BACKGROUND OF THE INVENTION
[0002] Integration associated safety concerns using lentiviral or retroviral vectors are
a major concern for modification of cells used for ACT. Some advances have been made
to avoid on-target or off-target unwanted side effects, such as RNA transfection of
T cells with T cell receptor (TCR) or CAR RNA electroporation (
Zhao, 2006, Mol Ther 13:151-159; Mitchell et al.,
Smits et al., 2004, Leukemia 18:1898-1902). By minimizing dosage of both RNA and T cells, such methods efficiently permit the
introduction of multiple genes into cells. However, the major constraint for transient
expression of CARs is the suboptimal effector activity and functionality of RNA transfected
T cells. Multiple T cell infusions and/or significant use of low dose chemotherapy
have been used to improve CAR function (
Barrett et al., 2013, Hum Gene Ther 24(8):717-27).
[0003] Various attempts have been made to improve effector activity and functionality of
CARs while in order to avoid the need for combination therapies and additional treatments.
Increasing RNA during the transfection process poses a negative impact on T cell function,
especially in vivo anti-tumor activities (
Barrett et al., 2011, Hum Gene Ther 22:1575-1586). Alternative constructs fusing an anti-CD3 antigen antibody fragment to an anti-tumor
antigen antibody fragment have also been tested in clinical trials for cancer treatments
(
Bargou et al., 2008, Science 321:974-977;
Klinger et al., 2012, Blood 119:6226-6233.). Unfortunately, these constructs were severely limited in functionality because
of a short half-life, poor accessibility to target cell sites, and a lack of proper
long term signaling function.
[0006] Clinical TCR studies have been hampered by low expression levels of the transduced
TCR, as well as mispairing of α and β chains. Because four TCRs can potentially be
expressed at the cell surface when a T cell transcribes the chains of two different
TCRs (native alpha/beta, exogenous alpha/beta, and native/exogenous "mispaired" heterodimers),
significant obstacles to the use of this approach are evident. In studies performed
to date, preclinical studies have clearly demonstrated that TCR miss-pairings have
the potential to induce harmful recognition of self-antigens.
[0007] Although early TCR and CAR T cell clinical data obtained in treating cancers has
shown promising results, the risk to the patient is high, and some patients' T cells
are not potent enough for effective treatment even after TCR or CAR redirection, forcing
modification of allogeneic donor-derived T cells. However, the endogenous αβ T-cell
receptor an infused allogeneic T cells may recognize major and minor histocompatibility
antigens in the recipient, leading to graft- versus-host-disease (GVHD). As a result,
the majority of current clinical trials using infusion of autologous CAR T cells rely
on immune tolerance to prevent TCR-mediated deleterious recognition of normal tissues
after adoptive cell transfer. This approach has achieved early clinical successes
but is limited by the time and expense to manufacture patient-specific T-cell products.
Therefore a need exists for safer methods of modifying T cells, while circumventing
the time and expense to manufacture patient-specific T-cell products.
SUMMARY OF THE INVENTION
[0008] The subject matter of the invention is as set out in the appended claims.
[0009] One aspect of the invention relates to a modified T cell comprising:
- (a) a nucleic acid capable of decreasing or eliminating expression of an endogenous
FAS gene; and
- (b) a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen
binding domain, a transmembrane domain and an intracellular domain of a costimulatory
molecule.
[0010] A further aspect of the invention relates to a method for generating a modified T
cell comprising:
introducing into a T cell
- (a) a nucleic acid capable of decreasing or eliminating expression of an endogenous
FAS gene; and
- (b) a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen
binding domain, a transmembrane domain and an intracellular domain of a co-stimulatory
molecule.
[0011] A further aspect of the invention relates to a pharmaceutical composition comprising
the above modified T cell of the invention for use as a medicament.A further aspect
of the invention relates to a pharmaceutical composition comprising the above modified
T cell of the invention for use in a method of treating a disease or condition associated
with enhanced immunity in a subject, said method comprising administering an effective
amount of said pharmaceutical composition to a subject in need thereof.
[0012] A further aspect of the invention relates to a pharmaceutical composition comprising
the above modified T cell of the invention for use in a method of treating an autoimmune
disease in a subject, said method comprising administering to the subject a therapeutically
effective amount of said pharmaceutical composition, wherein said autoimmune disease
is preferably selected from the group consisting of Acquired Immunodeficiency Syndrome
(AIDS), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune
Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner
ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic
purpura (ATP), Behcet's disease, cardiomyopathy, celiac sprue-dermatitis hepetiformis,
chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating
polyneuropathy (CIPD), cicatricial pemphigoid, cold agglutinin disease, crest syndrome,
Crohn's disease, Degas' disease, dermatomyositis-juvenile, discoid lupus, essential
mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre
syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia
purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic
arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed
connective tissue disease, multiple sclerosis, myasthenia gravis, pemacious anemia,
polyarteritis nodosa, polychondritis, polyglandular syndromes, polymyalgia rheumatica,
polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis,
psoriasis, psoriatic arthritis, Raynaud's phenomena, Reiter's syndrome, rheumatic
fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis
(PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome, stiff-man syndrome,
systemic lupus erythematosus, Takayasu arteritis, temporal arteritis/giant cell arteritis,
ulcerative colitis, uveitis, vitiligo, Wegener's granulomatosis, and any combination
thereof.
[0013] A further aspect of the invention relates to a pharmaceutical composition comprising
the above modified T cell of the invention for use in a method of treating cancer
in a subject, said method comprising administering to the subject a therapeutically
effective amount of said pharmaceutical composition, wherein the cancer is preferably
selected from the group consisting of breast cancer, prostate cancer, ovarian cancer,
cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer,
liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and any combination thereof.
[0014] A further aspect of the invention relates to a pharmaceutical composition comprising
the above modified T cell of the invnetion for use in a method for stimulating a T
cell-mediated immune response to a target cell or tissue in a subject, said method
comprising administering to a subject an effective amount of said pharmaceutical composition,
wherein said method preferably comprises inducing lysis of the target cell or tissue,
wherein said induced lysis is preferably antibody-dependent cell-mediated cytotoxicity
(ADCC).
[0015] A further aspect of the invention relates to a pharmaceutical composition comprising
the above modified T cell of the invention for use in a method for adoptive cell transfer
therapy, said method comprising administering an effective amount of said pharmaceutical
composition to a subject in need thereof to prevent or treat an immune reaction that
is adverse to the subject.
[0016] A further aspect of the invention relates to a composition comprising the modified
T cell generated according to the above method of the invention.
[0017] A further aspect of the invention relates to a pharmaceutical composition comprising
the modified T cell generated according to the method of the invention and a pharmaceutically
acceptable carrier.
[0018] As described herein, the present invention relates to compositions and methods for
generating a modified T cell with a nucleic acid capable of altering gene expression
of an endogenous gene being FAS and further comprising a nucleic acid encoding a chimeric
antigen receptor (CAR).
[0019] One aspect of the invention includes a modified T cell comprising a nucleic acid
capable of downregulating gene expression of an endogenous gene being , , FAS; and
a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding
domain, a transmembrane domain and an intracellular domain of a co-stimulatory molecule.
[0020] The methods of treatment recited in the following paragraphs in the context of the
invention are to be understood as pertaining to the recited substance(s) for use in
methods for treating the recited diseases/conditions.
[0021] In yet another aspect, the invention includes a method of treating a disease or condition
associated with enhanced immunity in a subject comprising administering an effective
amount of a pharmaceutical composition comprising the modified T cell described herein
to a subject in need thereof.
[0022] In still another aspect, the invention includes a method of treating a condition
in a subject, comprising administering to the subject a therapeutically effective
amount of a pharmaceutical composition comprising the modified T cell described herein.
[0023] In another aspect, the invention includes a method for stimulating a T cell-mediated
immune response to a target cell or tissue in a subject comprising administering to
a subject an effective amount of a pharmaceutical composition comprising the modified
T cell described herein.
[0024] In yet another aspect, the invention includes a method for adoptive cell transfer
therapy comprising administering an effective amount of a pharmaceutical composition
comprising the modified T cell described herein to a subject in need thereof to prevent
or treat an immune reaction that is adverse to the subject.
[0025] In another aspect, the invention includes a composition comprising the modified T
cell generated according to the method described herein.
[0026] In yet another aspect, the invention includes a pharmaceutical composition comprising
the modified T cell generated according to the method described herein.
[0027] In various embodiments of the above aspects or any other aspect of the invention
delineated herein, the nucleic acid capable of downregulating gene expression is selected
from the group consisting of an antisense RNA, antagomiR siRNA, shRNA, and a CRISPR
system, such as an pAd5/F35-CRISPR vector.
[0028] In one embodiment, the the antigen binding domain of the CAR comprises an antibody
selected from the group consisting of a monoclonal antibody, a polyclonal antibody,
a synthetic antibody, human antibody, humanized antibody, single domain antibody,
single chain variable fragment, and antigen-binding fragments thereof. In another
embodiment, the antigen binding domain of the CAR specifically binds an antigen on
a target cell. In yet another embodiment, the intracellular domain of the CAR comprises
dual signaling domains.
[0029] In another embodiment, modified T cell described herein further comprises an exogenous
nucleic acid encoding a costimulatory molecule, such as CD3, CD27, CD28, CD83, CD86,
CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In one embodiment, the method of generating the
modified T cell described herein further comprises electroporating a RNA encoding
a co-stimulatory molecule into the T cell. In some embodiments where the costimulatory
molecule is CD3, the CD3 comprises at least two different CD3 chains, such as CD3
zeta and CD3 epsilon chains.
[0030] In another embodiment, the T cell is obtained from the group consisting of peripheral
blood mononuclear cells, cord blood cells, a purified population of T cells, and a
T cell line.
[0031] In yet another embodiment, the method of generating the modified T cell as described
herein further comprises expanding the T cell. In one embodiment, expanding the T
cell comprises culturing the T cell with a factor selected from the group consisting
of flt3-L, IL-1, IL-3 and c-kit ligand.
[0032] In still another embodiment, the method of generating the modified T cell as described
herein further comprising cryopreserving the T cell. In another embodiment, the method
described herein further comprises thawing the cryopreserved T cell prior to introducing
the nucleic acid into the T cell.
[0033] In one embodiment, introducing the nucleic acid is selected from the group consisting
of transducing the expanded T cells, transfecting the expanded T cells, and electroporating
the expanded T cells.
[0034] In yet another embodiment, the method described herein further comprises expressing
Klf4, OctS/4 and Sox2 in the T cells to induce pluripotency of the T cell.
[0035] In various embodiments of the above aspects or any other aspect of the invention
delineated herein, the invention includes administering the modified T cell to a subject.
In one embodiment, the subject has a condition, such as an autoimmune disease. In
some embodiments, the autoimmune disease is selected from the group consisting of
Acquired Immunodeficiency Syndrome (AIDS), alopecia areata, ankylosing spondylitis,
antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia,
autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative
syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy,
celiac sprue-dermatitis hepetiformis; chronic fatigue immune dysfunction syndrome
(CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), cicatricial pemphigoid,
cold agglutinin disease, crest syndrome, Crohn's disease, Degos' disease, dermatomyositis-juvenile,
discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves'
disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis,
idiopathic thrombocytopenia purpura (ITP), IgA nephropathy, insulin-dependent diabetes
mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis,
Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia
gravis, pemacious anemia, polyarteritis nodosa, polychondritis, polyglandular syndromes,
polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia,
primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomena, Reiter's
syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive
systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome,
stiff-man syndrome, systemic lupus erythematosus, Takayasu arteritis, temporal arteritis/giant
cell arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's granulomatosis, and
any combination thereof.
[0036] In another embodiment, the condition is a cancer, such as a cancer selected from
the group consisting of breast cancer, prostate cancer, ovarian cancer, cervical cancer,
skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain
cancer, lymphoma, leukemia, lung cancer, and any combination thereof.
[0037] In another embodiment, the method described herein further comprises inducing lysis,
such as antibody-dependent cell-mediated cytotoxicity (ADCC), of the target cell or
tissue.
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The following detailed description of preferred embodiments of the invention will
be better understood when read in conjunction with the appended drawings. For the
purpose of illustrating the invention, there are shown in the drawings embodiments
which are presently preferred. It should be understood, however, that the invention
is not limited to the precise arrangements and instrumentalities of the embodiments
shown in the drawings.
Figure 1, comprising Figures 1A-1C, is an illustration of the CRISPR design and targeting
of the TCR αβ-CD3 complex in 293T cells. Figure 1A shows the CRISPR. gRNA targeting
sites within the genomic locus of TCR-α and β constant region. Each exon is shown
by a block. Black blocks represent coding regions. Grey columns represent non-coding
regions. Thirteen gRNAs were designed to target exon 1 of the TCR α constant region(TRAC),
10 gRNAs target a conserved sequence on exon 1 of the TCR β constant regions 1 (TRBC1)
and 2 (TRBC2), and 10 gRNAs target exon1 of the beta-2 microglobin gene. Figure 1B
shows a typical gRNA scaffold sequence. gRNA PCR products were generated by overlap
PCR and cloned into MSGV vector with a T7 promoter. Figure 1C shows Sanger sequencing
results showing that multiple peaks exist in 293T TCR TRAC and TRBC genomic PCR products
after transfection of CAS9 mRNA and gRNAs into the cells.
Figure 2, comprising Figures 2A-2E, shows the disruption of the TCR αβ-CD3 complex
in primary T cells. Figure 2A is a table showing the parameters used for electroporating
CAS9 mRNA and gRNA into primary T cells with BTX830. 360V 1ms with 2mm cuvettes yielded
the best mean fluorescent intensity (MFI) and efficiency for electroporating day3
beads stimulated primary T cells. Figure 2B is a panel of graphs showing T cells incubated
at 32°C 5% CO2 having a much higher MFI than normal 37°C 5% CO2 condition. Figure 2C is a schematic illustration of the CRISPR system transferred
into primary T cells. CAS9 mRNA and gRNA were electro-transferred into T cells three
days after bead stimulation of primary T cells. T cells were then cultured with 100
lU/mL of IL-2 and some cells were incubated at 32°C 5% CO2 for 1 day and then for another 7 to 9 days. CD3 expression was analyzed on days 7-9
after electroporation by flow cytometry. Figure 2D is a panel of graphs showing that
the targeting efficiency at 37°C was about 2.5 times higher than at 32°C. Figure 2E
is a panel of graphs showing down regulation of CD3 on day 6 after electro-transfer
of varying amounts and ratios of CAS9 and gRNA targeting TCRβ. CD3 expression was
analyzed by staining for CD3. The representative flow data at day 6 after electroporation
is shown. Quadrant represent the percentage of CD3 negative cells in T-cell populations.
Figure 3, comprising Figures 3A-3D, shows that TCRneg alpha or beta knock out in T cells can be enriched by depletion of TCRpos T cells. Figure 3A is a panel of graphs showing CD3 expression before and after micro-bead
depletion of TCRneg alpha or beta knock out in T cells. Flow cytometry illustrates expression of CD3.
Numbers in the lower right quadrant represent the percentage of CD3 negative cells
in T-cell populations. Figure 3B is a panel of sequencing graphs showing that multiple
peaks were observed in CD3neg enriched T cell genomic PCR products. Figure 3C is a panel of graphs showing the
CD4 and CD8 T cell repertoire analysis after CD3 micro-bead enrichment in single alpha
chain, beta chain, and alpha beta double knock out T cells modified with CRISPR. Data
shows the ratio of CD8 T cell population was enriched by CRISPR modification, suggesting
CD8 T cell may be more easily modified than CD4 T cells. Figure 3D shows sequencing
results of deletions and insertions introduced to the TCR alpha and beta locus after
CRISPR modification.
Figure 4, comprising Figures 4A-4C, shows that multiple electro-transfers of gRNA
greatly improved the targeting efficiency of CRISPR system in primary T cells. Figure
4A is a panel of graphs showing that multiple electroporations of gRNAs greatly improved
the targeting efficiency. Electroporating T cells up to three times within 24 hours
gave the highest targeting efficiency, nearly 80%. In the initial experiment, only
a 15% percent of TCR targeting efficiency was achieved in T cells. Sustained expression
of CAS9 was observed after electro-transfer of CAS9 mRNA into the T cells. A likely
reason for low cleavage efficiency may be due to rapid degradation of gRNAs. A higher
CD3 negative population was obtained. Figure 4B is a panel of graphs showing that
capping impairs the function of gRNA, while early introduction of gRNAs in a second
round yielded higher efficiencies. Figure 4C is a panel of graphs showing that multiple
electro-transfers of gRNA targeting TRAC and TRBC in ND221 gave a cleavage rate of
approximately 64.5% and 57.5%, respectively.
Figure 5, comprising Figures 5A and 5B, shows TCRneg T cells could be expanded under different stimulating conditions. Figure 5A is a
panel of graphs showing that TCRneg T cells restored CD3 expression after re-introduction of TCR alpha and beta chains
into TCRneg T cells. CD3 and Vb13.1 were detected after electroporating TCR alpha and beta chain
into TCRneg T cells. CD3 expression level was comparable to TCRpos T cells. Figure 5B is a panel of graphs showing fold of expansion after different
conditions used to stimulate TCRneg T cells. PBMC REP yielded approximately 500 fold expansion, while CD3/CD28 beads,
or K562 aAPC re-stimulation yielded about 25-58 fold expansion.
Figure 6, comprising Figures 6A and 6B, shows TCRneg T cell characteristics after expansion under different conditions. Figure 6A is a
panel of graphs showing TCRneg T cell phenotype characteristics after expansion under different conditions. Figure
6B is a panel of graphs showing TCRneg T cell phenotype characteristics after expansion under different conditions.
Figure 7, comprising Figures 7A-7C, shows expanded TCRneg T cells with potent anti-tumor activity after re-direction in vitro. Figure 7A is
a panel of graphs showing that TCRneg T cells could be re-directed by introduction of an anti NY-ESO 1G4 TCR in the cells.
Compared with CAS9 MOCK group, when re-directed by 1G4 TCR, TCRneg T cells showed a higher level of Vb13.1 expression due to less miss-pairing of exo
and endogenous TCR alpha and beta chains. Figure 7B is a panel of graphs showing that
TCRneg T cells re-directed with 1G4 TCR had high de-granulation activity when cocultured
with a tumor (Nalm6-ESO) cell line. Figure 7C is a graph showing that TCRneg T cells re-directed with 1G4 TCR had high cytotoxicity against a tumor cell line.
Figure 8 is a panel of illustrations showing that directed TCRneg T cells control the growth of tumor in NSG mice after re-direction.
Figure 9, comprising Figure 9A-9D, shows that HLA-CLASS I elimination was obtained
by disruption of beta-2 microglobin. Figure 9A shows sequencing data of CRISPRs able
to disrupt the beta-2 microglobin locus in HEK293 cells. Figure 9B is a panel of graphs
showing thatbHLA-CLASS I negative T cell population was generated by disruption of
beta-2 microglobin. Figure 9C is a panel of graphs showing thatcIFNg improved the
targeting efficiency of beta-2 microglobin in primary T cells. Figure 9D is a panel
of graphs showing that HLA-CLASS Ineg T cells were enriched by microbead depletion.
Figure 10 is a panel of graphs showing simultaneous knock out of HLA-CLASS I and TCR
in primary T cells. CD4 and CD8 T cells were stimulated with CD3/CD28 dynabeads. Three
days after stimulation, expanded T cells were electroporated with CAS9 mRNA together
with TCR β constant region (TRBC) and beta-2 microglobin targeting gRNAs. Both TCR
expression and beta-2 microglobin expression were evaluated using anti-CD3 monoclonal
antibody (mAb) and anti-beta-2 microglobin mAb six days after electroporation. Numbers
represent the percentage of population in each quadrant.
Figure 11, comprising Figures 11A-11D, shows triple knock out of HLA-CLASS I and TCR
alpha and beta chain in primary T cells. Figure 11A is a panel of graphs showing that
CD4 and CD8 T cells were stimulated with CD3/CD28 dynabeads. Three days after stimulation,
expanded T cells were electroporated with CAS9 mRNA, together with TCR alpha, beta
constant region (TRAC,TRBC) and beta-2 microglobin targeting gRNAs. Both TCR expression
and HLA-CLASS I expression were evaluated using anti-CD3 monoclonal antibody (mAb)
and anti-beta-2 microglobin mAb six days after electroporation. Numbers represent
the percentage of population in each quadrant. Figure 11B is a schematic illustrating
isolation of HLA-CLASS I and TCR alpha and beta chain triple knock out T cells. Figure
11C is a panel of graphs showing electroporation efficiency tested by GFP expression.
Figure 11D is a panel of graphs showing re-introduction of TCR alpha and beta chains
into TCRneg T cells measured by flow cytometry. About 64% of alpha negative and about 14% beta
negative population was observed in total TCRneg T cells.
Figure 12, comprising Figures 12A-12D, shows knock out of FAS in 293T cells. Figure
12A is an image showing Sanger sequencing results of multiple peaks when FAS was knocked
out in 293T cells. Figure 12B is a panel of graphs showing FACS data revealing surface
expression of FAS protein was disrupted by CRISPRs. Figure 12C is a panel of images
showing FAS protein was replaced by GFP after homologous recombination with CRISPRs.
Figure 12D is a panel of graphs of FACS data showing the percentage of homologous
recombinations with CRISPRs.
Figure 13 shows knock out of FAS in primary T cells. FACS data illustrated that surface
FAS protein expression was abolished by CRISPRs.
Figure 14, comprising Figures 14A and 14B, shows knock out of PD1 in 293T and primary
T cells. Figure 14A is an image showing Sanger sequencing results of multiple peaks
when PD1 were targeted in 293T cells. Figure 14B is a panel of graphs showing FACS
data of surface expression of PD1 protein disrupted by CRISPRs.
Figure 15, comprising Figures 15A and 15B, shows knock out of CTLA4 in 293T and primary
cells, such as CCD1079-SK. Figure 15A is an image showing Sanger sequencing results
of multiple peaks when CTLA4 were targeted in 293T cells. Figure 15B is an image showing
sequence data after limiting dilution and single cell expansion. Sanger sequencing
results identified the deletions and insertions at the CTLA4 genomic locus.
Figure 16 shows knock out of PPP2r2d in 293T. Sanger sequencing data indicated PPP2r2d
was targeted in 293T cells by CRISPRs.
Figure 17, comprising Figures 17A and 17B, shows generation of iPSCs from FAS knock
out T cells. Figure 17A is a panel of images showing morphological change during the
process of reprogramming FASneg T cells to iPSCs. Typical embryonic stem cell morphology formation indicating FASneg Tcells can be induced to pluripotent state. Figure 17B is a graph showing that FASneg T cells were reprogrammed to iPSCs at an efficiency of about 5 times of the wild
type counterparts. p53 deficient cell lines have been reported as easier to reprogram
due to the hinderance of the apoptosis pathway. FAS knock out may facilitate the reprogramming
process by a similar mechanism.
Figure 18, comprising Figure 18A and 18B, show the generation of iPSCs from CD3neg T cells. Figure 18A is a panel of images showing ES-like morphology formed by CD3neg TCR alpha or beta chain knock out T cells under defined reprogramming conditions.
The morphology remains constant after several passages. Figure 18B is a series of
graphs showing that reprogramming CD3neg T cells was about 5 time more efficient than the wild type counterparts, suggesting
that TCR knock-out may play a role in the process of T cell reprogramming or affect
the cell viability after Sendai virus infection.
Figure 19 is a graph showing knockdown of endogenous T cell receptors (TCRs) with
siRNA and adding a second disulfide bond and de-N-glycosylation to the beta chain.
Figure 20, comprising Figures 20A and 20B, shows TCR knockout by CAS9 RNA and gRNA.
Six days after electroporation, cells were analyzed for TCR expression by assessing
CD3.
Figure 21 is an illustration showing PCR sequencing results after CD3 micro-bead depletion.
Figure 22 is a panel of graphs showing re-expression of CD3 four hours after NY-ESO-1
TCR RNA electroporation.
Figure 23, comprising Figures 23A-23D, is a panel of graphs showing that knocking
down endogenous TCR enhanced both transgene expression and function of TCR RNA electroporated
T cells. Figure 23A shows TCR expression of T cells electroporated with TCR siRNA
(solid open histogram), control siRNA (dotted open histogram) and T cells without
any siRNA (filled histogram). Figure 23B shows transgene (TCR vb13.1) expression of
wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA electroporated T cells with TCR
siRNA, control siRNA, or no siRNA. Figure 23C shows NY-ESO-1 tetramer staining of
wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA electroporated T cells with TCR
siRNA, control siRNA, or no siRNA. Figure 23D shows specific lysis of a HLA-A2/NY-ESO-1
positive tumor line by TCR siRNA knockdown, wildtype NY-ESO-1 TCR RNA electroporated
T cells.
Figure 24 is a graph showing fluorescence of tumor cells after injection of T cells
into a mouse model. Ten million Nalm6-CBG-ESO-GFP (click beetle green) tumor cells
that expressed both NY-ESO-1 and GFP were intravenously injected into NOD/SCID mice.
Five days after tumor inoculation, CBR transduced and RNA electroporated T cells were
injected as indicated in the different groups and tumor cells were detected by fluorescence.
Figure 25 is a panel of images showing fluorescence of injected tumor and hybrid TCR
T cells in mouse models over time.
Figure 26 is a panel of images showing the generation of universal CAR 19 T cells.
The top of the figure is an illustration of the protocol to generate the universal
CAR19 T cells. The graph on the left shows the percentage of CAR19 positive T cells
after lentiviral-CAR19 gene transduction. The right panel of graphs shows the percentage
of TCR single negative and TCR/HLA-A double negative T cells before and after sorting.
Figure 27 is a panel of graphs and a table showing fold expansion of CD19 positive
cells after stimulation with irradiated CD19 presenting K562 cells.
Figure 28A is a panel of graphs showing the endogenous and transgenic gene expression
of K562-CD19 expanded cells.
Figure 28B is a panel of graphs showing that endogenous TCR expression remained negative
in TCR single negative cells, while TCR and HLA-A expression remained negative in
TCR/HLA-A double negative T cells after K562-CD19 stimulated expansion
Figure 29A is a panel of graphs showing that the majority of expanded universal CAR19
T cells are CD45RO positive and expressed medium levels of CD28 expression.
Figure 29B is a panel of graphs showing that the majority of expanded universal CAR19
T cells retained high levels of CD621, expression and low levels of CCR7 expression.
Figure 30A is a graph showing that CRISPR gene editing did not affect the anti-tumor
activity of universal CAR19 T cells in vitro.
Figure 30B is a panel of graphs showing that the TCR single and TCR/HLA-A double negative
CAR19 T cells showed robust lytic capacity when challenged with Nalm6 tumor cells.
Figure 30C is a panel of graphs showing cytokine secretion as part of the potent anti-tumor
activity of these cells.
Figure 30D is a panel of graphs showing TCR single ablation or TCR and HLA-A double
ablation in CAR19 T cells that exhibited similar proliferation kinetics after challenge
with Nalm6 tumor cells.
Figure 31 is a panel of images showing that CRISPR gene editing did not affect the
anti-tumor activity of universal CAR19 T cells in vivo. All the mice receiving unmanipulated
T cells and mice infused with lentiviral GFP transduced wild type T cells died within
3 weeks after tumor cell infusion. Objective tumor regression was observed for mice
receiving CAR19 T cells. CRISPR edited TCR single or TCR/HLAA double negative universal
CAR19 T cells showed the same anti-tumor activity.
Figure 32A is a panel of graphs showing TCR single or TCR and HLA-A double ablation
in T cells sharply reduced alloreactivity.
Figure 32B is a panel of graphs showing elimination of HLA-A molecule activated NK
cells with a long period of co-culture (5 days).
