FIELD
[0001] The present invention relates to the field of molecular biology and cancer biology.
Provided herein are methods of using certain immunologically related genes as biomarkers
for predicting clinical sensitivity and therapeutic response to treatment with a farnesyltransferase
inhibitor in a subject having cancer. Further described herein is a kit for carrying
out these methods.
BACKGROUND
[0002] Stratification of patient populations to improve therapeutic response rate is increasingly
valuable in the clinical management of cancer patients. Farnesyltransferase inhibitors
(FTI) are therapeutic agents that have utility in the treatment of cancers, such as
leukemia, lymphoma and certain solid tumors. However, patients respond differently
to an FTI treatment. Therefore, methods to predict the responsiveness of a cancer
patient to an FTI treatment, or methods to select patients for an FTI treatment represent
unmet needs. The methods and compositions of the present invention meet these needs
and provide other related advantages.
[0003] Shi Yuquan et al. (The Prostate, vol. 62, no. 1, 2005, pages 69-82) discloses that farnesyl transferase inhibitors (FTIs) can enhance the killing of
prostate tumors with activated H-Ras. Together with the absence of increased acute
toxicity to normal bowel, these results imply that FTI treatment should be further
studied as a possible adjuvant to radiotherapy in the treatment of abdominal cancers
with activated Ras signaling.
[0004] Yao et al. (Carcinogenesis, vol. 27, no. 2006, pages 1420-1431) disclose that treatment with FTIs L-744,832 or FTI-277 reduced clonogenic survival
of prostate tumor cells expressing oncogenic H-ras after irradiation. PI3-kinase/Akt
and MAPK signaling pathways were downregulated by FTIs in these cells. FTI treatment
reduced tumor hypoxia and also reduced MMP-9 expression in tumors with activated mutant
H-ras. According to Yao
et al. FTIs can enhance the killing of prostate tumors with activated H-Ras.
[0005] Misso et al. (Journal of Cellular Physiology, vol. 228, no. 1, 2013, pages 130-141) describe that the synergistic combination of the FTI tipifarnib and of docetaxel
determines synergistic apoptotic conditions. At the same time, the combination modulates
the expression of the components of the multichaperone complex that is involved in
the regulation of the stability of members of the ras-mediated pathway. Misso
et al. disclose that the antiproliferative activity of geldanamycin is dependent upon the
activation status of HSP90 and that it is strongly synergistic when added in combination
with tipifarnib but not with docetaxel in cells overexpressing HSP90 and even more
in cells with increased HSP90 activity.
[0006] X Chen et al. (Oncogene, vol. 33, no. 47, 2013, pages 5442-5449) used mice with an Hras
G12V knock-in allele to elucidate the early events after Hras activation, and to evaluate
the therapeutic effectiveness of farnesyltransferase inhibition. The FTI SCH66336
blocks HRAS farnesylation and delocalizes it from the plasma membrane. NRAS and KRAS
are not affected as they are alternatively prenylated. When tested in lines harboring
HRAS, NRAS or KRAS mutations, SCH66336 delocalized, inhibited signaling and preferentially
inhibited growth only of HRAS-mutant lines. Treatment with SCH66336 also induced near-complete
regression of papillomas of TPA-treated Hras
G12V knock-in mice.
[0007] WO 2015/164862 describes compositions and methods for treatment of Hras-driven cancers. Administration
of a farnesyltransferase inhibitor, for example, tipifarnib, alone or in combination
with a MEK inhibitor can reduce tumor size and tumor growth in cancers such as poorly
differentiated thyroid cancer (PDTC) and anaplastic thyroid cancer (ATC).
SUMMARY OF THE INVENTION
[0008] Provided herein is a compound for use in a method of treating a H-Ras mutant head
and neck squamous cell carcinoma (HNSCC) in a subject, wherein the compound is tipifarnib
and wherein the method comprises administering a therapeutically effective amount
of tipifarnib to said subject, wherein said HNSCC is at an advanced stage, metastatic,
relapsed or refractory and wherein said HNSCC is human papillomavirus (HPV)-negative.
[0009] In some embodiments, the H-Ras mutation of said subject comprises an amino acid substitution
at a codon selected from the group consisting of G12, G13, and Q61.
[0010] In some embodiments, the method comprises determining the presence of H-Ras mutation
in a sample from said subject. In another embodiment, said sample is a tissue biopsy
or a tumor biopsy. In one embodiment, said H-Ras mutation is determined by a method
selected from the group consisting of sequencing, Polymerase Chain Reaction (PCR),
DNA microarray, Mass Spectrometry (MS), Single Nucleotide Polymorphism (SNP) assay,
denaturing high-performance liquid chromatography (DHPLC), and Restriction Fragment
Length Polymorphism (RFLP) assay.
[0011] In some embodiments, tipifarnib is administered at a dose of 1-1000 mg/kg body weight
or tipifarnib is administered at a dose of 600 mg twice a day or at a dose of 900
mg twice a day.
[0012] In some embodiments, tipifarnib is administered twice a day.
[0013] In some embodiments, tipifarnib is administered for a period of one to seven days.
In some embodiments, tipifarnib is administered on days 1-7 anpd 15-21 of a 28-day
treatment cycle.
[0014] In another embodiment, tipifarnib is administered for at least 3 cycles or for at
least 6 cycles.
[0015] In another embodiment, said treatment cycle continues for up to 12 months. In some
embodiments, tipifarnib is administered at a dose of 900 mg twice a day on days 1-7
and 15-21 of a 28-day treatment cycle.
[0016] In some embodiments, the tipifarnib is administered before, during, or after irradiation.
[0017] In some embodiments, the method further comprises administering a therapeutically
effective amount of a second active agent or a support care therapy. In another embodiment,
said second active agent is selected from the group consisting of a DNA-hypomethylating
agent, a therapeutic antibody that specifically binds to a cancer antigen, a hematopoietic
growth factor, a cytokine, an antibiotic, a cox-2 inhibitor, an immunomodulatory agent,
an anti-thymocyte globulin, an immunosuppressive agent, and a corticosteroid or a
pharmacological derivative thereof or wherein said second active agent is an anti-PD1
antibody or an anti-PDL1 antibody.
[0018] Also disclosed herein are methods for population selection of cancer patients for
treatment with an FTI. The methods are based, in part, on the discovery that the genotype
and the expression level of certain immunological genes can be used to predict responsiveness
of a cancer patient to an FTI treatment.
[0019] In some examples, an FTI is for use in methods for treating cancer in a subject including
(a) KIR typing the subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5,
and (b) administering a therapeutically effective amount of the FTI to the subject.
In some examples, the subject is a carrier of KIR2DS2. In some examples, the subject
is a carrier of KIR2DS5. In some examples, the subject is a carrier of KIR2DS2 and
KIR2DS5.
[0020] In some examples, the methods further include HLA typing the subject before administering
the FTI treatment to the subject, wherein the subject is a carrier of HLA-C2. In some
examples, the subject is a carrier of both KIR2DS2 and HLA-C2.
[0021] In some examples, the KIR typing of a subject includes determining the presence of
a KIR gene in a sample from the subject. In some examples, the sample is a blood sample.
In some examples the sample is a bone marrow sample. In some examples the sample is
peripheral blood mononuclear cells (PBMC). In some examples the sample is enriched
natural killer (NK) cells.
[0022] In some examples the KIR tying is performed by sequencing, Polymerase Chain Reaction
(PCR), DNA microarray, Mass Spectrometry (MS), Single Nucleotide Polymorphism (SNP)
assay, Immunoblotting assay, or Enzyme-Linked Immunosorbent Assay (ELISA). In one
example the KIR typing is performed by PCR. In one example the KIR tying is performed
by DNA microarray. In one example the KIR typing is performed by an immunoblotting
assay or ELISA.
[0023] In some examples, an FTI is for use in methods for treating cancer in a subject including
(a) determining expression level of a biomarker selected from the group consisting
of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM in a sample from the subject, wherein
(i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2; (ii) the expression level of KIR2DL2 in the sample is lower than
a reference expression level of KIR2DL2; (iii) the expression level of KIR2DS5 in
the sample is higher than a reference expression level of KIR2DS5; (iv) the expression
level of KIR2DL5 in the sample is lower than a reference expression level of KIR2DL5;
or (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; or any combination thereof; and (b) administering a therapeutically
effective amount of the FTI to the subject.
[0024] In some examples, an FTI is for use in methods for treating cancer in a subject including
(a) determining expression levels of KIR2DS2 and KIR2DL2, or of KIR2DS5 and KIR2DL5
in a sample from the subject, wherein (i) the ratio of the expression level of KIR2DS2
to the expression level of KIR2DL2 in the sample is higher than a reference ratio;
or (ii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in the sample is higher than a reference ratio; and (b) administering a therapeutically
effective amount of the FTI to the subject.
[0025] In some examples the sample is a blood sample. In some examples the sample is a bone
marrow sample. In some examples the sample is peripheral blood mononuclear cells (PBMC).
In some examples the sample is enriched NK cells. In some examples the NK cells are
further expanded in vitro.
[0026] In some examples determining expression level of a biomarker includes determining
the protein level of the biomarker. Methods of determining the protein level of a
biomarker can be an immunohistochemistry (IHC) approach, an immunoblotting assay,
flow cytometry (FACS), or ELISA. In some examples the protein level of a biomarker
is measured by ELISA.
[0027] In some examples determining expression level of a biomarker includes determining
the mRNA level of the biomarker. Methods of determining the mRNA level of a biomarker
can be qPCR, RT-PCR, RNA-seq, microarray analysis, SAGE, MassARRAY technique, or FISH.
In some examples the mRNA level of a biomarker is measured by qPCR or RT-PCR.
[0028] In some examples the subject is a cancer patient. In some examples the subject has
a hematological cancer. In some examples the subject has a solid tumor. The solid
tumor can be a benign tumor or a cancer. In some other examples the the subject has
a premalignant condition. The hematological cancer can be acute myeloid leukemia (AML),
myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia (CMML), natural killer
cell lymphoma (NK lymphoma), natural killer cell leukemia (NK leukemia), cutaneous
T-Cell lymphoma (CTCL), peripheral T-cell lymphoma (PTCL), or chronic myeloid leukemia
(CML). In some examples the patient is a MDS patient. The MDS patient can have very
low risk MDS, low risk MDS, intermediate risk MDS, or high risk MDS. In some examples
the patient is a lower risk MDS patient, which can have a very low risk MDS, low risk
MDS, intermediate risk MDS. In some examples the patient is an AML patient. In some
examples the AML patient is post-remission induction or post transplantation. In some
examples the AML patient is over age 60 or otherwise unfit for remission induction.
[0029] In some examples, an FTI is for use in methods for selecting a cancer patient for
an FTI treatment including (a) KIR typing the subject, wherein the subject is a carrier
of KIR2DS2 or KIR2DS5, and (b) administering a therapeutically effective amount of
an FTI to the subject. In some examples, the methods include a) KIR typing the subject,
wherein the subject is a carrier of KIR2DS2 or KIR2DS5, b) HLA typing the subject,
wherein the subject is a carrier of HLA-C2 and (c) administering a therapeutically
effective amount of the FTI to the subject. In some examples the subject is a carrier
of both KIR2DS2 and HLA-C2.
[0030] In some examples, an FTI is for use in methods of selecting a cancer patient for
an FTI treatment including (a) determining expression level of a biomarker selected
from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM in a sample
from the subject, wherein (i) the expression level of KIR2DS2 in the sample is higher
than a reference expression level of KIR2DS2; (ii) the expression level of KIR2DL2
in the sample is lower than a reference expression level of KIR2DL2; (iii) the expression
level of KIR2DS5 in the sample is higher than a reference expression level of KIR2DS5;
(iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or (v) the expression level of GZMM in the sample is higher than
a reference expression level of GZMM; or any combination thereof; and (b) administering
a therapeutically effective amount of the FTI to the subject.
[0031] In some examples, an FTI is for use in methods for selecting a cancer patient for
an FTI treatment including (a) determining expression levels of KIR2DS2 and KIR2DL2,
or of KIR2DS5 and KIR2DL5 in a sample from the subject, wherein (i) the ratio of the
expression level of KIR2DS2 to the expression level of KIR2DL2 in the sample is higher
than a reference ratio; or (ii) the ratio of the expression level of KIR2DS5 to the
expression level of KIR2DL5 in the sample is higher than a reference ratio; and (b)
administering a therapeutically effective amount of an FTI to the subject.
[0032] In one example the methods for treating MDS in a subject include (a) KIR typing the
subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5, and (b) administering
a therapeutically effective amount of tipifarnib to the subject. The methods can further
include HLA typing the subject, wherein the subject is a carrier of HLA-C2. In some
examples the subject is a carrier of both KIR2DS2 and HLA-C2. In some examples the
MDS is lower risk MDS.
[0033] Disclosed herein are methods for population selection of cancer patients for treatment
with an FTI based on Ras mutation status. In some examples, disclosed herein are methods
for predicting responsiveness of a cancer patient to an FTI treatment based on the
mutation status of Ras in a sample from the patient. In some examples, disclosed herein
are methods for treating cancer in a subject with a therapeutically effective amount
of an FTI.
[0034] In some examples, disclosed herein is an FTI for use in methods for treating a cancer
in a subject including (a) determining the presence or absence of a Ras mutation in
a sample from the subject, wherein the Ras mutation includes a K-Ras mutation or a
N-Ras mutation, and subsequently (b) administering a therapeutically effective amount
of the an FTI to the subject if the sample is determined to lack the K-Ras mutation
or the N-Ras mutation.
[0035] In some examples the methods includes determining the presence or absence an amino
acid substitution at a codon selected from a group consisting of G12, G13, and Q61
of K-Ras. In some examples, the methods includes determining the presence or absence
an amino acid substitution at a codon selected from a group consisting of G12, G13,
and Q61 of N-Ras.
[0036] In some examples, the patient is administered an FTI treatment if the sample is determined
to not have amino acid substitution at G12, G13, and Q61 of K-Ras, and also not have
amino acid substitution at G12, G13, and Q61 of N-Ras. In some examples, the patient
is administered an FTI treatment if the sample is determined to not have any K-Ras
mutation or any N-Ras mutation. In some examples, the patient is administered an FTI
treatment if the sample is determined to have wild type K-Ras and wild type N-Ras.
[0037] The subject is a cancer patient. In some examples the subject has a hematological
cancer. In some examples the subject has a solid tumor. The solid tumor can be a benign
tumor or a cancer. In some other examples the subject has a premalignant condition.
The hematological cancer can be chronic myelomonocytic leukemia (CMML), myeloproliferative
neoplasm (MPN), myelodysplastic syndrome (MDS), acute myeloid leukemia (AML), Juvenile
Myelomonocytic Leukemia (JMML), chronic myeloid leukemia (CML), natural killer cell
lymphoma (NK lymphoma), natural killer cell leukemia (NK leukemia), cutaneous T-Cell
lymphoma (CTCL), or peripheral T-cell lymphoma (PTCL). In some examples the patient
is a CMML patient. In some examples the patient is an MDS patient. In some examples
the patient is an AML patient.
[0038] In some examples, disclosed herein is tipifarnib for use in methods for treating
CMML in a subject (a) determining the presence or absence of a K-Ras mutation in a
sample from the subject, and subsequently (b) administering a therapeutically effective
amount of tipifarnib to the subject if the sample is determined to have wild type
K-Ras.
[0039] In some examples disclosed herein is tipifarnib for use in methods for treating CMML
in a subject (a) determining the presence or absence of a N-Ras mutation in a sample
from the subject, and subsequently (b) administering a therapeutically effective amount
of tipifarnib to the subject if the sample is determined to have wild type N-Ras.
[0040] Disclosed herein are methods for population selection of cancer patients for treatment
with an FTI based on the presence of a H-Ras mutation. In some examples disclosed
herein are methods for predicting responsiveness of a cancer patient to an FTI treatment,
methods for cancer patient population selection for an FTI treatment, and methods
for treating cancer in a subject with a therapeutically effective amount of an FTI,
based on the presence of a H-Ras mutation in a sample from the patient.
[0041] In some examples, disclosed herein is an FTI for use in methods for treating a cancer
in a subject including (a) determining the presence or absence of a H-Ras mutation
in a sample from the subject subsequently (b) administering a therapeutically effective
amount of the FTI to the subject if the sample is determined to have a H-Ras mutation.
In some examples the H-Ras mutation can be an amino acid substitution at G12, G13,
and Q61 of H-Ras.
[0042] In some examples, disclosed herein is an FTI for use in methods for treating a cancer
in a patient include (a) determining the presence or absence of a H-Ras mutation,
a K-Ras mutation, and a N-Ras mutation in a sample from the subject, and subsequently
(b) administering a therapeutically effective amount of the FTI to the subject if
the sample is determined to have a H-Ras mutation, but no K-Ras mutation or N-Ras
mutation. In some examples the methods include (a) determining a cancer patient to
have a H-Ras mutation and wild type K-Ras and wild type N-Ras, and subsequently (b)
administering a therapeutically effective amount of an FTI to the subject. In some
examples the FTI is tipifarnib.
[0043] In some examples the subject has a hematological cancer. In some examples the subject
has a solid tumor. In some examples the cancer is HPV negative. In some examples the
cancer is hepatocelluar carcinoma, salivary gland tumor, thyroid tumor, urothelial
cancer, breast cancer, melanoma, gastric cancer, pancreatic cancer, or lung cancer.
In some embodiments, the cancer is head and neck squamous cell carcinoma (HNSCC).
In some examples the cancer is salivary gland tumor. In some examples the cancer is
a thyroid tumor.
[0044] In some embodiments, provided herein is tipifarnib for use in a method of treating
a HNSCC in a subject based on the presence of a H-Ras mutation. In some embodiments,
the HNSCC can be HPV negative HNSCC. In some embodiments, the HNSCC can be relapsed/recurrent
HNSCC. In some embodiments, the HNSCC can be metastatic HNSCC. The methods provided
herein include (a) determining the presence or absence of a H-Ras mutation in a sample
from the subject having HNSCC, and subsequently (b) administering a therapeutically
effective amount of tipifarnib to the subject if the sample is determined to have
a H-Ras mutation.
[0045] In some examples, disclosed herein is tipifarnib for use in a method of treating
a salivary gland tumor in a subject based on the presence of a H-Ras mutation. In
some examples the salivary gland tumor can be HPV negative. In some examples the salivary
gland tumor can be advanced salivary gland tumor. In some examples the salivary gland
tumor can be metastatic salivary gland tumor. The methods disclosed herein include
(a) determining the presence or absence of a H-Ras mutation in a sample from the subject
having salivary gland tumor, and subsequently (b) administering a therapeutically
effective amount of tipifarnib to the subject if the sample is determined to have
a H-Ras mutation.
[0046] In some examples disclosed herein is a method of treating a thyroid cancer in a subject
based on the presence of a H-Ras mutation. In some examples the thyroid cancer can
be HPV negative. In some examples the thyroid cancer can be advanced thyroid cancer.
In some examples the thyroid cancer can be metastatic thyroid cancer. The methods
disclosed herein include (a) determining the presence or absence of a H-Ras mutation
in a sample from the subject having thyroid cancer, and subsequently (b) administering
a therapeutically effective amount of tipifarnib to the subject if the sample is determined
to have a H-Ras mutation.
[0047] In some embodiments, the sample is a tumor biopsy. In some embodiments, the sample
is a tissue sample. In some embodiments, the sample is a blood sample. In some embodiments,
the sample is a peripheral blood sample. In some embodiments, the sample is a serum
sample. In some embodiments, the sample is a bone marrow sample. In some embodiments,
the sample is peripheral blood mononuclear cells (PBMC).
[0048] In some embodiments, the Ras mutation status is determined by analyzing nucleic acids
obtained from a sample. In some embodiments, the Ras mutation status is determined
by analyzing proteins obtained from a sample. In some embodiments, the Ras mutation
status is determined by sequencing, Polymerase Chain Reaction (PCR), DNA microarray,
Mass Spectrometry (MS), Single Nucleotide Polymorphism (SNP) assay, denaturing high-performance
liquid chromatography (DHPLC), or Restriction Fragment Length Polymorphism (RFLP)
assay. In some embodiments, the Ras mutation status is determined by multiplexing
PCR. In some embodiments, the Ras mutation status is determined by next generation
sequencing.
[0049] As disclosed herein, the FTI may be selected from the group consisting of lonafarnib
(SCH-66336), CP-609,754, BMS-214662, L778123, L744823, L739749, R208176, AZD3409 and
FTI-277. In some embodiments, the FTI is administered at a dose of 1-1000 mg/kg body
weight. According to the invention the FTI is tipifarnib. In some embodiments, tipifarnib
is administered at a dose of 200-1200 mg twice a day ("b.i.d."). In some embodiments,
tipifarnib is administered at a dose of 600 mg daily orally. In some embodiments,
tipifarnib is administered at a dose of 300 mg b.i.d. orally for 3 of out of 4 weeks
in repeated 4 week cycles. In some embodiments, tipifarnib is administered at a dose
of 600 mg b.i.d. orally for 3 of out of 4 weeks in repeated 4 week cycles. In some
embodiments, tipifarnib is administered at a dose of 900 mg b.i.d. orally in alternate
weeks (one week on, one week off) in repeated 4 week cycles (days 1-7 and 15-21 of
repeated 28-day cycles). In some embodiments, tipifarnib is administered at a dose
of 1200 mg b.i.d. orally in alternate weeks (days 1-7 and 15-21 of repeated 28-day
cycles). In some embodiments, tipifarnib is administered at a dose of 1200 mg b.i.d.
orally for days 1-5 and 15-19 out of repeated 28-day cycles. In some embodiments,
patients receive at least three cycles of treatment. In some embodiments, patients
receive at least six cycles of treatment.
[0050] In some embodiments, the methods provided herein also include administering a second
therapy to the subject. The second therapy can be a radiation therapy. In some embodiments,
the methods provided herein also include administering a second therapeutically effective
amount of a secondary active agent or a support care therapy to the subject. In some
embodiments, the secondary active agent is a DNA-hypomethylating agent, a therapeutic
antibody that specifically binds to a cancer antigen, a hematopoietic growth factor,
cytokine, anti-cancer agent, antibiotic, cox-2 inhibitor, immunomodulatory agent,
anti-thymocyte globulin, immunosuppressive agent, corticosteroid or a pharmacologically
derivative thereof. In some embodiments, the secondary active agent is a DNA-hypomethylating
agent, such as azacitidine or decitabine. In some embodiments, the second active agent
is anti-PD1 antibody or anti-PDL1 antibody.
[0051] In some examples the kits disclosed herein for predicting the responsiveness of a
cancer patient to an FTI treatment include at least one agent for KIR typing the cancer
patient, and an ancillary agent, wherein the cancer patient is predicted to be responsive
to the FTI treatment if the cancer patient is a carrier of KIR2DS2 or KIR2DS5. The
kits can further include an agent for HLA typing, wherein the cancer patient is predicted
to be responsive to the FTI treatment if the cancer patient is a carrier of HLA-C2.
