquots were stored at -70 °C and
then dissolved before use, and gemcitabine was dissolved in 100% saline. 5-fluorouracil
was dissolved in DMSO.
Preparation of cell lines
[0061] AsPC1 cell lines (Cell # 6 x 10
5 cells/ 100 ml), which were cell lines used in the experiment, are human pancreatic
cancer metastatic cells purchased from the American Type Cell Culture (ATCC, Rockville,
MD). The cell lines were cultured at 37 °C to give a cell density of 1 to 2 x 10
6/ml in Roswell Park Memorial Institute (RPMI 1640) medium containing 10% fetal bovine
serum (FBS), 50 U/ml penicillin, and 50 µg/ml streptomycin.
Experimental methods
[0062] AsPC1 cells were injected into each of nude mouse experiment groups ① to ④. The reagents
and materials and method of culturing cell lines, which were used in the experiment,
are the same as described in Example 1.
[0063] The cultured 5 x 10
6 AsPC1 cells were subcutaneously injected into nude mice (BALB/c-nu/nu nude mice,
purchased from Joongang Laboratory animal, Seoul, Korea). The injection was performed
until cancer was grown to a size of 100 mm
3 (about 10 days). Following cancer engraftment, the mice were divided into groups,
each group having a similar average weight, and then either or both of gemcitabine
and Pep1 were subcutaneously and intraperitoneally injected into the mice according
to the conditions for each of the four experiment groups below (refer to FIG. 1).
Cancer volume was measured with calipers and calculated by the following formula [width
2 x length x 0.52].
[0064] After grafting, either or both of Pep1 and gemcitabine were administered to each
of the four experiment groups.
① AsPC1 grafting control
② AsPC1 grafting + PEP1 2 mg/kg (once a day, s.c) administered group
③ 2 mg/kg grafting + gemcitabine 125 mg/kg (once every third day, i.p) administered
group
④ 2 mg/kg grafting + PEP1 2 mg/kg (once a day, s.c) + gemcitabine 125 mg/kg administered
group (once every third day, i.p)
[0065] After then, weight of each mouse was quantified every time. Also, cancer tissue sample
preparation and cell proliferation marker (PCNA)/apoptosis marker (TUNEL) staining
were performed.
[0066] For analyses of experiment results, averages between several experiment groups was
assessed by a student's t-test. The standard of statistical significance was set as
p=0.0002.
Experimental results
[0067] According to the analyses of individual experiment groups, it can be seen that, when
a combination of gemcitabine and PEP1, and gemcitabine were administered, the weight
of a mouse was the smallest at day 20 after the administration (refer to FIG. 2).
[0068] FIGS. 3 to 6 show cells in each experiment group.
[0069] In the AsPC1 cell-inoculated control (group ①; refer to FIG. 3), it was shown that
collagen parts stained in blue color (corresponding to the dark gray parts in FIG.
3) were increased between cancer cells stained in red color (corresponding to the
light gray parts in FIG. 3). That is, it can be seen that fibrosis is considerably
developed due to cancer.
[0070] In group ② in which AsPC1 cells were treated with PEP1 (refer to FIG. 4), compared
with FIG. 3, parts stained in blue color (corresponding to the dark gray parts in
FIG. 4) were not shown. This indicates that collagen was reduced, and thus, fibrosis
was considerably inhibited by PEP1.
[0071] Meanwhile, in group ③ in which AsPC1 cells were treated with gemcitabine (refer to
FIG. 5), it can be seen that parts stained in red color (corresponding to black parts
in FIG. 5) were considerably reduced, and the parts stained in blue color (corresponding
to the light gray parts in FIG. 5) were increased. This indicates that cancer cells
were killed by gemcitabine, but fibrosis was considerably developed.
[0072] Here, remaining red-colored cells may probably be an anticancer agent against CD133+
cancer stem cells. In pancreatic cancer, it was known that the CD133+ cancer stem
cells have resistance to gemcitabine, which is an anticancer agent, and development
of fibrosis around these cells demonstrates that drug delivery is not well performed.