Figure 32C is a graph showing that no off-target activity was observed when the cells
were challenged by allogeneic whole blood PBMC for 24 hours in an IFNr Eispot assay.
Figure 33 is a panel of graphs showing that FAS ablation enhanced the anti-tumor activity
of CAR19 T cells. FAS negative C AR19 T cells were generated. FAS ablation was confirmed
by flow cytometry analysis. CAR19 gene expression of FASneg T cells was comparable
to the wild type. Even after incubation with Nalm6 tumor cells for a short period
of 4 hours, CD1 07a expression was greatly enhanced in FASneg CAR19 T cells compared
the wild type counterpart.
Figure 34A is a graph showing that FAS ablation in CAR19 T cells enhanced CART cell
survival and proliferation under in vitro antigenic conditions. FASneg CAR19 T cells expanded faster than wild type CAR19 T
cells when the cells were stimulated with high levels of CD19+ K562 cells.
Figure 34B is a panel of graphs showing FASneg CAR19 T cells had reduced apoptosis
levels as measured by Annexin V staining.
Figure 35A is a graph showing that FAS ablation in CAR19 T cells enhanced CART cell
function in an animal model. As had been observed in vitro, FASneg T cells showed enhanced proliferation as compared to the wild type T cells.
Figure 35B is a panel of images showing FASneg CAR19 group demonstrated superior anti-tumor
activity when compared to wild type group.
Figure 35C is a graph showing significant differences in bioluminescence data between
FASneg CAR19 group and wild type group.
Figure 36 is a panel of graphs showing the generation of PD1 negative PSCA-CAR T cells.
PD1 ablation was confirmed by flow cytometric analysis. PD1 negative cells were enriched
by microbead depletion. Wild type or PD1 negative PSCA-CAR T cells were expanded by
stimulation with irradiated PSCA antigen presenting PC3 tumor cells. PSCA-CAR positive
cells were enriched after expansion.
Figure 37 is a panel of graphs showing that PD1 ablation and CD137 expression in PSCA-CAR
T cells enhanced CART cell activation under in vitro antigenic conditions.
Figure 38A is a panel of images showing PD1 ablation in an in vivo PC3-PSCA-PDL1 NSG
model. The PSCA-CAR T cells demonstrated enhanced CART cell in vivo anti-tumor activity
as compared to wild type group.
Figure 38B is a graph showing the difference in tumor burden between the PD1 negative
and the wild type group.
Figure 39 is a panel of histological images showing that T cells with TCR or TCR/HLA-I
ablated did not cause graft versus host disease (GVHD). The mice treated with the
double or triple knock out CART cells did not develop any signs of GVHD. By contrast,
3 out of 4 mice from the wild-type CD19 CART group developed GVHD by day 65, which
was confirmed by histological examination of different organs.
Figure 40A is a graph showing the percent survival of animals injected with T cells
with TCR or TCR/HLA-1 ablated. Mice were sub-lethally irradiated and injected. Four
out 5 mice receiving wild type T cells died of GVHD during the 60 day study. PBS treated,
TCR single and TCR/HLA-I double ablated T cell treated groups did not show any signs
of GVHD.
Figure 40B is a panel of graphs showing the body weight of mice receiving wild type
T cells, PBS treated, TCR single or TCR/HLA-I double-ablated T cells.
Figure 41A is a panel of images showing improved anti-tumor activity of universal
CART cells after blocking PD1 and Fas pathways with CRISPR/Cas9. Superior anti-tumor
activity was detected in PD1 knock out universal CD19-CART cells when injected into
Nalm6-PDL1 bearing mice.
Figure 41B is a graph showing quantitative bioluminescence data of mice receiving
different CRISPR/Cas9 edited T cells.
Figure 42 is a panel of illustrations showing a one-shot system to generate universal
CART cells. As gRNAs are prone to degrade, a simplified one-shot method was developed
to constitutively express gRNAs together with CAR in a single lentiviral vector.
Figure 43 is a panel of graphs showing efficient gene ablation with the one-shot system.
Different amounts of CD3 ablation were observed after electro-transfer of Cas9 mRNA.
Figure 44A is a panel of images showing the morphological changes during the process
of reprogramming of iPSCs from Fas knock out T cells. Typical embryonic stem cell
morphology formation indicating FASneg Tcells can be induced to pluripotent state.
Figure 44B is a graph showing FASneg T cells reprogrammed to iPSCs at an efficiency
of about 5 times of the wild type counterparts. p53 deficient cell lines have been
reported as easier to reprogram due to the hindrance of the apoptosis pathway. FAS
knock out may facilitate the reprogramming process using a similar mechanism.
Figure 45A is a panel of images showing the ES-like morphology of iPSCs from CD3neg
TCR alpha or beta chain knock out T cells under defined reprogramming conditions.
The morphology remained constant after several passages.
Figure 45B is a graph showing that reprogramming of CD3neg T cells was about 5 times
less efficient than the wild type counterparts, suggesting that TCR knock-out may
play a role in the process of T cell reprogramming or affect the cell viability after
Sendai virus infection.
Figure 45C is a panel of images showing phosphatase staining of CD3neg iPSC cells.
Figure 46 is a panel of graphs showing induction of endogenous pluripotent stem cell
genes in different T-iPSC cell lines.
Figure 47A is a panel of images showing immunostaining for Tra-1-60 and SSEA4 expression.
Figure 47B is an image showing the confirmation of Fas knock out of T-iPSC by Sanger
sequencing.
Figure 48A is a panel of graphs showing gene ablation in naive T cells with a different
version of Cas9. CD3 was knocked out with dCas9 and FokI-Cas9.
Figure 48B is a panel of graphs showing that two gRNAs were needed for gene ablation
of dCas9 and FokI-Cas9.
Figure 48C is in image showing rare off-target events in gene modified T cells with
CRISPR/cas9.
Figure 49 is a panel of images showing the strategy of introducing CRISPR/Cas9 into
T cells. Schematic representation of gRNAs driven by the T7 promoter is shown on the
left. Schematic representation of the generation of gene-edited antigen-specific T
cells using the CRISPR system is shown on the right. T cells were electroporated with
Cas9 mRNA and gRNAs targeting a specific gene 3 days after CD3/CD28 bead stimulation
and then cultured for 24 hours at 32°C in the presence of IL2 before being returned
to the normal 37°C culture condition. Specific gene-disrupted T cells were sorted
on day 8 and redirected with CAR or TCR by lentiviral transduction or mRNA electroporation
gene transfer.
Figure 50A is a panel of graphs showing CRISPR/Cas9 mediated efficient TCR disruption
in T cells. CD3 expression of CRISPR/Cas9 edited T cells cultured at 37°C or 32°C.
Figure 50B is a panel of graphs showing CD3 expression of CRISPR/Cas9 edited T cells
cultured after sequential CRISPR RNA electroporation.
Figure 51A is a panel of graphs showing the efficient CRISPR gene disruption that
occurred in T cells. CD3 expression of T cells transferred with CRISPR using different
Cas9:gRNA ratios (upper and middle panel) and amount of total CRISPR RNA (lower panel).
Figure 51B is a table showing the targeting efficiency calculated by both flow cytometry
and clonal sequencing.
Figure 52 is an image showing the amount of TCR-targeted gene disruption measured
by a mismatch-selective T7 surveyor nuclease assay on DNA amplified from the cells.
The calculated amount of targeted gene disruption in TRAC and TRBC is shown at the
bottom. Arrows indicate expected bands.
Figure 53A is an image of indels (in gene disruption) observed by clonal sequence
analysis of PCR amplicons after CRISPR-mediated recombination of the TCR α and β locus.
Figure 53B is an image of a diagram of the human locus encoding the TCR α and β CRISPR
gRNA targeting sites within the genomic locus of the TCR α and β constant region.
Each exon is shown by a block. Arrow: sense strand gRNA targeting site; blue arrow:
anti-sense strand gRNA targeting site. Multiple peaks in the Sanger sequencing results
show the CRISPR-mediated events of NHEJ at the TRAC and TRBC genomic loci.
Figure 54 is a panel of graphs showing CD3 expression in purified TCRneg cells.
Figure 55 is a panel of graphs showing redirection of TCR/CD3neg cells via the electrotransfer of 1G4 TCR (a and β) or CAR19 mRNA.
Figure 56 is a graph showing TCR/CD3neg cell expansion after 10 days using different stimulation conditions.
Figure 57 is a panel of graphs showing that CRISPR/Cas9 editing did not impair antitumor
efficacy of primary T cells. The phenotypes of TCR/CD3neg cells after the four different expansion techniques are shown.
Figure 58 is a panel of graphs showing the relative CD19-CAR expression after electrotransfer
of CD19-CAR RNA into Cas9 MOCK and TCR/GD3neg cells.
Figure 59A is a panel of graphs showing that no significant functional difference
was observed between CD19-CAR redirected Cas9 MOCK and TCR/CD3neg cells as confirmed by CD107 release assay after incubation with Nalm6 target cells.
Representative data from 3 independent experiments are shown. Bars, standard error.
Figure 59B is a graph showing that no significant functional difference was observed
between CD19-CAR redirected Cas9 MOCK and TCR/CD3neg cells as confirmed by cytotoxicity assay after incubation with Nalm6 target cells.
Representative data from 3 independent experiments are shown. Bars, SE=standard error.
Figure 59C is a panel of graphs showing that no significant functional difference
was observed between CD19-CAR redirected Cas9 MOCK and TCR/CD3neg cells as confirmed by IL2 and IFNγ secretion after incubation with the Nalm6 target
cells. Representative data from 3 independent experiments are shown. Bars, SE=standard
error.
Figure 59D is a panel of images of NOD/scid/yc(-/-) mice (n=12) injected with 1×106 Nalm6 tumor cells (i.v.) the mice were randomly sorted into three groups. Cas9 MOCK
and TCR/CD3neg T cells (10×106) expressing the CD19-CAR after electroporation were injected i.v. every 4 days for
a total of three injections (arrows). Mice treated with T cells electroporated with
no RNA served as controls. Images were obtained from the surviving animals as indicated.
Imaging commenced 1 day before the start of T cell treatment. Bars, SE=standard error,
EP=electroporation; E:T=effector to tumor ratio; arrow, time point of T cell infusion;
ns, not significant. ****P<0.0001, ns by two-way ANOVA plus the Bonferroni post test.
Figure 59E is a graph showing the radiance of the fluorescent cells.
Figure 60 is a panel of graphs showing double and triple gene ablation by CRISPR/Cas9
to generate universal effector cells. HLA-I disruption with gRNA targeting B2M.
Figure 61 is a flow chart of the protocol to generate universal effector cells as
described herein.
Figure 62 is a panel of graphs showing that TCR ablation abrogated non-specific killing
activity. 624mel-CBG and PC3-CBG tumor cell lines were incubated with T cells pre-treated
with or without PHA at an effector to target ratio of 20:1 for 24 hours and cytotoxicity
was calculated based on a luciferase assay. Data are the means±SD; n=3.
Figure 63 is a panel of graphs showing an IFNγ Elispot assay to measure alloreactivity
of TCR and TCR/HLA disruption by challenging the gene-ablated T cells with irradiated
allogenic PBMCs (left panel) or co-culturing allogenic PBMCs with irradiated gene-ablated
T cells. Specific spots are shown on the y axis as the spots produced in the presence
of stimulators minus the spots produced by the effectors alone. **P<0.01 by Mann-Whitney
test.
Figure 64 is a panel of graphs showing that the disruption of the endogenous TCR by
CRISPR/Cas9 improved TCR-redirected T cell function. Vb13.1 and CD3 expression is
shown in T cells transfected with Cas9 mRNA alone (Cas9 Mock) or CD3neg T cells with disrupted endogenous TCR α alone (α KO), β alone ( β KO), α and β double
(α+β KO) that were electroporated with NY-ESO-1 TCR α (1G4 α,2ug), β (1G4 β,2ug) or
α+β RNA (1G4 α+β,2+2ug) RNA.
Figure 65A is a panel of graphs showing CD107a up-regulation of the TCR (1G4) α/β
RNA electroporated TCR α or β single knockout or α+β double knockout T cells stimulated
with a HLA-A2/NY-ESO-1-positive cell line (Nahn6-ESO) or the control cell line Nahn6.
Figure 65B is a graphs showing the lytic ability of TCR α+β RNA (1G4 TCR) electroporated
TCR α or β single-knockout or α+β double-knockout T cells shown in (a) in a luciferase-based
CTL assay against Nalm6-ESO.
Figure 66 is a panel of graphs showing Vbeta and CD3 expression in TCR α+β double-disrupted
T cells (TCRneg T cells) electroporated with two different NY-ESO-1 TCR RNA (1G4 TCR,10ug or 8F TCR,10ug)
compared with control Cas9 Mock T cells.
Figure 67A is a panel of graphs showing CD107a up-regulation in NY-ESO-1 TCR (1G4
TCR or 8F TCR) RNA electroporated TCR double-knockout CD8+ T cells stimulated with the HLA-A2/NY-ESO-1-positive cell lines Nalm6-ESO, 624-mel
or U266. Nalm6 was used as the negative control.
Figure 67B is a panel of graphs showing cytokine production (IL-2 and TNF-α) of NY-ESO-1
TCR (1G4 TCR or 8F TCR) RNA electroporated TCR double-knockout T cells after stimulation
with the HLA-A2/NY-ESO-1-positive cell lines Nalm6-ESO or U266; 888mel melanoma cells
were used as a negative control.*P<0. 05, **P<0. 01 ****P<0.0001, by two-way ANOVA plus the Bonferroni post test.
Figure 68 is a panel of images showing the generation of universal CART cells with
a combination of lentiviral gene transfer and CRISPR/Cas9 electroporation. A flow
chart of the generation of universal CD19-CART cells is shown. T cells were transduced
with lentiviral CD19-CAR on day 1 after stimulation, and Cas9 mRNA and gRNAs targeting
the TCR α and TCR β chains and B2M were electroporated in the T cells 2 days later.
The TCR and HLA-I double-negative cell population was enriched before re-simulation
for expansion.
Figure 69 is a panel of graphs showing CD19-CAR expression in gene-modified lenti-CD19-CAR
T cells expanded by CD3/CD28 bead stimulation after 1G4 TCR electroporation.
Figure 70 is a panel of graphs showing the phenotype of CD19-CAR T cells.
Figure 71 is a graph showing CD107a release in TCR-negative and TCR/HLA-I double-negative
CD19-CAR T cells. Representative data from 3 independent experiments are shown. Bars,
SE=standard error.
Figure 72 is a panel of graphs showing cytokine secretion of TCRnegative and TCR/HLA-I
double-negative CD19-CAR T cells. Representative data from 3 independent experiments
are shown. Bars, SE=standard error.
Figure 73 is a graph showing tumor lytic capability of TCR-negative and TCR/HLA-I
double-negative CD19-CAR T cells. Representative data from 3 independent experiments
are shown. Bars, SE=standard error.
Figure 74 a panel of graphs showing CFSE-labeled CD19-CAR and non-transduced T cells
incubated with K562 and target K562-CD19 tumor cells at a ratio of 1 to 10 for 72
hours.
Figure 75A is a graph showing BLI from mice treated with a single injection on day
7 expressing CD19-CAR and GFP using a lentiviral vector, ns, no difference by two-way
ANOVA plus the Bonferroni post test. Tumors were established in NSG mice (n=4 per
group) by i.v. injection of 1×106 Nalm6 cells. Beginning on day 7, T cells (1×107) expressing lentiviral (LV) transduced CD19-CAR were infused with a single injection.
T cells expressing LV GFP protein were injected as controls.
Figure 75B is a graph showing the overall survival of mice receiving LV-GFP, LV-CD19-CAR,
LV-CD19-CAR-TCR/CD3neg and LV-CD19-CAR-TCR/HLA-Ineg T cells. ns, no difference by the log-rank Mantel-Cox test.
Figure 76 is a panel of images showing that gene-modified CAR T cells retained antitumor
efficacy and did not induce GVHD. Tumors were established in NSG mice (n=4 per group)
by i.v. injection with 1×106 Nalm6 cells. Beginning on day 7, T cells (2×107) expressing LV-CD19-CAR were infused with a single injection. T cells expressing
LV GFP protein were injected as controls. Imaging commenced 1 day before T cell treatment.
Organs of randomly chosen mice from different treatment groups were collected on day
65 and used for CD3 immunohistochemistry staining. Figure 77 is a series of schematics
of vectors showing the design of pAd5F35-CRISPR targeting PD1, Fas and TCR alpha chain.
Figure 78 is an illustration showing the design of penton modified pAd5F35-CRISPR
with anti-CD3 ScFv, and schematic delivery of pAd5F35-CRISPR for knock in/out chimeric
antigen receptor into T cells in vitro and in vivo.
Figure 79A is a graph showing Sanger sequencing of PCR products flanking PD1-gRNA
targeting site. Adenoviral-pAd5F35-CRISPR-PD1 virus was transduced into MD231 cells.
3 days later, genomic DNA was extracted and performed PCR.
Figure 79B shows the sequences of the targeting events in MDA231 cells after Adenoviral-CRISPR
manipulation. PD1 PCR products were cloned into TOPO vector and sequenced.
Figure 80 is a chart showing that a decrease in gRNA use improved T cell fold expansion
and only slightly decreased knockout efficiency.
Figure 81 is a chart showing the parameters used for optimizing electroporation conditions
to obtain high CD3/B2M knockout efficiency with improved T cell fold expansion. Compared
with standard electroporation (EP) conditions in a 2mm cuvette (EP#10-13) or 4mm cuvette.
High CD3/B2M knockout efficiency was observed with improved T cell fold expansion
(EP#1 and 5).
Figure 82 is a chart showing optimization of EP conditions to achieve maximum fold
expansion with tolerable knockout efficiency.
Figure 83 is a chart showing additional optimization of EP conditions to achieve maximum
fold expansion with tolerable knockout efficiency.
Figure 84 diagrams the T cell stimulation, lentiviral transduction and CRISPR electroporation
procedure.
Figure 85 is a chart showing T cell numbers (upper chart) and fold expansion (lower
chart) after the electroporation and culturing procedure.
Figure 86 is a panel of graphs showing the average expansion of T cells. Fold expansion
of the T cells transduced with CD1 9 CAR alone (TD alone) or transduced with CD19
CAR and edited with CRISPR (TD/KO) (left graph). Fold expansion of the T cells on
day 10 is shown in the right graph.
Figure 87 is a panel of flow graphs showing CD3/B2M/CAR expression at day 8 of expanded
T cells.
Figure 88 is a panel of graphs showing CD3/B2M expression after CD3+ T cell depletion.
Figure 89 is a panel of graphs showing CD3/B2M expression on day 11 in CD19 CAR TD
(transduced)/CRISPR electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated
T cells; and CD19 CAR TD T cells. ND463 non-transduced (NOTD) were used as a negative
control. Figure 90 is a panel of graphs showing CD19 CAR expression on day 11 in CD19
CAR TD (transduced)/CRISPR electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR
electroporated T cells; and CD19 CAR TD T cells. ND463 non-transduced (NOTD) were
used as a negative control.
Figure 91 is a panel of graphs showing CD3/B2M/CAR expression on day 11 in CD19 CAR
TD (transduced)/CRISPR electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated
T cells; and CD19 CAR TD T cells. ND463 non-transduced (NOTD) were used as a negative
control.
Figure 92 is a chart summarizing CD3/B2M/CAR expression in CD19 CAR TD (transduced)/CRISPR
electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and
CD19 CAR TD T cells.
Figure 93 is a panel of graphs showing CD107a up-regulation in CD19 CAR TD (transduced)/CRISPR
electroporated, CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and
CD19 CAR TD T cells.
Figure 94 is a panel of graphs showing lytic activity of the T cells on day 11.
Figure 95 is a panel of graphs showing cytokine production of the T cells on day 11.
Figure 96 is a panel of graphs showing T cell expansion. No abnormal T cell growth
was observed.
DETAILED DESCRIPTION
Definitions
[0039] Unless defined otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the art to which the
invention pertains. Although any methods and materials similar or equivalent to those
described herein can be used in the practice for testing of the present invention,
the preferred materials and methods are described herein. In describing and claiming
the present invention, the following terminology will be used.
[0040] It is also to be understood that the terminology used herein is for the purpose of
describing particular embodiments only, and is not intended to be limiting.
[0041] The articles "a" and "an" are used herein to refer to one or to more than one (
i.e., to at least one) of the grammatical object of the article. By way of example, "an
element" means one element or more than one element.
[0042] "About" as used herein when referring to a measurable value such as an amount, a
temporal duration, and the like, is meant to encompass variations of ±20% or f 10%,
more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from
the specified value, as such variations are appropriate to perform the disclosed methods.
[0043] "Activation," as used herein, refers to the state of a T cell that has been sufficiently
stimulated to induce detectable cellular proliferation. Activation can also be associated
with induced cytokine production, and detectable effector functions. The term "activated
T cells" refers to, among other things, T cells that are undergoing cell division.
[0044] The term "antibody," as used herein, refers to an immunoglobulin molecule which specifically
binds with an antigen. Antibodies can be intact immunoglobulins derived from natural
sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins.
Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in
the present invention may exist in a variety of forms including, for example, polyclonal
antibodies, monoclonal antibodies, Fv, Fab and F(ab)
2, as well as single chain antibodies (scFv) and humanized antibodies (
Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, NY;
Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New
York;
Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883;
Bird et al., 1988, Science 242:423-426).
[0045] The term "antibody fragment" refers to a portion of an intact antibody and refers
to the antigenic determining variable regions of an intact antibody. Examples of antibody
fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear
antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.
[0046] An "antibody heavy chain," as used herein, refers to the larger of the two types
of polypeptide chains present in all antibody molecules in their naturally occurring
conformations.
[0047] An "antibody light chain," as used herein, refers to the smaller of the two types
of polypeptide chains present in all antibody molecules in their naturally occurring
conformations. α and β light chains refer to the two major antibody light chain isotypes.
[0048] By the term "synthetic antibody" as used herein, is meant an antibody which is generated
using recombinant DNA technology, such as, for example, an antibody expressed by a
bacteriophage as described herein. The term should also be construed to mean an antibody
which has been generated by the synthesis of a DNA molecule encoding the antibody
and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying
the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic
DNA or amino acid sequence technology which is available and well known in the art.
[0049] The term "antigen" or "Ag" as used herein is defined as a molecule that provokes
an immune response. This immune response may involve either antibody production, or
the activation of specific immunologically-competent cells, or both. The skilled artisan
will understand that any macromolecule, including virtually all proteins or peptides,
can serve as an antigen. Furthermore, antigens can be derived from recombinant or
genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide
sequences or a partial nucleotide sequence encoding a protein that elicits an immune
response therefore encodes an "antigen" as that term is used herein. Furthermore,
one skilled in the art will understand that an antigen need not be encoded solely
by a full length nucleotide sequence of a gene. It is readily apparent that the present
invention includes, but is not limited to, the use of partial nucleotide sequences
of more than one gene and that these nucleotide sequences are arranged in various
combinations to elicit the desired immune response. Moreover, a skilled artisan will
understand that an antigen need not be encoded by a "gene" at all. It is readily apparent
that an antigen can be generated synthesized or can be derived from a biological sample.
Such a biological sample can include, but is not limited to a tissue sample, a tumor
sample, a cell or a biological fluid.
[0050] The term "anti-tumor effect" as used herein, refers to a biological effect which
can be manifested by a decrease in tumor volume, a decrease in the number of tumor
cells, a decrease in the number of metastases, an increase in life expectancy, or
amelioration of various physiological symptoms associated with the cancerous condition.
An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides,
cells and antibodies of the invention in prevention of the occurrence of tumor in
the first place.
[0051] The term "auto-antigen" means, in accordance with the present invention, any self-antigen
which is recognized by the immune system as being foreign. Auto-antigens comprise,
but are not limited to, cellular proteins, phosphoproteins, cellular surface proteins,
cellular lipids, nucleic acids, glycoproteins, including cell surface receptors.
[0052] The term "autoimmune disease" as used herein is defined as a disorder that results
from an autoimmune response. An autoimmune disease is the result of an inappropriate
and excessive response to a self-antigen. Examples of autoimmune diseases include
but are not limited to, Addision's disease, alopecia areata, ankylosing spondylitis,
autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (Type 1), dystrophic
epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barr
syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple
sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid
arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathies, thyroiditis,
vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, among others.
[0053] As used herein, the term "autologous" is meant to refer to any material derived from
the same individual to which it is later to be re-introduced into the individual.
[0054] "Allogeneic" refers to a graft derived from a different animal of the same species.
[0055] "Xenogeneic" refers to a graft derived from an animal of a different species.
[0056] The term "cancer" as used herein is defined as disease characterized by the rapid
and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through
the bloodstream and lymphatic system to other parts of the body. Examples of various
cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer,
cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer,
liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like. In certain
embodiments, the cancer is medullary thyroid carcinoma.
[0057] The term "chimeric antigen receptor" or "CAR," as used herein, refers to an artificial
T cell receptor that is engineered to be expressed on an immune effector cell and
specifically bind an antigen. CARs may be used as a therapy with adoptive cell transfer.
T cells are removed from a patient and modified so that they express the receptors
specific to a particular form of antigen. In some embodiments, the CARs have been
expressed with specificity to a tumor associated antigen, for example. CARs may also
comprise an intracellular activation domain, a transmembrane domain and an extracellular
domain comprising a tumor associated antigen binding region. In some aspects, CARs
comprise fusions of single-chain variable fragments (scFv) derived monoclonal antibodies,
fused to CD3-zeta transmembrane and intracellular domain. The specificity of CAR designs
may be derived from ligands of receptors (e.g., peptides). In some embodiments, a
CAR can target cancers by redirecting the specificity of a T cell expressing the CAR
specific for tumor associated antigens.
[0058] The term "cleavage" refers to the breakage of covalent bonds, such as in the backbone
of a nucleic acid molecule. Cleavage can be initiated by a variety of methods, including,
but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both
single-stranded cleavage and double-stranded cleavage are possible. Double-stranded
cleavage can occur as a result of two distinct single-stranded cleavage events. DNA
cleavage can result in the production of either blunt ends or staggered ends. In certain
embodiments, fusion polypeptides may be used for targeting cleaved double-stranded
DNA.
[0059] As used herein, the term "conservative sequence modifications" is intended to refer
to amino acid modifications that do not significantly affect or alter the binding
characteristics of the antibody containing the amino acid sequence. Such conservative
modifications include amino acid substitutions, additions and deletions. Modifications
can be introduced into an antibody of the invention by standard techniques known in
the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative
amino acid substitutions are ones in which the amino acid residue is replaced with
an amino acid residue having a similar side chain. Families of amino acid residues
having similar side chains have been defined in the art. These families include amino
acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains
(e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine,
asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar
side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine),
beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side
chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino
acid residues within the CDR regions of an antibody can be replaced with other amino
acid residues from the same side chain family and the altered antibody can be tested
for the ability to bind antigens using the functional assays described herein.
[0060] "Co-stimulatory ligand," as the term is used herein, includes a molecule on an antigen
presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically
binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which,
in addition to the primary signal provided by, for instance, binding of a TCR/CD3
complex with an MHC molecule loaded with peptide, mediates a T cell response, including,
but not limited to, proliferation, activation, differentiation, and the like. A co-stimulatory
ligand can include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2,
4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule
(ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor,
3/TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and
a ligand that specifically binds with B7-H3. A co-stimulatory ligand also encompasses,
inter alia, an antibody that specifically binds with a co-stimulatory molecule present
on a T cell, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1,
ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3,
and a ligand that specifically binds with CD83.
[0061] A "co-stimulatory molecule" refers to the cognate binding partner on a T cell that
specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory
response by the T cell, such as, but not limited to, proliferation. Co-stimulatory
molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll
ligand receptor.