[0052] In some examples the kits disclosed herein for predicting the responsiveness of a
cancer patient to an FTI treatment include at least one agent for determining expression
of at least one biomarkers in a sample from the cancer patient, and an ancillary agent,
wherein the biomarker is selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5,
KIR2DL5, and GZMM; and wherein the cancer patient is predicted to be responsive to
the FTI treatment if
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5;
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in the sample is higher than a reference ratio; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in the sample is higher than a reference ratio; or any combination thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0053] FIG. 1A shows the correlation of KIR2DS5 expression levels with the clinical outcome
of AML patients treated with tipifarnib. "SD" stands for "stable disease"; "PD" stands
for "progressive disease"; "CR" stands for "complete response"; "HI" refers to "hematologic
improvement." FIG. 1B shows the correlation of KIR2DS5 expression levels with the
progression-free survival ("PFS") of AML patients treated with tipifarnib.
FIG. 2A shows the correlation between the ratio of expression level of KIR2DS2 to
the expression level of KIR2DL2 and the PFS of AML patients treated with tipifarnib.
FIG. 2B shows the correlation between the ratio of expression level of KIR2DS2 to
the expression level of KIR2DL2 and the overall survival ("OS") of AML patients treated
with tipifarnib.
FIG. 2A: Cox Proportional Hazards Regression
| Parameter |
b |
SE |
Wald |
P |
Exp(b) |
95% Cl of Exp(b) |
| 2DS/2DL |
-7.4132 |
2.0012 |
13.7227 |
0.0002 |
0.0006 |
0.0000 to 0.0299 |
FIG. 2B: Cox Proportional Hazards Regression
| |
b |
SE |
Wald |
P |
Exp(b) |
95% Cl of Exp(b) |
| 2DS2/2DL2 Ratio |
-5.3430 |
1.6871 |
10.0296 |
0.0015 |
0.0048 |
0.0002 to 0.1283 |
FIGs. 3A and 3B both show the lack of correlation between the ratio of expression
level of KIR2DS2 to the expression level of KIR2DL2 and the OS of AML patients treated
with non-FTI chemotherapy agents. In FIG. 3A, patients were treated with high dose
cytarabine and mitoxantrone. In FIG. 3B, patients were treated with high dose cytarabine
and mitoxantrone/intense chemo.
FIG. 4A shows the correlation between the ratio of expression level of KIR2DS5 to
the expression level of KIR2DL5A and both the PFS and OS of AML patients treated with
tipifarnib. FIG. 4B shows the lack of correlation between the ratio of expression
level of KIR2DS5 to the expression level of KIR2DL5A with OS of AML patients treated
with non-FTI chemotherapy agents (cytarabine and mitoxantrone).
FIG. 4A: Cox Proportional Hazards Regression
| Tipifarnib/PFS |
b |
SE |
Wald |
P |
Exp(b) |
95% Cl of Exp(b) |
| 2DS5/2DL5A Ratio |
-3.5254 |
1.2351 |
8.1480 |
0.0043 |
0.0294 |
0.0026 to 0.3272 |
FIG. 5 shows the correlation of levels of GZMM expression with the clinical outcome
of AML patients treated with tipifarnib.
FIG. 6A shows the correlation between the expression level of GZMM and survival of
AML patients treated with tipifarnib. FIG. 6B shows the lack of correlation between
the expression level of GZMM with survival of AML patients treated with non-FTI chemotherapy
agents (cytarabine and mitoxantrone).
FIG. 6A: Cox Proportional Hazards Regression
| (Tipifarnib) |
b |
SE |
Wald |
P |
Exp(b) |
95% Cl of Exp(b) |
| GZMM/OS |
-0.5642 |
0.1652 |
11.6675 |
0.0006 |
0.5688 |
0.4122 to 0.7850 |
| GZMM/PFS |
-0.5856 |
0.1809 |
10.4780 |
0.0012 |
0.5568 |
0.3913 to 0.7923 |
FIG. 7A shows the correlation of levels of KIR2DS2 expression with the clinical outcome
of AML patients treated with tipifarnib. FIG. 7B shows the specific correlation of
levels of KIR2DS2 expression with the clinical outcome of AML patients treated with
tipifarnib (left panel), but not with non-FTI chemotherapy agents (right panel).
FIG. 8 shows the correlation between N-RAS wild type status and the prolonged progression-free
survival ("PFS") in AML patients treated with tipifarnib.
FIG. 9 shows the higher response rate to tipifarnib treatment in AML patients having
wild type N-RAS compared to those having mutant N-RAS.
DETAILED DESCRIPTION
1. Definitions
[0054] As used herein, the articles "a," "an," and "the" refer to one or to more than one
of the grammatical object of the article. By way of example, a biomarker refers to
one biomarker or more than one biomarkers.
[0055] As used herein, the term "NK cell," or "natural killer cell," refers to the type
of bone marrow-derived large granular lymphocytes that share a common progenitor with
T cells, but do not have B cell or T cell surface markers. NK cells usually constitute
10-15% of all circulating lymphocytes. NK cells are defensive cells of innate immunity
that recognize structures on the surface of virally infected cells or tumor cells
and kill these cells by releasing cytotoxins. NK cells can be activated without previous
antigen exposure.
[0056] In order to kill infected cells or tumor cells selectively, NK cells must distinguish
healthy cells from diseased cells. The cytolytic activity of human NK cells is modulated
by the interaction of inhibitory and activatory membrane receptors, which are expressed
on the surface of NK cells, with MHC (HLA) class I molecules, which are expressed
by non-NK cells, including tumor cells, or cells from a bone marrow transplant recipient.
The killer cell immunoglobulin-like receptors (KIR; or CD158) mapping to chromosome
19q13.4.3-5, constitute a family of MHC-I (HLA-A, -B, -C) binding receptors that regulate
the activation threshold of NK cells (
Valiante el at. Immunity 7:739-751(1997)).
[0057] In humans, the class I HLA complex is about 2000 kb long and contains about 20 genes.
Within the class I region exist genes encoding the well characterized class I MHC
molecules designated HLA-A, HLA-B and HLA-C. In addition, there are nonclassical class
I genes that include HLA-E, HLA-F, HLA-G, HLA-H, HLA-J and HLA-X as well as a new
family known as MIC. While HLA-A and -B play some role, the interactions between KIRs
and HLA-C molecules predominate in preventing NK cells from attacking healthy autologous
cells (
Colonna et al. PNAS, 90:1200-12004 (1993);
Moesta AK et al., Front Immunol. 3:336(2012)).
[0058] HLA-C gene has multiple alleles, including HLA-C 1 and HLA-C2 based on the presence
of asparagine or lysine at amino acid position 80 in the mature protein (Mandelboim
et al. 1996). Furthermore, HLA-C1 contains a conserved serine residue at amino acid
position 77, while an asparagine is present in HLA-C2 at the same position. Thus,
at least three genotypes can be distinguished regarding HLA-C: those having both HLA-C1
and HLA-C2 (HLA-C1/HLA-C2 heterozygous), those having either HLA-C1 (HLA-C1/HLA-C1
homozygous) or HLA-C2 (HLA-C2/HLA-C2 homozygous), and those lacking both HLA-C1 and
HLA-C2.
[0059] As used herein, the term "KIR genes" refers to the genes that encode the KIR receptors
on NK cells. The KIR genes are clustered in one of the most variable regions of the
human genome in terms of both gene content and sequence polymorphism. This extensive
variability generates a repertoire of NK cells in which KIR are expressed at the cell
surface in a combinatorial fashion. Interactions between KIR and their appropriate
ligands on target cells result in the production of positive or negative signals that
regulate NK cell function.
[0060] KIR genes are inherited in two major haplotypes: A and B. Haplotype A has only one
activatory receptor, KIR2DS4, that is inactivated in most of the US population due
to a 22 bp deletion. KIR haplotype B includes 22 KIR2DS2 and 16 KIR2DS5 alleles that
are present in ∼45% and ∼25% of Caucasian Americans, respectively. There is a strong
linkage disequilibrium between KIR2DS2 (activatory) and KIR2DL2 (inhibitory). DNA
methylation maintains allele-specific KIR gene expression (e.g. CpG island in KIR2DS2
promoter spans from -160 through +26 and has 6 cytosine sites) (
Moesta AK et al., Front Immunol. 3:336(2012)).
[0061] To date, at least 14 distinct KIR genes have been identified, which are KIR2DL1,
KIR2DL2, KIR2DL3, KIR2DL4, KIR2DL5, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DL1,
KIR3DL2, KIR3DL3, KIR3DS1. These genes share extensive sequence homology. Each gene
is about 9-16 Kb in length, divided into 8-9 exons that encode the signal peptide,
two or three extracellular domains, stem, transmembrane region, and cytoplasmic tail.
These genes vary with respect to their presence or absence on different KIR haplotypes,
creating considerable diversity in the number of KIR genotypes observed in the population.
For example, some individuals might carry only seven of the 14 KIR genes while other
individuals might carry 12 of the 14 KIR genes. Each KIR gene encodes either an inhibitory
or an activating KIR. For example, KIR2DS2 and KIR2DS5 are both activating KIRs, and
KIR2DL2 and KIR2DL5 are both inhibitory KIRs. One particular KIR gene can have multiple
alleles. For example, KIR2DL5 includes two alleles, KIR2DL5A and KIR2DL5B. Thus, four
genotypes can be distinguished regarding KIR2DL5: those having both KIR2DL5A and KIR2DL5B,
those having either KIR2DL5A or KIR2DL5B, and those lacking KIR2DL5.
[0067] As used herein, the term "KIR typing" refers to the process of determining the genotype
of the KIR genes in a subject, including determining the presence or absence of one
or more specific KIR genes or alleles in the genome of the subject. KIR typing can
also include determining the copy number of one or more specific KIRs genes or alleles
in the genome of the subj ect.
[0068] As used herein, the term "HLA typing" refers to the process of determining the genotype
of the HLA genes in a subject, including determining the presence or absence of one
or more specific HLA genes or alleles in the genome of the subject. HLA typing also
include determining the copy number of one or more specific HLA genes or alleles in
the genome of the subj ect.
[0069] Granzyme M (GZMM) is a serine protease expressed in a multiple cytotoxic lymphocyte
subsets. The granule-exocytosis pathway is the major mechanism via which cytotoxic
lymphocytes eliminate virus-infected and tumor cells. In this pathway, cytotoxic lymphocytes
release granules containing the pore-forming protein perforin and a family of serine
proteases known as granzymes (GZM) into the immunological synapse. Pore-formation
by perforin facilitates entry of granzymes into the target cell, where they can activate
various death pathways. There are five human granzymes: GZMA, GZMB, GZMH, GZMK, and
GZMM. Of the five GZMs, GZMM is a marker for NK cells or NKT cells, and GZMH is a
marker for cytotoxic T cells (
Poot, Cell Death and Differentiation 21:359-368 (2014)).
[0071] As used herein, the term "subject" refers to a mammal. A subject can be a human or
a non-human mammal such as a dog, cat, bovid, equine, mouse, rat, rabbit, or transgenic
species thereof. The subject can be a patient, or a cancer patient.
[0072] As used herein, the term "cancer" or "cancerous" refers to the physiological condition
in mammals that is typically characterized by unregulated cell growth. Examples of
cancer include, but are not limited to, hematological cancers (e.g., multiple myeloma,
lymphoma and leukemia), and solid tumors. As used herein, the term "premalignant condition"
refers to a condition associated with an increased risk of cancer, which, if left
untreated, can lead to cancer. A premalignant condition can also refer to non-invasive
cancer that have not progressed into aggressive, invasive stage.
[0073] As used herein, the term "treat," "treating," and "treatment," when used in reference
to a cancer patient, refer to an action that reduces the severity of the cancer, or
retards or slows the progression of the cancer, including (a) inhibiting the cancer
growth, or arresting development of the cancer, and (b) causing regression of the
cancer, or delaying or minimizing one or more symptoms associated with the presence
of the cancer.
[0074] As used herein, the term "determining" refers to using any form of measurement to
assess the presence of a substance, either quantitatively or qualitatively. Measurement
can be relative or absolute. Measuring the presence of a substance can include determining
whether the substance is present or absent, or the amount of the substance.
[0075] As used herein, the term "carrier" when used in connection with a gene refers to
a subject whose genome includes at least one copy of the gene, and when used in connection
with an allele of a gene refers to a subject whose genome includes at least one copy
of the specific allele. For example, a carrier of KIR2DS2 refers to a subject whose
genome includes at least one copy of KIR2DS2. If a gene has more than one alleles,
a carrier of the gene refers to subject whose genome includes at least one copy of
at least one allele of the gene. For example, the gene KIR2DL5 has two known alleles,
KIR2DL5A and KIR2DL5B. A carrier of KIR2DL5A refers to a subject whose genome includes
at least one copy of the allele KIR2DL5A; a carrier of KIR2DL5B refers to a subject
whose genome includes at least one copy of the allele KIR2DL5B. A carrier of KIR2DL5
refers to a subject whose genome includes at least one copy of KIR2DL5A, KIR2DL5B,
or both. For another example, a carrier of HLA-C2 refers to a subject whose genome
includes at least one copy of the allele HLA-C2. The subject can be HLA-C2/HLA-C2
homozygous, or HLA-C1/HLA-C2 heterozygous.
[0076] As used herein, the term "administer," "administering," or "administration" refers
to the act of delivering, or causing to be delivered, a compound or a pharmaceutical
composition to the body of a subject by a method described herein or otherwise known
in the art. Administering a compound or a pharmaceutical composition includes prescribing
a compound or a pharmaceutical composition to be delivered into the body of a patient.
Exemplary forms of administration include oral dosage forms, such as tablets, capsules,
syrups, suspensions; injectable dosage forms, such as intravenous (IV), intramuscular
(IM), or intraperitoneal (IP); transdermal dosage forms, including creams, jellies,
powders, or patches; buccal dosage forms; inhalation powders, sprays, suspensions,
and rectal suppositories.
[0077] As used herein, the term "therapeutically effective amount" of a compound when used
in connection with a disease or disorder refers to an amount sufficient to provide
a therapeutic benefit in the treatment or management of the disease or disorder or
to delay or minimize one or more symptoms associated with the disease or disorder.
A therapeutically effective amount of a compound means an amount of the compound,
alone or in combination with other therapies, that provides a therapeutic benefit
in the treatment or management of the disease or disorder. The term encompasses an
amount that improves overall therapy, reduces or avoids symptoms, or enhances the
therapeutic efficacy of another therapeutic agent. The term also refers to the amount
of a compound that sufficiently elicits the biological or medical response of a biological
molecule (
e.
g., a protein, enzyme, RNA, or DNA), cell, tissue, system, animal, or human, which
is being sought by a researcher, veterinarian, medical doctor, or clinician.
[0078] As used herein, the term "sample" refers to a material or mixture of materials containing
one or more components of interest. A sample from a subject refers to a sample obtained
from the subject, including samples of biological tissue or fluid origin, obtained,
reached, or collected
in vivo or
in situ. A sample can be obtained from a region of a subject containing precancerous or cancer
cells or tissues. Such samples can be, but are not limited to, organs, tissues, fractions
and cells isolated from a mammal. Exemplary samples include bone marrow, whole blood,
partially purified blood, peripheral blood mononuclear cells ("PBMC"), and tissue
biopsies. Exemplary samples also include cell lysate, a cell culture, a cell line,
a tissue, oral tissue, gastrointestinal tissue, an organ, an organelle, a biological
fluid, a blood sample, a urine sample, a skin sample, and the like.
[0079] As used herein, the term "biomarker" refers to a gene that can be either present
or absent in individual subjects, or can be present but differentially expressed in
individual subjects. The presence a biomarker, including the expression level of the
biomarker, in a sample from a subject can indicate the responsiveness of the subject
to a particular treatment, such as an FTI treatment.
[0080] As used herein, the term "express" or "expression" when used in connection with a
gene refers to the process by which the information carried by the gene becomes manifest
as the phenotype, including transcription of the gene to a messenger RNA (mRNA), the
subsequent translation of the mRNA molecule to a polypeptide chain and its assembly
into the ultimate protein.
[0081] As used herein, the term "RNA product of the biomarker" refers to a RNA transcript
transcribed from a biomarker, and the term "protein product of the biomarker" refers
to a protein or polypeptide translated from a RNA product of a biomarker.
[0082] As used herein, the term "expression level" of a biomarker refers to the amount or
accumulation of the expression product of a biomarker, such as, for example, the amount
of a RNA product of the biomarker (the RNA level of the biomarker) or the amount of
a protein product of the biomarker (the protein level of the biomarker). If the biomarker
is a gene with more than one alleles, the expression level of a biomarker refers to
the total amount of accumulation of the expression product of all existing alleles
for this gene, unless otherwise specified. For example, the expression level of KIR2DL5
refers to the total expression levels of both KIR2DL5A and KIR2DL5B, unless otherwise
specified.
[0083] As used herein, the term "reference expression level" refers to a predetermined expression
level of a biomarker that one can use to determine the significance of the expression
level of the biomarker in a sample from a subject. A reference expression level of
a biomarker can be the expression level of the biomarker in a sample from a healthy
individual. A reference expression level of a biomarker can also be a cut-off value
determined by a person of ordinary skill in the art through statistic analysis of
the expression levels of the biomarker in a sample population and the responsiveness
to a treatment of the individuals in the sample population. For example, by analyzing
the expression levels of GZMM in individuals of a sample population and the responsiveness
of these individuals to an FTI treatment, a person of ordinary skill in the art can
determine a cut-off value as the reference expression level of GZMM, wherein a subject
is likely to be responsive to the FTI treatment if the expression level of GZMM of
the subject is higher than the reference expression level.
[0084] As used herein, the term "responsiveness" or "responsive" when used in connection
with a treatment refers to the effectiveness of the treatment in lessening or decreasing
the symptoms of the disease being treated. For example, a cancer patient is responsive
to an FTI treatment if the FTI treatment effectively inhibits the cancer growth, or
arrests development of the cancer, causes regression of the cancer, or delays or minimizes
one or more symptoms associated with the presence of the cancer in this patient.
[0085] The responsiveness to a particular treatment of a cancer patient can be characterized
as a complete or partial response. "Complete response," or "CR" refers to an absence
of clinically detectable disease with normalization of previously abnormal radiographic
studies, bone marrow, and cerebrospinal fluid (CSF) or abnormal monoclonal protein
measurements. "Partial response," or "PR," refers to at least about a 10%, 20%, 30%,
40%, 50%, 60%, 70%, 80%, or 90% decrease in all measurable tumor burden (i.e., the
number of malignant cells present in the subject, or the measured bulk of tumor masses
or the quantity of abnormal monoclonal protein) in the absence of new lesions.
[0086] A person of ordinary skill in the art would understand that clinical standards used
to define CR, PR, or other level of patient responsiveness to treatments can vary
for different types of cancer. For example, for hematopoietic cancers, patient being
"responsive" to a particular treatment can be defined as patients who have a complete
response (CR), a partial response (PR), or hematological improvement (HI) (
Lancet et al., Blood 2:2 (2006)). HI can be defined as any bone marrow blast count less than 5% or a reduction in
bone marrow blasts by at least half. On the other hand, patient being "not responsive"
to a particular treatment can be defined as patients who have either progressive disease
(PD) or stable disease (SD). Progressive disease (PD) can be defined as either >50%
increase in bone marrow or circulating blast % from baseline, or new appearance of
circulating blasts (on at least 2 consecutive occasions). Stable disease (SD) can
be defined as any response not meeting CR, PR, HI, or PD criteria.
[0087] As used herein, the term "likelihood" refers to the probability of an event. A subject
is "likely" to be responsive to a particular treatment when a condition is met means
that the probability of the subject to be responsive to a particular treatment is
higher when the condition is met than when the condition is not met. The probability
to be responsive to a particular treatment can be higher by, for example, 5%, 10%,
25%, 50%, 100%, 200%, or more in a subject who meets a particular condition compared
to a subject who does not meet the condition. For example, a cancer patient is "likely"
to be responsive to an FTI treatment when the subject is a carrier of KIR2DS2 means
that the probability of a subject to be responsive to FTI treatment is 5%, 10%, 25%,
50%, 100%, 200%, or more higher in a subject who is a carrier of KIR2DS2 compared
to a subject who is not a carrier of KIR2DS2. For another example, a subject is "likely"
to be responsive to tipifarnib treatment when the expression level of GZMM in a sample
from the subject is higher than a reference expression level of GZMM means that the
probability of a subject to be responsive to tipifarnib treatment is 5%, 10%, 25%,
50%, 100%, 200%, or more in a subject whose expression level of GZMM is higher than
a reference expression level of GZMM compared to a subject whose expression level
of GZMM is lower than the reference expression level.
[0088] Ras proteins are GTPases that regulate proliferation and by transducing biological
information from extracellular signals to the nucleus. Mammalian cells express three
ras genes that encode four Ras proteins, which are H-Ras, N-Ras, K
A-Ras and K
B-Ras. K
A-Ras and K
B-Ras are also generally referred to as K-Ras. Ras proteins exist in either an active,
GTP-bound or an inactive, GDP-bound, state. Mutant RAS proteins accumulate in the
GTP-bound conformation due to defective intrinsic GTPase activity and/or resistance
to inactivation by GTPase activating proteins (GAPs). Mutations that lock Ras proteins
in their GTP-bound, activated state result in uncontrolled growth and malignant transformation.
K-Ras mutations that result in glycine to valine substitutions at the catalytic sites
of K-Ras, which leads to the loss of GTPase activity and subsequent continuous binding
of GTP to RAS (
Yokota, Anti- Cancer Agents in Medicinal Chemistry, 12:163-171(2012)). The substitution of other amino acids, such as aspartate and valine at codon 12
and aspartate at codon 13, can result in the projection of larger amino acid side
chains into the GDP/GTP binding pocket of the protein which interfere with GTP hydrolysis.
As a result of those conformational and structural changes EGFR signalling becomes
deregulated in response to the constitutive activation of K-Ras protein (
Herreros-Villanueva et al., Clinica Chimica Acta 431 (2014) 21:1-220).
[0089] An exemplary amino acid sequence and a corresponding encoding nucleic acid sequence
of human K-Ras Isoform A (K
A-Ras)( GENBANK: NM_033360.3 GI:575403058) are provided below:

[0090] An exemplary amino acid sequence and a corresponding encoding nucleic acid sequence
of human K-Ras Isoform B (K
B-Ras) (GENBANK: NM_033360.3 GI:575403058) are provided below:

[0093] Ras isoforms are farnesylated. Farnesyltransferase (FTase) have crucial roles in
the post-translational modifications of Ras proteins. A way of interfering with Ras
function is the inhibition of FTase, the enzyme coupling a 15-carbon isoprenyl group
to Ras proteins, by Farnesyltransferase Inhibitors ("FTI"). FTIs are a class of biologically
active anticancer drugs that inhibit farnesylation of a wide range of target proteins,
including Ras. The FTIs block Ras activation through inhibition of FTase, ultimately
resulting in cell growth arrest. Thus, it was predicted that FTIs would be effective
therapeutic agents in the treatment of cancer.