[0073] However, compared with FIG. 5, in group ④ in which AsPC1 cells were treated with
PEP1 and gemcitabine (refer to FIG. 6), it was observed that parts stained in blue
color (corresponding to the light gray parts in FIG. 6) were reduced. It was seen
that fibrosis was considerably inhibited by PEP1, and thus the inhibition of drug
delivery due to fibrosis was considerably reduced, which indicates that intracellular
delivery of gemcitabine, which is an anticancer agent, may more easily occur.
Example 3: TGF-β inhibitory effect of PEP1 in HepG2 cell lines
[0074] To verify the TGF-β inhibitory effect of PEP1, which is considered as the main cause
of fibrosis, an experiment for confirming a TGF-β signaling inhibiting action in HepG2
cell lines was performed as follows.
Preparation of reagents and materials
[0075] Reagents and materials used in the experiment are as follows. After powdery PEP1
was dissolved in 0.2 µm filtered sterile water, aliquots were stored at -70 °C and
then dissolved before use. As a cell line, HepG2 (ATCC HB-8065; American Type Culture
Collection) was used, and recombinant human TGF-β1 was dissolved in 4 mM HCl, thereby
preparing a 10 µg/mL stock. SB431542 (Sigma) used as a positive control was prepared
in a 10 mM stock.
Preparation of cell lines
[0076] 2×10
6HepG2 cells (ATCC HB-8065) were seeded into a 60 mm petri-dish and cultured in a CO
2 incubator for 16 hours. Afterward, media were transferred to serum-free media (SFM),
and then the cells were further cultured for 24 hours. Subsequently, 10 ng/ml of TGF-β1
was added to the media, and then various concentrations of PEP1 (0.1, 1, 5, 10 µM)
were treated to media, followed by culturing for 72 hours. Each treated group was
further cultured in a CO
2 incubator for 1 hour at 37 °C.
Experiment for analyzing expression of TGF-β inhibition-related genes
[0077] RNA was extracted from peptide-treated cells using an RNeasy
® Plus Mini Kit (Qiagen) according to the manufacture's protocol. The extracted RNA
was quantified, and then cDNA was synthesized from 1 µg of total RNA using a reverse
transcription system (Promega). Afterward, qRT-PCR was performed using a CFX96-real-time
system (Bio-rad). As TGF-β-related biomarkers, mRNA expression of fibronectin (FN),
Smad2 and Smad4 were analyzed, and as a reference gene, GAPDH was used. For PCR, primers
of each gene were constructed as follows. The genes were amplified real time using
the primers of Table 3 below with 40 cycles (95 °C, 15 sec, 57 °C, 30 sec, 72 °C,
30 sec). The nucleotide sequences of the primers are as follows.
[Table 3]
| Gene |
Forward sequence (5'-3') |
Reverse sequence (5'-3') |
| FN |
CAGGATCACTTACGGAGAAACAG (SEQ. ID. NO: 3) |
GCCAGTGACAGCATACACAGTG (SEQ. ID. NO: 4) |
| Smad2 |
ATCCTAACAGAACTTCCGCC (SEQ. ID. NO: 5) |
CTCAGCAAAAACTTCCCCAC (SEQ. ID. NO: 6) |
| Smad4 |
GCATCGACAGAGACATACAG (SEQ. ID. NO: 7) |
CAACAGTAACAATAGGGCAG (SEQ. ID. NO: 8) |
| GAPDH |
AGGGCTGCTTTTAACTCTGGT (SEQ. ID. NO: 9) |
CCCCACTTGATTTTGGAGGGA (SEQ. ID. NO: 10) |
Experiment results
[0078] The TGF-β inhibitory effects of PEP1 were evaluated by qRT-PCR. Following 48-hour
culture of PEP1 in the presence of TGF-β, mRNA expression levels of TGF-β-related
genes such as Smad2 and Smad4 were measured and compared with the reference gene GAPDH
(refer to FIGS. 7, 8, 9 and 10). Compared with the non-treated control, Smad2 and
Smad4 expression was increased in the TGF-P treated group, and in the positive control
SB431542, compared with the TGF-β treated group, as the concentration of PEP1 was
increased, the Smad2 and Smad4, as TGF-β biomarkers, were concentration-dependently
inhibited.