[0062] A "co-stimulatory signal", as used herein, refers to a signal, which in combination
with a primary signal, such as TCR/CD3 ligation, leads to T cell proliferation and/or
upregulation or downregulation of key molecules.
[0063] The term "CRISPR/CAS," "clustered regularly interspaced short palindromic repeats
system," or "CRISPR" refers to DNA loci containing short repetitions of base sequences.
Each repetition is followed by short segments of spacer DNA from previous exposures
to a virus. Bacteria and archaea have evolved adaptive immune defenses termed CRISPR-CRISPR-associated
(Cas) systems that use short RNA to direct degradation of foreign nucleic acids. In
bacteria, the CRISPR system provides acquired immunity against invading foreign DNA
via RNA-guided DNA cleavage.
[0064] In the type II CRISPR/Cas system, short segments of foreign DNA, termed "spacers"
are integrated within the CRISPR genomic loci and transcribed and processed into short
CRISPR RNA (crRNA). These crRNAs anneal to trans-activating crRNAs (tracrRNAs) and
direct sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins.
Recent work has shown that target recognition by the Cas9 protein requires a "seed"
sequence within the crRNA and a conserved dinucleotide-containing protospacer adjacent
motif (PAM) sequence upstream of the crRNA-binding region.
[0065] To direct Cas9 to cleave sequences of interest, crRNA-tracrRNA fusion transcripts,
hereafter referred to as "guide RNAs" or "gRNAs" may be designed, from human U6 polymerase
III promoter. CRISPR/CAS mediated genome editing and regulation, highlighted its transformative
potential for basic science, cellular engineering and therapeutics.
[0066] The term "CRISPRi" refers to a CRISPR system for sequence specific gene repression
or inhibition of gene expression, such as at the transcriptional level.
[0067] A "disease" is a state of health of an animal wherein the animal cannot maintain
homeostasis, and wherein if the disease is not ameliorated then the animal's health
continues to deteriorate. In contrast, a "disorder" in an animal is a state of health
in which the animal is able to maintain homeostasis, but in which the animal's state
of health is less favorable than it would be in the absence of the disorder. Left
untreated, a disorder does not necessarily cause a further decrease in the animal's
state of health.
[0068] The term "downregulation" as used herein refers to the decrease or elimination of
gene expression of one or more genes.
[0069] "Effective amount" or "therapeutically effective amount" are used interchangeably
herein, and refer to an amount of a compound, formulation, material, or composition,
as described herein effective to achieve a particular biological result or provides
a therapeutic or prophylactic benefit. Such results may include, but are not limited
to, anti-tumor activity as determined by any means suitable in the art.
[0070] "Encoding" refers to the inherent property of specific sequences of nucleotides in
a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis
of other polymers and macromolecules in biological processes having either a defined
sequence of nucleotides (
i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if transcription and translation
of mRNA corresponding to that gene produces the protein in a cell or other biological
system. Both the coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the non-coding strand,
used as the template for transcription of a gene or cDNA, can be referred to as encoding
the protein or other product of that gene or cDNA.
[0071] As used herein "endogenous" refers to any material from or produced inside an organism,
cell, tissue or system.
[0072] As used herein, the term "exogenous" refers to any material introduced from or produced
outside an organism, cell, tissue or system.
[0073] The term "expand" as used herein refers to increasing in number, as in an increase
in the number of T cells. In one embodiment, the T cells that are expanded ex vivo
increase in number relative to the number originally present in the culture. In another
embodiment, the T cells that are expanded ex vivo increase in number relative to other
cell types in the culture. The term "ex vivo," as used herein, refers to cells that
have been removed from a living organism, (e.g., a human) and propagated outside the
organism (e.g., in a culture dish, test tube, or bioreactor).
[0074] The term "expression" as used herein is defined as the transcription and/or translation
of a particular nucleotide sequence driven by its promoter.
[0075] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising
expression control sequences operatively linked to a nucleotide sequence to be expressed.
An expression vector comprises sufficient cis-acting elements for expression; other
elements for expression can be supplied by the host cell or in an in vitro expression
system. Expression vectors include all those known in the art, such as cosmids, plasmids
(
e.g., naked or contained in liposomes) and viruses (
e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses)
that incorporate the recombinant polynucleotide.
[0076] "Homologous" as used herein, refers to the subunit sequence identity between two
polymeric molecules,
e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules,
or between two polypeptide molecules. When a subunit position in both of the two molecules
is occupied by the same monomeric subunit;
e.g., if a position in each of two DNA molecules is occupied by adenine, then they are
homologous at that position. The homology between two sequences is a direct function
of the number of matching or homologous positions;
e.g., if half (
e.g., five positions in a polymer ten subunits in length) of the positions in two sequences
are homologous, the two sequences are 50% homologous; if 90% of the positions (
e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
[0077] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other
antigen-binding subsequences of antibodies) which contain minimal sequence derived
from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins
(recipient antibody) in which residues from a complementary-determining region (CDR)
of the recipient are replaced by residues from a CDR of a non-human species (donor
antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and
capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin
are replaced by corresponding non-human residues. Furthermore, humanized antibodies
can comprise residues which are found neither in the recipient antibody nor in the
imported CDR or framework sequences. These modifications are made to further refine
and optimize antibody performance. In general, the humanized antibody will comprise
substantially all of at least one, and typically two, variable domains, in which all
or substantially all of the CDR regions correspond to those of a non-human immunoglobulin
and all or substantially all of the FR regions are those of a human immunoglobulin
sequence. The humanized antibody optimally also will comprise at least a portion of
an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
For further details, see
Jones et al., Nature, 321: 522-525, 1986;
Reichmann et al., Nature, 332: 323-329, 1988;
Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.
[0078] "Fully human" refers to an immunoglobulin, such as an antibody, where the whole molecule
is of human origin or consists of an amino acid sequence identical to a human form
of the antibody.
[0079] "Identity" as used herein refers to the subunit sequence identity between two polymeric
molecules particularly between two amino acid molecules, such as, between two polypeptide
molecules. When two amino acid sequences have the same residues at the same positions;
e.g., if a position in each of two polypeptide molecules is occupied by an Arginine,
then they are identical at that position. The identity or extent to which two amino
acid sequences have the same residues at the same positions in an alignment is often
expressed as a percentage. The identity between two amino acid sequences is a direct
function of the number of matching or identical positions;
e.g., if half (
e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences
are identical, the two sequences are 50% identical; if 90% of the positions (e.g.,
9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
[0080] The term "immunoglobulin" or "Ig," as used herein is defined as a class of proteins,
which function as antibodies. Antibodies expressed by B cells are sometimes referred
to as the BCR (B cell receptor) or antigen receptor. The five members included in
this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody
that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal
secretions and mucus secretions of the respiratory and genitourinary tracts. IgG is
the most common circulating antibody. IgM is the main immunoglobulin produced in the
primary immune response in most subjects. It is the most efficient immunoglobulin
in agglutination, complement fixation, and other antibody responses, and is important
in defense against bacteria and viruses. IgD is the immunoglobulin that has no known
antibody function, but may serve as an antigen receptor. IgE is the immunoglobulin
that mediates immediate hypersensitivity by causing release of mediators from mast
cells and basophils upon exposure to allergen.
[0081] The term "immune response" as used herein is defined as a cellular response to an
antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce
the formation of antibodies and/or activate lymphocytes to remove the antigen.
[0082] As used here, "induced pluripotent stem cell" or "iPS cell" refers to a pluripotent
stem cell that is generated from adult cells, such as T cells. The expression of reprogramming
factors, such as Klf4, Oct3/4 and Sox2, in adult cells convert the cells into pluripotent
cells capable of propagation and differentiation into multiple cell types.
[0083] As used herein, an "instructional material" includes a publication, a recording,
a diagram, or any other medium of expression which can be used to communicate the
usefulness of the compositions and methods of the invention. The instructional material
of the kit discolsed herein may, for example, be affixed to a container which contains
the nucleic acid, peptide, and/or composition of the invention or be shipped together
with a container which contains the nucleic acid, peptide, and/or composition. Alternatively,
the instructional material may be shipped separately from the container with the intention
that the instructional material and the compound be used cooperatively by the recipient.
[0084] "Isolated" means altered or removed from the natural state. For example, a nucleic
acid or a peptide naturally present in a living animal is not "isolated," but the
same nucleic acid or peptide partially or completely separated from the coexisting
materials of its natural state is "isolated." An isolated nucleic acid or protein
can exist in substantially purified form, or can exist in a non-native environment
such as, for example, a host cell.
[0085] The term "knockdown" as used herein refers to a decrease in gene expression of one
or more genes.
[0086] The term "knockout" as used herein refers to the ablation of gene expression of one
or more genes.
[0087] A "lentivirus" as used herein refers to a genus of the Retroviridae family. Lentiviruses
are unique among the retroviruses in being able to infect non-dividing cells; they
can deliver a significant amount of genetic information into the DNA of the host cell,
so they are one of the most efficient methods of a gene delivery vector. HIV, SIV,
and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer
the means to achieve significant levels of gene transfer in vivo.
[0088] By the term "modified" as used herein, is meant a changed state or structure of a
molecule or cell of the invention. Molecules may be modified in many ways, including
chemically, structurally, and functionally. Cells may be modified through the introduction
of nucleic acids.
[0089] By the term "modulating," as used herein, is meant mediating a detectable increase
or decrease in the level of a response in a subject compared with the level of a response
in the subject in the absence of a treatment or compound, and/or compared with the
level of a response in an otherwise identical but untreated subject. The term encompasses
perturbing and/or affecting a native signal or response thereby mediating a beneficial
therapeutic response in a subject, preferably, a human.
[0090] In the context of the present invention, the following abbreviations for the commonly
occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytosine,
"G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
[0091] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence"
includes all nucleotide sequences that are degenerate versions of each other and that
encode the same amino acid sequence. The phrase nucleotide sequence that encodes a
protein or an RNA may also include introns to the extent that the nucleotide sequence
encoding the protein may in some version contain an intron(s).
[0092] The term "operably linked" refers to functional linkage between a regulatory sequence
and a heterologous nucleic acid sequence resulting in expression of the latter. For
example, a first nucleic acid sequence is operably linked with a second nucleic acid
sequence when the first nucleic acid sequence is placed in a functional relationship
with the second nucleic acid sequence. For instance, a promoter is operably linked
to a coding sequence if the promoter affects the transcription or expression of the
coding sequence. Generally, operably linked DNA sequences are contiguous and, where
necessary to join two protein coding regions, in the same reading frame.
[0093] The term "overexpressed" tumor antigen or "overexpression" of a tumor antigen is
intended to indicate an abnormal level of expression of a tumor antigen in a cell
from a disease area like a solid tumor within a specific tissue or organ of the patient
relative to the level of expression in a normal cell from that tissue or organ. Patients
having solid tumors or a hematological malignancy characterized by overexpression
of the tumor antigen can be determined by standard assays known in the art.
[0094] "Parenteral" administration of an immunogenic composition includes, e.g., subcutaneous
(s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion
techniques.
[0095] The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore,
nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides
as used herein are interchangeable. One skilled in the art has the general knowledge
that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric
"nucleotides." The monomeric nucleotides can be hydrolyzed into nucleosides. As used
herein polynucleotides include, but are not limited to, all nucleic acid sequences
which are obtained by any means available in the art, including, without limitation,
recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant
library or a cell genome, using ordinary cloning technology and PCR
™, and the like, and by synthetic means.
[0096] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably,
and refer to a compound comprised of amino acid residues covalently linked by peptide
bonds. A protein or peptide must contain at least two amino acids, and no limitation
is placed on the maximum number of amino acids that can comprise a protein's or peptide's
sequence. Polypeptides include any peptide or protein comprising two or more amino
acids joined to each other by peptide bonds. As used herein, the term refers to both
short chains, which also commonly are referred to in the art as peptides, oligopeptides
and oligomers, for example, and to longer chains, which generally are referred to
in the art as proteins, of which there are many types. "Polypeptides" include, for
example, biologically active fragments, substantially homologous polypeptides, oligopeptides,
homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives,
analogs, fusion proteins, among others. The polypeptides include natural peptides,
recombinant peptides, synthetic peptides, or a combination thereof.
[0097] The term "promoter" as used herein is defined as a DNA sequence recognized by the
synthetic machinery of the cell, or introduced synthetic machinery, required to initiate
the specific transcription of a polynucleotide sequence.
[0098] As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence
which is required for expression of a gene product operably linked to the promoter/regulatory
sequence. In some instances, this sequence may be the core promoter sequence and in
other instances, this sequence may also include an enhancer sequence and other regulatory
elements which are required for expression of the gene product. The promoter/regulatory
sequence may, for example, be one which expresses the gene product in a tissue specific
manner.
[0099] A "constitutive" promoter is a nucleotide sequence which, when operably linked with
a polynucleotide which encodes or specifies a gene product, causes the gene product
to be produced in a cell under most or all physiological conditions of the cell.
[0100] An "inducible" promoter is a nucleotide sequence which, when operably linked with
a polynucleotide which encodes or specifies a gene product, causes the gene product
to be produced in a cell substantially only when an inducer which corresponds to the
promoter is present in the cell.
[0101] A "tissue-specific" promoter is a nucleotide sequence which, when operably linked
with a polynucleotide encodes or specified by a gene, causes the gene product to be
produced in a cell substantially only if the cell is a cell of the tissue type corresponding
to the promoter.
[0102] A "Sendai virus" refers to a genus of the Paramyxoviridae family. Sendai viruses
are negative, single stranded RNA viruses that do not integrate into the host genome
or alter the genetic information of the host cell. Sendai viruses have an exceptionally
broad host range and are not pathogenic to humans. Used as a recombinant viral vector,
Sendai viruses are capable of transient but strong gene expression.
[0103] A "signal transduction pathway" refers to the biochemical relationship between a
variety of signal transduction molecules that play a role in the transmission of a
signal from one portion of a cell to another portion of a cell. The phrase "cell surface
receptor" includes molecules and complexes of molecules capable of receiving a signal
and transmitting signal across the plasma membrane of a cell.
[0105] By the term "specifically binds," as used herein with respect to an antibody, is
meant an antibody which recognizes a specific antigen, but does not substantially
recognize or bind other molecules in a sample. For example, an antibody that specifically
binds to an antigen from one species may also bind to that antigen from one or more
species. But, such cross-species reactivity does not itself alter the classification
of an antibody as specific. In another example, an antibody that specifically binds
to an antigen may also bind to different allelic forms of the antigen. However, such
cross reactivity does not itself alter the classification of an antibody as specific.
In some instances, the terms "specific binding" or "specifically binding," can be
used in reference to the interaction of an antibody, a protein, or a peptide with
a second chemical species, to mean that the interaction is dependent upon the presence
of a particular structure (e.g., an antigenic determinant or epitope) on the chemical
species; for example, an antibody recognizes and binds to a specific protein structure
rather than to proteins generally. If an antibody is specific for epitope "A", the
presence of a molecule containing epitope A (or free, unlabeled A), in a reaction
containing labeled "A" and the antibody, will reduce the amount of labeled A bound
to the antibody.
[0106] By the term "stimulation," is meant a primary response induced by binding of a stimulatory
molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal
transduction event, such as, but not limited to, signal transduction via the TCR/CD3
complex. Stimulation can mediate altered expression of certain molecules, such as
downregulation of TGF-beta, and/or reorganization of cytoskeletal structures, and
the like.
[0107] A "stimulatory molecule," as the term is used herein, means a molecule on a T cell
that specifically binds with a cognate stimulatory ligand present on an antigen presenting
cell.
[0108] A "stimulatory ligand," as used herein, means a ligand that when present on an antigen
presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically
bind with a cognate binding partner (referred to herein as a "stimulatory molecule")
on a T cell, thereby mediating a primary response by the T cell, including, but not
limited to, activation, initiation of an immune response, proliferation, and the like.
Stimulatory ligands are well-known in the art and encompass,
inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist
anti-CD28 antibody, and a superagonist anti-CD2 antibody.
[0109] The term "subject" is intended to include living organisms in which an immune response
can be elicited (e.g., mammals). A "subject" or "patient," as used therein, may be
a human or non-human mammal. Non-human mammals include, for example, livestock and
pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably,
the subject is human.
[0110] As used herein, a "substantially purified" cell is a cell that is essentially free
of other cell types. A substantially purified cell also refers to a cell which has
been separated from other cell types with which it is normally associated in its naturally
occurring state. In some instances, a population of substantially purified cells refers
to a homogenous population of cells. In other instances, this term refers simply to
cell that have been separated from the cells with which they are naturally associated
in their natural state. In some embodiments, the cells are cultured
in vitro. In other embodiments, the cells are not cultured
in vitro.
[0111] A "target site" or "target sequence" refers to a genomic nucleic acid sequence that
defines a portion of a nucleic acid to which a binding molecule may specifically bind
under conditions sufficient for binding to occur.
[0112] As used herein, the term "T cell receptor" or "TCR" refers to a complex of membrane
proteins that participate in the activation of T cells in response to the presentation
of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility
complex molecules. TCR is composed of a heterodimer of an alpha (a) and beta (β) chain,
although in some cells the TCR consists of gamma and delta (γ/δ) chains. TCRs may
exist in alpha/beta and gamma/delta forms, which are structurally similar but have
distinct anatomical locations and functions. Each chain is composed of two extracellular
domains, a variable and constant domain. In some embodiments, the TCR may be modified
on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic
T cell, a memory T cell, regulatory T cell, natural killer T cell, and gamma delta
T cell.
[0113] The term "therapeutic" as used herein means a treatment and/or prophylaxis. A therapeutic
effect is obtained by suppression, remission, or eradication of a disease state.
[0114] The term "transfected" or "transformed" or "transduced" as used herein refers to
a process by which exogenous nucleic acid is transferred or introduced into the host
cell. A "transfected" or "transformed" or "transduced" cell is one which has been
transfected, transformed or transduced with exogenous nucleic acid. The cell includes
the primary subject cell and its progeny.
[0115] To "treat" a disease as the term is used herein, means to reduce the frequency or
severity of at least one sign or symptom of a disease or disorder experienced by a
subject.
[0116] The phrase "under transcriptional control" or "operatively linked" as used herein
means that the promoter is in the correct location and orientation in relation to
a polynucleotide to control the initiation of transcription by RNA polymerase and
expression of the polynucleotide.
[0117] A "vector" is a composition of matter which comprises an isolated nucleic acid and
which can be used to deliver the isolated nucleic acid to the interior of a cell.
Numerous vectors are known in the art including, but not limited to, linear polynucleotides,
polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
Thus, the term "vector" includes an autonomously replicating plasmid or a virus. The
term should also be construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds,
liposomes, and the like. Examples of viral vectors include, but are not limited to,
Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral
vectors, lentiviral vectors, and the like.
[0118] Ranges: throughout this disclosure, various aspects of the invention can be presented
in a range format. It should be understood that the description in range format is
merely for convenience and brevity and should not be construed as an inflexible limitation
on the scope of the invention. Accordingly, the description of a range should be considered
to have specifically disclosed all the possible subranges as well as individual numerical
values within that range. For example, description of a range such as from 1 to 6
should be considered to have specifically disclosed subranges such as from 1 to 3,
from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual
numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies
regardless of the breadth of the range.
Description
[0119] Universal T cells that avoid graft vs host disease (GVHD) are highly desired in the
clinical setting. However, use of allogeneic T cells is a risk because of rejection
by the host's immune system through the recognition of HLA-A molecules. Targeting
strategies to manipulate multiple genes are complicated and efforts have yielded low
efficiency in T cells without preventing GVHD and host vs graft reactions simultaneously.
[0120] The FAS receptor/FAS ligand (FAS/FASL) apoptosis signaling pathway negatively regulates
T cell function. PD1 and CTLA4 are two major inhibitory signaling pathways in T cells.
The enhanced anti-tumor immunity that results from antibody-mediated blockade of CTLA-4,
PD-1 or PD-L1 suggests the potential to improve efficiency of immunotherapies by inhibiting
these pathways. The invention includes the generation of modified T cells wherein
FAS is depleted as a means to generate modified T cells with reduced immunogenicity.
[0121] The present invention includes methods and compositions for generating a modified
T cell by knocking down endogenous gene expression and expressing either a modified
T cell receptor or a chimeric antigen receptor. In some embodiments, the invention
includes a method for generating the modified T cell. Such a modified T cell can be
included in a therapeutic composition and administered to a patient in need thereof.
Knockdown of Endogenous Gene Expression
[0122] The present invention includes downregulation of endogenous gene expression in a
T cell, being FAS. In one embodiment, the T cell with downregulated gene expression
has reduced immunogenicity in an allogeneic environment. In another embodiment, the
T cell with reduced immunogenicity expresses a modified TCR or a CAR for targeted
effector activity.
[0123] In one aspect, the invention includes a method for generating a modified T cell comprising
introducing a nucleic acid into a T cell capable of downregulating endogenous gene
expression, where the gene is FAS. Downregulating expression of an endogenous gene
that is involved in producing an immune response to a cell, such as TCR α chain, TCR
β chain, beta-2 microglobulin, or a HLA molecule, reduces immune-mediated rejection
of the modified T cell. For example, downregulating expression of endogenous TCR,
MHC or beta-2 microglobulin genes removes surface presentation of alloantigens on
the T cell that could cause rejection by the host immune system. Also, downregulating
an endogenous gene that regulates inhibitory signaling pathways in T cells, such as
CTLA-4, PD1, and/or FAS, enhances anti-tumor efficacy of the modified T cell when
exposed to an immunosuppressive microenvironment.
[0124] In one aspect, a nucleic acid capable of downregulating endogenous gene expression
is introduced, such as by electroporation, transfection, or lenti- or other viral
transduction, into the T cell. In another aspect, the invention includes a modified
T cell comprising an electroporated nucleic acid capable of downregulating endogenous
gene expression. In yet another aspect, a modified T cell includes an electroporated
nucleic acid capable of downregulating endogenous TCR gene expression. In another
aspect, the composition comprising the modified T cell is generated according to a
method described herein. In yet another aspect, the invention includes a pharmaceutical
composition comprising the modified T cell or a modified T cell generated according
to the method described herein and a pharmaceutically acceptable carrier.
[0125] The nucleic acid capable of regulating endogenous gene expression may downregulate
the endogenous gene expression. In one embodiment, the nucleic acid capable of downregulating
endogenous gene expression is selected from the group consisting of an antisense RNA,
antagomiR, siRNA, shRNA, and a CRISPR system. Endogenous gene expression may be downregulated,
knocked-down, decreased, and/or inhibited by, for example, an antisense RNA, antagomiR,
siRNA, shRNA, a CRISPR system, etc.
CRISPR/Cas
[0126] The CRISPR/Cas system is a facile and efficient system for inducing targeted genetic
alterations. Target recognition by the Cas9 protein requires a 'seed' sequence within
the guide RNA (gRNA) and a conserved di-nucleotide containing protospacer adjacent
motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR/CAS system can
thereby be engineered to cleave virtually any DNA sequence by redesigning the gRNA
in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR/CAS
system can simultaneously target multiple genomic loci by co-expressing a single CAS9
protein with two or more gRNAs, making this system uniquely suited for multiple gene
editing or synergistic activation of target genes.
[0127] One example of a CRISPR/Cas system used to inhibit gene expression, CRISPRi, is described
in
U.S. Publication No.: 2014/0068797. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease
to introduce DNA double stranded breaks which trigger error-prone repair pathways
to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity.
When coexpressed with a guide RNA, a DNA recognition complex is generated that specifically
interferes with transcriptional elongation, RNA polymerase binding, or transcription
factor binding. This CRISPRi system efficiently represses expression of targeted genes.
[0128] CRISPR/Cas gene disruption occurs when a guide nucleic acid sequence specific for
a target gene and a Cas endonuclease are introduced into a cell and form a complex
that enables the Cas endonuclease to introduce a double strand break at the target
gene. In one embodiment, the CRISPR system comprises an expression vector, such as,
but not limited to, an pAd5F35-CRISPR vector. In one embodiment, a modified T cell
is generated by introducing a Cas expression vector and a guide nucleic acid sequence
specific for a gene into a T cell. In another embodiment, the Cas expression vector
induces expression of Cas9 endonuclease. Other endonucleases may also be used, including
but not limited to, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10,
Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof.
[0129] In one embodiment, inducing the Cas expression vector comprises exposing the T cell
to an agent that activates an inducible promoter in the Cas expression vector. In
such an embodiment, the Cas expression vector includes an inducible promoter, such
as one that is inducible by exposure to an antibiotic (e.g., by tetracycline or a
derivative of tetracycline, for example doxycycline). However, it should be appreciated
that other inducible promoters can be used. The inducing agent can be a selective
condition (e.g., exposure to an agent, for example an antibiotic) that results in
induction of the inducible promoter. This results in expression of the Cas expression
vector.
[0130] The guide nucleic acid sequence is specific for a gene and targets that gene for
Cas endonuclease-induced double strand breaks. The sequence of the guide nucleic acid
sequence may be within a loci of the gene. In one embodiment, the guide nucleic acid
sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.
[0131] The guide nucleic acid sequence may be specific for any gene, such as a gene that
would reduce immunogenicity or reduce sensitivity to an immunosuppressive microenvironment.
In one embodiment, the gene may include a sequence specific for a T cell receptor
(TCR) chain (such as an alpha, beta, gamma and/or delta chain), beta-2 microglobulin,
FAS, PD1, a major histocompatibility complex protein (such as a HLA class I molecule
and/or HLA class II molecule), CTLA-4, or any combination thereof.
[0132] The guide nucleic acid sequence includes a RNA sequence, a DNA sequence, a combination
thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides.
The guide nucleic acid sequence can be a single molecule or a double molecule. In
one embodiment, the guide nucleic acid sequence comprises a single guide RNA.
T Cell Receptor
[0133] Adoptive immunotherapy with T cells harboring antigen-specific TCRs have therapeutic
potential in the treatment of cancer and certain chronic viral infections. Gene-engineering
of T cells with a specific TCR has the advantage of redirecting the T cell to an intracellular
antigen. Given that most oncogenic proteins are intracellular, development of a panel
of TCRs specific to an oncogenic driver protein has great appeal.
[0134] The present invention also includes a modified T cell with downregulated gene expression
as described herein and an exogenous T cell receptor (TCR). In one aspect, the invention
includes a method for generating a modified T cell comprising introducing a nucleic
acid encoding a modified T cell receptor (TCR) comprising affinity for a surface antigen
on a target cell into the T cell and a nucleic acid capable of regulating endogenous
gene expression being FAS, wherein the T cells are capable of expressing the modified
TCR.
[0135] In another aspect, the invention includes a modified T cell comprising an exogenous
nucleic acid encoding a modified T cell receptor (TCR) comprising affinity for a surface
antigen on a target cell and a nucleic acid capable of downregulating endogenous gene
expression being FAS, wherein the T cell expresses the modified TCR and wherein the
endogenous gene expression is downregulated in the T cell. The invention also includes
a population of cells comprising the modified T cell described herein.
[0136] A T cell receptor is a complex of membrane proteins that participate in the activation
of T cells in response to the presentation of antigen. Stimulation of the TCR is triggered
by major histocompatibility complex molecules (MHC) on antigen presenting cells that
present antigen peptides to the T cells and bind to the TCR complexes to induce a
series of intracellular signaling cascades.
[0137] The TCR is generally composed of six different membrane bound chains that form the
TCR heterodimer responsible for ligand recognition. TCRs exist in alpha/beta and gamma/delta
forms, which are structurally similar but have distinct anatomical locations and functions.
In one embodiment, the TCR comprises a TCR alpha and TCR beta chain, such as the nucleic
acid encoding the TCR comprises a nucleic acid encoding a TCR alpha and a TCR beta
chain. In another embodiment, a TCR alpha chain or a TCR beta chain or both chains
comprise at least one N-deglycosylation.