[0094] Thirty percent of all human cancers express oncogenically activated Ras. The high
prevalence of mutated Ras, found in 30% of all human cancers, makes this pathway an
attractive target for anticancer drug development. Initially, it was predicted that
the Ras mutation (s) that led to constitutively active RAS pathway can serve as a
biomarker for patient response to FTIs, which was based on the preclinical evidence
that FTIs could block RAS-transformed cells. (
Raponi et al., Blood 111:2589-96 (2008)). Contrary to the conventional understanding, disclosed herein are the unexpected
discoveries that the cancer patients who have wild type K-Ras and N-Ras are more sensitive
to FTI treatment compared to those who have a mutant K-Ras or N-Ras, and that selection
of cancer patients based on the Ras mutation status can improve the overall response
rate of an FTI treatment, such as a tipifarnib treatment.
[0095] As used herein, the term "Ras mutation" refers to an activation mutation in a
ras gene or Ras protein. A Ras mutation can refer to either a genetic alternation in
the DNA sequence of one of the
ras genes that results in activation of the corresponding Ras protein, or the alteration
in the amino acid sequence of a Ras protein that results in its activation. Thus,
the term "Ras mutation" as used herein does not include an alternation in a
ras gene that does not result in the activation of the Ras protein, or an alternation
of a Ras protein sequence that does not lead to its activation. Accordingly, a sample
or a subject that does not have any "Ras mutation" as used herein can still have a
mutation in a
ras gene that does not affect the activity of the Ras protein or a mutation that impairs
the activity of the Ras protein, or have a mutation in a Ras protein that does not
affect its activity or a mutation that impairs its activity. A sample or a subject
can have multiple copies of
a ras gene. A sample or a subject can also have both wild type and mutant Ras proteins.
As used herein, a sample or a subject having a Ras mutation can also have a copy of
wild type
ras gene and/or the wild type Ras protein. A sample or a subject that is determined to
"have wild type Ras," as used herein, refers to the sample or subject that only has
wild type
ras gene and the wild type Ras protein, and no Ras mutation. Accordingly, a sample or
a subject that is determined to "have wild type K-Ras," as used herein, refers to
the sample or subject that only has wild type
kras gene and wild type K-Ras protein, and no K-Ras mutation. A sample or a subject that
is determined to "have wild type N-Ras," as used herein, refers to the sample or subject
that only has wild type
nras gene and wild type N-Ras protein, and no N-Ras mutation.
[0096] The Ras protein can be K-Ras, N-Ras, H-Ras, or any combination thereof. The K-Ras
can be K
A-Ras, K
B-Ras, or both. In some embodiments, the mutation is a missense mutation that locks
the Ras protein into its GTP bound activated state. In some embodiment, the mutation
results in an amino acid substitution in one or more of codons 12, 13, 61 of the Ras
protein.
[0097] In some examples the Ras mutation is a K-Ras mutation. In some examples the K-Ras
mutation is a mutation in K
A-Ras, K
B-Ras, or both. The K-Ras mutation can include at least one mutation at a codon selected
from the group consisting of G12, G13, and Q61 of K
A-Ras, K
B-Ras, or both. In some examples the K
A-Ras mutation can include at least one mutation selected from the group consisting
of the amino acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C,
G13D, G13R, G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 R and A146V. In some examples
the K
B-Ras mutation can include at least one mutation selected from the group consisting
of the amino acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C,
G13D, G13R, G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 Rand A146V.
[0098] In some examples the Ras mutation is an N-Ras mutation. In some examples the N-Ras
mutation can include at least one mutation at a codon selected from the group consisting
of G12, G13, G15, G60 and Q61. In some examples the N-Ras mutation can include at
least one mutation at a codon selected from the group consisting of G12, G13, and
Q61. In some examples the N-Ras mutation can include at least one mutation selected
from the group consisting of the amino acid substitutions of G12C, G12D, G12F, G12S,
G12A, G12V, G12R, G13C, G13R, G13A, G13D, G13V, G15W, G60E, Q61P, Q61L, Q61R, Q61K,
Q61H and Q61E.
[0099] In some embodiments, the Ras mutation is an H-Ras mutation. In some embodiments,
the H-Ras mutation can include at least one mutation at a codon selected from the
group consisting of G12, G13, and Q61. In some embodiments, the N-Ras mutation can
include at least one mutation selected from the group consisting of the amino acid
substitutions of G12R, G12V, G13C, G13R, Q61L and Q61R.
2. Farnesyltransferase Inhibitors for Cancer Treatment
2.1. Farnesyltransferase inhibitors
[0100] Disclosed herein is an FTI for use in methods to treat a cancer in a selected cancer
patient or a selected population of cancer patients. The representative FTIs roughly
belong to two classes (
Shen et al., Drug Disc. Today 20:2 (2015)). The FTIs in the first class have the basic framework of farnesyldiphosphate (FPP).
For instance, FPP analogs with a malonic acid group (Ta) were reported to be FTIs
that compete with FPP (
Duez, S. et al. Bioorg. Med. Chem. 18:543-556(2010)). In addition, imidazole-containing derivatives linked by an acidic substituent
and a peptidyl chain were also synthesized as bisubstrate FTIs, and the designed bisubstrate
inhibitors have better affinities than FPP. The FTIs in the second class are peptidomimetic
molecules, which can be divided into two groups, namely thiol and non-thiol FTIs.
Regarding the thiol FTIs, for instance L-739749, a selective peptidomimetic FTI shows
potent antitumor activity in nude mice without system toxicity (
Kohl, N.E. et al. PNAS 91:9141-9145(1994)). Additionally, a variety of thiol inhibitors were also developed, such as tripeptidyl
FTIs (
Lee, H-Y. et al. Bioorg. Med. Chem. Lett. 12:1599-1602(2002)).
[0101] For non-thiol FTIs, the heterocycles were therefore widely used to substitute the
thiol group to contact with the zinc ion in the binding site. According to the structures
of pharmacophoric groups, the nonthiol FTIs can be divided into three classes. The
first class is featured by different monocyclic rings, such as L-778123, an FTI in
Phase I clinical trials for solid tumors and lymphoma. L-778123 binds into the CAAX
peptide site and competes with the CAAX substrate of farnesyltransferase. The second
class is represented by tipifarnib in Phase III trials and BMS-214662 in Phase III
trials, which are composed of diverse monocyclic rings and bicyclic rings (
Harousseau et al. Blood 114:1166-1173 (2009)). The representative inhibitor of the third class is lonafarnib, which is active
in Ras-dependent and -independent malignant tumors, and has entered Phase III clinical
trials for combating carcinoma, leukemia, and myelodysplastic syndrome. Lonafarnib
is an FTI with a tricycle core, which contains a central seven-membered ring fused
with two six-membered aromatic rings.
[0102] Thus, FTIs as described herein can take on a multitude of forms but share the essential
inhibitory function of interfering with or lessening the farnesylation of proteins
implicated in cancer and proliferative diseases.
[0103] Numerous FTIs include those described in
U.S. Pat. Nos. 5,976,851;
5,972,984;
5,972,966;
5,968,965;
5,968,952;
6,187,786;
6,169,096;
6,037,350;
6,177,432;
5,965,578;
5,965,539;
5,958,939;
5,939,557;
5,936,097;
5,891,889;
5,889,053;
5,880,140;
5,872,135;
5,869,682;
5,861,529;
5,859,015;
5,856,439;
5,856,326;
5,852,010;
5,843,941;
5,807,852;
5,780,492;
5,773,455;
5,767,274;
5,756,528;
5,750,567;
5,721,236;
5,700,806;
5,661,161;
5,602,098;
5,585,359;
5,578,629;
5,534,537;
5,532,359;
5,523,430;
5,504,212;
5,491,164;
5,420,245; and
5,238,922.
[0105] In some examples the FTIs include Arglabin (i.e.l(R)-10-epoxy-5(S),7(S)-guaia-3(4),11(13)-dien-6,12-olide
descibed in
WO-98/28303 (NuOncology Labs); perrilyl alcohol described in
WO-99/45912 (Wisconsin Genetics); SCH-66336 (lonafarnib), i.e. (+)-(R)-4-[2-[4-(3,10-dibromo-8-chloro-5,6-dihydro-11H-benzo
[5,6]cyclohepta[1,2-b]pyridin-11-yl)piperidin-1-yl]-2-oxoethyl]piperidine-1-carboxamide,
described in
U.S. Patent No. 5874442 (Schering); L778123, i.e. 1-(3-chlorophenyl)-4-[1-(4-cyanobenzyl)-5-imidazolylmethyl]-2-piperazinone,
described in
WO-00/01691 (Merck); L739749, i.e. compound 2(S)-[2(S)-[2(R)-amino-3-mercapto]propylamino-3(S)-methyl]-pentyloxy-3-phenylpropionyl-methionine
sulfone described in
WO-94/10138 (Merck); FTI-277, i.e., methyl {N-[2-phenyl-4-N[2(R)-amino-3-mecaptopropylamino]
benzoyl]}-methionate (Calbiochem); L744832, i.e, 2S)-2-[[(2S)-2-[(2S,3S)-2-[(2R)-2-amino-3-mercaptopropyl]amino]-3-methylpentyl]oxy]-1-oxo-3-phenylpropyl]amino]-4-(methylsulfonyl)-butanoic
acid 1-methylethyl ester (Biomol International L.P.); CP-609,754 (Pfizer), i.e., (R)-6-[(4-chlorophenyl)-hydroxyl-(1-methyl-1-H-imidazol-5-yl)-methyl]-4-(3-ethynylphenyl)-1-methyl-2-(1H)-quinonlinone
and (R)-6-[(4-chlorophenyl)-hydroxyl-(3-methyl-3-H-imidazol-4-yl)-methyl]-4-(3-ethynylphenyl)-1-methyl-2-(1H)-quinolinone;
R208176 (Johnson & Johnson), i.e., JNJ-17305457, or (R)-1-(4-chlorophenyl)-1-[5-(3-chlorophenyl)tetrazolo[1,5-a]quinazolin-7-yl]-1-(1-methyl-1H-imidazol-5-yl)methanamine;
AZD3409 (AstraZeneca), i.e. (S)-isopropyl 2-(2-(4-fluorophenethyl)-5-((((2S,4S)-4-(nicotinoylthio)pyrrolidin-2-yl)methyl)amino)benzamido)-4-(methylthio)butanoate;
BMS 214662 (Bristol-Myers Squibb), i.e. (R)-2,3,4,5-tetrahydro-1-(IH-imidazol-4-ylmethyl)-3-(phenylmethyl)-4-(2-thienylsulphonyl)-IH-1,4-benzodiazapine-7-carbonitrile,
described in
WO 97/30992 (Bristol Myers Squibb) and Pfizer compounds (A) and (B) described in
WO-00/12498 and
WO-00/12499.
[0106] In some examples the FTI are the non-peptidal, so-called "small molecule" therapeutics,
such as are quinolines or quinoline derivatives including:
7-(3-chlorophenyl)-9-[(4-chlorophenyl)-1H-imidazol-1-ylmethyl]-2,3-dihydro-o-1H,5H-benzo[ij]quinolizin-5
-one,
7-(3-chlorophenyl)-9-[(4-chlorophenyl)-1H-imidazol-1-ylmethyl]-1,2-dihydro-o-4H-pyrrolo[3,2,1-ij]quinoline-4-one,
8-[amino(4-chlorophenyl)(1-methyl-1H-imidazol-5-yl),methyl]-6-(3-chloroph-enyl)-1,2-dihydro-4H-pyrrolo[3,2,1-ij]quinolin-4-one,
and
8-[amino(4-chlorophenyl)(1-methyl-1H-imidazol-5-yl)methyl]-6-(3-chlorophe-nyl)-2,3-dihydro-1H,5H-benzo[ij]quinolizin-5-one.
[0107] Tipifarnib is a nonpeptidomimetic FTI (
Thomas et al., Biologics 1: 415-424 (2007)). It is a 4,6-disubstituted-1-methylquinolin-2-one derivative ((B)-6-[amino(4-chlorophenyl)(1-methyl-1H-imidazol-5-yl)methyl]-4-(3-ch-lorophenyl)-1-methyl-2(1H)-quinolinone))
that was obtained by optimization of a quinolone lead identified from compound library
screening. Tipifarnib competitively inhibits the CAAX peptide binding site of FTase
and is extremely potent and highly selective inhibitor of farnesylation. Tipifarnib
is not an inhibition of geranylgeranyltransferase I. Tipifarnib has manageable safety
profile as single agent therapy, is reasonably well tolerated in man and requires
twice-daily dosing to obtain effective plasma concentrations.
[0108] Tipifarnib is synthesized by the condensation of the anion of 1-methylimidazole with
a 6-(4-chlorobenzoyl) quinolone derivative, followed by dehydration. The quinolone
intermediate was prepared in four steps by cyclization of N-phenyl-3-(3-chlorophenyl)-2-propenamide,
acylation, oxidation and N-methylation. Tipifarnib was identified from Janssen's ketoconazole
and retinoic acid catabolism programs as a key structural feature into Ras prenylation
process. Tipifarnib is a potent inhibitor of FTase in vitro and is orally active in
a variety of animal models. Single agent activity of tipifarnib was observed in unselected
tumor populations (AML, MDS/CMML, urothelial cancer, breast cancer, PTCL/CTCL) although
a phase III clinic study failed to demonstrate improvement in overall survival.
[0109] In some examples, disclosed herein is an FTI for use in a method of treating cancer
in a subject with an FTI or a pharmaceutical composition having FTI, or selecting
a cancer patient for an FTI treatment. The pharmaceutical compositions provided herein
contain therapeutically effective amounts of an FTI and a pharmaceutically acceptable
carrier, diluent or excipient. In some examples the FTI is arglabin; perrilyl alcohol;
lonafarnib (SCH-66336); L778123; L739749; FTI-277; L744832; R208176; BMS 214662; AZD3409;
or CP-609,754. According to the invention, the FTI is tipifarnib.
2.2. Formulations
[0110] The FTI can be formulated into suitable pharmaceutical preparations such as solutions,
suspensions, tablets, dispersible tablets, pills, capsules, powders, sustained release
formulations or elixirs, for oral administration or in sterile solutions or suspensions
for ophthalmic or parenteral administration, as well as transdermal patch preparation
and dry powder inhalers. Typically the FTI is formulated into pharmaceutical compositions
using techniques and procedures well known in the art (see, e.g.,
Ansel Introduction to Pharmaceutical Dosage Forms, Seventh Edition 1999).
[0111] In the compositions, effective concentrations of the FTI and pharmaceutically acceptable
salts is (are) mixed with a suitable pharmaceutical carrier or vehicle. The concentrations
of the FTI in the compositions are effective for delivery of an amount, upon administration,
that treats, prevents, or ameliorates one or more of the symptoms and/or progression
of cancer, including haematological cancers and solid tumors.
[0112] The compositions can be formulated for single dosage administration. To formulate
a composition, the weight fraction of the FTI is dissolved, suspended, dispersed or
otherwise mixed in a selected vehicle at an effective concentration such that the
treated condition is relieved or ameliorated. Pharmaceutical carriers or vehicles
suitable for administration of the FTI provided herein include any such carriers known
to those skilled in the art to be suitable for the particular mode of administration.
[0113] In addition, the FTI can be formulated as the sole pharmaceutically active ingredient
in the composition or may be combined with other active ingredients. Liposomal suspensions,
including tissue-targeted liposomes, such as tumor-targeted liposomes, may also be
suitable as pharmaceutically acceptable carriers. These may be prepared according
to methods known to those skilled in the art. For example, liposome formulations may
be prepared as known in the art. Briefly, liposomes such as multilamellar vesicles
(MLV's) may be formed by drying down egg phosphatidyl choline and brain phosphatidyl
serine (7:3 molar ratio) on the inside of a flask. A solution of an FTI provided herein
in phosphate buffered saline lacking divalent cations (PBS) is added and the flask
shaken until the lipid film is dispersed. The resulting vesicles are washed to remove
unencapsulated compound, pelleted by centrifugation, and then resuspended in PBS.
[0114] The FTI is included in the pharmaceutically acceptable carrier in an amount sufficient
to exert a therapeutically useful effect in the absence of undesirable side effects
on the patient treated. The therapeutically effective concentration may be determined
empirically by testing the compounds in in vitro and in vivo systems described herein
and then extrapolated therefrom for dosages for humans.
[0115] The concentration of FTI in the pharmaceutical composition will depend on absorption,
tissue distribution, inactivation and excretion rates of the FTI, the physicochemical
characteristics of the FTI, the dosage schedule, and amount administered as well as
other factors known to those of skill in the art. For example, the amount that is
delivered is sufficient to ameliorate one or more of the symptoms of cancer, including
hematopoietic cancers and solid tumors.
[0116] In certain embodiments, a therapeutically effective dosage should produce a serum
concentration of active ingredient of from about 0.1 ng/ml to about 50-100 µg/ml.
In one embodiment, the pharmaceutical compositions provide a dosage of from about
0.001 mg to about 2000 mg of compound per kilogram of body weight per day. Pharmaceutical
dosage unit forms are prepared to provide from about 1 mg to about 1000 mg and in
certain embodiments, from about 10 to about 500 mg of the essential active ingredient
or a combination of essential ingredients per dosage unit form.
[0117] The FTI may be administered at once, or may be divided into a number of smaller doses
to be administered at intervals of time. It is understood that the precise dosage
and duration of treatment is a function of the disease being treated and may be determined
empirically using known testing protocols or by extrapolation from in vivo or in vitro
test data. It is to be noted that concentrations and dosage values may also vary with
the severity of the condition to be alleviated. It is to be further understood that
for any particular subject, specific dosage regimens should be adjusted over time
according to the individual need and the professional judgment of the person administering
or supervising the administration of the compositions, and that the concentration
ranges set forth herein are exemplary only and are not intended to limit the scope
or practice of the claimed compositions.
[0118] Thus, effective concentrations or amounts of one or more of the compounds described
herein or pharmaceutically acceptable salts thereof are mixed with a suitable pharmaceutical
carrier or vehicle for systemic, topical or local administration to form pharmaceutical
compositions. Compounds are included in an amount effective for ameliorating one or
more symptoms of, or for treating, retarding progression, or preventing. The concentration
of active compound in the composition will depend on absorption, tissue distribution,
inactivation, excretion rates of the active compound, the dosage schedule, amount
administered, particular formulation as well as other factors known to those of skill
in the art.
[0119] The compositions are intended to be administered by a suitable route, including but
not limited to orally, parenterally, rectally, topically and locally. For oral administration,
capsules and tablets can be formulated. The compositions are in liquid, semi-liquid
or solid form and are formulated in a manner suitable for each route of administration.
[0120] Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical
application can include any of the following components: a sterile diluent, such as
water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene
glycol, dimethyl acetamide or other synthetic solvent; antimicrobial agents, such
as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium
bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers,
such as acetates, citrates and phosphates; and agents for the adjustment of tonicity
such as sodium chloride or dextrose. Parenteral preparations can be enclosed in ampules,
pens, disposable syringes or single or multiple dose vials made of glass, plastic
or other suitable material.
[0121] In instances in which the FTI exhibits insufficient solubility, methods for solubilizing
compounds can be used. Such methods are known to those of skill in this art, and include,
but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using
surfactants, such as TWEEN®, or dissolution in aqueous sodium bicarbonate.
[0122] Upon mixing or addition of the compound(s), the resulting mixture may be a solution,
suspension, emulsion or the like. The form of the resulting mixture depends upon a
number of factors, including the intended mode of administration and the solubility
of the compound in the selected carrier or vehicle. The effective concentration is
sufficient for ameliorating the symptoms of the disease, disorder or condition treated
and may be empirically determined.
[0123] The pharmaceutical compositions are provided for administration to humans and animals
in unit dosage forms, such as tablets, capsules, pills, powders, granules, sterile
parenteral solutions or suspensions, and oral solutions or suspensions, and oil water
emulsions containing suitable quantities of the compounds or pharmaceutically acceptable
salts thereof. The pharmaceutically therapeutically active compounds and salts thereof
are formulated and administered in unit dosage forms or multiple dosage forms. Unit
dose forms as used herein refer to physically discrete units suitable for human and
animal subjects and packaged individually as is known in the art. Each unit dose contains
a predetermined quantity of the therapeutically active compound sufficient to produce
the desired therapeutic effect, in association with the required pharmaceutical carrier,
vehicle or diluent. Examples of unit dose forms include ampules and syringes and individually
packaged tablets or capsules. Unit dose forms may be administered in fractions or
multiples thereof. A multiple dose form is a plurality of identical unit dosage forms
packaged in a single container to be administered in segregated unit dose form. Examples
of multiple dose forms include vials, bottles of tablets or capsules or bottles of
pints or gallons. Hence, multiple dose form is a multiple of unit doses which are
not segregated in packaging.
[0124] Sustained-release preparations can also be prepared. Suitable examples of sustained-release
preparations include semipermeable matrices of solid hydrophobic polymers containing
the compound provided herein, which matrices are in the form of shaped articles, e.g.,
films, or microcapsule. Examples of sustained-release matrices include iontophoresis
patches, polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides, copolymers of L-glutamic acid and ethyl-L-glutamate,
non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers
such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic
acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While
polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins for shorter time
periods. When encapsulated compound remain in the body for a long time, they may denature
or aggregate as a result of exposure to moisture at 37 °C, resulting in a loss of
biological activity and possible changes in their structure. Rational strategies can
be devised for stabilization depending on the mechanism of action involved. For example,
if the aggregation mechanism is discovered to be intermolecular S--S bond formation
through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl
residues, lyophilizing from acidic solutions, controlling moisture content, using
appropriate additives, and developing specific polymer matrix compositions.
[0125] Dosage forms or compositions containing active ingredient in the range of 0.005%
to 100% with the balance made up from non toxic carrier may be prepared. For oral
administration, a pharmaceutically acceptable non toxic composition is formed by the
incorporation of any of the normally employed excipients, such as, for example pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives,
sodium crosscarmellose, glucose, sucrose, magnesium carbonate or sodium saccharin.
Such compositions include solutions, suspensions, tablets, capsules, powders and sustained
release formulations, such as, but not limited to, implants and microencapsulated
delivery systems, and biodegradable, biocompatible polymers, such as collagen, ethylene
vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid
and others. Methods for preparation of these compositions are known to those skilled
in the art. The contemplated compositions may contain about 0.001% 100% active ingredient,
in certain embodiments, about 0.1-85% or about 75-95%.