[0079] Also, decreased expression of fibronectin, which is a TGF-β-related fibrosis gene,
shown after 48-hour culture of PEP1 in the presence of TGF-β was assessed by comparing
mRNA expression levels of fibronectin and GAPDH (refer to FIG. 11). Compared with
the non-treated negative control, in the TGF-β treated group, fibronectin expression
was increased. Meanwhile, in the positive control SB431542, compared with the TGF-β
treated group, the PEP1 treated group showed fibronectin inhibition as the concentration
of PEP1 was increased. The positive control (SB431542) showed an inhibition ratio
of 60.7%, and PEP1 showed an inhibition ratio of 22.8% to 47.5% (refer to FIG. 12).
[0080] Such results can show that PEP1 has a direct effect of inhibiting the expression
of Smad2 and Smad4, which are downstream genes involved in the TGF-β signaling mechanism,
and inhibits the fibronectin expression induced by TGF-β and thus has a possibility
as an agent for preventing and treating fibrosis.
Example 4: TGF-4 inhibitory effect of PEP1 in radiation-exposed NHEK cell lines
[0081] To confirm PEP1 effects on fibrosis induced by radiation exposure for anticancer
treatment and other tumor treatments, an experiment for confirming a TGF-β inhibitory
effect of PEP1 in radiation-exposed NHEKs was performed.
Preparation of reagents and cell lines
[0082] PEP1 synthesized according to Example 1 and a placebo (sham) as a control were prepared.
Normal human epidermal keratinocytes (NHEKs) were cultured in a monolayer to be used
for a radiation exposure experiment. For the radiation exposure experiment, ionized
radiation was used at an intensity of 6 Gy.
Experiment method
[0083] To examine the cell differentiation of NHEK cell lines according to radiation exposure,
NHEKs were treated with each of the placebo and 1 mM of PEP1, and then divided into
radiation-exposed groups and non-exposed groups, followed by culturing for 10 days
(refer to FIG. 13).
[0084] Also, to examine the change in expression levels of biomarkers for the NHEK cell
lines due to the radiation exposure, the NHEKs were treated with each of the placebo
and 1 mM of PEP1 and divided into non-exposed groups (-) and radiation-exposed groups
(+), and then expression levels of the biomarkers were examined at day 1 and day 10
after the radiation exposure (refer to FIG. 14). In measurement of the expression
levels of the biomarkers, GAPDH was used as a reference control.
[0085] In addition, to exactly observe the inhibition of TGF-β signaling by PEP1 when the
NHEKs were continuously cultured after the radiation exposure, the cells were divided
into a group in which the radiation (6 Gy, IR)-exposed NHEKs were treated with a placebo
(sham) and a 1 µM PEP1-treated group and then cultured for 10 days. The expression
levels of respective markers were observed by performing western blotting on the TGF-β
and fibrosis-related biomarkers (refer to FIG. 15).
[0086] Western blotting procedures were as follows. Peptide-treated cells were washed with
PBS twice, collected into a 1.5 mL centrifuge tube using a cell scraper, followed
by centrifugation (1,000 rpm, 4 °C, 2 minutes). After removal of the obtained supernatant,
100 µL of RIPA buffer was added to the NHEKs. The cells were cultured on ice for 40
minutes and vortexed every 10 minutes (micro-centrifuge was previously cooled at 4
°C), and then the sample was stirred using a 1 ml syringe 40 to 50 times. Finally,
the sample was centrifuged at 13,000 rpm for 15 minutes to obtain a supernatant.