[0138] Each chain is composed of two extracellular domains, a variable and constant domain.
In one embodiment, the TCR comprises at least one murine constant region. The constant
domain is proximal to the cell membrane, followed by a transmembrane domain and a
short cytoplasmic tail. In one embodiment, the modified TCR comprises a cytoplasmic
domain including a co-stimulatory signaling domain, such as a 4-1BB co-stimulatory
signaling domain. The variable domain contributes to the determination of the particular
antigen and MHC molecule to which the TCR has binding specificity. In turn, the specificity
of a T cell for a unique antigen-MHC complex resides in the particular TCR expressed
by the T cell.
[0139] Each of the constant and variable domains may include an intra-chain disulfide bond.
In one embodiment, TCR comprises at least one disulfide bond. The variable domains
include the highly polymorphic loops analogous to the complementarity determining
regions (CDRs) of antibodies. The diversity of TCR sequences is generated via somatic
rearrangement of linked variable (V), diversity (D), joining (J), and constant genes.
[0140] Functional alpha and gamma chain polypeptides are formed by rearranged V-J-C regions,
whereas beta and delta chains consist of V-D-J-C regions. The extracellular constant
domain includes a membrane proximal region and an immunoglobulin region.
[0141] In one embodiment, the TCR includes a wildtype TCR, a high affinity TCR, and a chimeric
TCR. When the TCR is modified, it may have higher affinity for the target cell surface
antigen than a wildtype TCR. In embodiments where the TCR is a chimeric TCR, the TCR
may include chimeric domains, such as the TCR comprises a co-stimulatory signaling
domain at a C' terminal of at least one of the chains. In other embodiment, the TCR
may include a modified chain, such as a modified alpha or beta chain. Such modifications
may include, but are not limited to, N-deglycosylation, altered domain (such as an
engineered variable region to target a specific antigen or increase affinity), addition
of one or more disulfide bonds, entire or fragment of a chain derived from a different
species, and any combination thereof.
[0142] In one embodiment, the TCR comprises specificity to a target cell antigen. The target
cell surface antigen may include any type of ligand that defines the surface of a
target cell. For example, the target cell surface antigen may be chosen to recognize
a ligand that acts as a cell surface marker on target cells associated with a particular
disease state. Thus examples of cell surface markers that may act as ligands for the
antigen binding domain of the TCR including those associated with viral, bacterial
and parasitic infections, autoimmune disease and cancer cells. In one embodiment,
the target cell surface antigen includes any tumor associated antigen (TAA) and viral
antigen, disease cell associated antigen, or any fragment thereof.
[0143] The target cell antigen may include any protein that can be processed and presented
by major histocompability complexes. For example, the target antigen may be associated
with a particular disease state. Thus examples of cell markers that may act as targets
of the TCR include those associated with viral, bacterial and parasitic infections,
autoimmune disease and cancer cells. In one embodiment, the target antigen includes
any of tumor associated antigens (TAA) and viral antigens, or any fragment thereof.
[0144] In one aspect, the invention includes a population of modified T cells comprising
a nucleic acid encoding a modified T cell receptor (TCR) comprising affinity for a
surface antigen on a target cell and a nucleic acid capable of downregulating
[0145] FAS, wherein the T cells are capable of expressing the modified TCR.
[0146] Techniques for engineering and expressing T cell receptors include, but are not limited
to, the production of TCR heterodimers which include the native disulphide bridge
which connects the respective subunits (
Garboczi, et al., (1996), Nature 384(6605): 134-41;
Garboczi, et al., (1996), J Immunol 157(12): 5403-10;
Chang et al., (1994), PNAS USA 91: 11408-11412;
Davodeau et al., (1993), J. Biol. Chem. 268(21): 15455-15460;
Golden et al., (1997), J. Imm. Meth. 206: 163-169;
U.S. Pat. No. 6,080,840).
Chimeric Antigen Receptor (CAR)
[0147] The present invention also includes a modified T cell with downregulated gene expression
as described herein and a CAR. Thus, the present invention encompasses the modified
T cell comprising a CAR or a nucleic acid encoding a CAR, wherein the CAR includes
an antigen binding domain, a transmembrane domain and an intracellular domain.
[0148] In one aspect, the invention includes a method of generating a modified T cell comprising
introducing a nucleic acid capable of downregulating endogenous gene expression being
FAS into a T cell and a nucleic acid encoding a chimeric antigen receptor (CAR) into
the T cell, wherein the CAR comprises an antigen binding domain, a transmembrane domain
and an intracellular domain of a co-stimulatory molecule.
[0149] In another aspect, the invention includes a modified T cell comprising a nucleic
acid capable of downregulating endogenous gene expression and a nucleic acid encoding
a chimeric antigen receptor (CAR), wherein the downregulated gene expression is FAS,
and wherein the CAR comprises an antigen binding domain, a transmembrane domain and
an intracellular domain of a co-stimulatory molecule. In one embodiment, the modified
T cell further comprises an exogenous nucleic acid encoding a modified TCR comprising
affinity for a surface antigen on a target cell as described elsewhere herein. The
invention also includes a population of cells comprising the modified T cell described
herein.
[0150] One or more domains or a fragment of a domain of the CAR may be human. In one embodiment,
the present invention includes a fully human CAR. The nucleic acid sequences coding
for the desired domains can be obtained using recombinant methods known in the art,
such as, for example by screening libraries from cells expressing the gene, by deriving
the gene from a vector known to include the same, or by isolating directly from cells
and tissues containing the same, using standard techniques. Alternatively, the gene
of interest can be produced synthetically, rather than as a cloned molecule.
[0151] Example of CARs are described in
U.S. Patent Nos.: 8,911,993,
8,906,682,
8,975,071,
8,916,381,
9,102,760,
9,101,584, and
9,102,761.
Antigen Binding Domain
[0152] In one embodiment, the CAR comprises an antigen binding domain that binds to an antigen
on a target cell. Examples of cell surface markers that may act as an antigen that
binds to the antigen binding domain of the CAR include those associated with viral,
bacterial and parasitic infections, autoimmune disease, and cancer cells.
[0153] The choice of antigen binding domain depends upon the type and number of antigens
that are present on the surface of a target cell. For example, the antigen binding
domain may be chosen to recognize an antigen that acts as a cell surface marker on
a target cell associated with a particular disease state.
[0154] In one embodiment, the antigen binding domain binds to a tumor antigen, such as an
antigen that is specific for a tumor or cancer of interest. In one embodiment, the
tumor antigen of the present invention comprises one or more antigenic cancer epitopes.
[0155] The antigen binding domain can include any domain that binds to the antigen and may
include, but is not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic
antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment
thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian
antibody or a fragment thereof.
[0156] The antigen binding domain may bind one or more antigens, such as but not limited
to CD19; CD123; CD22; CD30; CD171; CS-1 (also referred to as CD2 subset 1, CRACC,
SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33;
epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside
GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cεr); TNF receptor family member
B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser/Thr)); prostate-specific
membrane antigen (PSMA); Receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-Like
Tyrosine Kinase 3 (FLT3); Tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6;
Carcinoembryonic antigen (CEA); Epithelial cell adhesion molecule (EPCAM); B7H3 (CD276);
KIT (CD117); Interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); Mesothelin;
Interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); Protease
Serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2);
Lewis(Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta);
Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha; Receptor
tyrosine-protein kinase ERBB2 (Hefl/neu); Mucin 1, cell surface associated (MUC1);
epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); Prostase;
prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); Ephrin B2;
fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I
receptor), carbonic anhydrase IX (CAIX); Proteasome (Prosome, Macropain) Subunit,
Beta Type, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting
of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog
1 (Abl) (bcr-abl); tyrosinase; ephrin type-A receptor 2 (EphA2); Fucosyl GM1; sialyl
Lewis adhesion molecule (sLe); ganglioside GM3 (aNeuSAc(2-3)bDGalp(1-4)bDGlcp(1-1)Cer);
transglutaminase 5 (TGS5); high molecular weight-melanoma-associated antigen (HMWMAA);
o-acetyl-GD2 ganglioside (OAcGD2); Folate receptor beta; tumor endothelial marker
1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid
stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member
D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic
lymphoma kinase (ALK); Polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide
portion of globoH glycoceramide (GloboH); mammary gland differentiation antigen (NY-BR-1);
uroplakin 2 (UPK2); Hepatitis A virus cellular receptor 1 (HAVCR1); adrenoceptor beta
3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen
6 complex, locus K 9 (LY6K); Olfactory receptor 51E2 (OR51E2); TCR Gamma Alternate
Reading Frame Protein (TARP); Wilms tumor protein (WT1); Cancer/testis antigen 1 (NY-ESO-1);
Cancer/testis antigen 2 (LAGE-1a); Melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant
gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X Antigen
Family, Member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma
cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related
antigen 1; tumor protein p53 (p53); p53 mutant; prostein; surviving; telomerase; prostate
carcinoma tumor antigen-1 (PCTA-1 or Galectin 8), melanoma antigen recognized by T
cells 1 (MelanA or MART1); Rat sarcoma (Ras) mutant; human Telomerase reverse transcriptase
(hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP);
ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-Acetyl glucosaminyl-transferase
V (NA17); paired box protein Pax-3 (PAX3); Androgen receptor; Cyclin B1; v-myc avian
myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN); Ras Homolog
Family Member C (RhoC); Tyrosinase-related protein 2 (TRP-2); Cytochrome P450 1B1
(CYP1B1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS or Brother of the
Regulator of Imprinted Sites), Squamous Cell Carcinoma Antigen Recognized By T Cells
3 (SART3); Paired box protein Pax-5 (PAXS); proacrosin binding protein sp32 (OY-TES1);
lymphocyte-specific protein tyrosine kinase (LCK); A kinase anchor protein 4 (AKAP-4);
synovial sarcoma, X breakpoint 2 (SSX2); Receptor for Advanced Glycation Endproducts
(RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papilloma
virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxyl esterase;
heat shock protein 70-2 mutated (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated
immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89);
Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like
family member f (CD300LF); C-type lectin domain family 12 member A (CLEC 12A); bone
marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone
receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like
5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).
[0157] In some instances, it is beneficial for the antigen binding domain to be derived
from the same species in which the CAR will ultimately be used in. For example, for
use in humans, it may be beneficial for the antigen binding domain of the CAR to comprise
a human antibody, humanized antibody as described elsewhere herein, or a fragment
thereof.
[0158] It is also beneficial that the antigen binding domain is operably linked to another
domain of the CAR, such as the transmembrane domain or the intracellular domain, both
described elsewhere herein, for expression in the cell. In one embodiment, a nucleic
acid encoding the antigen binding domain is operably linked to a nucleic acid encoding
a transmembrane domain and a nucleic acid encoding an intracellular domain.
Transmembrane Domain
[0159] With respect to the transmembrane domain, the CAR can be designed to comprise a transmembrane
domain that connects the antigen binding domain of the CAR to the intracellular domain.
In one embodiment, the transmembrane domain is naturally associated with one or more
of the domains in the CAR. In some instances, the transmembrane domain can be selected
or modified by amino acid substitution to avoid binding of such domains to the transmembrane
domains of the same or different surface membrane proteins to minimize interactions
with other members of the receptor complex.
[0160] The transmembrane domain may be derived either from a natural or from a synthetic
source. Where the source is natural, the domain may be derived from any membrane-bound
or transmembrane protein. Transmembrane regions of particular use in this invention
may be derived from (i.e. comprise at least the transmembrane region(s) of) the alpha,
beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8,
CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some instances,
a variety of human hinges can be employed as well including the human Ig (immunoglobulin)
hinge.
[0161] In one embodiment, the transmembrane domain may be synthetic, in which case it will
comprise predominantly hydrophobic residues such as leucine and valine. Preferably
a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic
transmembrane domain.
Intracellular Domain
[0162] The intracellular domain or otherwise the cytoplasmic domain of the CAR is responsible
for activation of the cell in which the CAR is expressed. The term "intracellular
domain" is thus meant to include any portion of the intracellular domain sufficient
to transduce the activation signal. In one embodiment, the intracellular domain includes
a domain responsible for an effector function. The term "effector function" refers
to a specialized function of a cell. Effector function of a T cell, for example, may
be cytolytic activity or helper activity including the secretion of cytokines.
[0163] In one embodiment, the intracellular domain of the CAR includes a domain responsible
for signal activation and/or transduction. The intracellular domain may transmit signal
activation via protein-protein interactions, biochemical changes or other response
to alter the cell's metabolism, shape, gene expression, or other cellular response
to activation of the chimeric intracellular signaling molecule.
[0164] Examples of an intracellular domain for use in the invention include, but are not
limited to, the cytoplasmic portion of the T cell receptor (TCR) and any co-stimulatory
molecule that acts in concert to initiate signal transduction following antigen receptor
engagement, as well as any derivative or variant of these elements and any synthetic
sequence that has the same functional capability. In one embodiment, the intracellular
domain of the CAR comprises dual signaling domains. The dual signaling domains may
include a fragment or domain from any of the molecules described herein.
[0165] Examples of the intracellular domain include a fragment or domain from one or more
molecules or receptors including, but are not limited to, TCR, CD3 zeta, CD3 gamma,
CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon R1b), CD79a,
CD79b, Fcgamma RIIa, DAP10, DAP12, T cell receptor (TCR), CD27, CD28, 4-1BB (CD137),
OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2,
CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1,
GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8alpha,
CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D,
ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b,
ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE/RANKL, DNAM1 (CD226),
SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55),
PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME
(SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG/Cbp, NKp44, NKp30, NKp46, NKG2D,
other co-stimulatory molecules described herein, any derivative, variant, or fragment
thereof, any synthetic sequence of a co-stimulatory molecule that has the same functional
capability, and any combination thereof.
[0166] In one embodiment, the intracellular domain of the CAR includes any portion of a
co-stimulatory molecule, such as at least one signaling domain from CD3, CD27, CD28,
ICOS, 4-1BB, PD-1, T cell receptor (TCR), any derivative or variant thereof, any synthetic
sequence thereof that has the same functional capability, and any combination thereof.
[0167] Between the antigen binding domain and the transmembrane domain of the CAR, or between
the intracellular domain and the transmembrane domain of the CAR, a spacer domain
may be incorporated. As used herein, the term "spacer domain" generally means any
oligo- or polypeptide that functions to link the transmembrane domain to, either the
antigen binding domain or, the intracellular domain in the polypeptide chain. In one
embodiment, the spacer domain may comprise up to 300 amino acids, preferably 10 to
100 amino acids and most preferably 25 to 50 amino acids. In another embodiment, a
short oligo- or polypeptide linker, preferably between 2 and 10 amino acids in length
may form the linkage between the transmembrane domain and the intracellular domain
of the CAR. An example of a linker includes a glycine-serine doublet.
Human Antibodies
[0168] It may be preferable to use human antibodies or fragments thereof when using bispecific
antibodies or the antigen binding domains of a CAR. Completely human antibodies are
particularly desirable for therapeutic treatment of human subjects. Human antibodies
can be made by a variety of methods known in the art including phage display methods
using antibody libraries derived from human immunoglobulin sequences, including improvements
to these techniques. See, also,
U.S. Pat. Nos. 4,444,887 and
4,716,111; and
PCT publications WO 98/46645,
WO 98/50433,
WO 98/24893,
WO 98/16654,
WO 96/34096,
WO 96/33735, and
WO 91/10741 The bispecific antibody can also include an antibody wherein the heavy and light
chains are encoded by a nucleotide sequence derived from one or more sources of human
DNA.
[0169] Human antibodies can also be produced using transgenic mice which are incapable of
expressing functional endogenous immunoglobulins, but which can express human immunoglobulin
genes. For example, the human heavy and light chain immunoglobulin gene complexes
may be introduced randomly or by homologous recombination into mouse embryonic stem
cells. Alternatively, the human variable region, constant region, and diversity region
may be introduced into mouse embryonic stem cells in addition to the human heavy and
light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered
non-functional separately or simultaneously with the introduction of human immunoglobulin
loci by homologous recombination. For example, it has been described that the homozygous
deletion of the antibody heavy chain joining region (JH) gene in chimeric and germ-line
mutant mice results in complete inhibition of endogenous antibody production. The
modified embryonic stem cells are expanded and microinjected into blastocysts to produce
chimeric mice. The chimeric mice are then bred to produce homozygous offspring which
express human antibodies. The transgenic mice are immunized in the normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
Antibodies directed against the target of choice can be obtained from the immunized,
transgenic mice using conventional hybridoma technology. The human immunoglobulin
transgenes harbored by the transgenic mice rearrange during B cell differentiation,
and subsequently undergo class switching and somatic mutation. Thus, using such a
technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE
antibodies, including, but not limited to, IgG1 (gamma 1) and IgG3. For an overview
of this technology for producing human antibodies, see,
Lonberg and Huszar (Int. Rev. Immunol., 13:65-93 (1995)). For a detailed discussion of this technology for producing human antibodies and
human monoclonal antibodies and protocols for producing such antibodies, see, e.g.,
PCT Publication Nos. WO 98/24893,
WO 96/34096, and
WO 96/33735; and
U.S. Pat. Nos. 5,413,923;
5,625,126;
5,633,425;
5,569,825;
5,661,016;
5,545,806;
5,814,318; and 5,939,598 In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San
Jose, Calif.) can be engaged to provide human antibodies directed against a selected
antigen using technology similar to that described above. For a specific discussion
of transfer of a human germ-line immunoglobulin gene array in germ-line mutant mice
that will result in the production of human antibodies upon antigen challenge see,
e.g.,
Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993);
Jakobovits et al., Nature, 362:255-258 (1993);
Bruggermann et al., Year in Immunol., 7:33 (1993); and
Duchosal et al., Nature, 355:258 (1992).
[0170] Human antibodies can also be derived from phage-display libraries (
Hoogenboom et al., J. Mol. Biol., 227:381 (1991);
Marks et al., J. Mol. Biol., 222:581-597 (1991);
Vaughan et al., Nature Biotech., 14:309 (1996)). Phage display technology (
McCafferty et al., Nature, 348:552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin
variable (V) domain gene repertoires from unimmunized donors. According to this technique,
antibody V domain genes are cloned in-frame into either a major or minor coat protein
gene of a filamentous bacteriophage, such as M13 or fd, and displayed as functional
antibody fragments on the surface of the phage particle. Because the filamentous particle
contains a single-stranded DNA copy of the phage genome, selections based on the functional
properties of the antibody also result in selection of the gene encoding the antibody
exhibiting those properties. Thus, the phage mimics some of the properties of the
B cell. Phage display can be performed in a variety of formats; for their review see,
e.g.,
Johnson, Kevin S, and Chiswell, David J., Current Opinion in Structural Biology 3:564-571
(1993). Several sources of V-gene segments can be used for phage display.
Clackson et al., Nature, 352:624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial
library of V genes derived from the spleens of unimmunized mice. A repertoire of V
genes from unimmunized human donors can be constructed and antibodies to a diverse
array of antigens (including self-antigens) can be isolated essentially following
the techniques described by
Marks et al., J. Mol. Biol., 222:581-597 (1991), or
Griffith et al., EMBO J., 12:725-734 (1993). See, also,
U.S. Pat. Nos. 5,565,332 and
5,573,905
Humanized Antibodies
[0172] Alternatively, in some embodiments, a non-human antibody can be humanized, where
specific sequences or regions of the antibody are modified to increase similarity
to an antibody naturally produced in a human. For instance, in the present invention,
the antibody or fragment thereof may comprise a non-human mammalian scFv. In one embodiment,
the antigen binding domain portion is humanized.
[0173] A humanized antibody can be produced using a variety of techniques known in the art,
including but not limited to, CDR-grafting (see, e.g., European Patent No.
EP 239,400;
International Publication No. WO 91/09967; and
U.S. Pat. Nos. 5,225,539,
5,530,101, and
5,585,089), veneering or resurfacing (see, e.g., European Patent Nos.
EP 592,106 and
EP 519,596;
Padlan, 1991, Molecular Immunology, 28(4/5):489-498;
Studnicka et al., 1994, Protein Engineering, 7(6):805-814; and
Roguska et al., 1994, PNAS, 91:969-973), chain shuffling (see, e.g.,
U.S. Pat. No. 5,565,332), and techniques disclosed in, e.g.,
U.S. Patent Application Publication No. US2005/0042664,
U.S. Patent Application Publication No. US2005/0048617,
U.S. Pat. No. 6,407,213,
U.S. Pat. No. 5,766,886,
International Publication No. WO 9317105,
Tan et al., J. Immunol., 169:1119-25 (2002),
Caldas et al., Protein Eng., 13(5):353-60 (2000),
Morea et al., Methods, 20(3):267-79 (2000),
Baca et al., J. Biol. Chem., 272(16):10678-84 (1997),
Roguska et al., Protein Eng., 9(10):895-904 (1996),
Couto et al., Cancer Res., 55 (23 Supp):5973s-5977s (1995),
Couto et al., Cancer Res., 55(8):1717-22 (1995),
Sandhu J S, Gene, 150(2):409-10 (1994), and
Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994). Often, framework residues in the framework regions will be substituted with the
corresponding residue from the CDR donor antibody to alter, preferably improve, antigen
binding. These framework substitutions are identified by methods well-known in the
art, e.g., by modeling of the interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence comparison to identify
unusual framework residues at particular positions. (See, e.g., Queen et al.,
U.S. Pat. No. 5,585,089; and
Riechmann et al., 1988, Nature, 332:323).
[0174] A humanized antibody has one or more amino acid residues introduced into it from
a source which is nonhuman. These nonhuman amino acid residues are often referred
to as "import" residues, which are typically taken from an "import" variable domain.
Thus, humanized antibodies comprise one or more CDRs from nonhuman immunoglobulin
molecules and framework regions from human. Humanization of antibodies is well-known
in the art and can essentially be performed following the method of Winter and co-workers
(
Jones et al., Nature, 321:522-525 (1986);
Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al.,
Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of
a human antibody, i.e., CDR-grafting (
EP 239,400;
PCT Publication No. WO 91/09967; and
U.S. Pat. Nos. 4,816,567;
6,331,415;
5,225,539;
5,530,101;
5,585,089;
6,548,640). In such humanized chimeric antibodies, substantially less than an intact human
variable domain has been substituted by the corresponding sequence from a nonhuman
species. In practice, humanized antibodies are typically human antibodies in which
some CDR residues and possibly some framework (FR) residues are substituted by residues
from analogous sites in rodent antibodies. Humanization of antibodies can also be
achieved by veneering or resurfacing (
EP 592,106;
EP 519,596;
Padlan, 1991, Molecular Immunology, 28(4/5):489-498;
Studnicka et al., Protein Engineering, 7(6):805-814 (1994); and
Roguska et al., PNAS, 91:969-973 (1994)) or chain shuffling (
U.S. Pat. No. 5,565,332)
[0175] The choice of human variable domains, both light and heavy, to be used in making
the humanized antibodies is to reduce antigenicity. According to the so-called "best-fit"
method, the sequence of the variable domain of a rodent antibody is screened against
the entire library of known human variable-domain sequences. The human sequence which
is closest to that of the rodent is then accepted as the human framework (FR) for
the humanized antibody (
Sims et al., J. Immunol., 151:2296 (1993);
Chothia et al., J. Mol. Biol., 196:901 (1987). Another method uses a particular framework derived from the consensus sequence
of all human antibodies of a particular subgroup of light or heavy chains. The same
framework may be used for several different humanized antibodies (
Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992);
Presta et al., J. Immunol., 151:2623 (1993).
[0176] Antibodies can be humanized with retention of high affinity for the target antigen
and other favorable biological properties. According to one aspect of the invention,
humanized antibodies are prepared by a process of analysis of the parental sequences
and various conceptual humanized products using three-dimensional models of the parental
and humanized sequences. Three-dimensional immunoglobulin models are commonly available
and are familiar to those skilled in the art. Computer programs are available which
illustrate and display probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays permits analysis
of the likely role of the residues in the functioning of the candidate immunoglobulin
sequence, i.e., the analysis of residues that influence the ability of the candidate
immunoglobulin to bind the target antigen. In this way, FR residues can be selected
and combined from the recipient and import sequences so that the desired antibody
characteristic, such as increased affinity for the target antigen, is achieved. In
general, the CDR residues are directly and most substantially involved in influencing
antigen binding.
[0177] A humanized antibody retains a similar antigenic specificity as the original antibody.
However, using certain methods of humanization, the affinity and/or specificity of
binding of the antibody to the target antigen may be increased using methods of "directed
evolution," as described by
Wu et al., J. Mol. Biol., 294:151 (1999).
Other Molecules
[0178] The present invention also includes the modified T cell described herein further
comprising a co-stimulatory molecule or a nucleic acid encoding the co-stimulatory
molecule. In one embodiment, the modified T cell of the invention further includes
an exogenous nucleic acid encoding a co-stimulatory molecule, such that the modified
T cell expresses the co-stimulatory molecule. The nucleic acid may be introduced into
the T cell by transducing the T cell, transfecting the T cell, or electroporating
the T cell. In another embodiment, the co-stimulatory molecule is selected from CD3,
CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In another embodiment,
the so-stimulatory molecule includes CD3 and comprises at least two different CD3
chains, such as CD3 zeta and CD3 epsilon chains.
[0179] In another embodiment, the modified T cell further comprises Klf4, Oct3/4, and/or
Sox2 or a nucleic acid encoding Klf4, Oct3/4, and/or Sox2 to induce pluripotency of
the T cell. The T cell can be induced to pluripotency by expressing Klf4, Oct3/4 and
Sox2. K.lf4, Oct3/4 and Sox2 may be expressed from a nucleic acid, viral vector(s)
or RNA molecule(s). In one embodiment, a viral vector encoding for Klf4, Oct3/4 and
Sox2 is introduced into the T cell to induce pluripotency. In another embodiment,
a Sendai viral vector is introduced into the T cells to induce pluripotency, wherein
the Sendai viral vector encodes Klf4, Oct3/4 and Sox2.
Introduction of Nucleic Acids
[0180] Methods of introducing nucleic acids into a cell include physical, biological and
chemical methods. Physical methods for introducing a polynucleotide, such as RNA,
into a host cell include calcium phosphate precipitation, lipofection, particle bombardment,
microinjection, electroporation, and the like. RNA can be introduced into target cells
using commercially available methods which include electroporation (Amaxa Nucleofector-II
(Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston,
Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg
Germany). RNA can also be introduced into cells using cationic liposome mediated transfection
using lipofection, using polymer encapsulation, using peptide mediated transfection,
or using biolistic particle delivery systems such as "gene guns" (see, for example,
Nishikawa, et al. Hum Gene Then, 12(8):861-70 (2001).
[0181] Biological methods for introducing a polynucleotide of interest into a host cell
include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors,
have become the most widely used method for inserting genes into mammalian, e.g.,
human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes
simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for
example,
U.S. Pat. Nos. 5,350,674 and
5,585,362.
[0182] Chemical means for introducing a polynucleotide into a host cell include colloidal
dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads,
and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles,
and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro
and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0183] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl
phosphatidylcholine ("DMPC") can be obtained from Sigma, St. Louis, MO; dicetyl phosphate
("DCP") can be obtained from K & K Laboratories (Plainview, NY); cholesterol ("Choi")
can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG")
and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL).
Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about
-20°C. Chloroform is used as the only solvent since it is more readily evaporated
than methanol. "Liposome" is a generic term encompassing a variety of single and multilamellar
lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates.
Liposomes can be characterized as having vesicular structures with a phospholipid
bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple
lipid layers separated by aqueous medium. They form spontaneously when phospholipids
are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement
before the formation of closed structures and entrap water and dissolved solutes between
the lipid bilayers (
Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal
vesicular structure are also encompassed. For example, the lipids may assume a micellar
structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated
are lipofectamine-nucleic acid complexes.