[0126] The FTI or pharmaceutically acceptable salts can be prepared with carriers that protect
the compound against rapid elimination from the body, such as time release formulations
or coatings.
[0127] The compositions can include other active compounds to obtain desired combinations
of properties. The compounds provided herein, or pharmaceutically acceptable salts
thereof as described herein, can also be administered together with another pharmacological
agent known in the general art to be of value in treating one or more of the diseases
or medical conditions referred to hereinabove, such as diseases related to oxidative
stress.
[0128] Lactose-free compositions provided herein can contain excipients that are well known
in the art and are listed, for example, in the U.S. Pharmocopia (USP) SP (XXI)/NF
(XVI). In general, lactose-free compositions contain an active ingredient, a binder/filler,
and a lubricant in pharmaceutically compatible and pharmaceutically acceptable amounts.
Exemplary lactose-free dosage forms contain an active ingredient, microcrystalline
cellulose, pre-gelatinized starch and magnesium stearate.
[0129] Further encompassed are anhydrous pharmaceutical compositions and dosage forms containing
a compound provided herein. For example, the addition of water (e.g., 5%) is widely
accepted in the pharmaceutical arts as a means of simulating long-term storage in
order to determine characteristics such as shelf-life or the stability of formulations
over time. See, e.g.,
Jens T. Carstensen, Drug Stability: Principles & Practice, 2d. Ed., Marcel Dekker,
NY, NY, 1995, pp. 379-80. In effect, water and heat accelerate the decomposition of some compounds. Thus,
the effect of water on a formulation can be of great significance since moisture and/or
humidity are commonly encountered during manufacture, handling, packaging, storage,
shipment and use of formulations.
[0130] Anhydrous pharmaceutical compositions and dosage forms provided herein can be prepared
using anhydrous or low moisture containing ingredients and low moisture or low humidity
conditions. Pharmaceutical compositions and dosage forms that comprise lactose and
at least one active ingredient that comprises a primary or secondary amine are anhydrous
if substantial contact with moisture and/or humidity during manufacturing, packaging,
and/or storage is expected.
[0131] An anhydrous pharmaceutical composition should be prepared and stored such that its
anhydrous nature is maintained. Accordingly, anhydrous compositions are packaged using
materials known to prevent exposure to water such that they can be included in suitable
formulary kits. Examples of suitable packaging include, but are not limited to, hermetically
sealed foils, plastics, unit dose containers (e.g., vials), blister packs and strip
packs.
[0132] Oral pharmaceutical dosage forms are either solid, gel or liquid. The solid dosage
forms are tablets, capsules, granules, and bulk powders. Types of oral tablets include
compressed, chewable lozenges and tablets which may be enteric coated, sugar coated
or film coated. Capsules may be hard or soft gelatin capsules, while granules and
powders may be provided in non effervescent or effervescent form with the combination
of other ingredients known to those skilled in the art.
[0133] In certain embodiments, the formulations are solid dosage forms, such as capsules
or tablets. The tablets, pills, capsules, troches and the like can contain any of
the following ingredients, or compounds of a similar nature: a binder; a diluent;
a disintegrating agent; a lubricant; a glidant; a sweetening agent; and a flavoring
agent.
[0134] Examples of binders include microcrystalline cellulose, gum tragacanth, glucose solution,
acacia mucilage, gelatin solution, sucrose and starch paste. Lubricants include talc,
starch, magnesium or calcium stearate, lycopodium and stearic acid. Diluents include,
for example, lactose, sucrose, starch, kaolin, salt, mannitol and dicalcium phosphate.
Glidants include, but are not limited to, colloidal silicon dioxide. Disintegrating
agents include crosscarmellose sodium, sodium starch glycolate, alginic acid, corn
starch, potato starch, bentonite, methylcellulose, agar and carboxymethylcellulose.
Coloring agents include, for example, any of the approved certified water soluble
FD and C dyes, mixtures thereof; and water insoluble FD and C dyes suspended on alumina
hydrate. Sweetening agents include sucrose, lactose, mannitol and artificial sweetening
agents such as saccharin, and any number of spray dried flavors. Flavoring agents
include natural flavors extracted from plants such as fruits and synthetic blends
of compounds which produce a pleasant sensation, such as, but not limited to peppermint
and methyl salicylate. Wetting agents include propylene glycol monostearate, sorbitan
monooleate, diethylene glycol monolaurate and polyoxyethylene laural ether. Emetic
coatings include fatty acids, fats, waxes, shellac, ammoniated shellac and cellulose
acetate phthalates. Film coatings include hydroxyethylcellulose, sodium carboxymethylcellulose,
polyethylene glycol 4000 and cellulose acetate phthalate.
[0135] When the dosage unit form is a capsule, it can contain, in addition to material of
the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms
can contain various other materials which modify the physical form of the dosage unit,
for example, coatings of sugar and other enteric agents. The compounds can also be
administered as a component of an elixir, suspension, syrup, wafer, sprinkle, chewing
gum or the like. A syrup may contain, in addition to the active compounds, sucrose
as a sweetening agent and certain preservatives, dyes and colorings and flavors.
[0136] Pharmaceutically acceptable carriers included in tablets are binders, lubricants,
diluents, disintegrating agents, coloring agents, flavoring agents, and wetting agents.
Enteric coated tablets, because of the enteric coating, resist the action of stomach
acid and dissolve or disintegrate in the neutral or alkaline intestines. Sugar coated
tablets are compressed tablets to which different layers of pharmaceutically acceptable
substances are applied. Film coated tablets are compressed tablets which have been
coated with a polymer or other suitable coating. Multiple compressed tablets are compressed
tablets made by more than one compression cycle utilizing the pharmaceutically acceptable
substances previously mentioned. Coloring agents may also be used in the above dosage
forms. Flavoring and sweetening agents are used in compressed tablets, sugar coated,
multiple compressed and chewable tablets. Flavoring and sweetening agents are especially
useful in the formation of chewable tablets and lozenges.
[0137] Liquid oral dosage forms include aqueous solutions, emulsions, suspensions, solutions
and/or suspensions reconstituted from non effervescent granules and effervescent preparations
reconstituted from effervescent granules. Aqueous solutions include, for example,
elixirs and syrups. Emulsions are either oil in-water or water in oil.
[0138] Elixirs are clear, sweetened, hydroalcoholic preparations. Pharmaceutically acceptable
carriers used in elixirs include solvents. Syrups are concentrated aqueous solutions
of a sugar, for example, sucrose, and may contain a preservative. An emulsion is a
two phase system in which one liquid is dispersed in the form of small globules throughout
another liquid. Pharmaceutically acceptable carriers used in emulsions are non aqueous
liquids, emulsifying agents and preservatives. Suspensions use pharmaceutically acceptable
suspending agents and preservatives. Pharmaceutically acceptable substances used in
non effervescent granules, to be reconstituted into a liquid oral dosage form, include
diluents, sweeteners and wetting agents. Pharmaceutically acceptable substances used
in effervescent granules, to be reconstituted into a liquid oral dosage form, include
organic acids and a source of carbon dioxide. Coloring and flavoring agents are used
in all of the above dosage forms.
[0139] Solvents include glycerin, sorbitol, ethyl alcohol and syrup. Examples of preservatives
include glycerin, methyl and propylparaben, benzoic add, sodium benzoate and alcohol.
Examples of non aqueous liquids utilized in emulsions include mineral oil and cottonseed
oil. Examples of emulsifying agents include gelatin, acacia, tragacanth, bentonite,
and surfactants such as polyoxyethylene sorbitan monooleate. Suspending agents include
sodium carboxymethylcellulose, pectin, tragacanth, Veegum and acacia. Diluents include
lactose and sucrose. Sweetening agents include sucrose, syrups, glycerin and artificial
sweetening agents such as saccharin. Wetting agents include propylene glycol monostearate,
sorbitan monooleate, diethylene glycol monolaurate and polyoxyethylene lauryl ether.
Organic adds include citric and tartaric acid. Sources of carbon dioxide include sodium
bicarbonate and sodium carbonate. Coloring agents include any of the approved certified
water soluble FD and C dyes, and mixtures thereof. Flavoring agents include natural
flavors extracted from plants such fruits, and synthetic blends of compounds which
produce a pleasant taste sensation.
[0140] For a solid dosage form, the solution or suspension, in for example propylene carbonate,
vegetable oils or triglycerides, is encapsulated in a gelatin capsule. Such solutions,
and the preparation and encapsulation thereof, are disclosed in
U.S. Patent Nos 4,328,245;
4,409,239; and
4,410,545. For a liquid dosage form, the solution, e.g., for example, in a polyethylene glycol,
may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid
carrier, e.g., water, to be easily measured for administration.
[0141] Alternatively, liquid or semi solid oral formulations may be prepared by dissolving
or dispersing the active compound or salt in vegetable oils, glycols, triglycerides,
propylene glycol esters (e.g., propylene carbonate) and other such carriers, and encapsulating
these solutions or suspensions in hard or soft gelatin capsule shells. Other useful
formulations include, but are not limited to, those containing a compound provided
herein, a dialkylated mono- or poly-alkylene glycol, including, but not limited to,
1,2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl
ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether
wherein 350, 550 and 750 refer to the approximate average molecular weight of the
polyethylene glycol, and one or more antioxidants, such as butylated hydroxytoluene
(BHT), butylated hydroxyanisole (BHA), propyl gallate, vitamin E, hydroquinone, hydroxycoumarins,
ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric
acid, thiodipropionic acid and its esters, and dithiocarbamates.
[0142] Other formulations include, but are not limited to, aqueous alcoholic solutions including
a pharmaceutically acceptable acetal. Alcohols used in these formulations are any
pharmaceutically acceptable water-miscible solvents having one or more hydroxyl groups,
including, but not limited to, propylene glycol and ethanol. Acetals include, but
are not limited to, di(lower alkyl) acetals of lower alkyl aldehydes such as acetaldehyde
diethyl acetal.
[0143] In all embodiments, tablets and capsules formulations may be coated as known by those
of skill in the art in order to modify or sustain dissolution of the active ingredient.
Thus, for example, they may be coated with a conventional enterically digestible coating,
such as phenylsalicylate, waxes and cellulose acetate phthalate.
[0144] Parenteral administration, generally characterized by injection, either subcutaneously,
intramuscularly or intravenously is also provided herein. Injectables can be prepared
in conventional forms, either as liquid solutions or suspensions, solid forms suitable
for solution or suspension in liquid prior to injection, or as emulsions. Suitable
excipients are, for example, water, saline, dextrose, glycerol or ethanol. In addition,
if desired, the pharmaceutical compositions to be administered may also contain minor
amounts of non toxic auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, stabilizers, solubility enhancers, and other such agents, such as
for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate and cyclodextrins.
Implantation of a slow release or sustained release system, such that a constant level
of dosage is maintained is also contemplated herein. Briefly, a compound provided
herein is dispersed in a solid inner matrix, e.g., polymethylmethacrylate, polybutylmethacrylate,
plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethyleneterephthalate,
natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinylacetate
copolymers, silicone rubbers, polydimethylsiloxanes, silicone carbonate copolymers,
hydrophilic polymers such as hydrogels of esters of acrylic and methacrylic acid,
collagen, cross-linked polyvinylalcohol and cross-linked partially hydrolyzed polyvinyl
acetate, that is surrounded by an outer polymeric membrane, e.g., polyethylene, polypropylene,
ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinylacetate
copolymers, silicone rubbers, polydimethyl siloxanes, neoprene rubber, chlorinated
polyethylene, polyvinylchloride, vinylchloride copolymers with vinyl acetate, vinylidene
chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber
epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl
alcohol terpolymer, and ethylene/vinyloxyethanol copolymer, that is insoluble in body
fluids. The compound diffuses through the outer polymeric membrane in a release rate
controlling step. The percentage of active compound contained in such parenteral compositions
is highly dependent on the specific nature thereof, as well as the activity of the
compound and the needs of the subject.
[0145] Parenteral administration of the compositions includes intravenous, subcutaneous
and intramuscular administrations. Preparations for parenteral administration include
sterile solutions ready for injection, sterile dry soluble products, such as lyophilized
powders, ready to be combined with a solvent just prior to use, including hypodermic
tablets, sterile suspensions ready for injection, sterile dry insoluble products ready
to be combined with a vehicle just prior to use and sterile emulsions. The solutions
may be either aqueous or nonaqueous.
[0146] If administered intravenously, suitable carriers include physiological saline or
phosphate buffered saline (PBS), and solutions containing thickening and solubilizing
agents, such as glucose, polyethylene glycol, and polypropylene glycol and mixtures
thereof.
[0147] Pharmaceutically acceptable carriers used in parenteral preparations include aqueous
vehicles, nonaqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants,
local anesthetics, suspending and dispersing agents, emulsifying agents, sequestering
or chelating agents and other pharmaceutically acceptable substances.
[0148] Examples of aqueous vehicles include Sodium Chloride Injection, Ringers Injection,
Isotonic Dextrose Injection, Sterile Water Injection, Dextrose and Lactated Ringers
Injection. Nonaqueous parenteral vehicles include fixed oils of vegetable origin,
cottonseed oil, corn oil, sesame oil and peanut oil. Antimicrobial agents in bacteriostatic
or fungistatic concentrations must be added to parenteral preparations packaged in
multiple dose containers which include phenols or cresols, mercurials, benzyl alcohol,
chlorobutanol, methyl and propyl p hydroxybenzoic acid esters, thimerosal, benzalkonium
chloride and benzethonium chloride. Isotonic agents include sodium chloride and dextrose.
Buffers include phosphate and citrate. Antioxidants include sodium bisulfate. Local
anesthetics include procaine hydrochloride. Suspending and dispersing agents include
sodium carboxymethylcelluose, hydroxypropyl methylcellulose and polyvinylpyrrolidone.
Emulsifying agents include Polysorbate 80 (TWEEN® 80). A sequestering or chelating
agent of metal ions include EDTA. Pharmaceutical carriers also include ethyl alcohol,
polyethylene glycol and propylene glycol for water miscible vehicles and sodium hydroxide,
hydrochloric acid, citric acid or lactic acid for pH adjustment.
[0149] The concentration of the FTI is adjusted so that an injection provides an effective
amount to produce the desired pharmacological effect. The exact dose depends on the
age, weight and condition of the patient or animal as is known in the art. The unit
dose parenteral preparations are packaged in an ampule, a vial or a syringe with a
needle. All preparations for parenteral administration must be sterile, as is known
and practiced in the art.
[0150] Illustratively, intravenous or intraarterial infusion of a sterile aqueous solution
containing an FTI is an effective mode of administration. Another embodiment is a
sterile aqueous or oily solution or suspension containing an active material injected
as necessary to produce the desired pharmacological effect.
[0151] Injectables are designed for local and systemic administration. Typically a therapeutically
effective dosage is formulated to contain a concentration of at least about 0.1% w/w
up to about 90% w/w or more, such as more than 1% w/w of the active compound to the
treated tissue(s). The active ingredient may be administered at once, or may be divided
into a number of smaller doses to be administered at intervals of time. It is understood
that the precise dosage and duration of treatment is a function of the tissue being
treated and may be determined empirically using known testing protocols or by extrapolation
from in vivo or in vitro test data. It is to be noted that concentrations and dosage
values may also vary with the age of the individual treated. It is to be further understood
that for any particular subject, specific dosage regimens should be adjusted over
time according to the individual need and the professional judgment of the person
administering or supervising the administration of the formulations, and that the
concentration ranges set forth herein are exemplary only and are not intended to limit
the scope or practice of the claimed formulations.
[0152] The FTI can be suspended in micronized or other suitable form or may be derivatized
to produce a more soluble active product or to produce a prodrug. The form of the
resulting mixture depends upon a number of factors, including the intended mode of
administration and the solubility of the compound in the selected carrier or vehicle.
The effective concentration is sufficient for ameliorating the symptoms of the condition
and may be empirically determined.
[0153] Of interest herein are also lyophilized powders, which can be reconstituted for administration
as solutions, emulsions and other mixtures. They can also be reconstituted and formulated
as solids or gels.
[0154] The sterile, lyophilized powder is prepared by dissolving an FTI provided herein,
or a pharmaceutically acceptable salt thereof, in a suitable solvent. The solvent
may contain an excipient which improves the stability or other pharmacological component
of the powder or reconstituted solution, prepared from the powder. Excipients that
may be used include, but are not limited to, dextrose, sorbital, fructose, corn syrup,
xylitol, glycerin, glucose, sucrose or other suitable agent. The solvent may also
contain a buffer, such as citrate, sodium or potassium phosphate or other such buffer
known to those of skill in the art at, in one embodiment, about neutral pH. Subsequent
sterile filtration of the solution followed by lyophilization under standard conditions
known to those of skill in the art provides the desired formulation. Generally, the
resulting solution will be apportioned into vials for lyophilization. Each vial will
contain a single dosage (including but not limited to 10-1000 mg or 100-500 mg) or
multiple dosages of the compound. The lyophilized powder can be stored under appropriate
conditions, such as at about 4 °C to room temperature.
[0155] Reconstitution of this lyophilized powder with water for injection provides a formulation
for use in parenteral administration. For reconstitution, about 1-50 mg, about 5-35
mg, or about 9-30 mg of lyophilized powder, is added per mL of sterile water or other
suitable carrier. The precise amount depends upon the selected compound. Such amount
can be empirically determined.
[0156] Topical mixtures are prepared as described for the local and systemic administration.
The resulting mixture may be a solution, suspension, emulsion or the like and are
formulated as creams, gels, ointments, emulsions, solutions, elixirs, lotions, suspensions,
tinctures, pastes, foams, aerosols, irrigations, sprays, suppositories, bandages,
dermal patches or any other formulations suitable for topical administration.
[0157] The FTI or pharmaceutical composition having an FTI can be formulated as aerosols
for topical application, such as by inhalation (see, e.g.,
U.S. Patent Nos. 4,044,126,
4,414,209, and
4,364,923, which describe aerosols for delivery of a steroid useful for treatment of inflammatory
diseases, particularly asthma). These formulations for administration to the respiratory
tract can be in the form of an aerosol or solution for a nebulizer, or as a microfine
powder for insufflation, alone or in combination with an inert carrier such as lactose.
In such a case, the particles of the formulation will have diameters of less than
50 microns or less than 10 microns.
[0158] The FTI or pharmaceutical composition having an FTI can be formulated for local or
topical application, such as for topical application to the skin and mucous membranes,
such as in the eye, in the form of gels, creams, and lotions and for application to
the eye or for intracisternal or intraspinal application. Topical administration is
contemplated for transdermal delivery and also for administration to the eyes or mucosa,
or for inhalation therapies. Nasal solutions of the active compound alone or in combination
with other pharmaceutically acceptable excipients can also be administered. These
solutions, particularly those intended for ophthalmic use, may be formulated as 0.01%
- 10% isotonic solutions, pH about 5-7, with appropriate salts.
[0159] Other routes of administration, such as transdermal patches, and rectal administration
are also contemplated herein. For example, pharmaceutical dosage forms for rectal
administration are rectal suppositories, capsules and tablets for systemic effect.
Rectal suppositories are used herein mean solid bodies for insertion into the rectum
which melt or soften at body temperature releasing one or more pharmacologically or
therapeutically active ingredients. Pharmaceutically acceptable substances utilized
in rectal suppositories are bases or vehicles and agents to raise the melting point.
Examples of bases include cocoa butter (theobroma oil), glycerin gelatin, carbowax
(polyoxyethylene glycol) and appropriate mixtures of mono, di and triglycerides of
fatty acids. Combinations of the various bases may be used. Agents to raise the melting
point of suppositories include spermaceti and wax. Rectal suppositories may be prepared
either by the compressed method or by molding. An exemplary weight of a rectal suppository
is about 2 to 3 grams. Tablets and capsules for rectal administration are manufactured
using the same pharmaceutically acceptable substance and by the same methods as for
formulations for oral administration.
[0160] The FTI or pharmaceutical composition having an FTI provided herein can be administered
by controlled release means or by delivery devices that are well known to those of
ordinary skill in the art. Examples include, but are not limited to, those described
in
U.S. Patent Nos.: 3,845,770;
3,916,899;
3,536,809;
3,598,123; and
4,008,719,
5,674,533,
5,059,595,
5,591,767,
5,120,548,
5,073,543,
5,639,476,
5,354,556,
5,639,480,
5,733,566,
5,739,108,
5,891,474,
5,922,356,
5,972,891,
5,980,945,
5,993,855,
6,045,830,
6,087,324,
6,113,943,
6,197,350,
6,248,363,
6,264,970,
6,267,981,
6,376,461,
6,419,961,
6,589,548,
6,613,358,
6,699,500 and
6,740,634. Such dosage forms can be used to provide slow or controlled-release of FTI using,
for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable
membranes, osmotic systems, multilayer coatings, microparticles, liposomes, microspheres,
or a combination thereof to provide the desired release profile in varying proportions.
Suitable controlled-release formulations known to those of ordinary skill in the art,
including those described herein, can be readily selected for use with the active
ingredients provided herein.
[0161] All controlled-release pharmaceutical products have a common goal of improving drug
therapy over that achieved by their non-controlled counterparts. In one embodiment,
the use of an optimally designed controlled-release preparation in medical treatment
is characterized by a minimum of drug substance being employed to cure or control
the condition in a minimum amount of time. In certain embodiments, advantages of controlled-release
formulations include extended activity of the drug, reduced dosage frequency, and
increased patient compliance. In addition, controlled-release formulations can be
used to affect the time of onset of action or other characteristics, such as blood
levels of the drug, and can thus affect the occurrence of side (e.g., adverse) effects.
[0162] Most controlled-release formulations are designed to initially release an amount
of drug (active ingredient) that promptly produces the desired therapeutic effect,
and gradually and continually release of other amounts of drug to maintain this level
of therapeutic effect over an extended period of time. In order to maintain this constant
level of drug in the body, the drug must be released from the dosage form at a rate
that will replace the amount of drug being metabolized and excreted from the body.
Controlled-release of an active ingredient can be stimulated by various conditions
including, but not limited to, pH, temperature, enzymes, water, or other physiological
conditions or compounds.
[0163] An FTI can be administered using intravenous infusion, an implantable osmotic pump,
a transdermal patch, liposomes, or other modes of administration. In one embodiment,
a pump may be used (see,
Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987);
Buchwald et al., Surgery 88:507 (1980);
Saudek et al., N. Engl. J. Med. 321:574 (1989). In another embodiment, polymeric materials can be used. In yet another embodiment,
a controlled release system can be placed in proximity of the therapeutic target,
i.e., thus requiring only a fraction of the systemic dose (see, e.g.,
Goodson, Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984).