[0087] 30 g of protein was transferred to a PVDF membrane (Millipore) by 8% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The PVDF membrane was blocked
with 5% skim milk, and incubated with specific primary antibodies. The antibodies
used in the experiment were as follows: fibronectin (285 kDa, 5% BSA 1:3000, ab2413,
Abcam), N-Cadherin (140 kDa, 5% BSA 1:1000, #4061, Cell Signaling), Smad4 (70 kDa,
5% BSA 1:1000, #9515, Cell Signaling), Smad 2/3 (60, 52 kDa, 5% BSA 1:1000, #3102,
Cell Signaling), P-Akt (60 kDa, 5% BSA 1:1000, #9271, Cell Signaling), pSmad 2/3 (Cell
Signaling #3102), GRHL2 (Abcam #ab15532), GAPDH (37 kDa, 5% BSA 1:1000, #2118, Cell
Signaling). Subsequently, the PVDF membrane was washed with tris-buffered saline containing
0.1% Tween-20 (TBST) and reacted with HRP-conjugated anti-rabbit antibodies (Jackson
Immuno Research Laboratories, INC.). Afterward, ECL detection (Amersham Pharmacia
Biotech) was performed, and obtained images were analyzed using an image analyzer
(GE Healthcare, ImageQuant LAS 4000).
Experimental results
[0088] In an experiment of cell differentiation in NHEK cell lines according to radiation
exposure, after a radiation exposure, a control showed differentiation (fibrosis development),
but the PEP1 treated group hardly showed differentiation even after the radiation
exposure. These results show that the progression of fibrosis caused by the radiation
exposure may be inhibited by PEP1 administration.
[0089] In an experiment for observing changes in expression levels of biomarkers in NHEK
cell lines according to radiation exposure, levels of increased expression of biomarkers
GRHL2, p63, and N-Cad 10 days after the radiation exposure were observed in each experiment
group. This showed that the expression levels of the biomarkers GRHL2 and p63, which
had TGF-β signaling inhibitory effects, were decreased in the placebo treated group
and increased in the PEP1 treated group. Such results demonstrate that the expression
of GRHL2 and p63, which have inhibitory effects on TGF-β signaling involved in fibrosis
development after the radiation exposure, were increased by PEP1.
[0090] Meanwhile, the expression level of a biomarker N-Cad expressed in fibrotic tissue
was increased in the placebo (sham) treated group and decreased in the PEP1 treated
group. The expression level of P-Akt (phosphorylation of Akt (protein kinase B)),
which is a biomarker indicating a degree of cell survival, was increased in the PEP1
treated group. These results demonstrate that not only can PEP1 inhibit fibrosis development
by the radiation exposure, but it can also be involved in a cell survival mechanism.
[0091] From the results of the experiment, PEP1 raised the expression of GRHL2 and p63 to
inhibit the TGF-β signaling process, and thus fibrosis was able to be inhibited by
the TGF-β signaling caused by the radiation exposure. Therefore, it can be seen that
PEP1 has a possibility as a drug for preventing or treating fibrosis caused by radiation
exposure and fibrosis of tissue cells.
Example 5: Verification of in vitro and in vivo radiation defensive effects and tissue
fibrosis inhibitory effects of PEP1
Preparation of reagents, cell lines and experimental animals
[0092] PEP1 synthesized according to Example 1 and a placebo (sham) used as a control were
prepared. NHEKs were cultured in a monolayer to prepare an
in vitro radiation exposure experiment. For
in vitro, in situ, and
in vivo radiation exposure experiments, ionized radiation was used at various intensities
ranging from 0 to 10 Gy (0, 2, 4, 6, 8, and 10 Gy).
[0093] Meanwhile, experimental animals were divided into two animal models. The first model
was an oral mucositis model, which was prepared by inducing an ulcer to the tongue
of each C3H mouse by exposing the head and the neck to radiation (6 Gy, IR) for 5
straight days. The second model is a dermal fibrosis model, which was prepared by
inducing local scleroderma by subcutaneously injecting 0.1 cc of a dilution of bleomycin
which was known as the cause of pulmonary fibrosis in a 0.9% NaCl aqueous solution
at a concentration of 0.5 mg/ml once a day for 24 to 28 days.
Experimental method and results
[0094] In vitro and
in situ experiments were performed on NHEK cell lines for confirming a PEP1 defensive effect
on radiation exposure damage and showed that, when NHEKs were divided into groups,
each treated with a placebo or PEP1 and then exposed to radiation at various intensities
ranging from 0 to 10 Gy (0, 2, 4, 6, 8, and 10 Gy), expression levels of a marker
exhibiting radiation exposure damage represented by radiation-induced premature senescence
(RIPS), a DNA damage response (DDR) protein, and markers for senescence-associated
heterochromatin foci (SAHF) were confirmed. The expression level of each marker was
measured using qRT-PCR, western blotting, and immunofluorescence staining. For the
measurement of the levels, senescence-associated β-galactosidase (SA β-Gal), p16INK4A,
p-p53Ser15, p-ATM, γ-H2AX, 53BP1,H3K9me3, HP1γ, and HMGA2 were used as markers.