[0184] Regardless of the method used to introduce exogenous nucleic acids into a host cell
or otherwise expose a cell to the inhibitor of the present invention, in order to
confirm the presence of the nucleic acids in the host cell, a variety of assays may
be performed. Such assays include, for example, "molecular biological" assays well
known to those of skill in the art, such as Southern and Northern blotting, RT-PCR
and PCR; "biochemical" assays, such as detecting the presence or absence of a particular
peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described
herein to identify agents falling within the scope of the invention.
[0185] In one embodiment, a nucleic acid encoding a T cell receptor (TCR) comprising affinity
for a surface antigen on a target cell is introduced into the expanded T cells. The
nucleic acid encoding the TCR may be the same or separate nucleic acid that is capable
of downregulating endogenous TCR gene expression. The nucleic acid encoding the TCR
may be introduced into the T cell at the same time or sequentially with the nucleic
acid capable of downregulating endogenous TCR gene expression. In one embodiment,
the nucleic acid encoding the TCR is introduced prior to the nucleic acid capable
of downregulating endogenous TCR gene expression.
[0186] Moreover, the nucleic acids may be introduced by any means, such as transducing the
expanded T cells, transfecting the expanded T cells, and electroporating the expanded
T cells. One nucleic acid may be introduced by one method and another nucleic acid
may be introduced into the T cell by a different method.
RNA
[0187] In one embodiment, the nucleic acids introduced into the T cell are RNA. In another
embodiment, the RNA is mRNA that comprises in vitro transcribed RNA or synthetic RNA.
The RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated
template. DNA of interest from any source can be directly converted by PCR into a
template for in vitro mRNA synthesis using appropriate primers and RNA polymerase.
The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA,
synthetic DNA sequence or any other appropriate source of DNA. The desired template
for in vitro transcription is a chimeric membrane protein. By way of example, the
template encodes an antibody, a fragment of an antibody or a portion of an antibody.
By way of another example, the template comprises an extracellular domain comprising
a single chain variable domain of an antibody, such as anti-CD3, and an intracellular
domain of a co-stimulatory molecule. In one embodiment, the template for the RNA chimeric
membrane protein encodes a chimeric membrane protein comprising an extracellular domain
comprising an antigen binding domain derived from an antibody to a co-stimulatory
molecule, and an intracellular domain derived from a portion of an intracellular domain
of CD28 and 4-1BB.
[0188] PCR can be used to generate a template for in vitro transcription of mRNA which is
then introduced into cells. Methods for performing PCR are well known in the art.
Primers for use in PCR are designed to have regions that are substantially complementary
to regions of the DNA to be used as a template for the PCR. "Substantially complementary",
as used herein, refers to sequences of nucleotides where a majority or all of the
bases in the primer sequence are complementary, or one or more bases are non-complementary,
or mismatched. Substantially complementary sequences are able to anneal or hybridize
with the intended DNA target under annealing conditions used for PCR. The primers
can be designed to be substantially complementary to any portion of the DNA template.
For example, the primers can be designed to amplify the portion of a gene that is
normally transcribed in cells (the open reading frame), including 5' and 3' UTRs.
The primers can also be designed to amplify a portion of a gene that encodes a particular
domain of interest. In one embodiment, the primers are designed to amplify the coding
region of a human cDNA, including all or portions of the 5' and 3' UTRs. Primers useful
for PCR are generated by synthetic methods that are well known in the art. "Forward
primers" are primers that contain a region of nucleotides that are substantially complementary
to nucleotides on the DNA template that are upstream of the DNA sequence that is to
be amplified. "Upstream" is used herein to refer to a location 5, to the DNA sequence
to be amplified relative to the coding strand. "Reverse primers" are primers that
contain a region of nucleotides that are substantially complementary to a double-stranded
DNA template that are downstream of the DNA sequence that is to be amplified. "Downstream"
is used herein to refer to a location 3' to the DNA sequence to be amplified relative
to the coding strand.
[0189] Chemical structures that have the ability to promote stability and/or translation
efficiency of the RNA may also be used. The RNA preferably has 5' and 3' UTRs. In
one embodiment, the 5' UTR is between zero and 3000 nucleotides in length. The length
of 5' and 3' UTR sequences to be added to the coding region can be altered by different
methods, including, but not limited to, designing primers for PCR that anneal to different
regions of the UTRs. Using this approach, one of ordinary skill in the art can modify
the 5' and 3' UTR lengths required to achieve optimal translation efficiency following
transfection of the transcribed RNA.
[0190] The 5' and 3' UTRs can be the naturally occurring, endogenous 5' and 3' UTRs for
the gene of interest. Alternatively, UTR sequences that are not endogenous to the
gene of interest can be added by incorporating the UTR sequences into the forward
and reverse primers or by any other modifications of the template. The use of UTR
sequences that are not endogenous to the gene of interest can be useful for modifying
the stability and/or translation efficiency of the RNA. For example, it is known that
AU-rich elements in 3' UTR sequences can decrease the stability of mRNA. Therefore,
3' UTRs can be selected or designed to increase the stability of the transcribed RNA
based on properties of UTRs that are well known in the art.
[0191] In one embodiment, the 5' UTR can contain the Kozak sequence of the endogenous gene.
Alternatively, when a 5' UTR that is not endogenous to the gene of interest is being
added by PCR as described above, a consensus Kozak sequence can be redesigned by adding
the 5' UTR sequence. Kozak sequences can increase the efficiency of translation of
some RNA transcripts, but does not appear to be required for all RNAs to enable efficient
translation. The requirement for Kozak sequences for many mRNAs is known in the art.
In other embodiments the 5' UTR can be derived from an RNA virus whose RNA genome
is stable in cells. In other embodiments various nucleotide analogues can be used
in the 3' or 5' UTR to impede exonuclease degradation of the mRNA.
[0192] To enable synthesis of RNA from a DNA template without the need for gene cloning,
a promoter of transcription should be attached to the DNA template upstream of the
sequence to be transcribed. When a sequence that functions as a promoter for an RNA
polymerase is added to the 5' end of the forward primer, the RNA polymerase promoter
becomes incorporated into the PCR product upstream of the open reading frame that
is to be transcribed. In one embodiment, the promoter is a T7 polymerase promoter,
as described elsewhere herein. Other useful promoters include, but are not limited
to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3
and SP6 promoters are known in the art.
[0193] In one embodiment, the mRNA has both a cap on the 5' end and a 3' poly(A) tail which
determine ribosome binding, initiation of translation and stability mRNA in the cell.
On a circular DNA template, for instance, plasmid DNA, RNA polymerase produces a long
concatameric product which is not suitable for expression in eukaryotic cells. The
transcription of plasmid DNA linearized at the end of the 3' UTR results in normal
sized mRNA which is not effective in eukaryotic transfection even if it is polyadenylated
after transcription.
[0195] The conventional method of integration of polyA/T stretches into a DNA template is
molecular cloning. However polyA/T sequence integrated into plasmid DNA can cause
plasmid instability, which is why plasmid DNA templates obtained from bacterial cells
are often highly contaminated with deletions and other aberrations. This makes cloning
procedures not only laborious and time consuming but often not reliable. That is why
a method which allows construction of DNA templates with polyA/T 3' stretch without
cloning highly desirable.
[0196] The polyA/T segment of the transcriptional DNA template can be produced during PCR
by using a reverse primer containing a polyT tail, such as 100T tail (size can be
50-5000 T), or after PCR by any other method, including, but not limited to, DNA ligation
or in vitro recombination. Poly(A) tails also provide stability to RNAs and reduce
their degradation. Generally, the length of a poly(A) tail positively correlates with
the stability of the transcribed RNA. In one embodiment, the poly(A) tail is between
100 and 5000 adenosines.
[0197] Poly(A) tails of RNAs can be further extended following in vitro transcription with
the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP). In one
embodiment, increasing the length of a poly(A) tail from 100 nucleotides to between
300 and 400 nucleotides results in about a two-fold increase in the translation efficiency
of the RNA. Additionally, the attachment of different chemical groups to the 3' end
can increase mRNA stability. Such attachment can contain modified/artificial nucleotides,
aptamers and other compounds. For example, ATP analogs can be incorporated into the
poly(A) tail using poly(A) polymerase. ATP analogs can further increase the stability
of the RNA.
[0198] 5' caps also provide stability to RNA molecules. In a preferred embodiment, RNAs
produced by the methods disclosed herein include a 5' cap. The 5' cap is provided
using techniques known in the art and described herein (
Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001);
Stepinski, et al., RNA, 7:1468-95 (2001);
Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
[0199] The RNAs produced by the methods disclosed herein can also contain an internal ribosome
entry site (IRES) sequence. The IRES sequence may be any viral, chromosomal or artificially
designed sequence which initiates cap-independent ribosome binding to mRNA and facilitates
the initiation of translation. Any solutes suitable for cell electroporation, which
can contain factors facilitating cellular permeability and viability such as sugars,
peptides, lipids, proteins, antioxidants, and surfactants can be included.
RNA Transfection
[0200] In some embodiments, the RNA encoding a TCR is electroporated into the cells. In
one embodiment, the RNA encoding the TCR is in vitro transcribed RNA.
[0201] The disclosed methods can be applied to the modulation of T cell activity in basic
research and therapy, in the fields of cancer, stem cells, acute and chronic infections,
and autoimmune diseases, including the assessment of the ability of the genetically
modified T cell to kill a target cancer cell.
[0202] The methods also provide the ability to control the level of expression over a wide
range by changing, for example, the promoter or the amount of input RNA, making it
possible to individually regulate the expression level. Furthermore, the PCR-based
technique of mRNA production greatly facilitates the design of the mRNAs with different
structures and combination of their domains.
[0203] One advantage of RNA transfection methods of the invention is that RNA transfection
is essentially transient and a vector-free. A RNA transgene can be delivered to a
lymphocyte and expressed therein following a brief in vitro cell activation, as a
minimal expressing cassette without the need for any additional viral sequences. Under
these conditions, integration of the transgene into the host cell genome is unlikely.
Cloning of cells is not necessary because of the efficiency of transfection of the
RNA and its ability to uniformly modify the entire lymphocyte population.
[0204] Genetic modification of T cells with in vitro-transcribed RNA (IVT-RNA) makes use
of two different strategies both of which have been successively tested in various
animal models. Cells are transfected with in vitro-transcribed RNA by means of lipofection
or electroporation. It is desirable to stabilize IVT-RNA using various modifications
in order to achieve prolonged expression of transferred IVT-RNA.
[0205] Some IVT vectors are known in the literature which are utilized in a standardized
manner as template for in vitro transcription and which have been genetically modified
in such a way that stabilized RNA transcripts are produced. Currently protocols used
in the art are based on a plasmid vector with the following structure: a 5' RNA polymerase
promoter enabling RNA transcription, followed by a gene of interest which is flanked
either 3' and/or 5' by untranslated regions (UTR), and a 3' polyadenyl cassette containing
50-70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized
downstream of the polyadenyl cassette by type II restriction enzymes (recognition
sequence corresponds to cleavage site). The polyadenyl cassette thus corresponds to
the later poly(A) sequence in the transcript. As a result of this procedure, some
nucleotides remain as part of the enzyme cleavage site after linearization and extend
or mask the poly(A) sequence at the 3' end. It is not clear, whether this nonphysiological
overhang affects the amount of protein produced intracellularly from such a construct.
[0206] RNA has several advantages over more traditional plasmid or viral approaches. Gene
expression from an RNA source does not require transcription and the protein product
is produced rapidly after the transfection. Further, since the RNA has to only gain
access to the cytoplasm, rather than the nucleus, and therefore typical transfection
methods result in an extremely high rate of transfection. In addition, plasmid based
approaches require that the promoter driving the expression of the gene of interest
be active in the cells under study.
[0207] In another aspect, the RNA construct is delivered into the cells by electroporation.
See, e.g., the formulations and methodology of electroporation of nucleic acid constructs
into mammalian cells as taught in
US 2004/0014645,
US 2005/0052630A1,
US 2005/0070841A1,
US 2004/0059285A1,
US 2004/0092907A1. The various parameters including electric field strength required for electroporation
of any known cell type are generally known in the relevant research literature as
well as numerous patents and applications in the field. See e.g.,
U.S. Pat. No. 6,678,556,
U.S. Pat. No. 7,171,264, and
U.S. Pat. No. 7,173,116. Apparatus for therapeutic application of electroporation are available commercially,
e.g., the MedPulser
™ DNA Electroporation Therapy System (Inovio/Genetronics, San Diego, Calif.), and are
described in patents such as
U.S. Pat. No. 6,567,694;
U.S. Pat. No. 6,516,223,
U.S. Pat. No. 5,993,434,
U.S. Pat. No. 6,181,964,
U.S. Pat. No. 6,241,701, and
U.S. Pat. No. 6,233,482; electroporation may also be used for transfection of cells in vitro as described
e.g. in
US20070128708A1. Electroporation may also be utilized to deliver nucleic acids into cells in vitro.
Accordingly, electroporation-mediated administration into cells of nucleic acids including
expression constructs utilizing any of the many available devices and electroporation
systems known to those of skill in the art presents an exciting new means for delivering
an RNA of interest to a target cell.
[0208] In one embodiment, the method includes electroporating a RNA encoding a TCR alpha
and beta chain. The TCR alpha and beta chain can be encoded on the same or separate
RNAs. When the alpha and beta are encoded by separate RNAs, the RNA may be co-electroporated.
[0209] In another embodiment, the method may further include electroporating a nucleic acid
encoding a costimulatory molecule. The costimulatory molecule nucleic acid may be
co-electroporated with the TCR RNA.
Sources of T Cells
[0210] Prior to expansion, a source of T cells is obtained from a subject. Non-limiting
examples of subjects include humans, dogs, cats, mice, rats, and transgenic species
thereof. Preferably, the subject is a human. T cells can be obtained from a number
of sources, including peripheral blood mononuclear cells, bone marrow, lymph node
tissue, spleen tissue, umbilical cord, and tumors. In certain embodiments, any number
of T cell lines available in the art, may be used. In certain embodiments, T cells
can be obtained from a unit of blood collected from a subject using any number of
techniques known to the skilled artisan, such as Ficoll separation. In one embodiment,
cells from the circulating blood of an individual are obtained by apheresis or leukapheresis.
The apheresis product typically contains lymphocytes, including T cells, monocytes,
granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
The cells collected by apheresis may be washed to remove the plasma fraction and to
place the cells in an appropriate buffer or media, such as phosphate buffered saline
(PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not
all divalent cations, for subsequent processing steps. After washing, the cells may
be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free,
Mg-free PBS. Alternatively, the undesirable components of the apheresis sample may
be removed and the cells directly resuspended in culture media.
[0211] In another embodiment, T cells are isolated from peripheral blood by lysing the red
blood cells and depleting the monocytes, for example, by centrifugation through a
PERCOLL
™ gradient. Alternatively, T cells can be isolated from umbilical cord. In any event,
a specific subpopulation of T cells can be further isolated by positive or negative
selection techniques.
[0212] The cord blood mononuclear cells so isolated can be depleted of cells expressing
certain antigens, including, but not limited to, CD34, CD8, CD14, CD19 and CD56. Depletion
of these cells can be accomplished using an isolated antibody, a biological sample
comprising an antibody, such as ascites, an antibody bound to a physical support,
and a cell bound antibody.
[0213] Enrichment of a T cell population by negative selection can be accomplished using
a combination of antibodies directed to surface markers unique to the negatively selected
cells. A preferred method is cell sorting and/or selection via negative magnetic immunoadherence
or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface
markers present on the cells negatively selected. For example, to enrich for CD4+
cells by negative selection, a monoclonal antibody cocktail typically includes antibodies
to CD14, CD20, CD11b, CD16, HLA-DR, and CD8.
[0214] For isolation of a desired population of cells by positive or negative selection,
the concentration of cells and surface (e.g., particles such as beads) can be varied.
In certain embodiments, it may be desirable to significantly decrease the volume in
which beads and cells are mixed together (i.e., increase the concentration of cells),
to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration
of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml
is used. In a further embodiment, greater than 100 million cells/ml is used. In a
further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or
50 million cells/ml is used. In yet another embodiment, a concentration of cells from
75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations
of 125 or 150 million cells/ml can be used. Using high concentrations can result in
increased cell yield, cell activation, and cell expansion.
[0215] T cells can also be frozen after the washing step, which does not require the monocyte-removal
step. While not wishing to be bound by theory, the freeze and subsequent thaw step
provides a more uniform product by removing granulocytes and to some extent monocytes
in the cell population. After the washing step that removes plasma and platelets,
the cells may be suspended in a freezing solution. While many freezing solutions and
parameters are known in the art and will be useful in this context, in a non-limiting
example, one method involves using PBS containing 20% DMSO and 8% human serum albumin,
or other suitable cell freezing media. The cells are then frozen to -80°C at a rate
of 1 ° per minute and stored in the vapor phase of a liquid nitrogen storage tank.
Other methods of controlled freezing may be used as well as uncontrolled freezing
immediately at -20°C or in liquid nitrogen.
[0216] In one embodiment, the population of T cells is comprised within cells such as peripheral
blood mononuclear cells, cord blood cells, a purified population of T cells, and a
T cell line. In another embodiment, peripheral blood mononuclear cells comprise the
population of T cells. In yet another embodiment, purified T cells comprise the population
of T cells.
Chimeric Membrane Protein
[0217] Generally, T cells are expanded by contact with a surface having attached thereto
an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates
a co-stimulatory molecule on the surface of the T cells. The present invention comprises
a novel method of expanding a population of T cells comprising electroporating the
T cells with RNA encoding a chimeric membrane protein and culturing the electroporated
T cells, wherein the electroporated T cells within the population expand at least
10 fold. The chimeric membrane protein of the invention comprises an extracellular
and intracellular domain. The extracellular domain comprises a target-specific binding
element, such as an antibody. In one embodiment, the chimeric membrane protein comprises
a single chain variable fragment (scFv) against CD3 and an intracellular domain derived
from a portion of an intracellular domain of CD28 and 4-1BB.
[0218] Expression of the chimeric membrane protein allows interaction with other cells in
the population, such as cells that express CD3, to stimulate and activate expansion
of the electroporated T cells. Not wishing to be held to any particular theory, the
cells that express CD3 may come into contact and bind with the chimeric membrane protein
that is expressed on the surface of the electroporated T cells. At least one T cell
expressing the chimeric membrane protein interacts with another cell expressing CD3.
This interaction stimulates expansion of the electroporated T cells.
[0219] In one embodiment, the T cells are expanded prior to downregulation of an endogenous
gene. In another embodiment, the modified T cells are expanded.
Extracellular Domain
[0220] The present invention includes an extracellular domain comprising an antigen binding
domain derived from an antibody directed against a co-stimulatory molecule. The co-stimulatory
molecule can include any molecule that co-stimulates T cells, such as, but not limited
to, CD3, CD28, or a combination thereof. In one embodiment, the extracellular domain
can include an antigen binding domain derived from anti-CD3, anti-CD28, or a combination
thereof. In another embodiment, the extracellular domain comprises a single chain
variable fragment (scFv) against CD3.
[0221] In another embodiment, the extracellular domain can include any portion of an antibody
that binds to antigen including, but not limited to, the antigen binding domain of
a synthetic antibody, human antibody, humanized antibody, single domain antibody,
single chain variable fragments, and fragments thereof. In some instances, it is beneficial
for the extracellular domain to be derived from the same species in which the chimeric
membrane protein will ultimately be used in. For example, for use in humans, it may
be beneficial for the extracellular domain of the chimeric membrane protein to comprise
a human antibody or fragment thereof. Thus, in one embodiment, the extracellular domain
portion comprises a human antibody or a fragment thereof as described elsewhere herein.
Alternatively, in some embodiments, the extracellular domain portion comprises a non-human
antibody that is humanized as described elsewhere herein.
Intracellular Domain
[0222] The intracellular domain or cytoplasmic domain comprises a costimulatory signaling
region. The costimulatory signaling region refers to an intracellular domain of a
costimulatory molecule. Costimulatory molecules are cell surface molecules other than
antigen receptors or their ligands that are required for an efficient response of
lymphocytes to antigen.
[0223] The cytoplasmic domain or the intracellular signaling domain of the chimeric membrane
protein is responsible for activation of at least one of effector functions of the
T cell. While usually the entire intracellular signaling domain can be employed, in
many cases it is not necessary to use the entire chain. To the extent that a truncated
portion of the intracellular signaling domain is used, such truncated portion may
be used in place of the intact chain as long as it transduces the effector function
signal. The intracellular signaling domain includes any truncated portion of the intracellular
signaling domain sufficient to transduce the effector function signal.
[0224] Nonlimiting examples of intracellular signaling domains for use in the chimeric membrane
protein include any portion of the intracellular domain of CD28, 4-1BB, T cell receptor
(TCR), co-stimulatory molecules, any derivative or variant of these sequences, any
synthetic sequence that has the same functional capability, and any combination thereof.
In one embodiment, the intracellular domain comprises a portion of an intracellular
domain of CD28 and 4-1BB.
Other Domains of the Chimeric Membrane Protein
[0225] Between the extracellular domain and the transmembrane domain of the chimeric membrane
protein, or between the cytoplasmic domain and the transmembrane domain of the chimeric
membrane protein, there may be incorporated a spacer domain, such as an oligo- or
polypeptide that functions to link the transmembrane domain to, either the extracellular
domain or, the cytoplasmic domain in the polypeptide chain. The spacer domain may
comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably
25 to 50 amino acids.
[0226] In some embodiments, the chimeric membrane protein further comprises a transmembrane
domain. In some embodiment, the chimeric membrane protein further comprises a hinge
domain. In one embodiment, the RNA encoding the chimeric membrane protein further
comprises a transmembrane and hinge domain, such as a CD28 transmembrane domain and
a CD8-alpha hinge domain.
Expansion of T Cells
[0227] As demonstrated by the data disclosed herein, expanding the T cells by the methods
disclosed herein can be multiplied by about 10 fold, 20 fold, 30 fold, 40 fold, 50
fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold,
500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold,
4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000
fold, 1,000,000 fold, 10,000,000 fold, or greater, and any and all whole or partial
intergers therebetween. In one embodiment, the T cells expand in the range of about
20 fold to about 50 fold.
[0228] Following culturing, the T cells can be incubated in cell medium in a culture apparatus
for a period of time or until the cells reach confluency or high cell density for
optimal passage before passing the cells to another culture apparatus. The culturing
apparatus can be of any culture apparatus commonly used for culturing cells in vitro.
Preferably, the level of confluence is 70% or greater before passing the cells to
another culture apparatus. More preferably, the level of confluence is 90% or greater.
A period of time can be any time suitable for the culture of cells in vitro. The T
cell medium may be replaced during the culture of the T cells at any time. Preferably,
the T cell medium is replaced about every 2 to 3 days. The T cells are then harvested
from the culture apparatus whereupon the T cells can be used immediately or cryopreserved
to be stored for use at a later time. In one embodiment, the invention includes cryopreserving
the expanded T cells. The cryopreserved T cells are thawed prior to introducing nucleic
acids into the T cell.
[0229] In another embodiment, the method comprises isolating T cells and expanding the T
cells. In another embodiment, the invention further comprises cryopreserving the T
cells prior to expansion. In yet another embodiment, the cryopreserved T cells are
thawed for electroporation with the RNA encoding the chimeric membrane protein.
[0230] Another procedure for ex vivo expansion cells is described in
U.S. Pat. No. 5,199,942. Expansion, such as described in
U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein.
Briefly, ex vivo culture and expansion of T cells comprises the addition to the cellular
growth factors, such as those described in
U.S. Pat. No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3 and c-kit ligand. In one embodiment,
expanding the T cells comprises culturing the T cells with a factor selected from
the group consisting of flt3-L, IL-1, IL-3 and c-kit ligand.
[0231] The culturing step as described herein (contact with agents as described herein or
after electroporation) can be very short, for example less than 24 hours such as 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23
hours. The culturing step as described further herein (contact with agents as described
herein) can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
or more days.
[0232] Various terms are used to describe cells in culture. Cell culture refers generally
to cells taken from a living organism and grown under controlled condition. A primary
cell culture is a culture of cells, tissues or organs taken directly from an organism
and before the first subculture. Cells are expanded in culture when they are placed
in a growth medium under conditions that facilitate cell growth and/or division, resulting
in a larger population of the cells. When cells are expanded in culture, the rate
of cell proliferation is typically measured by the amount of time required for the
cells to double in number, otherwise known as the doubling time.
[0233] Each round of subculturing is referred to as a passage. When cells are subcultured,
they are referred to as having been passaged. A specific population of cells, or a
cell line, is sometimes referred to or characterized by the number of times it has
been passaged. For example, a cultured cell population that has been passaged ten
times may be referred to as a P10 culture. The primary culture, i.e., the first culture
following the isolation of cells from tissue, is designated P0. Following the first
subculture, the cells are described as a secondary culture (P1 or passage 1). After
the second subculture, the cells become a tertiary culture (P2 or passage 2), and
so on. It will be understood by those of skill in the art that there may be many population
doublings during the period of passaging; therefore the number of population doublings
of a culture is greater than the passage number. The expansion of cells (i.e., the
number of population doublings) during the period between passaging depends on many
factors, including but is not limited to the seeding density, substrate, medium, and
time between passaging.
[0234] In one embodiment, the cells may be cultured for several hours (about 3 hours) to
about 14 days or any hourly integer value in between. Conditions appropriate for T
cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media
1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation
and viability, including serum (e.g., fetal bovine or human serum), interleukin-2
(IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and
TNF-α. or any other additives for the growth of cells known to the skilled artisan.
Other additives for the growth of cells include, but are not limited to, surfactant,
plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media
can include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer,
with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented
with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or
an amount of cytokine(s) sufficient for the growth and expansion of T cells. Antibiotics,
e.g., penicillin and streptomycin, are included only in experimental cultures, not in cultures
of cells that are to be infused into a subject. The target cells are maintained under
conditions necessary to support growth, for example, an appropriate temperature (
e.g., 37° C) and atmosphere (
e.g., air plus 5% CO
2).
[0235] The medium used to culture the T cells may include an agent that can co-stimulate
the T cells. For example, an agent that can stimulate CD3 is an antibody to CD3, and
an agent that can stimulate CD28 is an antibody to CD28. This is because, as demonstrated
by the data disclosed herein, a cell isolated by the methods disclosed herein can
be expanded approximately 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70
fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold,
700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold,
6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold,
10,000,000 fold, or greater. In one embodiment, the T cells expand in the range of
about 20 fold to about 50 fold, or more by culturing the electroporated population.
[0236] In one embodiment, the method includes introducing a nucleic acid encoding a T cell
receptor (TCR) comprising affinity for a surface antigen on a target cell into the
expanded T cells, and electroporating a RNA encoding a co-stimulatory molecule into
the T cells, wherein the electroporated T cells are capable of expressing the TCR
and the costimulatory molecule.
[0237] In another embodiment, the method further comprises stimulating the expanded T cells
with at least one co-stimulatory molecule selected from the group consisting of CD3,
CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. The stimulation may include
co-electroporation with RNA encoding the co-stimulatory molecule. In such an embodiment,
the expanded T cells are further electroporated or co-electroporated with a RNA encoding
CD3. The CD3 includes comprises at least two different CD3 chains, such as CD3 zeta
and CD3 epsilon chains.
[0238] In another embodiment, the method of expanding the T cells can further comprise isolating
the expanded T cells for further applications. In yet another embodiment, the method
of expanding can further comprise a subsequent electroporation of the expanded T cells
followed by culturing. The subsequent electroporation may include introducing a nucleic
acid encoding an agent, such as a transducing the expanded T cells, transfecting the
expanded T cells, or electroporating the expanded T cells with a nucleic acid encoding
a TCR, into the expanded population of T cells, wherein the agent further stimulates
the T cell. The agent may stimulate the T cells, such as by stimulating further expansion,
effector function, or another T cell function. In one embodiment, the agent nucleic
acid is co-electroporated with the chimeric membrane protein RNA. In another embodiment,
the agent nucleic acid, such as a TCR RNA, is electroporated after culturing the electroporated
population. In a further embodiment, the agent nucleic acid, such as a TCR RNA, is
electroporated into expanded T cells that were cryopreserved.