[0164] In some embodiments, a controlled release device is introduced into a subject in
proximity of the site of inappropriate immune activation or a tumor. Other controlled
release systems are discussed in the review by
Langer (Science 249:1527-1533 (1990). The F can be dispersed in a solid inner matrix, e.g., polymethylmethacrylate, polybutylmethacrylate,
plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethyleneterephthalate,
natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinylacetate
copolymers, silicone rubbers, polydimethylsiloxanes, silicone carbonate copolymers,
hydrophilic polymers such as hydrogels of esters of acrylic and methacrylic acid,
collagen, cross-linked polyvinylalcohol and cross-linked partially hydrolyzed polyvinyl
acetate, that is surrounded by an outer polymeric membrane, e.g., polyethylene, polypropylene,
ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinylacetate
copolymers, silicone rubbers, polydimethyl siloxanes, neoprene rubber, chlorinated
polyethylene, polyvinylchloride, vinylchloride copolymers with vinyl acetate, vinylidene
chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber
epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl
alcohol terpolymer, and ethylene/vinyloxyethanol copolymer, that is insoluble in body
fluids. The active ingredient then diffuses through the outer polymeric membrane in
a release rate controlling step. The percentage of active ingredient contained in
such parenteral compositions is highly dependent on the specific nature thereof, as
well as the needs of the subject.
[0165] The FTI or pharmaceutical composition of FTI can be packaged as articles of manufacture
containing packaging material, a compound or pharmaceutically acceptable salt thereof
provided herein, which is used for treatment, prevention or amelioration of one or
more symptoms or progression of cancer, including hematological cancers and solid
tumors, and a label that indicates that the compound or pharmaceutically acceptable
salt thereof is used for treatment, prevention or amelioration of one or more symptoms
or progression of cancer, including hematological cancers and solid tumors.
[0166] The articles of manufacture disclosed herein contain packaging materials. Packaging
materials for use in packaging pharmaceutical products are well known to those of
skill in the art. See, e.g.,
U.S. Patent Nos. 5,323,907,
5,052,558 and
5,033,252. Examples of pharmaceutical packaging materials include, but are not limited to,
blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes,
pens, bottles, and any packaging material suitable for a selected formulation and
intended mode of administration and treatment. A wide array of formulations of the
compounds and compositions provided herein are.
2.3. Dosages
[0167] A therapeutically effective amount of the pharmaceutical composition having an FTI
is administered orally or parenterally. In some embodiments, the pharmaceutical composition
having tipifarnib as the active ingredient and is administered orally in an amount
of from 1 up to 1500 mg/kg daily, either as a single dose or subdivided into more
than one dose, or more particularly in an amount of from 10 to 1200 mg/kg daily. In
some embodiments, the pharmaceutical composition having tipifarnib as the active ingredient
and is administered orally in an amount of 100 mg/kg daily, 200 mg/kg daily, 300 mg/kg
daily, 400 mg/kg daily, 500 mg/kg daily, 600 mg/kg daily, 700 mg/kg daily, 800 mg/kg
daily, 900 mg/kg daily, 1000 mg/kg daily, 1100 mg/kg daily, or 1200 mg/kg daily. In
some embodiments, the FTI is tipifarnib.
[0168] According to the invention, the FTI is tipifarnib. In some embodiments, the FTI is
administered at a dose of 200-1500 mg daily. In some embodiments, the FTI is administered
at a dose of 200-1200 mg daily. In some embodiments, the FTI is administered at a
dose of 200 mg daily. In some embodiments, the FTI is administered at a dose of 300
mg daily. In some embodiments, the FTI is administered at a dose of 400 mg daily.
In some embodiments, the FTI is administered at a dose of 500 mg daily. In some embodiments,
the FTI is administered at a dose of 600 mg daily. In some embodiments, the FTI is
administered at a dose of 700 mg daily. In some embodiments, the FTI is administered
at a dose of 800 mg daily. In some embodiments, the FTI is administered at a dose
of 900 mg daily. In some embodiments, the FTI is administered at a dose of 1000 mg
daily. In some embodiments, the FTI is administered at a dose of 1100 mg daily. In
some embodiments, the FTI is administered at a dose of 1200 mg daily. In some embodiments,
the FTI is administered at a dose of 1300 mg daily. In some embodiments, the FTI is
administered at a dose of 1400 mg daily.
[0169] According to the invention, the FTI is tipifarnib. In some embodiments, the FTI is
administered at a dose of 200-1400 mg b.i.d. (
i.e., twice a day). In some embodiments, the FTI is administered at a dose of 300-1200
mg b.i.d. In some embodiments, the FTI is administered at a dose of 300-900 mg b.i.d.
In some embodiments, the FTI is administered at a dose of 600 mg b.i.d. In some embodiments,
the FTI is administered at a dose of 700 mg b.i.d. In some embodiments, the FTI is
administered at a dose of 800 mg b.i.d. In some embodiments, the FTI is administered
at a dose of 900 mg b.i.d. In some embodiments, the FTI is administered at a dose
of 1000 mg b.i.d. In some embodiments, the FTI is administered at a dose of 1100 mg
b.i.d. In some embodiments, the FTI is administered at a dose of 1200 mg b.i.d.
[0170] According to the invention, the FTI is tipifarnib. As a person of ordinary skill
in the art would understand, the dosage varies depending on the dosage form employed,
condition and sensitivity of the patient, the route of administration, and other factors.
The exact dosage will be determined by the practitioner, in light of factors related
to the subject that requires treatment. Dosage and administration are adjusted to
provide sufficient levels of the active ingredient or to maintain the desired effect.
Factors which can be taken into account include the severity of the disease state,
general health of the subject, age, weight, and gender of the subject, diet, time
and frequency of administration, drug combination(s), reaction sensitivities, and
tolerance/response to therapy. During a treatment cycle, the daily dose could be varied.
In some embodiments, a starting dosage can be titrated down within a treatment cycle.
In some embodiments, a starting dosage can be titrated up within a treatment cycle.
The final dosage can depend on the occurrence of dose limiting toxicity and other
factors. In some embodiments, the FTI is administered at a starting dose of 300 mg
daily and escalated to a maximum dose of 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900
mg, 1000 mg, 1100 mg, or 1200 mg daily. In some embodiments, the FTI is administered
at a starting dose of 400 mg daily and escalated to a maximum dose of 500 mg, 600
mg, 700 mg, 800 mg, 900 mg, 1000 mg, 1100 mg, or 1200 mg daily. In some embodiments,
the FTI is administered at a starting dose of 500 mg daily and escalated to a maximum
dose of 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg, 1100 mg, or 1200 mg daily. In some
embodiments, the FTI is administered at a starting dose of 600 mg daily and escalated
to a maximum dose of 700 mg, 800 mg, 900 mg, 1000 mg, 1100 mg, or 1200 mg daily. In
some embodiments, the FTI is administered at a starting dose of 700 mg daily and escalated
to a maximum dose of 800 mg, 900 mg, 1000 mg, 1100 mg, or 1200 mg daily. In some embodiments,
the FTI is administered at a starting dose of 800 mg daily and escalated to a maximum
dose of 900 mg, 1000 mg, 1100 mg, or 1200 mg daily. In some embodiments, the FTI is
administered at a starting dose of 900 mg daily and escalated to a maximum dose of
1000 mg, 1100 mg, or 1200 mg daily. The dose escalation can be done at once, or step
wise. For example, a starting dose at 600 mg daily can be escalated to a final dose
of 1000 mg daily by increasing by 100 mg per day over the course of 4 days, or by
increasing by 200 mg per day over the course of 2 days, or by increasing by 400 mg
at once.
[0171] In some embodiments, the FTI is administered at a relatively high starting dose and
titrated down to a lower dose depending on the patient response and other factors.
In some embodiments, the FTI is administered at a starting dose of 1200 mg daily and
reduced to a final dose of 1100 mg, 1000 mg, 900 mg, 800 mg, 700mg, 600mg, 500 mg,
400 mg, or 300 mg daily. In some embodiments, the FTI is administered at a starting
dose of 1100 mg daily and reduced to a final dose of 1000 mg, 900 mg, 800 mg, 700mg,
600mg, 500 mg, 400 mg, or 300 mg daily. In some embodiments, the FTI is administered
at a starting dose of 1000 mg daily and reduced to a final dose of 900 mg, 800 mg,
700mg, 600mg, 500 mg, 400 mg, or 300 mg daily. In some embodiments, the FTI is administered
at a starting dose of 900 mg daily and reduced to a final dose of 800 mg, 700mg, 600mg,
500 mg, 400 mg, or 300 mg daily. In some embodiments, the FTI is administered at a
starting dose of 800 mg daily and reduced to a final dose of 700mg, 600mg, 500 mg,
400 mg, or 300 mg daily. In some embodiments, the FTI is administered at a starting
dose of 600 mg daily and reduced to a final dose of 500 mg, 400 mg, or 300 mg daily.
The dose reduction can be done at once, or step wise. In some embodiments, the FTI
is tipifarnib. For example, a starting dose at 900 mg daily can be reduced to a final
dose of 600 mg daily by decreasing by 100 mg per day over the course of 3 days, or
by decreasing by 300 mg at once.
[0172] A treatment cycle can have different length. In some embodiments, a treatment cycle
can be one week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 3
months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11
months, or 12 months. In some embodiments, a treatment cycle is 4 weeks. A treatment
cycle can have intermittent schedule. In some embodiments, a 2-week treatment cycle
can have 5-day dosing followed by 9-day rest. In some embodiments, a 2-week treatment
cycle can have 6-day dosing followed by 8-day rest. In some embodiments, a 2-week
treatment cycle can have 7-day dosing followed by 7-day rest. In some embodiments,
a 2-week treatment cycle can have 8-day dosing followed by 6-day rest. In some embodiments,
a 2-week treatment cycle can have 9-day dosing followed by 5-day rest.
[0173] In some embodiments, the FTI is administered daily for 3 of out of 4 weeks in repeated
4 week cycles. In some embodiments, the FTI is administered daily in alternate weeks
(one week on, one week off) in repeated 4 week cycles. In some embodiments, the FTI
is administered at a dose of 300 mg b.i.d. orally for 3 of out of 4 weeks in repeated
4 week cycles. In some embodiments, the FTI is administered at a dose of 600 mg b.i.d.
orally for 3 of out of 4 weeks in repeated 4 week cycles. In some embodiments, the
FTI is administered at a dose of 900 mg b.i.d. orally in alternate weeks (one week
on, one week off) in repeated 4 week cycles. In some embodiments, the FTI is administered
at a dose of 1200 mg b.i.d. orally in alternate weeks (days 1-7 and 15-21 of repeated
28-day cycles). In some embodiments, the FTI is administered at a dose of 1200 mg
b.i.d. orally for days 1-5 and 15-19 out of repeated 28-day cycles.
[0174] In some embodiments, a 900 mg b.i.d. tipifarnib alternate week regimen can be used
adopted. Under the regimen, patients receive a starting dose of 900 mg, po, b.i.d.
on days 1-7 and 15-21 of 28-day treatment cycles. In some embodiments, patients receive
two treatment cycles. In some embodiments, patients receive three treatment cycles.
In some embodiments, patients receive four treatment cycles. In some embodiments,
patients receive five treatment cycles. In some embodiments, patients receive six
treatment cycles. In some embodiments, patients receive seven treatment cycles. In
some embodiments, patients receive eight treatment cycles. In some embodiments, patients
receive nine treatment cycles. In some embodiments, patients receive ten treatment
cycles. In some embodiments, patients receive eleven treatment cycles. In some embodiments,
patients receive twelve treatment cycles. In some embodiments, patients receive more
than twelve treatment cycles.
[0175] In the absence of unmanageable toxicities, subjects can continue to receive the tipifarnib
treatment for up to 12 months. The dose can also be increased to 1200 mg b.i.d. if
the subject is tolerating the treatment well. Stepwise 300 mg dose reductions to control
treatment-related, treatment-emergent toxicities can also be included.
[0176] In some other embodiments, tipifarnib is given orally at a dose of 300 mg b.i.d.
daily for 21 days, followed by 1 week of rest, in 28-day treatment cycles (21-day
schedule;
Cheng DT, et al., J Mol Diagn. (2015) 17(3):251-64). In some embodiments, a 5-day dosing ranging from 25 to 1300 mg b.i.d. followed
by 9-day rest is adopted (5-day schedule;
Zujewski J., J Clin Oncol., (2000) Feb;18(4):927-41). In some embodiments, a 7-day b.i.d. dosing followed by 7-day rest is adopted (7-day
schedule;
Lara PN Jr., Anticancer Drugs., (2005) 16(3):317-21;
Kirschbaum MH, Leukemia., (2011) Oct;25(10): 1543-7). In the 7-day schedule, the patients can receive a starting dose of 300 mg b.i.d.
with 300 mg dose escalations to a maximum planned dose of 1800 mg b.i.d.. In the 7-day
schedule study, patients can also receive tipifarnib b.i.d. on days 1-7 and days 15-21
of 28-day cycles at doses up to 1600 mg b.i.d..
[0177] FTI can inhibit the growth of mammalian tumors when administered as a twice daily
dosing schedule. Administration of an FTI in a single dose daily for one to five days
can produce a marked suppression of tumor growth lasting out to at least 21 days.
In some embodiments, FTI is administered at a dosage range of 50-400 mg/kg. In some
embodiments, FTI is administered at 200 mg/kg. Dosing regimen for specific FTIs are
also well known in the art >(
e.g., U.S. Patent No. 6838467). For example, suitable dosages for the compounds Arglabin (
WO98/28303), perrilyl alcohol (
WO 99/45712), SCH-66336 (
U.S. Pat. No. 5,874,442), L778123 (
WO 00/01691), 2(S)-[2(S)-[2(R)-amino-3-mercapto]propylamino-3(S)-methyl]-pentyloxy-3-phenylpropionyl-methionine
sulfone (
WO94/10138), BMS 214662 (
WO 97/30992), AZD3409; Pfizer compounds A and B (
WO 00/12499 and
WO 00/12498) are given in the aforementioned patent specifications which are known to or can
be readily determined by a person skilled in the art.
[0178] In relation to perrilyl alcohol, the medicament may be administered 1-4g per day
per 150 lb human patient. Preferably, 1-2 g per day per 150 lb human patient. SCH-66336
typically can be administered in a unit dose of about 0.1 mg to 100 mg, more preferably
from about 1 mg to 300 mg according to the particular application. Compounds L778123
and 1-(3-chlorophenyl)-4-[1-(4-cyanobenzyl)-5-imidazolylmethyl]-2-piperazinone may
be administered to a human patient in an amount between about 0.1 mg/kg of body weight
to about 20 mg/kg of body weight per day, preferably between 0.5 mg/kg of bodyweight
to about 10 mg/kg of body weight per day.
[0179] Pfizer compounds A and B may be administered in dosages ranging from about 1.0 mg
up to about 500 mg per day, preferably from about 1 to about 100 mg per day in single
or divided (i.e. multiple) doses. Therapeutic compounds will ordinarily be administered
in daily dosages ranging from about 0.01 to about 10 mg per kg body weight per day,
in single or divided doses. BMS 214662 may be administered in a dosage range of about
0.05 to 200 mg/kg/day, preferably less than 100 mg/kg/day in a single dose or in 2
to 4 divided doses.
2.4. Combination therapies
[0180] FTI treatment can be administered in combination with radiotherapy, or radiation
therapy. Radiotherapy includes using γ-rays, X-rays, and/or the directed delivery
of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated,
such as microwaves, proton beam irradiation (
U.S. Patent Nos. 5,760,395 and
4,870,287), and UV-irradiation. It is most likely that all of these factors affect a broad
range of damage on DNA, on the precursors of DNA, on the replication and repair of
DNA, and on the assembly and maintenance of chromosomes.
[0181] A therapeutically effective amount of the pharmaceutical composition having an FTI
can be administered that effectively sensitizes a tumor in a host to irradiation.
(
U.S. Patent No. 6545020). Irradiation can be ionizing radiation and in particular gamma radiation. In some
embodiments, the gamma radiation is emitted by linear accelerators or by radionuclides.
The irradiation of the tumor by radionuclides can be external or internal.
[0182] Irradiation can also be X-ray radiation. Dosage ranges for X-rays range from daily
doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single
doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and
depend on the half-life of the isotope, the strength and type of radiation emitted,
and the uptake by the neoplastic cells.
[0183] In some embodiments, the administration of the pharmaceutical composition commences
up to one month, in particular up to 10 days or a week, before the irradiation of
the tumor. Additionally, irradiation of the tumor is fractionated the administration
of the pharmaceutical composition is maintained in the interval between the first
and the last irradiation session.
[0184] The amount of FTI, the dose of irradiation and the intermittence of the irradiation
doses will depend on a series of parameters such as the type of tumor, its location,
the patients' reaction to chemo- or radiotherapy and ultimately is for the physician
and radiologists to determine in each individual case.
[0185] In some embodiments, the methods provided herein further include administering a
therapeutically effective amount of a second active agent or a support care therapy.
The second active agent can be a chemotherapeutic agent. A chemotherapeutic agent
or drug can be categorized by its mode of activity within a cell, for example, whether
and at what stage they affect the cell cycle. Alternatively, an agent can be characterized
based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce
chromosomal and mitotic aberrations by affecting nucleic acid synthesis.
[0186] Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and
cyclosphosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan;
aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines
and methylamelamines, including altretamine, triethylenemelamine, trietylenephosphoramide,
triethiylenethiophosphoramide, and trimethylolomelamine; acetogenins (especially bullatacin
and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin;
callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic
analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin;
duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin;
pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards, such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine
oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide,
and uracil mustard; nitrosureas, such as carmustine, chlorozotocin, fotemustine, lomustine,
nimustine, and ranimnustine; antibiotics, such as the enediyne antibiotics (
e.g., calicheamicin, especially calicheamicin gammalI and calicheamicin omegaI1); dynemicin,
including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well
as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores,
aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin,
carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin,
6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin,
2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin,
marcellomycin, mitomycins, such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins,
peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin,
tubercidin, ubenimex, zinostatin, and zorubicin; anti-metabolites, such as methotrexate
and 5-fluorouracil (5-FU); folic acid analogues, such as denopterin, pteropterin,
and trimetrexate; purine analogs, such as fludarabine, 6-mercaptopurine, thiamiprine,
and thioguanine; pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine,
carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine;
androgens, such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane,
and testolactone; anti-adrenals, such as mitotane and trilostane; folic acid replenisher,
such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid;
eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine;
diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate;
hydroxyurea; lentinan; lonidainine; maytansinoids, such as maytansine and ansamitocins;
mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin;
losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSKpolysaccharide
complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone;
2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A,
roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol;
mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; taxoids,
e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum
coordination complexes, such as cisplatin, oxaliplatin, and carboplatin; vinblastine;
platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone;
teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (
e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids,
such as retinoic acid; capecitabine; carboplatin, procarbazine,plicomycin, gemcitabine,
navelbine, transplatinum, and pharmaceutically acceptable salts, acids, or derivatives
of any of the above.
[0187] The second active agents can be large molecules
(e.g., proteins) or small molecules
(e.g., synthetic inorganic, organometallic, or organic molecules). In some embodiments,
the second active agent is a DNA-hypomethylating agent, a therapeutic antibody that
specifically binds to a cancer antigen, a hematopoietic growth factor, cytokine, anti-cancer
agent, antibiotic, cox-2 inhibitor, immunomodulatory agent, anti-thymocyte globulin,
immunosuppressive agent, corticosteroid or a pharmacologically active mutant or derivative
thereof.
[0188] In some embodiments, the second active agent is a DNA hypomethylating agent, such
as a cytidine analog (
e.g., azacitidine) or a 5-azadeoxycytidine (
e.g. decitabine). In some embodiments, the second active agent is a cytoreductive agent,
including but not limited to Induction, Topotecan, Hydrea, PO Etoposide, Lenalidomide,
LDAC, and Thioguanine. In some embodiments, the second active agent is Mitoxantrone,
Etoposide, Cytarabine, or Valspodar. In some embodiment, the second active agent is
Mitoxantrone plus Valspodar, Etoposide plus Valspodar, or Cytarabine plus Valspodar.
In some embodiment, the second active agent is idarubicin, fludarabine, topotecan,
or ara-C. In some other embodiments, the second active agent is idarubicin plus ara-C,
fludarabine plus ara-C, mitoxantrone plus ara-C, or topotecan plus ara-C. In some
embodiments, the second active agent is a quinine. Other combinations of the agents
specified above can be used, and the dosages can be determined by the physician.
[0189] For any specific cancer type described herein, treatments as described herein or
otherwise available in the art can be used in combination with the FTI treatment.
For example, drugs that can be used in combination with the FTI include belinostat
(Beleodaq®) and pralatrexate (Folotyn®), marketed by Spectrum Pharmaceuticals, romidepsin
(Istodax®), marketed by Celgene, and brentuximab vedotin (Adcetris®) (for ALCL), marketed
by Seattle Genetics; drugs that can be used in combination with the FTI include azacytidine
(Vidaza®) and lenalidomide (Revlimid®), marketed by Celgene, and decitabine (Dacogen®)
marketed by Otsuka and Johnson & Johnson; drugs that can be used in combination with
the FTI for thyroid cancer include AstraZeneca's vandetanib (Caprelsa®), Bayer's sorafenib
(Nexavar®), Exelixis' cabozantinib (Cometriq®) and Eisai's lenvatinib (Lenvima®).
[0190] Non-cytotoxic therapies such as tpralatrexate (Folotyn®), romidepsin (Istodax®) and
belinostat (Beleodaq®) can also be used in combination with the FTI treatment.
[0191] In some embodiments, the second active agent is an immunotherapy agent. In some embodiments,
the second active agent is anti-PD1 antibody or anti-PDL1 antibody.
[0192] It is contemplated that the second active agent or second therapy used in combination
with an FTI can be administered before, at the same time, or after the FTI treatment.
The second active agent or second therapy used in combination with an FTI can be administered
before the FTI treatment. The second active agent or second therapy used in combination
with an FTI can be administered at the same time as FTI treatment. The second active
agent or second therapy used in combination with an FTI can be administered after
the FTI treatment.
[0193] The FTI treatment can also be administered in combination with a bone marrow transplant.
The FTI can be administered before the bone marrow transplant. The FTI can also be
is administered after the bone marrow transplant.