[0095] Meanwhile, to confirm a PEP1 inhibitory effect on tissue fibrosis induced by TGF-β
or bleomycin treatment in NHEK cell lines through an
in vitro experiment, NHEKs were treated with each of a placebo and PEP1 to give a final concentration
of 10 µg/ml, cultured, and treated with TGF-β and bleomycin every 48 hours, followed
by measuring expression levels of fibronectin (FN) and collagen type 1 (Col 1α1) using
qRT-PCR and western blotting. For the
in vivo experiment, first, in the first oral mucositis model, C3H mice were divided into
groups, each intraperitoneally treated with a placebo or PEP1 to give a final dose
of 1 mg/kg and exposed to radiation (6 Gy, IR) for five consecutive days to induce
a tongue ulcer corresponding to an oral mucositis. Ten days later, the mice were sacrificed
to collect tongue tissue, which was stained with toluidine blue and by H&E staining,
to perform biopsy. In addition, using a comparative control which was treated with
rapamycin for 5 days at a dose of 5 mg/kg per day, an experiment for relatively examining
PEP1 effects was performed.
[0096] Meanwhile, in the second dermal fibrosis model, C3H mice were divided into groups,
each intraperitoneally treated with a placebo or PEP1 to give the final dose of 50
mg/kg, and subcutaneously treated with bleomycin at the concentrations mentioned in
the preparation of the experimental animals for 24 to 28 days. 28 days later, the
mice were sacrificed to detect scleroderma, followed by an experiment for examining
fibrosis diffusion using Masson's trichrome staining.
[0097] According to the
in vitro and
in vivo animal model experiments, it can be seen that the PEP1 treatment exhibits a defensive
effect on radiation exposure damage. Specifically, according to the
in vitro experiment, it can be seen that the PEP1 has an RIPS inhibitory effect, which was
indicated by inhibition of the marker expression, and according to the
in vivo experiment, it can be seen that the PEP1 has defensive effects against exposure to
radiation and induction of tissue fibrosis, which were indicated by biopsy.
[0098] According to the experiment examples, it can be seen that the PEP1 and the composition
including the PEP1 according to the present invention have effects of preventing or
treating senescence and diseases related to cellular fibrosis occurring in various
regions due to various reasons including TGF-β signaling, tissue fibrosis caused by
cancer, treatment with an anticancer agent, and radiation exposure. Therefore, it
is concluded that a therapeutic agent for preventing or treating fibrosis-related
senescence and diseases can be developed using PEP1 and a composition including the
PEP1 according to the present invention.
<110> GEMVAX & KAEL CO., LTD. KIM, Sangjae
<120> A Peptide Possessing Fibrosis Inhibition Activity and the Composition Comprising
the Same
<130> OF15P068PCT
<150> KR 10-2014-0043586
<151> 2014-04-11
<160> 10
<170> PatentIn version 3.2
<210> 1
<211> 16
<212> PRT
<213> Homo sapiens
<400> 1

<210> 2
<211> 1132
<212> PRT
<213> Homo sapiens
<400> 2




<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> FN forward primer
<400> 3
caggatcact tacggagaaa cag 23
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> FN reverse primer
<400> 4
gccagtgaca gcatacacag tg 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Smad2 forward primer
<400> 5
atcctaacag aacttccgcc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Smad2 reverse primer
<400> 6
ctcagcaaaa acttccccac 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Smad4 forward primer
<400> 7
gcatcgacag agacatacag 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Smad4 reverse primer
<400> 8
caacagtaac aatagggcag 20
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> GAPDH forward primer
<400> 9
agggctgctt ttaactctgg t 21
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> GAPDH reverse primer
<400> 10
ccccacttga ttttggaggg a 21