Therapy
[0239] The modified T cells described herein may be included in a composition for therapy.
The composition may include a pharmaceutical composition and further include a pharmaceutically
acceptable carrier. A therapeutically effective amount of the pharmaceutical composition
comprising the modified T cells may be administered.
[0240] In one aspect, the invention includes a method for stimulating a T cell-mediated
immune response to a target cell or tissue in a subject comprising administering to
a subject an effective amount of a modified T cell. In this embodiment, the T cell
is modified as described elsewhere herein. The modified T cells may be administered
to induce lysis of the target cell or tissue, such as where the induced lysis is antibody-dependent
cell-mediated cytotoxicity (ADCC).
[0241] In another aspect, the invention includes a method for adoptive cell transfer therapy
comprising administering an effective amount of pharmaceutical composition comprising
the modified T cell described herein to a subject in need thereof to prevent or treat
an immune reaction that is adverse to the subject.
[0242] In yet another embodiment, a method of treating a disease or condition associated
with enhanced immunity in a subject comprising administering an effective amount of
a pharmaceutical composition comprising the modified T cell described herein to a
subject in need thereof.
[0243] The modified T cells generated as described herein can be uniform and possess T cell
function. Further, the modified T cells can be administered to an animal, preferably
a mammal, even more preferably a human, to suppress an immune reaction, such as those
common to autoimmune diseases such as diabetes, psoriasis, rheumatoid arthritis, multiple
sclerosis, GVHD, enhancing allograft tolerance induction, transplant rejection, and
the like. In addition, the cells of the present invention can be used for the treatment
of any condition in which a diminished or otherwise inhibited immune response, especially
a cell-mediated immune response, is desirable to treat or alleviate the disease. In
one aspect, the invention includes treating a condition, such as an autoimmune disease,
in a subject, comprising administering to the subject a therapeutically effective
amount of a pharmaceutical composition comprising the modified T cell described herein.
[0244] Examples of autoimmune disease include but are not limited to, Acquired Immunodeficiency
Syndrome (AIDS, which is a viral disease with an autoimmune component), alopecia areata,
ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune
hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune
lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's
disease, cardiomyopathy, celiac sprue-dermatitis hepetiformis; chronic fatigue immune
dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD),
cicatricial pemphigoid, cold agglutinin disease, crest syndrome, Crohn's disease,
Degos' disease, dermatomyositis-juvenile, discoid lupus, essential mixed cryoglobulinemia,
fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre syndrome, Hashimoto's
thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP),
IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's
disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue
disease, multiple sclerosis, myasthenia gravis, pemacious anemia, polyarteritis nodosa,
polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and
dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis,
psoriatic arthritis, Raynaud's phenomena, Reiter's syndrome, rheumatic fever, rheumatoid
arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known
as systemic sclerosis (SS)), Sjogren's syndrome, stiff-man syndrome, systemic lupus
erythematosus, Takayasu arteritis, temporal arteritis/giant cell arteritis, ulcerative
colitis, uveitis, vitiligo and Wegener's granulomatosis.
[0245] The T cells generated as described herein can also be modified and used to treat
inflammatory disorders. Examples of inflammatory disorders include but are not limited
to, chronic and acute inflammatory disorders. Examples of inflammatory disorders include
Alzheimer's disease, asthma, atopic allergy, allergy, atherosclerosis, bronchial asthma,
eczema, glomerulonephritis, graft vs. host disease, hemolytic anemias, osteoarthritis,
sepsis, stroke, transplantation of tissue and organs, vasculitis, diabetic retinopathy
and ventilator induced lung injury.
[0246] In another embodiment, the modified T cell described herein may be used for the manufacture
of a medicament for the treatment of an immune response in a subject in need thereof.
[0247] Cells of the invention can be administered in dosages and routes and at times to
be determined in appropriate pre-clinical and clinical experimentation and trials.
Cell compositions may be administered multiple times at dosages within these ranges.
Administration of the cells of the invention may be combined with other methods useful
to treat the desired disease or condition as determined by those of skill in the art.
[0248] The cells of the invention to be administered may be autologous, allogeneic or xenogeneic
with respect to the subject undergoing therapy.
[0249] The administration of the cells of the invention may be carried out in any convenient
manner known to those of skill in the art. The cells of the present invention may
be administered to a subject by aerosol inhalation, injection, ingestion, transfusion,
implantation or transplantation. The compositions described herein may be administered
to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally,
intramedullary, intramuscularly, by intravenous (
i.v.) injection, or intraperitoneally. In other instances, the cells of the invention
are injected directly into a site of inflammation in the subject, a local disease
site in the subject, a lymph node, an organ, a tumor, and the like.
[0250] The cells described herein can also be administered using any number of matrices.
The present invention utilizes such matrices within the novel context of acting as
an artificial lymphoid organ to support, maintain, or modulate the immune system,
typically through modulation of T cells. Accordingly, the present invention can utilize
those matrix compositions and formulations which have demonstrated utility in tissue
engineering. Accordingly, the type of matrix that may be used in the compositions,
devices and methods of the invention is virtually limitless and may include both biological
and synthetic matrices. In one particular example, the compositions and devices set
forth by
U.S. Pat. Nos. 5,980,889;
5,913,998;
5,902,745;
5,843,069;
5,787,900; or
5,626,561 are utilized. Matrices comprise features commonly associated with being biocompatible
when administered to a mammalian host. Matrices may be formed from natural and/or
synthetic materials. The matrices may be non-biodegradable in instances where it is
desirable to leave permanent structures or removable structures in the body of an
animal, such as an implant; or biodegradable. The matrices may take the form of sponges,
implants, tubes, telfa pads, fibers, hollow fibers, lyophilized components, gels,
powders, porous compositions, or nanoparticles. In addition, matrices can be designed
to allow for sustained release of seeded cells or produced cytokine or other active
agent. In certain embodiments, the matrix of the present invention is flexible and
elastic, and may be described as a semisolid scaffold that is permeable to substances
such as inorganic salts, aqueous fluids and dissolved gaseous agents including oxygen.
[0251] A matrix is used herein as an example of a biocompatible substance. However, the
current invention is not limited to matrices and thus, wherever the term matrix or
matrices appears these terms should be read to include devices and other substances
which allow for cellular retention or cellular traversal, are biocompatible, and are
capable of allowing traversal of macromolecules either directly through the substance
such that the substance itself is a semi-permeable membrane or used in conjunction
with a particular semi-permeable substance.
Pharmaceutical compositions
[0252] Pharmaceutical compositions of the present invention may comprise the modified T
cell as described herein, in combination with one or more pharmaceutically or physiologically
acceptable carriers, diluents or excipients. Such compositions may comprise buffers
such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates
such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or
amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione;
adjuvants (
e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are
preferably formulated for intravenous administration.
[0253] Pharmaceutical compositions of the present invention may be administered in a manner
appropriate to the disease to be treated (or prevented). The quantity and frequency
of administration will be determined by such factors as the condition of the patient,
and the type and severity of the patient's disease, although appropriate dosages may
be determined by clinical trials.
[0254] When "an immunologically effective amount", "an anti-immune response effective amount",
"an immune response-inhibiting effective amount", or "therapeutic amount" is indicated,
the precise amount of the compositions of the present invention to be administered
can be determined by a physician with consideration of individual differences in age,
weight, immune response, and condition of the patient (subject). It can generally
be stated that a pharmaceutical composition comprising the modified T cells described
herein may be administered at a dosage of 10
4 to 10
9 cells/kg body weight, preferably 10
5 to 10
6 cells/kg body weight, including all integer values within those ranges. T cell compositions
may also be administered multiple times at these dosages. The cells can be administered
by using infusion techniques that are commonly known in immunotherapy (see, e.g.,
Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regime for a particular patient can readily be
determined by one skilled in the art of medicine by monitoring the patient for signs
of disease and adjusting the treatment accordingly.
[0255] In certain embodiments, it may be desired to administer activated T cells to a subject
and then subsequently redraw blood (or have an apheresis performed), activate T cells
therefrom according to the present invention, and reinfuse the patient with these
activated and expanded T cells. This process can be carried out multiple times every
few weeks. In certain embodiments, T cells can be activated from blood draws of from
10 ml to 400 ml. In certain embodiments, T cells are activated from blood draws of
20 ml, 30 ml, 40 ml, 50 ml, 60 ml, 70 ml, 80 ml, 90 ml, or 100 ml. Not to be bound
by theory, using this multiple blood draw/multiple reinfusion protocol, may select
out certain populations of T cells.
[0256] In certain embodiments of the present invention, cells expanded and modified using
the methods described herein, or other methods known in the art where T cells are
expanded to therapeutic levels, are administered to a patient in conjunction with
(e.g., before, simultaneously or following) any number of relevant treatment modalities,
including but not limited to treatment with agents such as antiviral therapy, cidofovir
and interleukin-2, Cytarabine (also known as ARA-C) or natalizumab treatment for MS
patients or efalizumab treatment for psoriasis patients or other treatments for PML
patients. In further embodiments, the T cells of the invention may be used in combination
with chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine,
methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents
such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytoxin, fludaribine,
cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and
irradiation. These drugs inhibit either the calcium dependent phosphatase calcineurin
(cyclosporine and FK506) or inhibit the p70S6 kinase that is important for growth
factor induced signaling (rapamycin). (
Liu et al., Cell 66:807-815, 1991;
Henderson et al., Immun. 73:316-321, 1991;
Bierer et al., Curr. Opin. Immun. 5:763-773, 1993). In a further embodiment, the cell compositions of the present invention are administered
to a patient in conjunction with (
e.g., before, simultaneously or following) bone marrow transplantation, T cell ablative
therapy using either chemotherapy agents such as, fludarabine, external-beam radiation
therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another
embodiment, the cell compositions of the present invention are administered following
B-cell ablative therapy such as agents that react with CD20,
e.g., Rituxan. For example, in one embodiment, subjects may undergo standard treatment
with high dose chemotherapy followed by peripheral blood stem cell transplantation.
In certain embodiments, following the transplant, subjects receive an infusion of
the expanded immune cells of the present invention. In an additional embodiment, expanded
cells are administered before or following surgery.
[0257] The dosage of the above treatments to be administered to a patient will vary with
the precise nature of the condition being treated and the recipient of the treatment.
The scaling of dosages for human administration can be performed according to art-accepted
practices. The dose for CAMPATH, for example, will generally be in the range 1 to
about 100 mg for an adult patient, usually administered daily for a period between
1 and 30 days. The preferred daily dose is 1 to 10 mg per day although in some instances
larger doses of up to 40 mg per day may be used (described in
U.S. Patent No. 6,120,766).
[0258] It should be understood that the method and compositions that would be useful in
the present invention are not limited to the particular formulations set forth in
the examples. The following examples are put forth so as to provide those of ordinary
skill in the art with a complete disclosure and description of how to make and use
the cells, expansion and culture methods, and therapeutic methods of the invention,
and are not intended to limit the scope of what the inventors regard as their invention.
[0259] The practice of the present invention employs, unless otherwise indicated, conventional
techniques of molecular biology (including recombinant techniques), microbiology,
cell biology, biochemistry and immunology, which are well within the purview of the
skilled artisan. Such techniques are explained fully in the literature, such as, "
Molecular Cloning: A Laboratory Manual", fourth edition (Sambrook, 2012); "
Oligonucleotide Synthesis" (Gait, 1984); "
Culture of Animal Cells" (Freshney, 2010); "
Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1997); "
Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "
Short Protocols in Molecular Biology" (Ausubel, 2002); "
Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar,
2011); "
Current Protocols in Immunology" (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides
of the invention, and, as such, may be considered in making and practicing the invention.
Particularly useful techniques for particular embodiments will be discussed in the
sections that follow.
EXPERIMENTAL EXAMPLES
[0260] The invention is further described in detail by reference to the following experimental
examples. These examples are provided for purposes of illustration only, and are not
intended to be limiting unless otherwise specified.
[0261] Without further description, it is believed that one of ordinary skill in the art
can, using the preceding description and the following illustrative examples, make
and utilize the compounds of the present invention and practice the claimed methods.
The following working examples therefore, specifically point out the preferred embodiments
of the present invention, and are not to be construed as limiting in any way the remainder
of the disclosure.
[0262] The materials and methods employed in these experiments are now described.
[0263] Primary human lymphocytes. Primary lymphocytes were stimulated with microbeads coated with CD3 and CD28 stimulatory
antibodies (Life Technologies, Grand Island, NY, Catalog) as described (
Human gene therapy 2011, 22(12):1575-1586). T cells were cryopreserved at day 10 in a solution of 90% fetal calf serum and
10% dimethylsulfoxide (DMSO) at 1 × 10
8 cells/vial.
[0264] NALM-6 was purchased from the German DSMZ Cell Collection (DSMZ catalog code: ACC
128). K562 and PC3 were purchased from American Type Culture Collection. 624mel melanoma
line was obtained from the Surgery Branch (NCI/NIH). All the cell lines were cultured
as instructed and routinely tested for mycoplasma contamination and confirmed as being
negative.
[0266] Human primary T cell preparation. Primary human CD4 and CD8 T cells were isolated from healthy volunteer donors following
leukapheresis by negative selection using RosetteSep kits (Stem Cell Technologies,
Vancouver BC, Canada). All specimens were collected under a University Institutional
Review Board-approved protocol, and written informed consent was obtained from each
donor.
[0267] Design and construction of CRISPRs. Cas9 DNA was synthesized by PCR then inserted to PGEM vector. gRNAs were selected
by GN19 with a NGG PAM site, with some selected from N20 with a NGG PAM site. All
gRNAs contained complementary sequences comprised of more than 13 base pair mispairs,
with potential off-target mRNA sites excluded (Table 1). GRNAs were designed, as shown
in Figure 1A, and synthesized by overlap PCR. All gRNA PCR products were ligated into
the MSGV vector. In vitro transcribed CAS9 and gRNA targeted constant regions of TCR
α, β chains and beta-2 microglobin. gRNAs were designed to target either a sequence
within exon 1 of the TCR α constant region, a consensus sequence common to exon 1
of both TCR β constant regions 1 and 2, beta-2 microglobulin or PD1. Sequences encoding
the gRNAs were assembled using overlap PCR and cloned into the MSGV vector containing
a T7 promoter. These plasmids were linearized with EcoRI. gRNA was in vitro transcribed.
Cas9 mRNA was in vitro transcribed using mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies,
Carlsbad, CA). The mRNA was stored at -80°C in nuclease-free vials for single use.
The gRNA targeting sequences used for the animal study were as follows:
TRAC-gRNA: TGTGCTAGACATGAGGTCTA, SEQ ID NO:1
TRBC-gRNA: GCAGTATCTGGAGTCATTGA, SEQ ID NO:2
B2M-gRNA: CGCGAGCACAGCTAAGGCCA, SEQ ID NO:3
PD1-gRNA: GGCGCCCTGGCCAGTCGTCT, SEQ ID NO:4
FAS-gRNA: GAGGGTCCAGATGCCCAGCA, SEQ ID NO:5
[0268] Flow cytometry. The following monoclonal antibodies and reagents were used with indicated specificity
and the appropriate isotype controls. From BD Biosciences (San Jose, CA): APC-conjugated
anti-CD3 (555335), FITC-anti-CD8(555366), PE-anti-CD8(555635), FITC-anti-CD27 (555440),
PE-anti-CD107(555801), PE-anti-beta-2 microglobin (551337), FITC-anti-HLA(555552);
Biolegend (San Diego, CA): FITC-anti-CD45RO(304204), APC-anti-CD62L(304814), APC-anti-CCR7(353214);
and Beckman Coulter (Pasadena, CA): PE-anti-Vb13.1(IM2021U). Data was acquired on
a FACS Accuri (BD Biosciences, San Jose, CA.) using CellQuest version 3.3 (BD Biosciences,
San Jose, CA) and analyzed by FCS Express version 3.00 (De Novo Software, Los Angeles,
CA) or FlowJo version 7.6.1 (Tree Star, Inc. Ashland, OR).
[0269] Propagation of primary T cells. Primary human T cells were cultured in RPMI 1640 supplemented with 10% FCS, 100-U/ml
penicillin, 100-g/ml streptomycin sulfate, 10-mM Hepes, and stimulated with magnetic
beads coated with anti-CD3/anti-CD28 at a 1:3 cell to bead ratio. Cells were counted
and fed every 2 days and once T cells appeared to rest down, as determined by both
decreased growth kinetics and cell size, the T cells were either used for functional
assays or cryopreserved.
[0270] Generation of CD3neg T cells. DNA supercoiled plasmids were linearized by SpeI and EcoRI, respectively. gRNA was
in vitro transcribed by T7 mScript
™ Standard mRNA Production System (Cambio, C-MSC100625, Cambridge, England). All mRNA
(Cas9, TCR α, TCR β and CARs) was in vitro transcribed using mMESSAGE mMACHINE T7
ULTRA kit (Life Technologies, AM1345, Carlsbad, CA). T cells were stimulated by CD3/CD28
dynabeads for three days prior to electroporation. Ten million primary T cells were
de-beaded prior to electro-transfer of 20 µg Cas9, 10 µg gRNA species into the cells
with a 360V, 1ms parameter by BTX830, following a second and/or a third electro-transfer
of 10 µg gRNA. Also, T cells were washed three times with OPTI-MEM and re-suspended
in OPTI-MEM (Invitrogen) at a final concentration of 1-3×10
8 cells/ml. Subsequently, 0.1 ml of the cells was mixed with 10 µg of IVT RNA (or as
indicated) and electroporated in a 2 mm cuvette. Ten million primary T cells were
de-beaded prior to the electrotransfer of 20 µg of Cas9 and 10 µg of gRNA species
into the cells using a BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms; this process
was followed by a second and a third electrotransfer of 5 µg of gRNA 12 to 24 hours
later.
[0271] Following electroporation, cells were immediately placed in 2 mL of pre-warmed culture
media and cultured at 37°C, 5% CO
2, or 32°C, 5% CO
2 for 1 day then returned to 37°C, 5% CO
2.
[0272] TCR α and β double disruption or TRAC, TRBC and B2M triple disruption. To generate TCR α and β double-knockout T cells, Cas9 mRNA was co-electroporated
with two different gRNAs targeting TCR α chain (TRAC), and TCR β chain (TRBC). The
TCR α and β double-knockout T cells could be purified in 2 steps: 1) depletion of
TCR-positive and α chain single-knockout cells with anti-CD3 microbeads after the
electroporation of the 1G4 TCR α chain RNA, and 2) depletion of TCR β chain single-knockout
cells with anti-CD3 microbeads after the electroporation of the TCR β chain RNA. For
TRAC, TRBC and B2M triple disruption, T cells were electroporated with Cas9 mRNA and
gRNAs targeting the TCR α and β chains and beta-2 microglobulin 3 days after anti-CD3/CD28
bead stimulation. The HLA-I-negative cell population was enriched on day 9 and electroporated
with TCR α chain RNA. The TCR-negative population was enriched on day 10. Five days
later, these cells were electroporated with TCR β chain RNA, and the TCR-negative
cell population was sorted the next day to obtain universal T cells. On day 18, TCR
or CAR RNA was electroporated into the universal T cells to generate universal effector
cells. TCR and HLA-I molecule expression was confirmed at each step.
[0273] Generation of universal CART cells. Universal CART cells were generated by combing the lentiviral transduction of CD19
or PSCA CAR with the RNA electroporation of CRISPR/gRNAs. 1 day after anti-CD3/CD28
beads stimulation, T cells were transduced with lentiviral-CD19 or PSCA CAR. 2 days
later, Cas9 and gRNAs targeting TCR α, β chain, B2M, PD1 were transferred into T cells
by electroporation. 6 days after CRISPRs delivery, T cells negative for CD3, HLA-I,
PD1 were sorted by microbeads depletion.
[0274] Enrichment of CD3neg T cells. Cells washed with Auto MACS buffer were incubated for 30 minutes with CD3 microbeads
(Miltenyi Biotec, 130-050-101, Auburn, CA) at 4°C. After washing twice, cells were
passed through a LD column (MiltenyiBiotec, 130-042-901, Auburn, CA), and the flow-through
fraction was collected for further use. The CD3 expression of CD3
neg T cells was restored by co-electroporation of 1G4TCR α and β mRNA, and the cells
were expanded using a single Rapid Expansion Protocol (REP), CD3/CD28 Dynabeads or
K562-based aAPC.
[0275] Generation and propagation of CD3neg T cells. CD3
neg T cells had CD3 expression restored by electro-transfer of exogenous 1G4TCR alpha
chain and TCR beta chain in vitro transcribed mRNA (5 µg for each chain). These cells
were expanded using a single Rapid Expansion Protocol (REP). PBMCs from three different
donors: ND052 105×10
6, ND405 83×10
6, ND410 136×10
6, were irradiated, then mixed together, to obtain a total of 324×10
6 PBMCs. The PBMCs were re-suspended in a final volume of 90 ml then R10 were added
to 300 ml, mixed, and divided into two T150 ml flasks. OKT were added to a final concentration
of 30 ng/ml. On day 2, IL-2 was added to 50 CU/ml. From day 5, cells were counted
and fed every 2 days and once T cells appeared to rest down, as determined by both
decreased growth kinetics and cell size, they were either used for functional assays
or cryopreserved.
[0276] Sanger sequencing. The level of genomic disruption of TCR α chain (TRAC), TCR β chain 1 (TRBC1), and
TCR β chain 2 (TRBC2) in T cells was determined by Surveyor Nuclease assay (Transgenomics,
Omaha, NE). The percent target disruption was quantified by densitometry. The PCR
primers used for the amplification of target locus were:
TRAC forward, 5'-TCATGTCCTAACCCTGATCCTCTT-3' SEQ ID NO:6
TRAC reverse, 5'-TTGGACTTTTCCCAGCTGACAGA-3' SEQ ID NO:7
TRBC total forward, 5'- TACCAGGACCAGACAGCTCTTAGA-3' SEQ ID NO:8
TRBC total reverse, 5'- TCTCACCTAATCTCCTCCAGGCAT-3' SEQ ID NO:9
PCR products were purified and ligated to TOPO cloning vector (Invitrogen) then transformed
in E.coli. Single clone was picked and sequenced to calculate the indels.
[0277] Generation of siRNA and CRISPRi for electroporation. RNA duplex targeting TCR constant regions for either alpha (5'-rArGrGrArGrGrArUrUrCrGrGrArArCrCrCrArArUrCrArCrUrGrArC-3'
SEQ ID NO:10 and 5'-rCrArGrUrGrArUrUrGrGrGrUrUrCrCrGrArArUrCrCrUrCCT-3' SEQ ID NO:11)
or beta (5'-rArCrCrUrCrCrUrUrCrCrCrArUrUrCrArCrCrCrArCrCrArGrCrUrC-3' SEQ ID NO:12
and 5'-rGrCrUrGrGrUrGrGrGrUrGrArArUrGrGrGrArArGrGrArGGT-3' SEQ ID NO:13) were designed
using Custom RNAi Design Tool (Integrated DNA Technologies, Coralville, IA) and the
siRNA was synthesized (Integrated DNA Technologies, Coralville, IA). siRNA for both
TCR alpha and beta was mixed and electroporated into stimulated T cells for endogenous
TCR knockdown.
[0278] mRNA in vitro transcription and T cell electroporation. T7 mscript systems kit (CellScript) was used to generate in vitro transcribed (IVT)
RNA. CD3/CD28 bead stimulated T cells were electroporated with IVT RNA using BTX EM830
(Harvard Apparatus BTX) as previously described
(Cancer research 2010, 70(22):9053-9061). Briefly, T cells were washed three times and resuspended in OPTI-MEM (Invitrogen)
at a final concentration of 1-3 × 10
8 cells/ml. Subsequently, 0.1 ml of cells were mixed with 10 ug IVT RNA (or as indicated)
and electroporated in a 2 mm cuvette.
[0279] ELISA assays. Target cells, different tumor cell lines expressing CD19, were washed and suspended
at 1×10
6 cells/ml in R10 medium (RPMI 1640 supplemented with 10% fetal calf serum; Invitrogen).
100 ul of each target cell type was added in duplicate to a 96 well round bottom plate
(Coming). Effector T cells were washed, and resuspended at 1×10
6 cells/ml in R10 medium and then 100 ul of T cells were combined with the target cells
in the indicated wells. In addition, wells containing T cells alone were prepared
as a control. The plates were incubated at 37° C for 18 to 20 hours. After the incubation,
supernatant was harvested and subjected to an ELISA assay (eBioscience).
[0280] CD107a staining Cells were plated at an Effector cell:T cell ratio of 1:1 (1×10
5 effectors to 1×10
5 targets) in 160 µl of complete RPMI medium in a 96 well plate. 20 µl of phycoerythrin-labeled
anti-CD107a antibody (BD Biosciences, 555801) was added and the plate was incubated
at 37° C for 1 hour before adding Golgi Stop (2 ul Golgi Stop in 3 ml RPMI medium,
20 ul/well; BD Biosciences, 51-2092KZ) and incubating the plate for another 2.5 hours.
Then 5 µl FTTC-anti-CD8 and 5 ul APC-anti-CD3 were added and incubated at 37° C for
30 min. After incubation, the samples were washed with FACS buffer and analyzed by
flow cytometry.
[0281] Luciferase based CTL assay. Naml6-CBG tumor cells were generated and employed in a modified version of a luciferase
based cytotoxic T lymphocyte assay. Briefly, click beetle green luciferase (CBG) was
cloned into the pELNS vector, packaged into lentivirus, transduced into Naml6 tumor
cells and sorted for CBG expression. The resulting Naml6-CBG cells were washed and
resuspended at 1×10
5 cells/ml in R10 medium, and 100 ul of CBG-labeled cells were incubated with different
ratios of T cells (e.g. 30:1, 15:1, etc) overnight at 37° C. 100 ul of the mixture
was transferred to a 96 well white luminometerplate. 100 ul of substrate was added
to the cells and luminescence was immediately determined. The results are reported
as percent killing based on the luciferase activity in the wells with tumor cells
but no T cells (% killing = 100 - ((RLU from well with effector and target cell coculture)
/ (RLU from well with target cells) × 100)).
[0282] Mouse xenograft studies. Studies were performed as previously described with certain modifications (
Human gene therapy 2011, 22(12):1575-1586;
Proceedings of the National Academy of Sciences of the United States of America 2009,
106(9):3360-3365). Briefly, 6-10 week old NOD/SCID gamma (NSG) mice were injected subcutaneously with
1×10
6 PC3-CBG tumors cells on the right flank at day 0 and the same mice were given SK-OV3-CBG
tumor cells (5×10
6 cells/mouse, subcutaneously.) on the left flank at day 5. The mice were treated with
T cells via the tail vein at day 23 post PC3-CBG tumor inoculation, such that both
tumors were approximately 200 mm
3 in volume. Lentivirally transduced T cells were given at 1×10
7 cells/mouse (10M), or 3×10
6 cells/mouse (3M). Briefly, for the Nalm6 tumor model, 6- to 10-week-old NOD/SCID
gamma (NSG) mice were injected with 1×10
6 click beetle green (CBG) transduced Nalm6 (Nalm6-CBG) cells through the tail vein
on day 0. The T cell treatment began on day 7 after the tumor inoculation. For the
PC3-PDL1 solid tumor model, 6- to 10-week-old NOD/SCID gamma (NSG) mice were injected
subcutaneously with 1×10
6 PSCA, PD-L1 and CBG transduced PC3 (PC3-PSCA-PDL1-CBG) tumors cells in the right
flank on day 0. The mice were treated with T cells via the tail vein at day 22 post
PC3-PDL1-CBG tumor inoculation, such that the tumors were approximately 200 mm
3 in volume. T cells were given at 2×10
6 cells/mouse (2M). Animals were randomized and grouped based on baseline tumor size.