3. Immunological Genes as Biomarkers for FTI Treatment
[0194] Disclosed herein are methods of selection of cancer patients for treatment with a
farnesyltransferase inhibitor (FTI). The methods disclosed herein are based, in part,
on the discovery that the genotypes and the expression levels of certain genes that
are associated with activities of natural killer cells (NK cells) are correlated with
the clinical benefit of an FTI treatment. Specifically, the genotyping of KIR genes
and HLA genes and the expression levels of biomarkers including KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5, and GZMM can be used to predict the responsiveness of a cancer patient
to an FTI treatment. As disclosed herein, in addition to the expression levels of
the individual biomarkers, the relative ratio of expression levels between certain
biomarkers, for example, the ratio of expression level of KIR2DS2 to that of KIR2DL2,
or the ratio of expression level of KIR2DS5 to that of KIR2DL5, can also be used to
predict responsiveness of a cancer patient to an FTI treatment. Accordingly, disclosed
herein are methods for predicting responsiveness of a cancer patient to an FTI treatment,
methods for cancer patient population selection for an FTI treatment, and methods
for treating cancer in a subject with a therapeutically effective amount of an FTI,
based on the genotype or the expression levels of these biomarkers in a sample from
the patient. Also disclosed herein are compositions and kits for predicting responsiveness
of a cancer patient to an FTI treatment.
[0195] Farnesyltransferase (FTase) have crucial roles in the post-translational modifications
of Ras proteins. FTIs are a class of biologically active anticancer drugs that inhibit
farnesylation of a wide range of target proteins, including Ras. The Ras proteins
play a pivotal role in the transduction of cell growth-stimulating signals, and mutation
of the ras gene leads to constant activation of the protein, ultimately resulting
in uncontrolled cell proliferation. The high prevalence of mutated ras genes, found
in 30% of all human cancers, makes this pathway an attractive target for anticancer
drug development. A way of interfering with Ras function is the inhibition of FTase,
the enzyme coupling a 15-carbon isoprenyl group to Ras proteins, by FTIs. The FTIs
block Ras activation through inhibition of FTase, ultimately resulting in cell growth
arrest. Thus, it was predicted that FTIs would be effective therapeutic agents in
the treatment of cancer.
[0197] Early studies of tipifarnib, an FTI, were conducted in poor risk and previously untreated
AML patients (CTEP-20 phase II), and AML patients with relapsed/refractory AML (INT-17
Phase II). A phase III study of tipifarnib versus best supportive care (BSC) failed
to demonstrate improvement in overall survival. Multiple gene/proteins have been associated
in the literature with the activity of FTI (AKAP13, mDIA, etc.) (
Raponi et al. Clin Cancer Res. 13:2254-60 (2007);
Kamasani et al. Cancer Biology & Therapy, 6:1418-1423 (2007)), and analyses of gene expression profiling in bone marrow samples from 2 AML studies
(CTEP-20, INT-17) identified the ratio of the expression of 2 genes: RASGRP1 (T cell
signal transducer) and APTX (DNA repair protein) as a potential biomarker of tipifarnib's
activity in AML (
Raponi et al. Blood. 111:2589-96(2008)). However, a subsequent prospective study using the 2-gene ratio in bone marrow
blasts as inclusion criterion failed to demonstrate significant clinical benefit of
tipifarnib in AML (
Lancet et al. Blood (ASH) 120: Abstract 1508(2012)).
[0198] Disclosed herein are multiple immunological genes as biomarkers associated with better
prognosis for an FTI treatment, and novel methods are disclosed herein for patient
selection for an FTI treatment. Unlike previously identified markers, such as RASGRP1,
which was found to be associated with good prognosis in not only FTI treatment, but
also other standard chemotherapy, the immunological related biomarkers identified
in instant invention are specifically associated with clinic benefit of an FTI treatment,
but not agents of other standard chemotherapies.
[0199] The biomarkers as identified herein include KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, GZMM,
as well as the specific ligand for KIR2DS2, HLA-C2. Carriers of KIR2DS2 and HLA-C2
were shown to be predisposed to MDS. (
Serio et al., Blood (ASH Annual Meeting Abstracts) 2006 108: Abstract 2670;
Cook et al., Blood 2004; 103: 1521-152) The immunological biomarkers identified in the instant invention are all NK cell
related genes. The discovery that an FTI, such as tipifarnib, selectively targets
cancers with the specific KIR genotypes or expression profiles described herein can
be, at least in part, based on the mechanism that certain NK cells with the specific
KIR genotypes or expression profiles can induce autoimmunity. Such NK cells can also
down regulate antigen presentation, kill or down regulate certain subtypes of T cells.
Through inhibiting the KIR-RAS signaling, an FTI can modulate or inhibit the activity
of NK cells, facilitate the cytotoxity toward cancer cells by modulating the patient's
own immune system. Also, through inhibiting the KIR-RAS signaling, an FTI can modulate
or inhibit the activity of NK cells and other immune cells against normal hematological
cells and their precursors, reducing or eliminating the need for red blood cell or
platelet transfusion, or hematological growth factor administration.
3.1. KIR typing and HLA typing
[0200] As disclosed herein, the genotype of KIR genes and HLA genes of a subject can be
indicative of the likelihood of the subject to respond to an FTI treatment. A cancer
patient who is a carrier of KIR2DS2, KIR2DS5, or HLA-C2 is likely to be responsive
to an FTI treatment. Accordingly, KIR typing cancer patients, and selectively treating
those who are carriers of KIR2DS2 or KIR2DS5, can increase the overall response rate
of the cancer patients to an FTI treatment. In addition, HLA typing the cancer patients,
and selectively treating those who are carrier of HLA-C2, can further increase the
overall response rate of the cancer patients to an FTI treatment.
[0201] In some examples, disclosed herein is an FTI for use in methods for treating cancer
in a subject by administering a therapeutically effective amount of the FTI to the
subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5. In some examples,
disclosed herein is an FTI for use in a method for treating cancer in a subject by
KIR typing the subject, and administering a therapeutically effective amount of the
FTI to the subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5. In some
examples the subject is a carrier of KIR2DS2. In some examples the subject is a carrier
of KIR2DS5. In some examples the subject is a carrier of both KIR2DS2 and KIR2DS5.
In some examples the subject is also not a carrier of KIR2DL2. In some examples the
subject is also not a carrier of KIR2DL5. In some examples the subject is a carrier
of KIR2DS2, but not a carrier of KIR2DL2. In some other examples the subject is a
carrier of KIR2DS5, but not a carrier of KIR2DL5.
[0202] In some examples the methods for treating cancer in a subject as disclosed herein
further include HLA typing the subject, and administering a therapeutically effective
amount of an FTI to the subject who is a carrier of HLA-C2. In some examples the subject
is a carrier of both KIR2DS2 and HLA-C2. In some examples the subject is a carrier
of both KIR2DS5 and HLA-C2. In some examples the subject is a carrier of KIR2DS2,
KIR2DS5 and HLA-C2. In some examples the subject who is a carrier of HLA-C2 is HLA-C2/HLA-C2
homozygous. In some examples the subject is HLA-C1/HLA-C2 heterozygous.
[0203] In some examples, disclosed herein is a method for selecting a cancer patient for
an FTI treatment by KIR typing, wherein a cancer patient is selected for the FTI treatment
if the cancer patient is a carrier of KIR2DS2 or KIR2DS5. In some examples disclosed
herein is a method for predicting the likelihood of a cancer patient to be responsive
to an FTI treatment by KIR typing, and determining that the cancer patient is likely
to be responsive to an FTI treatment if the cancer patient is a carrier of KIR2DS2
or KIR2DS5. In some examples the method further includes administering a therapeutically
effective amount of an FTI to the cancer patient. In some examples the subject is
a carrier of KIR2DS2. In some examples the subject is a carrier of KIR2DS5. In some
examples the subject is a carrier of both KIR2DS2 and KIR2DS5. In some examples the
subject is also not a carrier of KIR2DL2. In some examples the subject is also not
a carrier of KIR2DL5. In some examples the subject is a carrier of KIR2DS2, but not
a carrier of KIR2DL2. In some other examples the subject is a carrier of KIR2DS5,
but not a carrier of KIR2DL5.
[0204] In some examples the methods for selecting a cancer patient for an FTI treatment
or predicting the likelihood of a cancer patient to be responsive to an FTI treatment
as disclosed herein further include HLA typing the subject, and administering a therapeutically
effective amount of an FTI to the subject who is a carrier of HLA-C2. In some examples
the subject is a carrier of both KIR2DS2 and HLA-C2. In some examples the subject
is a carrier of both KIR2DS5 and HLA-C2. In some examples the subject is a carrier
of KIR2DS2, KIR2DS5 and HLA-C2. In some examples the subject who is a carrier of HLA-C2
is HLA-C2/HLA-C2 homozygous. In some examples the subject is HLA-C1/HLA-C2 heterozygous.
[0205] Methods of KIR typing are well known in the art. Exemplary methods of KIR typing
are disclosed in
WO 2012047985;
Lebedeva et al., Hum Immun., 68(9):789-96 (2007);
Gonzalez et al., Hum Immun., 70(10):858-63 (2009);
Yun et al., Blood (ASH Annual Meeting Abstracts) 106:Abstract 1407 (2005) (Also see
Yun et al., Clin Immunol. 123(3):272-280 (2007).);
Leung et al., J Immun. 174:6540-6545 (2005);
Dinauer et al., US 2008/0280289 (See also
WO 2005/046459 selected parts; and KIR Genotyping Product Brochure 2004.);
Chen et al., WO 2009/051672. Also see
PCT/US2008/011671;
Trachtenberg et al, Patent Application Publication No. US 2008/0213787 (Also see
WO 2007/041067.);
Houtchens et al., Immunogenetics. 59(7):525-37 (2007).;
Gomez- Lozano et al., Tissue Antigens 59(3):184-193 (2002); and
Shilling et al., J Immunol. 168:2307-2315 (2002);
U.S. Pat. Nos. 6,723,564,
6,111,251,
6,104,028,
6,558,902,
6,706,530,
6,423,966,
5,777,324,
6,569,385,
6,500,621,
6,300,076, and
6,258,538;
Uhrberg et al., Immunity 7:753-763 (1997);
Gomez-Lozano et al., Tissue Antigens 59:184-193 (2002);
Cook et al., Hum. Immunology 64:567-571 (2003);
Crum et al., Tissue Antigens 56:313-326 (2000);
Middleton et al., Transplant immunology 10:147-164 (2002);
Ross et al., Nature Biotech., 16:1347-1351 (1998);
Fei et al., Rapid Comm. Mass. Spec., 14:950-959 (2000);
Fei et al., NAR 26(11):2827-2828 (1998);
Amexis et al., PNAS 98(21) 12097-12102 (2001);
Li et al., Electrophoresis 20:1258-1265 (1999);
Buetow et al., PNAS 98(2) 581-584 (2001);
Storm et al., Methods in Mol. Biol., 212:241-262 (2003);
Parham, Immunology Lett. 92:11-13 (2004); and MassARRAY™ Homogenous Mass EXTEND™ (hME) Assay, Sequenom®, Application Notes,
Bulletin #1021.
[0206] Moreover, some KIR genotyping kits available include, Inno-Train, "KIR-Ready Gene"
Product Brochure 9/2005; Miltenyi Biotec, "KIR Typing Kit" Product Brochure 2009;
Invitrogen, "KIR Genotyping SSP Kit" Product Brochure 11/2006; and Tepnel Lifecodes,
"KIR Genotyping" Product Brochure 6/2005.
[0207] The methods provided herein can be performed by any method described herein or otherwise
known in the art. In some examples, disclosed herein is an FTI for use in a method
for treating cancer in a subject with the FTI by KIR typing, or selecting a cancer
patient for an FTI treatment by KIR typing, wherein the KIR typing is performed by
sequencing, Polymerase Chain Reaction (PCR), DNA microarray, Mass Spectrometry (MS),
Single Nucleotide Polymorphism (SNP) assay, Immunoblotting assay, or Enzyme-Linked
Immunosorbent Assay (ELISA). In some examples the KIR typing is performed by DNA microarray.
In some examples the KIR typing is performed by ELISA. In some examples the KIR typing
is performed by sequencing. In some examples the KIR typing is performed by next generation
sequencing (NGS).
[0208] In some examples the KIR typing can be performed by PCR. In some examples KIR typing
can be performed by PCR using sequence specific primer (SSP). In some examples the
SSPs include those that are specific for amplifying KIR2DL2, KIR2DL5, KIR2DS2, KIR2DS5,
or any combination thereof. In some examples KIR typing can be performed by PCR using
sequence-specific oligonucleotide probe (SSOP). In some examples KIR typing can be
performed by PCR using sequence based typing (SBT). In some examples KIR typing can
be performed by DNA microarray. In some examples KIR typing can be performed by MS.
In some examples the KIR typing can be performed by matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF) mass spectrometry. As a person of ordinary skill in the
art would understand, the KIR typing can be performed by any method described herein
or otherwise known in the art.
[0209] Methods for HLA typing are well known in the art. Initially, the most extensively
employed DNA typing method for the identification of these alleles has been restriction
fragment length polymorphism (RFLP) analysis. In addition to restriction fragment
length polymorphism (PCR-RFLP), another approach has been the hybridization of PCR
amplified products with sequence-specific oligonucleotide probes (PCR-SSO) to distinguish
between HLA alleles (see,
Tiercy et al., (1990) Blood Review 4: 9-15). This method requires a PCR product of the HLA locus of interest be produced and
then dotted onto nitrocellulose membranes or strips. Then each membrane is hybridized
with a sequence specific probe, washed, and then analyzed by exposure to x-ray film
or by colorimetric assay depending on the method of detection. Similar to the PCR-SSP
methodology, probes are made to the allelic polymorphic area responsible for the different
HLA alleles. Each sample must be hybridized and probed at least 100-200 different
times for a complete Class I and II typing. Hybridization and detection methods for
PCR-SSO typing include the use of nonradioactive labeled probes, microplate formats,
etc. (see e.g.,
Saiki et al. (1989) Proc. Natl. Acad. Sci., U.S.A. 86: 6230-6234;
Erlich et al. (1991) Eur. J. Immunogenet. 18(1-2): 33-55;
Kawasaki et al. (1993) Methods Enzymol. 218:369-381).
[0210] A molecular typing method using sequence specific primer amplification (PCR-SSP)
has been described (see,
Olerup and Zetterquist (1992) Tissue Antigens 39: 225-235). This PCR-SSP method is simple, useful and fast, since the detection step is much
simpler. In PCR-SSP, allelic sequence specific primers amplify only the complementary
template allele, allowing genetic variability to be detected with a high degree of
resolution. This method allows determination of HLA type simply by whether or not
amplification products (collectively called an "amplicon") are present or absent following
PCR. In PCR-SSP, detection of the amplification products is usually done by agarose
gel electrophoresis followed by ethidium bromide (EtBr) staining of the gel.
[0211] Another HLA typing method is SSCP-Single-Stranded Conformational Polymorphism. Briefly,
single stranded PCR products of the different HLA loci are run on non-denaturing Polyacrylamide
Gel Electrophoresis (PAGE). The single strands will migrate to a unique location based
on their base pair composition. By comparison with known standards, a typing can be
deduced. It can be used to determine true homozygosity.
[0212] Other methods of HLA typing, including but not limited to sequencing, Polymerase
Chain Reaction (PCR), DNA microarray, Mass Spectrometry (MS), Single Nucleotide Polymorphism
(SNP) Assay, Immunoblotting assay, or Enzyme-Linked Immunosorbent Assay (ELISA), can
also be used in the methods provided herein. In some examples the sequencing can be
NGS. Other methods have been described in
U.S. Patent No. 6670124,
US5468611,
US8435740,
US8771951 and
U.S. 20130267613. Other different methods for HLA typing known in the art can also be used in methods
disclosed herein.
[0213] For example, Single Nucleotide Polymorphism (SNP) Assay can be used for HLA typing.
The SNP assay can type different HLA based on polymorphism at position 77 in HLA-C
and position 83 in HLA-B and -A. The SNP assay can be performed on the HT7900 from
Applied Biosystems, following the allelic discrimination assay protocol provided by
the manufacturer. Primers for the assay were designed in such a way that they amplified
all the alleles of a particular HLA type (such as HLA-C) as well as the amplicon containing
the polymorphic region of interest. Two probes were designed with a single mismatch
between them. Each probe bound only one group of alleles and was labeled with either
6FAM or VIC fluorescent dye at their 5' end. The probes also contained Taqman® minor
groove binder (MGB) with non-fluorescent quencher (NFQ) (Applied Biosystems). For
HLA-C, forward primer can be 5'-TTGGGACCGGGAGACACAG-3' and reverse primer can be 5'-CGATGTAATCCTTGCCGTC-3'.
The probes used for HLA-C1 and HLA-C2 can be 6FAM-CCGAGTGAG CCTGC-MGBNFQ and VIC-CCGAGTGAA
CCTGC-MGBNFQ, respectively. Each assay reaction mix can contain 250 nM probe concentration
and 20 ng of genomic DNA in 1× Taqman genotyping master mix from Applied Biosystems
(USA).
[0214] In some examples the KIR typing or HLA typing is performed as a companion diagnostic
to the FTI treatment. The companion diagnostic can be performed at the clinic site
where the subject is treated. The companion diagnostic can also be performed at a
site separate from the clinic site where the subject is treated.
[0215] In some examples the methods of KIR typing or HLA typing include obtaining a sample
from a subject. The subject can be a cancer patient. The sample can be a whole blood
sample, a bone marrow sample, a partially purified blood sample, PBMCs, or tissue
biopsy. In some examples the sample is a bone marrow sample from a cancer patient.
In some examples the sample is PBMCs from a cancer patient. In some examples the sample
is enriched NK cells. The NK cells can be enriched from bone marrow, whole blood,
or partially purified blood from a cancer patient. In some examples the NK cells are
further expanded
in vitro before KIR typing.
3.2. KIR expression and GZMM expression
[0216] As disclosed herein, the expression level of a biomarker selected from the group
consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM in a sample from a subject
can be indicative of the likelihood of the subject to be responsive to an FTI treatment.
A cancer patient whose expression level of KIR2DS2 is higher than a reference expression
level of KIR2DS2 is likely to be responsive to an FTI treatment. A cancer patient
whose expression level of KIR2DS5 is higher than a reference expression level of KIR2DS5
is likely to be responsive to an FTI treatment. A cancer patient whose expression
level of GZMM is higher than a reference expression level of GZMM is likely to be
responsive to an FTI treatment. A cancer patient whose expression level of KIR2DL2
is lower than a reference expression level of KIR2DL2 is likely to be responsive to
an FTI treatment. A cancer patient whose expression level of KIR2DL5 is lower than
a reference expression level of KIR2DL5 is likely to be responsive to an FTI treatment.
Accordingly, detecting the expression level of one or more of these biomarkers in
cancer patients, and selectively treating the cancer patients who meet one or more
of the above-described conditions, can increase the overall response rate of the cancer
patients to an FTI treatment.
[0217] In some examples the expression level of KIR2DL5 is the total expression levels of
KIR2DL5A and KIR2DL5B. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5A. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5B.
[0218] Additionally, disclosed herein are methods of using the ratio of expression levels
of certain biomarkers to predict the likelihood of a subject to be responsive to an
FTI treatment. For example, a high ratio of expression level of KIR2DS2 to the expression
level of KIR2DL2 (the "2DS2/2DL2 ratio") can indicate that the subject is likely to
be responsive to an FTI treatment. Similarly, a high ratio of expression level of
KIR2DS5 to the expression level of KIR2DL5 (the "2DS5/2DL5 ratio") can indicate that
the subject is likely to be responsive to an FTI treatment. Accordingly, detecting
the expression level of these biomarkers in cancer patients, and selectively treating
the cancer patients whose 2DS2/2DL2 ratio is higher than a reference ratio, or whose
2DS5/2DL5 ratio is higher than a reference ratio, or both, can increase the overall
response rate of cancer patients to the FTI treatment.
[0219] In some examples, disclosed herein is an FTI for use in a method for treating cancer
in a subject by administering a therapeutically effective amount of the FTI to the
subject, wherein
- (i) the expression level of KIR2DS2 in a sample from the subject is higher than a
reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the subject is lower than a
reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the subject is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the subject is lower than a
reference expression level of KIR2DL5; or
- (v) the expression level of GZMM in a sample from the subject is higher than a reference
expression level of GZMM; or any combination thereof.
[0220] In some examples, disclosed herein is an FTI for use in a method for treating cancer
in a subject by
- (a) determining expression level of a biomarker selected from the group consisting
of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM in a sample from the subject, wherein
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; and
- (b) administering a therapeutically effective amount of the FTI to the subject.
[0221] In some examples, disclosed herein is an FTI for use in a method for selecting a
cancer patient for the FTI treatment by determining the expression level of a biomarker
selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM
in a sample from a cancer patient, wherein the cancer patient is selected for the
FTI treatment if
- (i) the expression level of KIR2DS2 in a sample from the subject is higher than a
reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the subject is lower than a
reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the subject is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the subject is lower than a
reference expression level of KIR2DL5; or
- (v) the expression level of GZMM in a sample from the subject is higher than a reference
expression level of GZMM; or any combination thereof.
[0222] In some examples methods disclosed herein include treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
one of the five conditions is met:
- (i) the expression level of KIR2DS2 in the sample of the subject or cancer patient
is higher than a reference expression level of KIR2DS2 (condition 1);
- (ii) the expression level of KIR2DS5 in the sample of the subject or cancer patient
is higher than a reference expression level of KIR2DS5 (condition 2);
- (iii) the expression level of KIR2DL2 in the sample of the subject or cancer patient
is lower than a reference expression level of KIR2DL2 (condition 3);
- (iv) the expression level of KIR2DL5 in the sample of the subject or cancer patient
lower than a reference expression level of KIR2DL5 (condition 4); and
- (v) the expression level of GZMM in the sample of the subject or cancer patient is
higher than a reference expression level of GZMM (condition 5).
[0223] A person of ordinary skill in the art would understand, satisfaction of any one of
the five above described conditions can indicate that a subject is likely to be responsive
to an FTI treatment. Accordingly, each condition can independently serve as a patient
selection criterion for an FTI treatment in order to increase the overall response
rate. A person of ordinary skill in the art would also understand that combinations
of two or more conditions can also serve as patient selection criteria for FTI treatment,
which are more selective than a single condition and can potentially achieve higher
overall response rate. Accordingly, also disclosed herein are method of using any
combination or permutation of the above conditions for patient selection for an FTI
treatment.
[0224] In some examples the method disclosed herein includes treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
the subject or cancer patient meets two of the five above described conditions, such
as conditions 1 and 2, 1 and 3, 1 and 4, 1 and 5, 2 and 3, 2 and 4, 2 and 5, 3 and
4, 3 and 5, or 4 and 5. In some examples the subject or cancer patient meets conditions
1 and 2. In some examples the subject or cancer patient meets conditions 1 and 3.
In some examples the subject or cancer patient meets conditions 1 and 4. In some examples
the subject or cancer patient meets conditions 1 and 5. In some examples the subject
or cancer patient meets conditions 2 and 3. In some examples the subject or cancer
patient meets conditions 2 and 4. In some examples the subject or cancer patient meets
conditions 2 and 5. In some examples the subject or cancer patient meets conditions
3 and 4. In some examples the subject or cancer patient meets conditions 3 and 5.