All animals were included in the experiments and blinded tumor assessment was done
for all the animal experiments conducted.
[0283] T cell stimulation, lentiviral transduction and CRISPR electroporation procedure. Figure 84 shows the procedure used to stimulate, lentiviral transduce and CRISPR
electroporate T cells. On day 0, T cells were obtained from 3 donors (100×10
6 cells/donor). The cells were stimulated with anti-CD3/anti-CD28 beads at a T cell:bead
ratio of 1:3. The concentration of cells was adjusted to 0.5×10
6/ml with 1.00mL/flask. On day 1, stimulated T cells were transduced with CD19 CAR
lentivirus at multiplicity of infection (MOI) of 2. 50mL (25×10
6 cells) of T cells were reserved as unmodified T cells (Group 9). On Day 3, the beads
were removed, the cells washed 2x in Opti-MEM media, and the transduced T cells from
each donor were separated into two groups, CART/mock EP (10mL, 50×10
6/mL) and CART/CRISPR (10mL, 50×10
6/mL). The cells were then electroporated with CAS9 RNA (1st EP) at 500V/1ms with 120µg
of CAS9 RNA/400µL of T cells. After electroporation, Groups 1, 3, 5 and 7 cells were
then split by culturing T cells in half new medium and half cultured medium. On day
4, the cells were washed twice and resuspended in Opti-MEM at 50×10
6/mL. 20µg TRBC4 and B2M gRNA. was electroporated into the 400µL of T cells. After
electroporation, the cells were cultured at 1×10
6 cells/mL in half fresh medium and half cultured medium. On days 5 and 7, the cells
were split and resuspended in half fresh medium and half cultured medium. On day 8,
CD3+ cells were removed from Groups 2, 4 and 6 via a low-density column. The CD3-
T cells were resuspended at 0.5-1×10
6 cells/mL in half fresh medium and half cultured medium and cultured to expand the
cells. On day 11, the T cells were harvested and 25×10
5 cells from the three donors were sent for karyotyping. The remaining cells were aliquoted
and frozen.
[0284] The results of the experiments are now described.
Example 1: Disruption of the TCR-CD3 complex on T cells using CRISPR.
[0285] Thirteen gRNAs targeting the constant regions of TCR α chain, 10 gRNAs targeting
the constant regions TCR β chain, and 10 RNAs targeting the beta-2 microglobin gene.(Figures
1A-1C and Figures 9A-9D) were developed and tested in 293T cells. Primary human T
cells were propagated ex vivo for three days with anti-CD3/anti-CD28 dynabeads for
three days. Since transient expression of CRISPR is sufficient to mediate gene knockout,
a "hit-and-run" delivery strategy was developed to transiently express the CRISPRs
by utilizing electro-transfer of in vitro transcribed RNA encoding CAS9 and gRNAs
(Figure 2C).
[0286] To measure TCR expression, a mAb specific for CD3 was used, which is only present
on the cell surface when TCR antibody is expressed. Six days after electro-transfer,
flow cytometric analysis revealed that CRISPRs targeting TRBC eliminated CD3 expression
on primary T cells at levels of 13.7 (Figure 2D) in donor ND147. The efficiency of
TCR knockout correlated with the amount of electro-transferred mRNA (Figure 2D). Although
the electro-transfer of RNA in primary T cells was well- tolerated, a slight reduction
in cell viability was observed that correlated with increasing amounts of introduced
RNA. ZFN and TALEN mediated gene disruption has been reported to be more efficient
when cells were transiently exposed to mild hypothermia. The same phenomenon was observed
with this CRISPR system.
[0287] The T cells were cultured for 1 day at 32°C after electro-transfer. CRISPR-mediated
disruption of CD3 was up to 2.5-fold better when electroporated T cells were cultured
at 32°C versus 37°C. Using this approach, 5.43% and 16.7% of electroporated T-cells
lost expression of CD3 using the CRISPRs targeting TRAC and TRBC, respectively, (Figure
2D, lower panel). No change in the levels of CD3 negative cells in the CAS9 MOCK samples
and no appreciable decrease in viability (measured by Trypan blue) were observed.
[0288] When gRNAs were electro-transferred for a second and a third time, the efficiency
of eliminating CD3 expression on primary T cells at levels was greatly improved.
- Targeting TRAC: at levels reaching 77% after three times electro-transfer of gRNA
(Figure 4A),
- Targeting TRAC or TRBC at levels reaching 64.5% or 57.5%, respectively, after a second
electro-transfer of gRNAs with a slight decreased viability (Figure 4C).
[0289] To confirm that electroporated T cells had been genetically modified at the intended
gRNA target sites (TCR α or β loci), Sanger sequencing was performed using specific
oligonucleotide primers flanking target sites within TRAC, TRBC1, or TRBC2. Multiple
peaks at the indicated PCR products starting from the target sites were present only
after electro-transfer of CRISPRs and the percent disruption correlated with loss
of cell surface CD3 expression (Figure 1C and 3B). These experiments in primary T
cells confirmed that CRISPRs designed to target TRAC or TRBC led to permanent disruption
of αβ TCR expression, as assessed by Sanger sequencing and confirmed by flow cytometric
analysis of CD3.
Example 2: Enrichment of TCR αβ negative T cells.
[0290] For future clinical applications, rapid and robust methods for isolating sources
of TCR disrupted populations may be utilized. To begin to address this issue, the
TCR/CD3
neg population was enriched by negative selection using clinically-approved paramagnetic
beads and a depletion column. With a single depletion step, the CD3
neg population was enhanced to over 99% (Figure 3A). A CD3
neg population could not be enriched from untransfected control cells. Back-to-back depletion
steps resulted in >99% enrichment, without skewing the CD4 or CDS T cell subsets (Figure
3C). Sequencing results also showed deletions and insertions were introduced to TCR
alpha and beta locus after CRISPR modification (Figure 3D).
Example 3: Generation of HLA-CLASS Ineg T cells by CRISPR.
[0291] To test the ability of CRISPR to knock out HLA-CLASS I expression from allogeneic
T cells, gRNAs targeting beta-2 microglobin were designed. The beta-2 microglobin
locus could be manipulated by CRISPR in 293 T cells (Figure 9A). Evidence showed disruption
of beta-2 microglobin abolished T cell surface HLA-CLASS I expression (Figure 9B).
[0292] IFN-gamma greatly improved, approximately 10 fold, targeting efficiency of beta-2
microglobin in T cells (Figure 9C). Multiple electro-transfers of beta-2 microglobin
gRNAs gave a 66% beta-2 microglobin negative population (Figure 11A).
[0293] For future allograft transplantation clinical applications, rapid and robust methods
for isolating sources of HLA-CLASS I null populations will be needed. To begin to
address this issue, the cells were labeled with PE-anti-beta-2 microglobin antibody,
and enriched for a HLA-CLASS I
neg population by negative selection using clinically-approved paramagnetic anti-PE microbeads
and a depletion column. With a single depletion step, the HLA-CLASS I
neg population was enhanced to over 99%. A HLA-CLASS I
neg population could not be enriched from untransfected control cells. An analysis of
HLA-CLASS I repertoire in enriched HLA-CLASS I
neg T cells via flow cytometry validated the elimination of HLA-CLASS I expression from
the cell surface (Figure 9D).
Example 4: CD3nesT cells can be propagated by different methods.
[0294] CD3
neg T cells restored CD3 expression after electro-transfer of exogenous 1G4-TCR alpha
and beta chain in vitro transcribed mRNA (5 µg each). These cells were expanded by:
(1) a single Rapid Expansion Protocol (REP), then tested for activity and specificity.
PBMCs were obtained from three different donors: ND052 105×10
6, ND405 83×10
6, ND410 136×10
6. Cell were after irradiated, then mixed together, and a total 324×10
6 PBMCs were obtained. 2×10
6 cells were electro-transferred with RNA. CD3
neg T were re-suspended in a final volume of 90 ml and R10 media was added for a total
volume of 300 ml. The cells were divided into 2 T150 ml flasks. OKT was added to a
final concentration of 30 ng/ml. On day 2, IL-2 was added to 50 CU/ml. From day 5,
cells were counted and fed every 2 days and once T cells appeared to rest down, as
determined by both decreased growth kinetics and cell size, they were either used
for functional assays or cryopreserved.
[0295] After a single REP, CD3
neg T cells were expanded for a 500 fold increase in number. These cells were expanded
by: (2) stimulated with magnetic beads coated with anti-CD3/anti-CD28 at a 1:3 cell
to bead ratio.
[0296] After a single REP, CD3
neg T cells were expanded for a 500 fold increase in number. These cells were expanded
by: (3) co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in equal mixture
at a concentration of 1×10
6/ml.
[0297] After a single REP, CD3
neg T cells were expanded for a 500 fold increase in number. These cells were expanded
by: (4) co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in equal mixture
at a concentration of 1×10
6/ml with 30 ng/ml OKT
[0298] After a single REP, CD3
neg T cells were expanded for a 500 fold increase in number. These cells were expanded
by: (5) co-cultured with irradiated K562-CD19 and K562/86/64/A2(2D11) in equal mixture
at a concentration of 1×10
6/ml with 1 mg/mi NY-ESO peptide.
Example 5: Re-direction of TCRneg T cells by electro-transfer of TCR.
[0299] To test the function of TCR
negT cells, these cells were re-directed by electro-transfer of TCR. By introducing TCR
alpha chain and TCR beta chain, these cells expressed high levels of TCR. The expression
of Vb13.1 was much higher in electro-transferred TCR
negT cells compared to CAS9 MOCK control (Figure 7A). When the cells were co-cultured
with the Nahn-6 NY-ESO leukemia cell line, positive for both HLA-A2 and NY-ESO, the
cells showed high levels of 107a, indicating elevated de-granulation activity (Figure
7B). The killing assay also showed potent toxicity towards this cell line (Figure
7C). This indicated that these cells are potentially safer than traditional clinical
trials with T cell expressing CARs and TCRs, as these cells would not trigger GVHD
and have less miss-pair toxicity than normal T cells with TCR treatment.
[0300] Some reports have shown that T cells can be genetically edited by ZFNs or TALEN to
eliminate expression of the endogenous αβ TCR. The methods and compositions described
herein to selectively deplete T cells expressing undesired αβ TCR also include incomplete
knockout of the endogenous TCR to treat GVHD and inhibit endogenous TCR from adversely
affecting CAR function (e.g., through competition for transcription factors). Therefore,
a genetic approach was designed using designer ZFNs to permanently disrupt the α and
β constant region sequences in T cells, thereby eliminating TCR expression.
[0301] ZFNs and TALENs are artificial restriction enzymes generated by fusing a DNA binding
domain to a DNA cleavage domain. When ZFNs and TALENs do not work efficiently, it
is often difficult to determine the cause. Failure could reflect a problem with the
design, with accessibility of the target sequence, or a delivery issue. At the same
time, ZFN targeting efficiency is usually low in T cells, making it difficult to manipulate
multiple genes at one time.
[0302] Distinct ZFNs and TALENs, the CRISPR/Cas system has recently emerged as a potentially
facile and efficient alternative to ZFNs and TALENs for inducing targeted genetic
alterations. Recent work has shown that target recognition by the Cas9 protein requires
a 'seed' sequence within the crRNA and a conserved di-nucleotide-containing protospacer
adjacent motif (PAM) sequence upstream of the crRNA-binding region. The CRISPR/CAS
system can thereby be retargeted to cleave virtually any DNA sequence by redesigning
the crRNA. The data disclosed herein shows the potential for gene editing by CRISPR/CAS
in 293T cells and primary T cells. The CRISPR/CAS system can simultaneously target
multiple genomic loci by co-expressing a single CAS9 protein with two or more gRNAs,
making this system uniquely suited for multiplex gene editing or synergistic activation
of target genes. By administering different gRNAs together with CAS9, multiple genes
can be simultaneously disrupted in T cells.
Example 6: HLA CLASS I and TCR α, β chain triple knockout by CRISPR.
[0303] To work toward "off-the-shelf" allogeneic t-cell therapies for malignancies and infectious
diseases, cell therapy by infusion of T cells was designed to reconstitute immunity
against pathogens and malignancies. The amount of time required to manufacture T cells
with the desired properties and in sufficient numbers ex vivo is often incompatible
with the treatment window for patients. Furthermore, autologous T cells from patients
with advanced disease may have compromised function and be tolerant to desired antigens.
[0304] To address this, patients can be infused with allogeneic T cells to avoid immune-mediated
rejection caused by host T cells recognizing disparate major or minor histocompatibility
antigens on the infused cells. To broaden the application of T cell therapy, and for
future allograft transplantation, rapid and robust methods for isolating sources of
TCR and HLA-CLASS I disrupted populations can be generated.
[0305] ZFN and TALEN comprise a zinc finger DNA-binding domain designed to bind a specific
DNA sequence fused to the cleavage domain of Fokl endonuclease. The design and construction
of ZFN and TALEN is very complicated and time consuming if there is more than one
gene to be manipulated, because the genes must be targeted individually. With the
CRISPR system described herein, the efficiency and shortened the time course of gene
disruption can be obtained.
[0306] To address this issue, CAS9 was electro-transferred with three different gRNAs targeting
TRAC, TRBC and beta-2 microglobin. Cells were labeled with PE-anti-beta-2 microglobin
antibody and enriched for a HLA-CLASS I
neg population by negative selection using clinically- approved paramagnetic anti-PE
microbeads and a depletion column. With a single depletion step, the HLA-CLASS I
neg population was enhanced to over 99% (Figure 9D). Then the cells were re-introduced
with TCR alpha chain, and HLA-CLASS I
neg CD3
neg population was enriched by microbeads (Figure 11). Five days later, the TCR beta
chain was re-introduced into the cells, and a HLA-CLASS I
neg CD3
neg population was enriched by microbeads again. Two days later, TCR was electro-transferred
into these triple knock out cells. On the day after electro-transformation, the cells
were stimulated with CD3/CD28 dynabeads. Then, the cells underwent lentiviral delivery
of antigen specific TCR the next day and culture expansion.
Example 7: FAS, PD1, CTLA4, PPP2R2D knockout by CRISPR.
[0307] The FAS receptor/FAS ligand (FAS/FASL) apoptosis signaling pathway has been widely
studied and is well characterized in T cells. PD1 and CTLA4 are two major inhibitory
signaling pathway in T cells that have also been extensively studied. Direct evidence
for the potential therapeutic impact of targeting these pathways came from studies
in preclinical murine tumor models demonstrating enhanced anti-tumor immunity after
antibody-mediated blockade of CTIA-4, PD-1 or PD-L1. Similar antibodies for use in
humans have been developed, and early clinical data showed promising results. Ppp2r2d
knockdown may also inhibit T-cell apoptosis and enhance T-cell proliferation, as well
as cytokine production. Ppp2r2d has potential as a target to improve the function
of human T cells.
[0308] To address this issue, CAS9 and three different gRNAs targeting FAS, PD1, CTLA4,
PPP2r2d were electro-transferred into T cells. Sanger sequencing data showed that
the indicated locus of FAS, PD1, CTLA4, PPP2r2d had been modified by the CRISPRs.
FAS was also replaced by GFP with homologous recombination triggered by CRISPR. FACS
data showed the surface expression of FAS and PD1 was abolished.
Example 8: Generation of IPS cells with gene modified primary and T cells.
[0309] Progress in adoptive T-cell therapy for cancer and infectious diseases is hampered
by the lack of readily available and antigen-specific human T lymphocytes. Pluripotent
stem cells could provide an unlimited source of T lymphocytes. To address this issue,
the expression of FAS, PD1, CTLA4, PPP2r2d were disrupted in primary cells and T cells.
[0310] Sendai virus was used to reprogram primary cells and T cells. There are multiple
methods to generate iPSCs, including virus-mediated gene transduction and chemical
induction. While lentiviral and retroviral vectors require integration into host chromosomes
to express reprogramming genes, DNA-based vectors, such as adenovirus, adeno-associated
virus, and plasmid vectors, exist episomally and do not require integration. However,
they may still be integrated into host chromosomes at certain frequencies, and the
reprogramming efficiency is relatively low. Likewise, mRNA based reprogramming is
complicated and shown to be extremely inefficient.
[0311] Unlike these methods, Sendai virus does not integrate into the host genome or alter
the genetic information of the host cell. Sendai virus also has reprogramming potential
comparable to lentiviral- and retroviral-based gene transduction.
[0312] Each well in a 24 well plate was seeded with 0.1 million wild type, FAS
neg, CD3
neg TCR alpha chain and TCR beta chain knock-out T cells. The cells were stimulated with
CD3/CD28 beads. At day 3 post stimulation, the beads were removed, the cells resuspended
in 1 mL of pre-warmed T cell complete medium, and then incubated with a calculated
volume of CytoTune Sendai virus comprising a polycistronic vector for expression of
hKlf4, hOct3/4 and hSox2 in the cells (Lifetechnologies, Carlsbad, CA). Treated T
cells were seeded in 24 well plates, and centrifuged at 2250 rpm for 90 minutes at
room temperature. An additional 1 mL of complete T cell medium was added to each well
and the plate was incubated overnight at 37°C in a humidified atmosphere of 5% CO2.
[0313] On the day after transduction, Sendai virus was removed by washing the T cells with
fresh complete medium and culturing the cells for 2 days. Media was half changed every
day. On day 3 after infection, cells were transferred to MEF feeder plates and cultured
in T cell medium without any cytokines. Four days after infection, the cells were
cultured in standard hES medium. Media was changed every day. ES-like colonies were
observed around day 7. The cells were cultured in conditioned hES medium from day
15 and cultures continued for an additional 10 days. Colonies were picked at around
25 to 30 days after transduction.
[0314] At around day 4, cell clumps were formed on feeder cells, indicating that the initiation
of the reprogramming process. T cells went through dramatic morphological changes
during the process of reprogramming to iPSCs. At around day 12, large cell clumps
with loose edges began to emerge. At around day 18, T cells were transformed to typical
ES-like colonies with well defined edges. Typical embryonic stem cell morphology was
observed indicating that the FAS
neg, CD3
neg TCR alpha chain and TCR beta chain knock-out T cells were induced to a pluripotent
state under defined reprogramming conditions (Figure 17A and 18A).
[0315] FAS
neg T cells were easier to reprogram to iPSCs, at an efficiency of about 5 times of its
wild type counterparts (Figure 17B). Likewise, reprogramming CD3
neg T cell was about 5 times more efficient than the wild type counterparts (Figure 18B).
p53 deficient cell lines have been reported be easier to reprogram since the apoptosis
pathway is hindered. FAS knock-out further induces apoptosis resistance. While loss
of TCR expression makes T cells less healthy, an indication that apoptosis plays an
important role in the process of reprogramming.
Example 9: Knockdown of TCR in T cells with siRNA.
[0316] Figure 19 is a graph showing IFN-gamma production of wild type NY-ESO-1 TCR (wt)
or modified NY-ESO-1 TCR with a second disulfide bond and de-N-glycosylation to the
beta chain(S/SD). RNA was electroporated into T cells with endogenous T cell receptors
(TCRs) knocked down with siRNA. IFN-gamma was detected by ELISA after the T cells
were stimulated with a HLA-A2 positive cell line pulsed with NY-ESO-1 specific peptide,
p156-165, for 18h.
[0317] Figure 20, comprising Figures 20A and 20B, shows TCR alpha knockdown by CAS9 RNA
and gRNA co-electroporation. Six days after electroporation, cells were analyzed for
TCR expression by assessing CD3.
[0318] Figure 21 shows Sanger sequencing. Results show multiple peaks in CD3 negative enriched
T cells, with either CAS9 mRNA and gRNAs electroporated to knockdown TCR alpha (TRAC-5)
or TCR beta (TRBC-7).
[0319] Figure 22 is a panel of graphs showing CD3 negative T cells with endogenous TCR beta
(TRB-7) knockdown re-expressed CD3 four hours after NY-ESO-1 TCR alpha and beta (1G4LY95
TCR) RNA electroporation. Normal T cells (ND424 Beads) were used as control, which
showed nearly 100% CD3 positive with 5.25% endogenous TCR vb13.1 expression.
[0320] Figure 23, comprising Figures 23A-23D, is a panel of graphs showing knock down of
endogenous TCR enhanced with both transgene expression and function of TCR RNA electroporated
T cells. Figure 23A shows TCR expression of T cells electroporated with TCR siRNA
(solid open histogram), control siRNA (dotted open histogram) and T cells without
any siRNA (filled histogram). Figure 23B shows transgene (TCR vb13.1) expression of
wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA electroporated T cells with TCR
siRNA, control siRNA, or no siRNA. Figure 23C shows NY-ESO-1 tetramer staining of
wild type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA electroporated T cells with TCR
siRNA, control siRNA, or no siRNA. Figure 23D shows specific lysis of a HLA-A2/NY-ESO-1
positive tumor line by TCR siRNA knockdown, wildtype NY-ESO-1 TCR RNA electroporated
T cells.
[0321] Figure 24 is a graph showing fluorescence of tumor cells after injection of T cells
into a mouse model. Ten million Nalm6-CBG-ESO-GFP (click beetle green) tumor cells
that expressed both NY-ESO-1 and GFP were intravenously injected into NOD/SCID mice.
Five days after tumor inoculation, CBR (click beetle red) transduced and RNA electroporated
T cells were injected as indicated in the different groups and tumor growth was monitored
by bioluminescent image (BLI).
[0322] Figure 25 show bioluminescent images of the mice from two groups that had been treated
by CD19BBZ CAR RNA T cells or modified NY-ESO-1 TCR RNA at different time points.
Example 10: Universal CAR19 T cells generated by combination of lentiviral transduction
and disruption of the TCR-CD3 complex on T cells using CRISPR.
[0323] As shown in Figure 26, primary T cell were stimulated with anti-CD3/anti-CD28 beads
at day 0, and then transduced with lenti-CAR19. Over 70% of the cells were CAR19 positive
as detected by flow cytometry. Since transient expression of CRISPR is sufficient
to mediate gene knockout, a "hit-and-run" delivery strategy was developed to transiently
express CRISPR by utilizing electro-transfer of in vitro transcribed RNA encoding
CAS9 and gRNAs targeting the constant regions of TCR α chain, TCR β chain, and beta-2
microglobulin gene on day 3. T cells were cultured for 24 hours at 32°C after electrotransfer,
then returned to normal condition.
[0324] To measure TCR expression, a monoclonal antibody specific for CD3 was used. CD3 was
chosen as CD3 is only present on the cell surface when TCRs are expressed. CRISPR
constructs were electroporated into primary T cells (Figure 26). TCR single negative
and TCR/HLA-A double negative cells were expanded by exposure to CD19 presenting K562
cells, which resulted in >100 fold expansion (Figure 27).
[0325] After expansion, the cells remained TCR single negative or TCR/HLA-A double negative,
and the CAR19 positive population was enriched. Endogenous TCR expression remained
negative in TCR single negative cells, while TCR and HLA-A expression remained negative
in TCR/HLA-A double negative T cells after K562-CD19 stimulated expansion (Figure
28A). CAR19 positive cells were enriched by K562-CD19 stimulated expansion (Figure
28B).
[0326] The majority of expanded universal T cells were CD45RO positive (Figure 29A) and
retained high levels of CD62L expression (Figure 29B), medium levels of CD28 expression
(Figure 29A) and low levels of CCR7 expression (Figure 29B).
[0327] CRISPR gene editing did not affect the anti-tumor activity of universal CAR19 T cells
in vitro (Figure 30A). Depletion of TCR or TCR/HLA-A had minimal effect on CAR 19
expression and anti-tumor activity (Figures 30B and 30C). TCR single and TCR/HLA-A
double negative CAR19 T showed robust lytic capacity when challenged with Nalm6 tumor
cells (Figure 30B). CD107a release and cytokine secretion also showed potent anti-tumor
activity in the universal cells (Figure 30C). TCR single ablation or TCR and HLA-A
double ablation CAR19 T cells exhibited similar proliferation kinetics after challenge
with CD19 expressing cells (Figure 30D).
[0328] To test the anti-tumor activity of CRISPR/CAS9 edited CAR19 T cells, TCR single negative,
TCR and HLA-A double negative CAR 19 T were infused into NSG mice bearing Nalm6 tumor
cells. All the mice receiving unmanipulated T cells and mice infused with lentiviral
GFP transduced wild type T cells died within 3 weeks after tumor cell infusion. Objective
tumor regression was observed for mice receiving CAR19 T cells (Figure 6). CRISPR/CAS9
was found to not affect the
in vivo tumor killing activity of CAR19 T cells, thus, confirming the advantage of combining
lentiviral gene transfer and CRISPR/CAS9 for T cell therapy.
[0329] Full ablation of TCR α and β chains and HLA-A molecule on T cells completely abrogated
non-specific killing when the cells were challenged with HLA unmatched tumor cell
lines (Figure 32A). Elimination of HLA-A molecules activated NK cells after a long
period of co-culture (5 days). No off-target activity was observed when these cells
were challenged by allogeneic whole blood PBMC after 24 hours in an IFNr Elispot assay.
The lack of off-target activity suggests T cells may play a dominant role in acute
immune responses after encountering allogeneic cells. All of the results suggest that
CRISPR/CAS9 edited TCR α and β chains and HLA-A molecules (triple negative) T cells
could serve as a source of universal effector donor cells.
[0330] CAS9 and different gRNAs targeting FAS were electro-transferred into T cells. FASneg
cells were sorted and then transduced with lentiviral CAR19. Flow cytometry and Sanger
sequencing data showed that FAS had been modified by the CRISPRs (Figure 33). CAR19
gene expression of FASneg T cells was comparable to the wild type. Even after a short
period of incubation with Nalm6 tumor cells, CD107a expression was greatly enhanced
in FASneg CAR19 T cells compared to wild type counterpart cells even within 4 hours
of co-culture.
[0331] Some reports showed that even weak antigenic stimuli can trigger FAS activation to
promote T cell proliferation(
Rethi, et al, Blood, vol. 112(4):1195-1204, 2008). Interestingly, FASneg CAR19 T cells expanded much quicker than the wild type CAR19
T cells when the cells were stimulated by high levels of CD19+ K562 cells. This suggests
that FAS/FASL triggered apoptosis instead of activation under high level antigenic
conditions (Figure 34A). FASneg CAR19 T cells further showed reduced apoptosis levels
as measured by Annexin V staining (Figure 34B).
[0332] As had been observed
in vitro, FASneg T cell showed enhanced proliferation as compared to wild type T cells. Similar
proliferation results were observed when a True Count assay of CAR19 T cells was performed
after infusion of the cells into Nalm6 bearing mice. The FASneg CAR19 group showed
superior anti-tumor activity when compared to the wild type group (Figure 35B). This
difference is illustrated in the graph of Figure 35C showing the bioilluminescence
data between those two groups. These data indicate that FAS ablation in CART cells
enhanced its anti-tumor activity.
[0333] CAS9 and different gRNAs targeting PD1 were electro-transferred into T cells after
lentiviral transduction with PSCA-CAR. PD1 knock out cells were confirmed by surface
PD1 expression after CD3/CD28 bead stimulation (Figure 36). PD1 negative cells were
enriched by microbead depletion and then stimulated with PSCA antigen presenting PC3
tumor cells. PSCA-CAR. positive cells were enriched both in the wild type and the
PD1 negative groups. After incubation with PC3-PSCA-PDLl tumor cells, PD1 expression
was quickly upregulated on the surface of wild type PSCA-CAR T cells, with very low
levels of PD1 expression detected on PD1 negative PSCA-CAR T cells (Figure 37). PD1
negative PSCA-CAR T cells also showed greatly enhanced and sustained high levels of
CD137 expression (Figure 37), a marker of T cell activation, indicating that the PD1/PDL1
inhibitory signaling pathway was blocked.
[0334] When tested in an in vivo PC3-PSCA-PDL1 NSG model, significant enhanced anti-tumor
activity was detected in the PD1 negative PSCA-CAR T cell group compared to the wild
type group (Figures 38A and 38B) suggesting a therapeutic value of PD1 ablation for
CART cell therapy.
[0335] To test the graft vs host disease (GVHD) effect of CRISPR engineered universal CART
cells, a high T cell dose was given to NSG mice with Nalm6 leukemia. The mice were
treated with double or triple knock out CART cells and did not show any signs of developing
GVHD. By contrast, 3 out of 4 mice from the wild-type CD19 CART group developed GVHD
by day 65, which was confirmed by histological examination of different organs (Figure
39).
[0336] In another experiment, the cells were resuspended in PBS and infused intravenously
into mice after a sub-lethal irradiation. Clinical GVHD was monitored 2 to 3 times
per week. Four out 5 mice receiving wild type T cells died during the 60 day study,
while PBS treated, TCR single and TCR/HLA-I double ablated T cell treated groups did
not show any signs of GVHD. Mice receiving wild type T cells underwent body weight
loss. However, PBS treated, TCR single and TCR/HLA-I double ablated T cell treated
groups slightly gained weight during the study (Figures 40A and 40B).
[0337] T cells were treated with Cas9 and gRNAs targeting CD3, B2M and PD1 or Fas after
lentiviral CD19-CAR transduction. Triple knock out universal CART cells were injected
into mice bearing Nalm6-PDL1 tumors. Superior anti-tumor activity was observed in
mice receiving PD1/CD3/HLA-I triple knock out cells as compared to CD3/HLA-I double
knock out cells, further indicating the therapeutic value of blocking the PD1 signaling
pathway (Figures 41A and 41B). These data supply a way to enhance the treatment of
universal CART cells with CRISPR/Cas9.
[0338] As gRNAs are prone to degrade, a simplified one-shot method was developed to generate
universal CART cells. gRNAs were constitutively expressed together with CARs in a
single lentiviral vector. Naive T cells were transduced by lentivirus encoding gRNAs
and CARs one day after stimulation with CD3/CD28 Dynabeads. The cells were electroporated
with Cas9 mRNA at day 3(Figure 42). This system allows the manipulation of several
genes with one vector (Figure 42). CD3 expression was confirmed by flow cytometry
at day 6. T cells treated with the one-shot system showed consistent gene ablation
as high as 90% in each of the different Cas9 mRNA groups (Figure 43).
[0339] Progress in adoptive T-cell therapy for cancer and infectious diseases has been hampered
by the lack of readily available antigen-specific human T lymphocytes. Pluripotent
stem cells could provide an unlimited source of T lymphocytes. To address this issue,
expression of FAS, PD1, CTLA4, and PPP2r2d was disrupted in primary cells and T cells.
[0340] Sendai virus was used to reprogram primary cells and T cells. There are multiple
methods available for the generation of iPSCs, including virus-mediated gene transduction
and chemical induction. While lentiviral and retroviral vectors require integration
into host chromosomes to express reprogramming genes, DNA-based vectors, such as adenovirus,
adeno-associated virus, and plasmid vectors, exist episomally and do not require integration,
however, they may still be integrated into host chromosomes at certain frequencies,
and the reprogramming efficiency is relatively low. Likewise, mRNA based reprogramming
is complicated and has proven to be extremely inefficient.
[0341] In contrast, Sendai virus does not integrate into the host genome or alter the genetic
information of the host cell. Sendai virus also has reprogramming potential comparable
to lentiviral- and retroviral-based gene transduction.
[0342] Each well in a 24 well plate was seeded with 0.1 million wild type, FASneg, CD3neg
TCR alpha and beta chain knock-out T cells. The cells were stimulated with CD3/CD28
beads. At day 3 post stimulation, the beads were removed, the cells were resuspended
in 1 mL of pre-warmed T cell complete medium, and then incubated with a calculated
volume of CytoTune Sendai virus comprising a polycistronic vector for expression of
hKlf4, hOct3/4 and hSox2 in the cells (Lifetechnologies, Carlsbad, CA). Treated T
cells were seeded in 24 well plates, and centrifuged at 2250 rpm for 90 minutes at
room temperature. An additional 1 mL of complete T cell medium was added to each well
and the plate was incubated overnight at 37°C in a humidified atmosphere of 5% CO2.
[0343] On the day after transduction, Sendai virus was removed by washing the T cells with
fresh complete medium and culturing the cells for 2 days. Media was half changed every
day. On day 3 after infection, cells were transferred to MEF feeder plates and cultured
in T cell medium without any cytokines. Four days after infection, the cells were
cultured in standard hES medium. Media was changed every day. ES-like colonies were
observed around day 7. The cells were cultured in conditioned hES medium from day
15 and cultures continued for an additional 10 days. Colonies were picked at around
25 to 30 days after transduction.
[0344] Around day 4, cell clumps were formed on feeder cells, indicating the initiation
of the reprogramming process. T cells went through dramatic morphological changes
during the reprogramming process to iPSCs (Figure 44A). Around day 12, large cell
clumps with loose edges began to emerge. Around day 18, T cells were transformed to
typical ES-like colonies with well-defined edges. FASneg T cells were reprogrammed
to iPSCs at an efficiency of about 5 times of the wild type counterparts (Figure 44B).
p53 deficient cell lines have been reported as easier to reprogram due to the hindrance
of the apoptosis pathway. FAS knock out may facilitate the reprogramming process using
a similar mechanism.
[0345] ES-like morphology of iPSCs reprogrammed from CD3neg TCR alpha or beta chain knock
out T cells was observed (Figure 45A). The morphology remained constant after several
passages. Reprogramming of CD3neg T cells was about 5 times less efficient than the
wild type counterparts (Figure 45B), suggesting that TCR knock-out may play a role
in the process of T cell reprogramming or affect the cell viability after Sendai virus
infection. Figure 45C is a panel of images showing phosphatase staining of CD3neg
iPSC cells.
[0346] Typical embryonic stem cell morphology was observed indicating that the FASneg, CD3neg
TCR alpha and beta chain knock-out T cells were induced to a pluripotent state under
defined reprogramming conditions. While loss of TCR expression makes T cells less
healthy, the data described herein suggests that apoptosis plays an important role
in the process of reprogramming.
[0347] Induction of endogenous pluripotent stem cell genes was also detected in the different
T-iPSC cell lines (Figure 46). Immunostainings for Tra-1-60 and SSEA4 expression further
indicated the stem cell phenotype of the T-iPSC cells (Figure 47A). Fas knock out
was confirmed in the T-iPSCs by Sanger sequencing (Figure 47B).
[0348] dCas9 and Fokl-Cas9 were reported to have less off-target activity. T cells were
evaluated if they could be edited by a modified version of the CRISPR/dCAS9 and (;RISPRIFokI-CAS9
system (Figure 48A). Flow cytometric data showed primary T cells were edited by both
CRISPR/dCAS9 and CRISPR/FokI-CAS9 (Figure 48B). The CRISPR/dCAS9 gene knock out system
exhibited enhanced specificity with at least one pair of gRNAs, rendering the knock
out event more precise and more specific.
[0349] To test the off-target events of CRISPR/CAS9 in T cells, a surveyor assay was performed
at off target sites. For the genes tested, no obvious cleavage was observed at the
genomic loci (Figure 48C).
Example 11: Multiplex genome editing.
[0350] CART cells were generated by using a CRISPR/Cas9 system to simultaneously disrupt
multiple genomic loci. The CART cells were deficient in the expression of endogenous
TCR and HLA class I (HLA-I) molecules for use as allogeneic universal CART cells.
T cell receptor (TCR) α chain, TCR β chain and beta-2 microglobulin (B2M) genes were
disrupted with high efficiency through the co-electroporation of mRNA encoding Cas9
with gRNAs targeting these genes. Universal TCR or CART cells were generated by combining
lentiviral (LV) delivery of CAR and CRISPR RNA electroporation to disrupt endogenous
TCR and B2M genes simultaneously. In addition, disruption of endogenous PD1 enhanced
the efficacy of CAR therapy in a solid tumor model.
Multiple deliveries of gRNAs disrupts genes in human primary T cells with high efficiency
without impairing effector function
[0351] Efficient multiplex genomic editing is required to generate universal T cells that
are deficient in TCR, HLA and other genes. CRISPR/gRNA RNA electroporation was optimized
to achieve efficient gene disruption in T cells. First, Cas9 and gRNAs were co-electroporated
with RNA generated using an in vitro transcription system (Figure 49, left), and a
"hit-and-run" delivery strategy was developed to transiently deliver the Cas9 mRNA
and gRNAs to T cells by electroporation (Figure 49, right).
[0352] An initial experiment targeting the TCR α constant region (TRAC) or β constant region
(TRBC) with single electroporation resulted in 1% to 3% CD3-negative (CD3
neg) T cells, respectively, (Figure 50A, upper graphs). To determine if transient exposure
to mild hypothermia allowed more efficient gene disruption, cells were edited at 37°C
or 32°C. CRISPR-mediated disruption of TRAC and TRB was increased up to 4-fold when
T cells were cultured for 24h at 32°C after Cas9/gRNA co-electroporation (Figure 50A,
lower graphs). The optimal molecular ratio of Cas9:gRNA for maximum disruption efficiency
was 1:1 to 2:1, and the gene disruption efficiency was correlated with the amount
of electrotransferred mRNA (Figure 51A).
[0353] Compared with mRNA, gRNAs are more prone to rapid degradation, which potentially
limits the targeting efficiency. Thus, multiple, sequential electroporations of gRNA
were tested after the initial Cas9/gRNA electroporation. There was a marked increase
in disruption frequency at the protein level, as 82.4% of cells were CD3
neg after the third gRNA electroporation (Figure 50B). Clonal sequencing showed that
the genomic targeting efficiency reached 89.4% after the third gRNA electroporation
(Figure 51B). A surveyor assay confirmed a cleavage rate of 81.7% and 49.3% at the
genomic loci of TRAC and TRBC, respectively, after a third electroporation of gRNAs
(Figure 52). Multiple peaks in the Sanger sequencing data flanking the TRAC and TRBC
target sites confirmed that the genomic reading frame shifted downstream of the target
sites (Figure 53A). The occurrence of insertions or deletions (indels) caused by the
NHEJ mediated by CRISPR/Cas9 was confirmed by clonal sequencing (Figure 53B). The
TCR disrupted TCR/CD3
neg population was enriched to over 99% (99.70±0.20%) by a single step of CD3 negative
selection (Figure 54).
[0354] To develop methods to expand the TCR/CD3
neg T cells, TCR/CD3
neg T cells were co-electroporated with the HLA-A2 restricted 1G4 NY-ESO-1 TCR (α+β)
RNAs to restore CD3 expression (Figure 55, left panel). Following T cell stimulation/expansion
methods, the following were compared: 1) a rapid T cell expansion protocol (REP) using
PBMC as feeder cells, 2) anti-CD3/CD28 Dynabeads (Beads), or 3) OKT3 loaded K562-based
artificial antigen-presenting cells expressing ligands for CD28 and 4-1BB (K562 aAPC).
TCR/CD3
neg T cells were also electroporated with CD19 CAR RNA (Figure 55, right panel) and then
stimulated by irradiated K562 aAPC that expressed CD19 (K562-CD19). Fold expansion
values of 751.0±217.1, 35.7±9.3, 46.3±8.5 and 57.5±5.0 were achieved for REP, Beads,
K562 aAPC and K562-CD19, respectively, after a single stimulation for 10 days (Figure
56).
[0355] To test whether CRISPR/Cas9 gene editing would affect the phenotype and function
of the T cells, the phenotype of TCR/CD3
neg T cells expanded by the different methods was examined and showed that all of the
expanded cells remained CD3 negative and most retained a high level of CD27 (from
79.8% to 93.4%), consistent with a central memory cell phenotype (Figure 57). The
expanded TCR/CD3
neg T cells were electroporated a second time with CD19 CAR mRNA to test their anti-tumor
activities. The surface CAR expression of the TCR/CD3
neg T cells was equal to that of the control group (Figure 58). When the TCR/CD3
neg CD19 CAR T cells were stimulated with CD19
+ Nalm6 leukemia cells, the CD107a up-regulation (Figure 59A), cytokine secretion (Figure
59C) and killing activity (Figure 59B) of CD19 CAR
+ TCR/CD3
neg T cells was equivalent to those of the wild-type control cells. The CD19 CAR TCR/CD3
neg T cells were infused into Nalm6-bearing NSG mice to test their in vivo anti-tumor
activity. Tumor regression was evident with an efficacy equivalent to that for the
CART19 wild-type counterpart cells (Figures 59D and 59E). The results indicate that
CRISPR/Cas9 editing of the endogenous TCR did not adversely affect the function of
primary T cells for adoptive immunotherapy.
Reduced alloreactivity of TCR a, β and B2M triple-disrupted T cells.
[0356] Disrupting both TCR α and β chains is required to prevent TCR miss-pairing-associated
toxicity for TCR-redirected T cell adoptive immunotherapy and B2M is essential for
the assembly and expression of HLA-I complex. In view of this, TCR α and β chains
and B2M triple disruption was developed to generate universal T cells. First, the
ability of eliminating HLA-I expression on the T cells by disrupting B2M was tested.
T cells were electroporated with B2M-targeting Cas9/gRNA RNA. This resulted in a B2M
and HLA-I double-negative population of 79.9%. The HLA-I
neg population could be further enriched by negative selection (Figure 60).
[0357] To generate triple-knockout T cells lacking the TCR α, β chains and B2M, Cas9 mRNA
was co-electroporated with three different gRNAs targeting TRAC, TRBC and B2M. As
a result, the CD3 and HLA-I double-negative cell population was 65.4% (Figure 61).
After enrichment of the double and triple knockout cells, the TCR α and β chains and
B2M triple-knockout T cells abrogated the non-specific killing of HLA unmatched tumor
cell lines (Figure 62). No response was observed when these cells were challenged
by allogeneic whole-blood irradiated PBMCs in an IFNy Elispot assay (Figure 63, left
panel). The ablation of HLA-I molecules also sharply reduced the allo-reactivity,
as confirmed by co-culture of allogenic PBMCs with irradiated B2M-disrupted cells
(Figure 63, right panel). The results above suggest that triple-negative T cells that
lack TCR α and β chains and B2M could potentially serve as a source of universal T
cells for adoptive immunotherapy, resisting rejection by the host immune system while
unable to cause graft versus host disease.
Improved anti-tumor activity of TCR redirected, endogenous TCR-disrupted T cells.
[0358] T cells with CRISPR/Cas9-disruption of TCR α and β chains showed elevated transgenic
TCR expression on the cell surface after being redirected with an NY-ESO-1 TCR (1G4).
Transgenic TCR expression was 67.6%, 78.8% or 94.3% for the TCR α or β chain single
knockout or the α/β double knockout, respectively, compared with 46.8% for wild-type
T cells. The improved transgenic TCR expression led to enhanced T cell function, as
evidenced by increased antigen-specific CD107a expression (Figure 65A) and enhanced
cytotoxicity (Figure 65B), especially for the α/β double-knockout T cells.
[0359] In a separate experiment, α/β double-knockout T cells were transfected with a different
NY-ESO-1 TCR (8F). Relative to 1G4 TCR, this 8F TCR exhibited a higher significant
improvements in both transgenic TCR expression (Figure 66; 60.1% for TCR/CD3
neg versus 44.7% (with ~5% endogenous TCR Vβ8 background) for wild-type T cells (Cas9
Mock T cells)) and function (CD107a expression in Figure 67A, and cytokine production
in Figure 67B). These results highlight the differential influence of endogenous TCR
on transgenic TCR expression and function.
Universal CART cells retain antitumor efficacy and do not cause GVHD.
[0360] Universal CD19 CART cells were generated by combining LV transduction of CD19 CAR
with RNA electroporation of Cas9/gRNAs (Figure 68). The cells were expanded and the
remaining CD3
neg cells had high levels of CD19 CAR expression (Figure 69). The majority of the expanded
T cells were CD45RO positive and retained a high level of CD62L expression and a medium
level of CD28 expression, consistent with a central memory cell status (Figure 70).
The expanded TCR/HLA-I double-negative CD19 CART showed robust in vitro anti-tumor
activities, such as CD107a release (Figure 71), cytokine secretion (Figure 72), lytic
capacity (Figure 73), and proliferation (Figure 74), that was as potent as those of
the wild-type CD19 CART cells.
[0361] The T cells were infused into NSG mice bearing disseminated Nalm6 leukemia. Mice
treated with CART cells with a disrupted endogenous TCR (LV-CD19 CAR TCR
neg) or with a simultaneous disruption of TCR and HLA-I (LV-CD19 CAR TCR/HLA-I
neg) exhibited tumor regression similar to that of mice treated with wild-type CD19 CART
cells (LV-CD19 CAR) (Figures 75A and 75B), suggesting that the disruption of TCR alone
or together with B2M did not affect CART cell anti-tumor activity.
[0362] To test the GVHD effect of the engineered T cells, a high T cell dose (20× 10
6/mouse) was given to NSG mice with Nalm6 leukemia. As shown in Figure 76, mice treated
with CD19 CART cells with TCR disruption alone (LV-CD 19 CAR TCR/CD3
neg) or the simultaneous disruption of TCR and B2M (LV-CD 19 CAR TCR/HLA-ID
neg) exhibited similar tumor regression compared with that of the wild-type CD19 CAR
T cells (LV-CD 19 CAR). Mice treated with the double or triple knock out CAR T cells
did not develop any signs of GVHD. By contrast, 3 out of 4 mice from the wild-type
CD19 CART (LV-CD19 CAR) group developed GVHD at day 65, which was confirmed by histological
examination of different organs. Thus, the disruption of TCR alone or together with
HLA-I did not affect the in vivo anti-tumor activity of CART cells while eliminating
alloreactivity.
Adenoviral CRISPR delivery into primary T cells.
[0363] The CRISPR/Cas9 system are rapidly being harnessed for gene regulation and gene editing
purposes in model organisms and cell lines. Viral vectors may be particularly fit
to broaden the applicability of CRISPR to other cell types, including dividing and
quiescent primary cells. Adenovirus, namely second-generation fiber-modified adenovirus
encoding Cas9 and single guide RNA (gRNA) molecules, were used to bring Cas9 nuclease
to the PD1, Fas and TRAC loci (Figure 77). Adenoviral-mediated transduction of CRISPR
into tumor cells (Figure 78) yielded high rates of targeted mutagenesis of up to about
71% (Figures 79A and 79B). Adenovirus appears to constitute a valuable platform for
introducing CRISPR into human T cells regardless of their quiescent status. This approach
will aid investigating the potential for CRISPR gene regulation and editing in numerous
experimental settings.
Electroporation optimization.
[0364] CD3 and B2M knock-out efficiency and T cell expansion were assessed after Cas9 and
gRNA electroporation (EP) in 4mm cuvettes and 2mm cuvettes. Standard EP conditions
with a 2mm cuvette (360v/1ms, 1
st EP - 20µg Cas9 RNA+ 10µg gRNA/100µl T cells, 2
nd EP 5µg gRNA/100µl T cells) showed the highest CD3 and B2M knockout percentages, 81.8%
and 88.6%, respectively, with T cell expansion at about 2.7 fold ( EP#1), compared
with about 18.8 fold expansion of control EP T cells (EP#12). Decreasing the gRNA
dose (EP#2-5) dramatically increased T cell expansion, but only slightly affected
CD3 and B2M knock-out efficiency. See Figure 80. Standard EP conditions with a 4mm
cuvette resulted in dramatically decreased CD3 and B2M knockout efficiency (EP#8),
suggesting that the EP conditions ( voltage or/and pulse length) need to be further
optimized for use with 4mm cuvettes.
[0365] Compared with standard electroporation (EP) conditions in a 2mm cuvette (EP#10-13)
or 4mm cuvette. High CD3/B2M knockout efficiency was observed with improved T cell
fold expansion (EP#1 and 5). See Figure 81.
[0366] To further optimize EP conditions to achieve maximum T cell fold expansion with CD3/B2M
knockout efficiency over 60%, different EP conditions and RNA amounts were tested.
The results showed that fold expansion was improved with relatively high CD3/B2M knockout
efficiency (63.5% for CD3 and 84.8% for B2M) for EP#4 (400v/2ms/120µg CAS9 RNA) for
EP#1 and (500v/1ms/20µg gRNA) for EP#2. See Figure 82.
[0367] Additional experiments were performed to optimize EP conditions. Results showed that
compared with the most favorable condition tested (EP#1 in Figure 82), using 500v/1ms/120µg
CAS9 RNA (EP#1) and 500v/1ms/20µg gRNA (EP#2) produced increased CD3/B2M knockout
efficiency and T cell expansion (EP#3). See Figure 83.
Large-scale electroporation and expansion.
[0368] Experiments were performed to determine if large-scale electroporations could yield
high knock-out and expansion efficiencies. On day 0, anti-CD3/anti-CD28 beads were
used to stimulate T cells obtained from 3 donors (100×10
6 cells/donor, concentrated to 0.5×10
6/ml). On day 1, stimulated T cells were transduced with CD19 CAR lentivirus. 50mL
(25×10
6 cells) of T cells were reserved as unmodified T cells (Group 9). On Day 3, the beads
were removed and the transduced T cells from each donor were separated into two groups,
CART/mock EP (10mL, 5×10
6) and CART/CRISPR (10mL, 50×10
6). The cells were then electroporated with CAS9 RNA (1st EP) and Groups 1, 3, 5 and
7 cells were split. On day 4, the gRNA was electroporated into the T cells and the
cells were cultured at 1×10
6 cells/mL. On days 5 and 7, the cells were split. On day 8, CD3+ cells were removed
from Groups 2, 4 and 6. On day 11, the T cells were harvested and 25×10
5 cells from the three donors were sent for karyotyping.
Table 1: Experimental groups.
| Group # |
Donor |
T cells |
| 1 |
ND391 |
CART/MOCK EP |
| 2 |
ND391 |
CART/CRISPR |
| 3 |
ND463 |
CART/MOCK EP |
| 4 |
ND463 |
CART/CRISPR |
| 5 |
ND463 |
UNMOD |
| 6 |
ND469 |
CART/MOCK EP |
| 7 |
ND469 |
CART/CRISPR |
[0369] T cell numbers (upper chart of Figure 85) and fold expansion (lower chart of Figure
85) were assessed after the electroporation and culturing procedure. Fold expansion
of the T cells transduced with CD19 CAR alone (TD alone) or transduced with CD19 CAR
and edited with CRISPR (TD/KO) is shown in the left graph of Figure 86 and fold expansion
of the T cells on day 10 is shown in the right graph of Figure 86. By optimizing electroporation
conditions and CAS9/gRNA doses, approx. 60-70% CD3/B2M knock-down efficiency and approx.
30 fold T cell expansion was observed after 10 days (Figure 87 shows CD3B2M/CAR expression
at day 10).
[0370] Eight days after CD3/CD28 bead stimulation and CRISPR RNA electroporation, CD3 positive
T cells were removed. Figure 88 shows CD3/B2M expression in the three donor populations
at day 8. On day 11, T cells were subjected to FACS staining to detect CD3, B2M and
CAR expression. ND463 non-transduced (NOTD) were used as a negative control. Figure
89 shows CD3 and B2M expression in CD19 CAR TD (transduced)/CRISPR electroporated,
CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T
cells. Figure 90 shows CAR expression in CD19 CAR TD/CRISPR electroporated, CD3 depleted
T cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T cells. Figure
91 shows CD3B2M/CAR expression on day 11 in CD19 CAR TD (transduced)/CRISPR electroporated,
CD3 depleted T cells; CD19 CAR TD/CRISPR electroporated T cells; and CD19 CAR TD T
cells. Figure 92 summarizes CD3B2M/CAR expression in the different T cells groups.
[0371] On day 11 the different T cell groups, as indicated in Figure 93, were stimulated
by a CD19 positive cell lines, Raji or Nalm6. K562 was used as a CD19 negative control.
After 4hr of coculturing, CD107a up-regulation was detected in each of the T cell
groups, except the negative controls.
[0372] On day 11, killing ability of the T cells, as indicated in Figure 94, were tested
using a luminescent cytotoxic lymphocyte (CTL) assay after coculturing the T cells
with CD19 positive target cells, Nalm6-CBG. Also on day 11, cytokine production of
the T cells was analyzed by stimulating the T cell groups with Nalm6 target cells,
see Figure 95.
[0373] The T cells were cultured in medium containing 100 U/ml of IL-2 for up to 26 days.
The results shown in Figure 96 indicate no abnormal T cell growth was observed for
the CRISPR edited T cells from the three donors.
[0374] As one of most attractive applications of the CRISPR/Cas9 system, multiplex genome
editing holds great promise for advancing T cell-based adoptive immunotherapy. However,
the low targeting efficiency of DNA transfection limits the use of multiplex genome
engineering in primary T cells. A "hit-and-run" delivery strategy was developed to
introduce CRISPRs to T cells via the co-electroporation of Cas9 mRNA and gRNA. Through
a combination of up to three rounds of gRNA electroporation with transient exposure
to mild hypothermia, a targeting efficiency of >80% at the protein level was routinely
achieved for a single gene disruption. More encouragingly, triple gene disruption
of TRAC, TRBC and B2M yielded double negative CD3 and HLA-I at about 65% without any
purification and selection. The results also demonstrate that enrichment to >99% purity
of gene-disrupted T cells was easily achieved using clinically approved paramagnetic
beads and that the purified T cells were expanded up to 500-fold in 10 days. The expanded
T cells maintained their gene disruption phenotype and displayed features consistent
with central memory T cells. The disrupted T cells did not cause GVHD, suggesting
that they may be used as allogeneic CAR T cells. Importantly, the gene-edited T cells
showed anti-tumor activities both in vitro and in different tumor mouse models that
were as potent or more potent than non-gene edited T cells. Thus, the process described
herein to generate synthetic cells could be easily translated into current GMP-compliant
manufacturing procedures.
[0375] The data described herein demonstrates that CRISPR/Cas9 is a powerful multiplex genome
editing tool in primary human T cells. Previous reports have shown that T cells can
be genetically edited by ZFNs or TALEN to eliminate the expression of the endogenous
TCR α and β chains to avoid GVHD. Due to the complexity of the targeting strategies
for manipulating multiple genes by zinc finger nucleases (ZFN) and TAL effector nuclease
TALEN in T cells, previous studies have not been able to prevent GVHD and host-versus-graft
reaction simultaneously in pre-clinical animal models. NK cell activation can also
be aborted by the ablation of stimulatory NK ligands by CRISPR/Cas9 or by the expression
of nonclassical HLA class I molecules such as HLA-E, which could potentially protect
universal T cells from NK-cell-mediated rejection.
[0376] In summary clinical scale universal CART cells, with potent anti-tumor activity and
reduced alloreactivity can be efficiently generated using multiplex CRISPR technology.
This approach can be incorporated into current GMP-compliant manufacturing procedures
and has a high potential for translation, given the successful translation of adoptive
transfer therapy with ZFNs for HIV/AIDS. It is possible that universal CAR and TCR
T cells will provide an alternative to autologous T cells. Indeed, it is conceivable
that universal CAR and TCR T cells with disabled checkpoint molecules may be more
efficacious and have wider use than current CART therapy using autologous T cells
against cancers and infectious diseases.
Other Embodiments
[0377] The recitation of a listing of elements in any definition of a variable herein includes
definitions of that variable as any single element or combination (or subcombination)
of listed elements. The recitation of an embodiment herein includes that embodiment
as any single embodiment or in combination with any other embodiments or portions
thereof.