In some examples the subject or cancer patient meets conditions 4 and 5. For example,
in some examples the method includes treating a subject with a therapeutically effective
amount of an FTI or selecting a cancer patient for an FTI treatment, wherein expression
level of KIR2DS2 in a sample of the subject is higher than a reference expression
level of KIR2DS2, and wherein the expression level of GZMM in a sample of the subject
is higher than a reference expression level of GZMM. For another example, in some
examples the method includes treating a subject with a therapeutically effective amount
of an FTI or selecting a cancer patient for an FTI treatment, wherein the expression
level of KIR2DS5 in a sample of the subject is higher than a reference expression
level of KIR2DS5, and the expression level of KIR2DL2 in a sample of the subject is
lower than a reference expression level of KIR2DL2.
[0225] In some examples the method herein includes treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
the subject or cancer patient meets three of the five above described conditions,
such as conditions 1, 2 and 3; 1, 2 and 4; 1, 2 and 5; 1, 3 and 4; 1, 3 and 5; 1,
4 and 5; 2, 3 and 4; 2, 3 and 5; 2, 4 and 5; or 3, 4 and 5. In some examples the subject
or cancer patient meets conditions 1, 2 and 3. In some examples the subject or cancer
patient meets conditions 1, 2 and 4. In some examples the subject or cancer patient
meets conditions 1, 2 and 5. In some examples the subject or cancer patient meets
conditions 1, 3 and 4. In some examples the subject or cancer patient meets conditions
1, 3 and 5. In some examples the subject or cancer patient meets conditions 1, 4 and
5. In some examples the subject or cancer patient meets conditions 2, 3 and 4. In
some examples the subject or cancer patient meets conditions 2, 3 and 5. In some examples
the subject or cancer patient meets conditions 2, 4 and 5. In some examples the subject
or cancer patient meets conditions 3, 4 and 5. For an example, in some other examples
the method includes treating a subject with a therapeutically effective amount of
an FTI or selecting a cancer patient for an FTI treatment, wherein the expression
level of KIR2DS2 in a sample of the subject is higher than a reference expression
level of KIR2DS2, the expression level of KIR2DL2 in a sample of the subject is lower
than a reference expression level of KIR2DL2, and the expression level of GZMM in
a sample of the subject is higher than a reference expression level of GZMM
[0226] In some examples the method disclosed herein includes treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
the subject or cancer patient meets four of the five above described conditions, such
as conditions 1, 2, 3 and 4; 1, 2, 3 and 5; 1, 2, 4 and 5; 1, 3, 4 and 5; or 2, 3,
4 and 5. In some examples the subject or cancer patient meets conditions 1, 2, 3 and
4. In some examples the subject or cancer patient meets conditions 1, 2, 3 and 5.
In some examples the subject or cancer patient meets conditions 1, 2, 4 and 5. In
some examples the subject or cancer patient meets conditions 1, 3, 4 and 5. In some
examples the subject or cancer patient meets conditions 2, 3, 4 and 5.
[0227] In some examples the method disclosed herein includes treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
the subject or cancer patient meets all five above described conditions, namely, wherein
- (i) the expression level of KIR2DS2 in a sample from the subject is higher than a
reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the subject is lower than a
reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the subject is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the subject is lower than a
reference expression level of KIR2DL5; and
- (v) the expression level of GZMM in a sample from the subject is higher than a reference
expression level of GZMM.
[0228] In addition to the expression level of individual biomarkers, the ratio of expression
levels between two biomarkers can also serve as criterion for patient selection for
an FTI treatment to increase response rate. In some examples, disclosed herein is
an FTI for use in a method for treating cancer in a subject by administering a therapeutically
effective amount of the FTI to the subject, wherein
- (i) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
(the 2DS2/2DL2 ratio) in a sample from the subject is higher than a reference 2DS2/2DL2
ratio; or
- (ii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
(the 2DS5/2DL5 ratio) in a sample from the sample is higher than a reference 2DS5/2DL5
ratio.
[0229] In some examples, disclosed herein is an FTI for use in a method of treating cancer
in a subject by determining expression levels of KIR2DS2 and KIR2DL2, or expression
levels of KIR2DS5 and KIR2DL5 in a sample from the subject, wherein
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
and administering a therapeutically effective amount of the FTI to the subject.
[0230] In some examples, disclosed herein is an FTI for use in a method for selecting a
cancer patient for an FTI treatment by determining expression levels of KIR2DS2 and
KIR2DL2, or expression levels of KIR2DS5 and KIR2DL5 in a sample from a cancer patient,
wherein the cancer patient is selected for the FTI treatment if
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
and administering a therapeutically effective amount of the FTI to the subject.
[0231] In some examples the method disclosed herein includes treating a subject with a therapeutically
effective amount of an FTI or selecting a cancer patient for an FTI treatment, wherein
the 2DS2/2DL2 ratio in a sample from the subject or cancer patient is higher than
a reference 2DS2/2DL2 ratio. In some examples the method includes treating a subject
with a therapeutically effective amount of an FTI or selecting a cancer patient for
an FTI treatment, wherein the 2DS5/2DL5 ratio in a sample from the subject or cancer
patient is higher than a reference 2DS5/2DL5 ratio. In some examples the method includes
treating a subject with a therapeutically effective amount of an FTI or selecting
a cancer patient for an FTI treatment, wherein the 2DS2/2DL2 ratio in a sample from
the subject or cancer patient is higher than a reference 2DS2/2DL2 ratio, and 2DS5/2DL5
ratio in a sample from the subject or cancer patient is higher than a reference 2DS5/2DL5
ratio.
[0232] In some examples the methods disclosed herein for selecting a cancer patient for
an FTI treatment can also be based on both the expression level of individual biomarkers
as well as the ratio of expression level between biomarkers. In some examples the
method includes treating a subject with a therapeutically effective amount of an FTI
or selecting a cancer patient for an FTI treatment, wherein the 2DS2/2DL2 ratio in
a sample from the subject or cancer patient is higher than a reference 2DS2/2DL2 ratio,
and the subject or cancer patient meets at least one of the five above described conditions
regarding individual expression level of the biomarkers. In some examples the method
includes treating a subject with a therapeutically effective amount of an FTI or selecting
a cancer patient for an FTI treatment, wherein the 2DS5/2DL5 ratio in a sample from
the subject or cancer patient is higher than a reference 2DS5/2DL5 ratio, and the
subject or cancer patient meets at least one of the five above described conditions
regarding individual expression level of the biomarkers. In some examples the method
includes treating a subject with a therapeutically effective amount of an FTI or selecting
a cancer patient for an FTI treatment, wherein the 2DS2/2DL2 ratio in a sample from
the subject or cancer patient is higher than a reference 2DS2/2DL2 ratio, and 2DS5/2DL5
ratio in a sample from the subject or cancer patient is higher than a reference 2DS5/2DL5
ratio, and the subject or cancer patient meets at least one of the five above described
conditions regarding individual expression level of the biomarkers.
[0233] In some examples the expression level of KIR2DL5 is the total expression levels of
KIR2DL5A and KIR2DL5B. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5A. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5B. Thus, in some examples the 2DS5/2DL5 ratio is the ratio of expression
level KIR2DS5 to the total expression levels of KIR2DL5A and KIR2DL5B. In some examples
the 2DS5/2DL5 ratio is the ratio of expression level KIR2DS5 to the expression level
of KIR2DL5A. In some examples the 2DS5/2DL5 ratio is the ratio of expression level
KIR2DS5 to the expression level of KIR2DL5B.
[0234] To reiterate, the five conditions for selecting a subject or a cancer patient for
an FTI treatment based on expression level of single biomarker includes: condition
1: the expression level of KIR2DS2 in a sample of the subject or cancer patient is
higher than a reference expression level of KIR2DS2. condition 2: the expression level
of KIR2DS5 in a sample of the subject or cancer patient is higher than a reference
expression level of KIR2DS5; condition 3: the expression level of KIR2DL2 in a sample
of the subject or cancer patient is lower than a reference expression level of KIR2DL2;
condition 4: the expression level of KIR2DL5 in a sample of the subject or cancer
patient is lower than a reference expression level of KIR2DL5; condition 5: the expression
level of GZMM in a sample of the subject or cancer patient is higher than a reference
expression level of GZMM. Any combination or permutation of these conditions can be
used in further combination with either one or both of the criteria based on expression
ratio (the 2DS2/2DL2 ratio and 2DS2/2DL2 ratio) as criteria for patient selection
for an FTI treatment.
[0235] For example, in some examples the method disclosed herein includes treating a subject
with a therapeutically effective amount of an FTI or selecting a cancer patient for
an FTI treatment, wherein the 2DS2/2DL2 ratio in a sample from the subject or cancer
patient is higher than a reference 2DS2/2DL2 ratio, and the expression level of GZMM
in a sample of the subject is higher than a reference expression level of GZMM. In
some examples the method includes treating a subject with a therapeutically effective
amount of an FTI or selecting a cancer patient for an FTI treatment, wherein the 2DS5/2DL5
ratio in a sample from the subject or cancer patient is higher than a reference 2DS5/2DL5
ratio, and the expression level of KIR2DS2 in a sample of the subject is higher than
a reference expression level of KIR2DS2. A person of ordinary skill in the art would
understand that the scope of the present invention is not limited to these exemplary
combinations and includes any combinations or permutations of the individual criterion
of patient selection for an FTI treatment as described herein.
[0236] As disclosed herein, the KIR genotype, HLA genotype, and the expression profile of
some NK cell related genes can be used to predict the responsiveness of a cancer patient
to an FTI treatment. Accordingly, disclosed herein are methods for selecting cancer
patients for an FTI treatment, or methods to treat a patient with FTI including first
KIR typing the patient or determining the expression profile of the biomarkers identified
herein to assess whether the patient is likely to respond to the treatment. The methods
can further include HLA typing the patient. A person of ordinary skill in the art
would understand that these methods can be used independently as patient selection
criteria for an FTI treatment. Additionally, the methods can also be used in connection
with other patient stratification approaches to further increase the response rate
of a patient population to an FTI treatment. For example, in some examples the methods
disclosed herein further include determining the mutation status of the ras gene and
selecting a patient for an FTI treatment when the patient has particular ras mutation,
such as K-ras mutation, or N-ras mutation as described in greater detail below. In
some examples the methods disclosed herein further include determining the mutation
status of the ras gene and selecting a patient for an FTI treatment when the patient
has wild type K-ras and wild type N-ras. The methods provided herein can further include
determining the mutation status of the ras gene and selecting a patient for an FTI
treatment when the patient has a H-ras mutation. In other embodiments, the methods
disclosed herein can further include using the 2 gene ratio between RASGRP1 and APTX
as additional patient selection criterion for an FTI treatment (
U.S. patent No. 7,932,036). Methods described herein or otherwise known in the art can be used to determine
the mutation status of the ras gene or expression of other biomarkers such as RASGRP1
or APTX. In some embodiments, the mutation status of H-ras can be determined by NGS.
[0237] In some examples the methods disclosed herein include determining the expression
level of a biomarker. In some examples the expression level of a biomarker can be
the protein level of the biomarker. In some examples the expression level of a biomarker
can be the RNA level of the biomarker. Any method as described herein or otherwise
known in the art to determine the protein level or RNA level of a gene can be used
for determining the expression level of a biomarker in present invention.
[0238] Exemplary methods of detecting or quantitating mRNA levels include but are not limited
to PCR-based methods, northern blots, ribonuclease protection assays, and the like.
The mRNA sequence (
e.g., the mRNA of a biomarker, such as CRBN or a CAP, or a fragment thereof) can be used
to prepare a probe that is at least partially complementary. The probe can then be
used to detect the mRNA sequence in a sample, using any suitable assay, such as PCR-based
methods, Northern blotting, a dipstick assay, and the like.
[0239] The commonly used methods known in the art for the quantification of mRNA expression
in a sample include northern blotting and in situ hybridization (
Parker &Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (
Hod, Biotechniques 13:852- 854 (1992)); and polymerase chain reaction (PCR) (
Weis et ah, Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
Representative methods for sequencing-based gene expression analysis include Serial
Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel
signature sequencing (MPSS).
[0241] It is noted, however, that other nucleic acid amplification protocols (i.e., other
than PCR) may also be used in the nucleic acid analytical methods described herein.
For example, suitable amplification methods include ligase chain reaction (see, e.g.,
Wu & Wallace, Genomics 4:560-569, 1988); strand displacement assay (see, e.g.,
Walker et al., Proc. Natl. Acad. Sci. USA 89:392-396, 1992;
U.S. Pat. No. 5,455,166); and several transcription-based amplification systems, including the methods described
in
U.S. Pat. Nos. 5,437,990;
5,409,818; and
5,399,491; the transcription amplification system (TAS) (
Kwoh et al., Proc. Natl. Acad. Sci. USA 86: 1173-1177, 1989); and self-sustained sequence replication (3SR) (
Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874-1878, 1990;
WO 92/08800). Alternatively, methods that amplify the probe to detectable levels can be used,
such as Q-replicase amplification (
Kramer & Lizardi, Nature 339:401-402, 1989;
Lomeli et al., Clin. Chem. 35: 1826-1831, 1989). A review of known amplification methods is provided, for example, by
Abramson and Myers in Current Opinion in Biotechnology 4:41-47 (1993).
[0242] mRNA may be isolated from the starting tissue sample. General methods for mRNA extraction
are well known in the art and are disclosed in standard textbooks of molecular biology,
including
Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). In particular, RNA isolation can be performed using purification kit, buffer set
and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's
instructions. For example, total RNA from cells in culture can be isolated using Qiagen
RNeasy mini- columns. Other commercially available RNA isolation kits include MASTERPURE®
Complete DNA and RNA Purification Kit (EPICENTRE®, Madison, Wis.), and Paraffin Block
RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using
RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium
chloride density gradient centrifugation.
[0243] In some the first step in gene expression profiling by PCR is the reverse transcription
of the RNA template into cDNA, followed by its exponential amplification in a PCR
reaction. In other examples a combined reverse-transcription-polymerase chain reaction
(RT-PCR) reaction may be used, e.g., as described in
U.S. Pat. Nos. 5,310,652;
5,322,770;
5,561 ,058;
5,641 ,864; and
5,693,517. The two commonly used reverse transcriptases are avilo myeloblastosis virus reverse
transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT).
The reverse transcription step is typically primed using specific primers, random
hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression
profiling. For example, extracted RNA can be reverse- transcribed using a GENEAMP™
RNA PCR kit (Perkin Elmer, Calif, USA), following the manufacturer's instructions.
The derived cDNA can then be used as a template in the subsequent PCR reaction.
[0244] In some examples Real-Time Reverse Transcription-PCR (qRT-PCR) can be used for both
the detection and quantification of RNA targets (
Bustin, et al., 2005, Clin. Sci., 109:365-379). Examples of qRT-PCR-based methods can be found, for example, in
U.S. Patent No. 7,101,663. Instruments for real-time PCR, such as the Applied Biosystems 7500, are available
commercially, as are the reagents, such as TaqMan Sequence Detection chemistry.
[0245] For example, TaqMan® Gene Expression Assays can be used, following the manufacturer's
instructions. These kits are pre-formulated gene expression assays for rapid, reliable
detection and quantification of human, mouse and rat mRNA transcripts. TaqMan® or
5'-nuclease assay, as described in
U.S. Pat. Nos. 5,210,015;
5,487,972; and
5,804,375; and
Holland et al., 1988, Proc. Natl. Acad. Sci. USA 88:7276-7280, can be used. TAQMAN® PCR typically utilizes the 5'-nuclease activity of Taq or Tth
polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any
enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers
are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide,
or probe, is designed to detect nucleotide sequence located between the two PCR primers.
The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter
fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the
reporter dye is quenched by the quenching dye when the two dyes are located close
together as they are on the probe. During the amplification reaction, the Taq DNA
polymerase enzyme cleaves the probe in a template-dependent manner. The resultant
probe fragments disassociate in solution, and signal from the released reporter dye
is free from the quenching effect of the second fluorophore. One molecule of reporter
dye is liberated for each new molecule synthesized, and detection of the unquenched
reporter dye provides the basis for quantitative interpretation of the data.
[0246] Any method suitable for detecting degradation product can be used in a 5' nuclease
assay. Often, the detection probe is labeled with two fluorescent dyes, one of which
is capable of quenching the fluorescence of the other dye. The dyes are attached to
the probe, preferably one attached to the 5' terminus and the other is attached to
an internal site, such that quenching occurs when the probe is in an unhybridized
state and such that cleavage of the probe by the 5' to 3' exonuclease activity of
the DNA polymerase occurs in between the two dyes.
[0247] Amplification results in cleavage of the probe between the dyes with a concomitant
elimination of quenching and an increase in the fluorescence observable from the initially
quenched dye. The accumulation of degradation product is monitored by measuring the
increase in reaction fluorescence.
U.S. Pat. Nos. 5,491 ,063 and
5,571,673 describe alternative methods for detecting the degradation of probe which occurs
concomitant with amplification. 5'-Nuclease assay data may be initially expressed
as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded
during every cycle and represent the amount of product amplified to that point in
the amplification reaction. The point when the fluorescent signal is first recorded
as statistically significant is the threshold cycle (Ct).
[0248] To minimize errors and the effect of sample-to-sample variation, PCR is usually performed
using an internal standard. The ideal internal standard is expressed at a constant
level among different tissues, and is unaffected by the experimental treatment. RNAs
most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping
genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and P-actin.
[0249] PCR primers and probes are designed based upon intron sequences present in the gene
to be amplified. In this example the first step in the primer/probe design is the
delineation of intron sequences within the genes. This can be done by publicly available
software, such as the DNA BLAT software developed by
Kent, W., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well
established methods of PCR primer and probe design.
[0251] Factors considered in PCR primer design include primer length, melting temperature
(Tm), and G/C content, specificity, complementary primer sequences, and 3'-end sequence.
In general, optimal PCR primers are generally 17-30 bases in length, and contain about
20-80%, such as, for example, about 50-60% G+C bases. Tm's between 50 and 80° C, e.g.
about 50 to 70° C. are typically preferred. For further guidelines for PCR primer
and probe design see, e.g.
Dieffenbach et ah, "General Concepts for PCR Primer Design" in: PCR Primer, A Laboratory
Manual, Cold Spring Harbor Laboratory Press, New York, 1995, pp. 133-155;
Innis and Gelfand, "Optimization of PCRs" in: PCR Protocols, A Guide to Methods and
Applications, CRC Press, London, 1994, pp. 5-11; and
Plasterer, T. N. Primerselect: Primer and probe design. Methods Mol. Biol. 70:520-
527 (1997).
[0252] An exemplary PCR program, for example, is 50°C for 2 minutes, 95°C for 10 minutes,
40 cycles of 95°C for 15 seconds, then 60°C for 1 minute. To determine the cycle number
at which the fluorescence signal associated with a particular amplicon accumulation
crosses the threshold (referred to as the CT), the data can be analyzed, for example,
using a 7500 Real-Time PCR System Sequence Detection software v1.3 using the comparative
CT relative quantification calculation method. Using this method, the output is expressed
as a fold-change of expression levels. In some examples the threshold level can be
selected to be automatically determined by the software. In some examples the threshold
level is set to be above the baseline but sufficiently low to be within the exponential
growth region of an amplification curve.
[0254] Differential gene expression can also be identified, or confirmed using the microarray
technique. In this method, polynucleotide sequences of interest (including cDNAs and
oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences
are then hybridized with specific DNA probes from cells or tissues of interest.
[0255] In an example of the microarray technique, PCR amplified inserts of cDNA clones are
applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences
are applied to the substrate. The microarrayed genes, immobilized on the microchip
at 10,000 elements each, are suitable for hybridization under stringent conditions.
Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent
nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled
cDNA probes applied to the chip hybridize with specificity to each spot of DNA on
the array. After stringent washing to remove non-specifically bound probes, the chip
is scanned by confocal laser microscopy or by another detection method, such as a
CCD camera. Quantitation of hybridization of each arrayed element allows for assessment
of corresponding mRNA abundance. With dual color fluorescence, separately labeled
cDNA probes generated from two sources of RNA are hybridized pairwise to the array.
The relative abundance of the transcripts from the two sources corresponding to each
specified gene is thus determined simultaneously. The miniaturized scale of the hybridization
affords a convenient and rapid evaluation of the expression pattern for large numbers
of genes. Such methods have been shown to have the sensitivity required to detect
rare transcripts, which are expressed at a few copies per cell, and to reproducibly
detect at least approximately two-fold differences in the expression levels (
Schena et al., Proc. Natl. Acad. Sci. USA 93(2): 106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following
manufacturer's protocols, such as by using the Affymetrix GENCHIP™ technology, or
Incyte's microarray technology.
[0256] Serial analysis of gene expression (SAGE) is a method that allows the simultaneous
and quantitative analysis of a large number of gene transcripts, without the need
of providing an individual hybridization probe for each transcript. First, a short
sequence tag (about 10-14 bp) is generated that contains sufficient information to
uniquely identify a transcript, provided that the tag is obtained from a unique position
within each transcript. Then, many transcripts are linked together to form long serial
molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously.
The expression pattern of any population of transcripts can be quantitatively evaluated
by determining the abundance of individual tags, and identifying the gene corresponding
to each tag. For more details see, e.g.
Velculescu et ah , Science 270:484-487 (1995); and
Velculescu et al, Cell 88:243-51 (1997).
[0257] The MassARRAY (Sequenom, San Diego, Calif.) technology is an automated, high-throughput
method of gene expression analysis using mass spectrometry (MS) for detection. According
to this method, following the isolation of RNA, reverse transcription and PCR amplification,
the cDNAs are subjected to primer extension. The cDNA-derived primer extension products
are purified, and dispensed on a chip array that is pre- loaded with the components
needed for MALTI-TOF MS sample preparation. The various cDNAs present in the reaction
are quantitated by analyzing the peak areas in the mass spectrum obtained.
[0258] mRNA level can also be measured by an assay based on hybridization. A typical mRNA
assay method can contain the steps of 1) obtaining surface-bound subject probes; 2)
hybridization of a population of mRNAs to the surface-bound probes under conditions
sufficient to provide for specific binding (3) post-hybridization washes to remove
nucleic acids not bound in the hybridization; and (4) detection of the hybridized
mRNAs. The reagents used in each of these steps and their conditions for use may vary
depending on the particular application.
[0259] Any suitable assay platform can be used to determine the mRNA level in a sample.
For example, an assay can be in the form of a dipstick, a membrane, a chip, a disk,
a test strip, a filter, a microsphere, a slide, a multiwell plate, or an optical fiber.
An assay system can have a solid support on which a nucleic acid corresponding to
the mRNA is attached. The solid support can have, for example, a plastic, silicon,
a metal, a resin, glass, a membrane, a particle, a precipitate, a gel, a polymer,
a sheet, a sphere, a polysaccharide, a capillary, a film a plate, or a slide. The
assay components can be prepared and packaged together as a kit for detecting an mRNA.
[0260] The nucleic acid can be labeled, if desired, to make a population of labeled mRNAs.
In general, a sample can be labeled using methods that are well known in the art (
e.g., using DNA ligase, terminal transferase, or by labeling the RNA backbone, etc.;
see, e.g., Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons 1995 and
Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, 2001 Cold
Spring Harbor, N.Y.). In some examples the sample is labeled with fluorescent label. Exemplary fluorescent
dyes include but are not limited to xanthene dyes, fluorescein dyes, rhodamine dyes,
fluorescein isothiocyanate (FITC), 6 carboxyfluorescein (FAM), 6 carboxy-2',4',7',4,7-hexachlorofluorescein
(HEX), 6 carboxy 4', 5' dichloro 2', 7' dimethoxyfluorescein (JOE or J), N,N,N',N'
tetramethyl 6 carboxyrhodamine (TAMRA or T), 6 carboxy X rhodamine (ROX or R), 5 carboxyrhodamine
6G (R6G5 or G5), 6 carboxyrhodamine 6G (R6G6 or G6), and rhodamine 110; cyanine dyes,
e.g. Cy3, Cy5 and Cy7 dyes; Alexa dyes,
e.g. Alexa-fluor-555; coumarin, Diethylaminocoumarin, umbelliferone; benzimide dyes,
e.g. Hoechst 33258; phenanthridine dyes,
e.g. Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin
dyes; polymethine dyes, BODIPY dyes, quinoline dyes, Pyrene, Fluorescein Chlorotriazinyl,
R110, Eosin, JOE, R6G, Tetramethylrhodamine, Lissamine, ROX, Napthofluorescein, and
the like.
[0261] Hybridization can be carried out under suitable hybridization conditions, which may
vary in stringency as desired. Typical conditions are sufficient to produce probe/target
complexes on a solid surface between complementary binding members,
i.e., between surface-bound subject probes and complementary mRNAs in a sample. In certain
examples stringent hybridization conditions can be employed.
[0262] Hybridization is typically performed under stringent hybridization conditions. Standard
hybridization techniques (
e.g. under conditions sufficient to provide for specific binding of target mRNAs in the
sample to the probes) are described in
Kallioniemi et al., Science 258:818-821 (1992) and
WO 93/18186. Several guides to general techniques are available,
e.g.,
Tijssen, Hybridization with Nucleic Acid Probes, Parts I and II (Elsevier, Amsterdam
1993). For descriptions of techniques suitable for
in situ hybridizations, see
Gall et al. Meth. Enzymol., 21:470-480 (1981); and
Angerer et al. in Genetic Engineering: Principles and Methods (Setlow and Hollaender,
Eds.) Vol 7, pgs 43-65 (Plenum Press, New York 1985). Selection of appropriate conditions, including temperature, salt concentration,
polynucleotide concentration, hybridization time, stringency of washing conditions,
and the like will depend on experimental design, including source of sample, identity
of capture agents, degree of complementarity expected, etc., and may be determined
as a matter of routine experimentation for those of ordinary skill in the art. Those
of ordinary skill will readily recognize that alternative but comparable hybridization
and wash conditions can be utilized to provide conditions of similar stringency.
[0263] After the mRNA hybridization procedure, the surface bound polynucleotides are typically
washed to remove unbound nucleic acids. Washing may be performed using any convenient
washing protocol, where the washing conditions are typically stringent, as described
above. The hybridization of the target mRNAs to the probes is then detected using
standard techniques.
[0264] In some examples the methods disclosed herein include determining the mRNA level
of one or more biomarkers selected from the group consisting of KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5, and GZMM using one of the approaches described herein or otherwise
known in the art. In one example the methods include determining the KIR2DS2 mRNA
level from a sample of a subject. In one example the methods include determining the
KIR2DL2 mRNA level from a sample of a subject. In one example the methods include
determining the KIR2DS5 mRNA level from a sample of a subject. In one example the
methods include determining the KIR2DL5 mRNA level from a sample of a subject. In
one example the methods include determining the GZMM mRNA level from a sample of a
subject.
[0265] In some examples the mRNA level of KIR2DL5 is the total mRNA levels of KIR2DL5A and
KIR2DL5B. In some examples the mRNA level of KIR2DL5 is the mRNA level of KIR2DL5A.
In some examples the mRNA level of KIR2DL5 is the mRNA level of KIR2DL5B.
[0266] In some examples the methods disclosed herein include determining the mRNA levels
of two or more of biomarkers selected from the group consisting of KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5, and GZMM. In some examples the methods include determining the mRNA
levels of three or more of these biomarkers. In some examples the methods include
determining the mRNA levels of four or more of these biomarkers. In some examples
the methods include determining the mRNA levels of all five of these biomarkers.
[0267] In some examples the methods disclosed herein include determining mRNA levels of
KIR2DS2 and KIR2DL2 in a sample from a subject or a cancer patient, and calculating
the ratio of mRNA level of KIR2DS2 to mRNA level KIR2DL2 (the 2DS2/2DL2 mRNA ratio).
In some examples the methods further include determining mRNA levels of KIR2DS5 and
KIR2DL5 a sample from a subject or a cancer patient, and calculating the ratio of
mRNA level of KIR2DS5 to mRNA level KIR2DL5 (the 2DS5/2DL5 mRNA ratio). In some examples
the methods further include determining mRNA levels of KIR2DS2 and KIR2DL2 in a sample
from a subject or a cancer patient, and mRNA levels of KIR2DS5 and KIR2DL5 a sample
from a subject or a cancer patient, and calculating both the 2DS2/2DL2 mRNA ratio
and the 2DS5/2DL5 mRNA ratio.
[0268] In some examples the mRNA level of one or more biomarkers selected from the group
consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM is determined by qPCR,
RT-PCR, RNA-seq, microarray analysis, SAGE, MassARRAY technique, or FISH. In some
examples the mRNA level of one or more of the biomarkers selected from the group consisting
of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM is determined by qPCR or RT-PCR.
[0269] In some examples the methods disclosed herein include determining the protein level
of one or more biomarkers selected from the group consisting of KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5, and GZMM. The protein level of the biomarker can be detected by
a variety of immunohistochemistry (IHC) approaches or other immunoassay methods.
[0270] IHC staining of tissue sections has been shown to be a reliable method of assessing
or detecting presence of proteins in a sample. Immunohistochemistry techniques utilize
an antibody to probe and visualize cellular antigens in situ, generally by chromogenic
or fluorescent methods. Thus, antibodies or antisera, preferably polyclonal antisera,
and most preferably monoclonal antibodies specific for each marker are used to detect
expression. As discussed in greater detail below, the antibodies can be detected by
direct labeling of the antibodies themselves, for example, with radioactive labels,
fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish
peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used
in conjunction with a labeled secondary antibody, comprising antisera, polyclonal
antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry
protocols and kits are well known in the art and are commercially available. Automated
systems for slide preparation and IHC processing are available commercially. The Ventana®
BenchMark XT system is an example of such an automated system.
[0271] Standard immunological and immunoassay procedures can be found in
Basic and Clinical Immunology (Stites & Terr eds., 7th ed. 1991). Moreover, the immunoassays can be performed in any of several configurations, which
are reviewed extensively in
Enzyme Immunoassay (Maggio, ed., 1980); and Harlow & Lane, supra. For a review of the general immunoassays, see also
Methods in Cell Biology: Antibodies in Cell Biology, volume 37 (Asai, ed. 1993);
Basic and Clinical Immunology (Stites & Ten, eds., 7th ed. 1991).
[0272] Commonly used assays to detect protein level of a biomarker include noncompetitive
assays, e.g., sandwich assays, and competitive assays. Typically, an assay such as
an ELISA assay can be used. ELISA assays are known in the art, e.g., for assaying
a wide variety of tissues and samples, including blood, plasma, serum or bone marrow.
[0273] A wide range of immunoassay techniques using such an assay format are available,
see, e.g.,
U.S. Pat. Nos. 4,016,043,
4,424,279, and
4,018,653. These include both single-site and two-site or "sandwich" assays of the non-competitive
types, as well as in the traditional competitive binding assays. These assays also
include direct binding of a labeled antibody to a target biomarker. Sandwich assays
are commonly used assays. A number of variations of the sandwich assay technique exist.
For example, in a typical forward assay, an unlabelled antibody is immobilized on
a solid substrate, and the sample to be tested brought into contact with the bound
molecule. After a suitable period of incubation, for a period of time sufficient to
allow formation of an antibody-antigen complex, a second antibody specific to the
antigen, labeled with a reporter molecule capable of producing a detectable signal
is then added and incubated, allowing time sufficient for the formation of another
complex of antibody-antigen-labeled antibody. Any unreacted material is washed away,
and the presence of the antigen is determined by observation of a signal produced
by the reporter molecule. The results may either be qualitative, by simple observation
of the visible signal, or may be quantitated by comparing with a control sample containing
known amounts of biomarker.
[0274] Variations on the forward assay include a simultaneous assay, in which both sample
and labeled antibody are added simultaneously to the bound antibody. These techniques
are well known to those skilled in the art, including any minor variations as will
be readily apparent. In a typical forward sandwich assay, a first antibody having
specificity for the biomarker is either covalently or passively bound to a solid surface.
The solid surface may be glass or a polymer, the most commonly used polymers being
cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene.
The solid supports may be in the form of tubes, beads, discs of microplates, or any
other surface suitable for conducting an immunoassay. The binding processes are well-known
in the art and generally consist of cross-linking covalently binding or physically
adsorbing, the polymer-antibody complex is washed in preparation for the test sample.
An aliquot of the sample to be tested is then added to the solid phase complex and
incubated for a period of time sufficient (e.g. 2-40 minutes or overnight if more
convenient) and under suitable conditions (e.g., from room temperature to 40°C such
as between 25°C and 32°C inclusive) to allow binding of any subunit present in the
antibody. Following the incubation period, the antibody subunit solid phase is washed
and dried and incubated with a second antibody specific for a portion of the biomarker.
The second antibody is linked to a reporter molecule which is used to indicate the
binding of the second antibody to the molecular marker.
[0275] In some examples flow cytometry (FACS) can be used to detect the protein level of
a biomarker. Surface proteins (such as KIRs) can be detected using antibodies against
specific biomarkers. The flow cytometer detects and reports the intensity of the fluorichrome-tagged
antibody, which indicates the expression level of the biomarker. Non-fluorescent cytoplasmic
proteins can also be observed by staining permeablized cells. The stain can either
be a fluorescence compound able to bind to certain molecules, or a fluorichrome-tagged
antibody to bind the molecule of choice.
[0276] An alternative method involves immobilizing the target biomarkers in the sample and
then exposing the immobilized target to specific antibody, which may or may not be
labeled with a reporter molecule. Depending on the amount of target and the strength
of the reporter molecule signal, a bound target may be detectable by direct labeling
with the antibody. Alternatively, a second labeled antibody, specific to the first
antibody is exposed to the target-first antibody complex to form a target-first antibody-second
antibody tertiary complex. The complex is detected by the signal emitted by a labeled
reporter molecule.
[0277] In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody,
generally by means of glutaraldehyde or periodate. As will be readily recognized,
however, a wide variety of different conjugation techniques exist, which are readily
available to the skilled artisan. Commonly used enzymes include horseradish peroxidase,
glucose oxidase, beta-galactosidase, and alkaline phosphatase, and other are discussed
herein. The substrates to be used with the specific enzymes are generally chosen for
the production, upon hydrolysis by the corresponding enzyme, of a detectable color
change. Examples of suitable enzymes include alkaline phosphatase and peroxidase.
It is also possible to employ fluorogenic substrates, which yield a fluorescent product
rather than the chromogenic substrates noted above. In all cases, the enzyme-labeled
antibody is added to the first antibody-molecular marker complex, allowed to bind,
and then the excess reagent is washed away. A solution containing the appropriate
substrate is then added to the complex of antibody-antigen-antibody. The substrate
will react with the enzyme linked to the second antibody, giving a qualitative visual
signal, which may be further quantitated, usually spectrophotometrically, to give
an indication of the amount of biomarker which was present in the sample. Alternately,
fluorescent compounds, such as fluorescein and rhodamine, can be chemically coupled
to antibodies without altering their binding capacity. When activated by illumination
with light of a particular wavelength, the fluorochrome-labeled antibody adsorbs the
light energy, inducing a state to excitability in the molecule, followed by emission
of the light at a characteristic color visually detectable with a light microscope.
As in the EIA, the fluorescent labeled antibody is allowed to bind to the first antibody-molecular
marker complex. After washing off the unbound reagent, the remaining tertiary complex
is then exposed to the light of the appropriate wavelength, the fluorescence observed
indicates the presence of the molecular marker of interest. Immunofluorescence and
EIA techniques are both very well established in the art and are discussed herein.
[0278] In some examples the methods disclosed herein include determining the protein level
of one or more biomarkers selected from the group consisting of KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5, and GZMM in a sample from a subject or a cancer patient using one
of the approaches described herein or otherwise known in the art. In one example the
method includes determining the KIR2DS2 protein level from a sample of a subject or
a cancer patient. In one example the methods includes determining the KIR2DL2 protein
level from a sample of a subject or a cancer patient. In one example the method includes
determining the KIR2DS5 protein level from a sample of a subject or a cancer patient.
In one example the method includes determining the KIR2DL5 protein level from a sample
of a subject or a cancer patient. In one example the method includes determining the
GZMM protein level from a sample of a subject or a cancer patient.
[0279] In some examples the protein level of KIR2DL5 is the total protein levels of KIR2DL5A
and KIR2DL5B. In some examples the protein level of KIR2DL5 is the protein level of
KIR2DL5A. In some examples the protein level of KIR2DL5 is the protein level of KIR2DL5B.
[0280] In some examples the methods disclosed herein include determining the protein levels
of two or more of these biomarkers. In some examples the methods include determining
the protein levels of three or more of these biomarkers. In some examples the methods
include determining the protein levels of four or more of these biomarkers. In some
the methods include determining the protein levels of five of these biomarkers.
[0281] In some examples the methods disclosed herein further include determining protein
levels of KIR2DS2 and KIR2DL2 in a sample from a subject or a cancer patient, and
calculating the ratio of protein level of KIR2DS2 to protein level KIR2DL2 (the 2DS2/2DL2
protein ratio). In some examples the methods further include determining protein levels
of KIR2DS5 and KIR2DL5 a sample from a subject or a cancer patient, and calculating
the ratio of protein level of KIR2DS5 to protein level KIR2DL5 (the 2DS5/2DL5 protein
ratio). In some examples the methods further include determining protein levels of
KIR2DS2 and KIR2DL2 in a sample from a subject or a cancer patient, and protein levels
of KIR2DS5 and KIR2DL5 a sample from a subject or a cancer patient, and calculating
both the 2DS2/2DL2 protein ratio and the 2DS5/2DL5 protein ratio.
[0282] In some examples the protein level of one or more biomarkers selected from the group
consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM is determined by immunoblotting
(Western blot), ELISA, immunohistochemistry, flow cytometry, cytometric bead array
or mass spectroscopy. In some examples the protein level of one or more biomarkers
selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM
is determined by ELISA.
3.3. Samples
[0283] In some embodiments, the methods further include obtaining a sample from a subject.
The subject can be a mammal, for example, a human. The subject can be male or female,
and can be an adult, child or infant. The subject can be a patient. The patient can
be a cancer patient. Samples can be analyzed at a time during an active phase of a
cancer (e.g., lymphoma, MDS, or leukemia), or when the cancer is inactive. In certain
embodiments, more than one sample from a subject can be obtained.
[0284] In some embodiments, the methods performed as a companion diagnostic to the FTI treatment.
The companion diagnostic can be performed at the clinic site where the subject is
treated. The companion diagnostic can also be performed at a site separate from the
clinic site where the subject is treated.
[0285] In certain embodiments, the sample used in the methods provided herein includes body
fluids from a subject. Non-limiting examples of body fluids include blood (e.g., peripheral
whole blood, peripheral blood), blood plasma, bone marrow, amniotic fluid, aqueous
humor, bile, lymph, menses, serum, urine, cerebrospinal fluid surrounding the brain
and the spinal cord, synovial fluid surrounding bone joints.
[0286] In one embodiment, the sample is a bone marrow sample. Procedures to obtain a bone
marrow sample are well known in the art, including but not limited to bone marrow
biopsy and bone marrow aspiration. Bone marrow has a fluid portion and a more solid
portion. In bone marrow biopsy, a sample of the solid portion is taken. In bone marrow
aspiration, a sample of the fluid portion is taken. Bone marrow biopsy and bone marrow
aspiration can be done at the same time and referred to as a bone marrow exam.
[0287] In some embodiments, the sample is a blood sample. The blood sample can be obtained
using conventional techniques as described in,
e.g. Innis et al, editors, PCR Protocols (Academic Press, 1990). White blood cells can be separated from blood samples using convention techniques
or commercially available kits, e.g. RosetteSep kit (Stein Cell Technologies, Vancouver,
Canada). Sub-populations of white blood cells, e.g. mononuclear cells, NK cells, B
cells, T cells, monocytes, granulocytes or lymphocytes, can be further isolated using
conventional techniques,
e.g. magnetically activated cell sorting (MACS) (Miltenyi Biotec, Auburn, California)
or fluorescently activated cell sorting (FACS) (Becton Dickinson, San Jose, California).
[0288] In one embodiment, the blood sample is from about 0.1 mL to about 10.0 mL, from about
0.2 mL to about 7 mL, from about 0.3 mL to about 5 mL, from about 0.4 mL to about
3.5 mL, or from about 0.5 mL to about 3 mL. In another embodiment, the blood sample
is about 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5,
5.0, 6.0, 7.0, 8.0, 9.0 or 10.0 mL.
[0289] In some embodiments, the sample used in the present methods includes a biopsy (
e.g., a tumor biopsy). The biopsy can be from any organ or tissue, for example, skin,
liver, lung, heart, colon, kidney, bone marrow, teeth, lymph node, hair, spleen, brain,
breast, or other organs. Any biopsy technique known by those skilled in the art can
be used for isolating a sample from a subject, for instance, open biopsy, close biopsy,
core biopsy, incisional biopsy, excisional biopsy, or fine needle aspiration biopsy.
[0290] In one embodiment, the sample used in the methods provided herein is obtained from
the subject prior to the subject receiving a treatment for the disease or disorder.
In another embodiment, the sample is obtained from the subject during the subject
receiving a treatment for the disease or disorder. In another embodiment, the sample
is obtained from the subject after the subject receiving a treatment for the disease
or disorder. In various embodiments, the treatment includes administering an FTI to
the subject.
[0291] In certain embodiments, the sample used in the methods provided herein includes a
plurality of cells. Such cells can include any type of cells,
e.g., stem cells, blood cells (
e.g., PBMCs), lymphocytes, NK cells, B cells, T cells, monocytes, granulocytes, immune
cells, or tumor or cancer cells. In certain embodiments, the sample used in the methods
provided herein includes a plurality of enriched NK cells from a blood sample or a
bone marrow sample of a subject, or a cancer patient. Specific cell populations can
be obtained using a combination of commercially available antibodies (
e.g., Quest Diagnostic (San Juan Capistrano, Calif.); Dako (Denmark)).
[0292] In certain embodiments, the sample used in the methods provided herein is from a
diseased tissue,
e.g., from an individual having cancer (
e.g., lymphoma, MDS, or leukemia). In certain embodiments. In some embodiments, the cells
can be obtained from the tumor or cancer cells or a tumor tissue, such as a tumor
biopsy or a tumor explants. In certain embodiments, the number of cells used in the
methods provided herein can range from a single cell to about 10
9 cells. In some embodiments, the number of cells used in the methods provided herein
is about 1 x 10
4, 5 x 10
4, 1 x 10
5, 5x 10
5, 1 x 10
6, 5 x 10
6, 1 x 10
7, 5 x 10
7, 1 x 10
8, or 5 x 10
8.
[0293] The number and type of cells collected from a subject can be monitored, for example,
by measuring changes in morphology and cell surface markers using standard cell detection
techniques such as flow cytometry, cell sorting, immunocytochemistry (
e.g., staining with tissue specific or cell-marker specific antibodies) fluorescence
activated cell sorting (FACS), magnetic activated cell sorting (MACS), by examination
of the morphology of cells using light or confocal microscopy, and/or by measuring
changes in gene expression using techniques well known in the art, such as PCR and
gene expression profiling. These techniques can be used, too, to identify cells that
are positive for one or more particular markers. Fluorescence activated cell sorting
(FACS) is a well-known method for separating particles, including cells, based on
the fluorescent properties of the particles (
Kamarch, 1987, Methods Enzymol, 151:150-165). Laser excitation of fluorescent moieties in the individual particles results in
a small electrical charge allowing electromagnetic separation of positive and negative
particles from a mixture. In one embodiment, cell surface marker-specific antibodies
or ligands are labeled with distinct fluorescent labels. Cells are processed through
the cell sorter, allowing separation of cells based on their ability to bind to the
antibodies used. FACS sorted particles may be directly deposited into individual wells
of 96-well or 384-well plates to facilitate separation and cloning.
[0294] In certain embodiments, subsets of cells are used in the methods provided herein.
Methods to sort and isolate specific populations of cells are well-known in the art
and can be based on cell size, morphology, or intracellular or extracellular markers.
Such methods include, but are not limited to, flow cytometry, flow sorting, FACS,
bead based separation such as magnetic cell sorting, size-based separation (
e.g., a sieve, an array of obstacles, or a filter), sorting in a microfluidics device,
antibody-based separation, sedimentation, affinity adsorption, affinity extraction,
density gradient centrifugation, laser capture microdissection,
etc. In some embodiments, the sample include enriched NK cells sorted by one or more methods
described herein, or otherwise known in the art. In one example the enriched NK cells
are further expanded
in vitro before being subjected to KIR typing, HLA typing or analysis of expression level
of one or more biomarkers selected from the group consisting of KIR2DS2, KIR2DL2,
KIR2DS5, KIR2DL5 and GZMM
[0295] The sample can be a whole blood sample, a bone marrow sample, a partially purified
blood sample, PBMCs, or tissue biopsy. In some embodiments, the sample is a bone marrow
sample from a cancer patient. In some embodiments, the sample is PBMCs from a cancer
patient. In some embodiments, the sample is enriched NK cells from bone marrow, whole
blood, or partially purified blood. In some embodiments, the NK cells are further
expanded
in vitro. Methods of obtaining a sample from a subject and methods to prepare the sample for
determining either the mRNA level or the protein level of one or more biomarkers are
well known in the art.
3.4. Reference levels and reference ratios
[0296] Disclosed herein is an FTI for use in methods of treating a subject with a therapeutically
effective amount of the FTI or selecting a cancer patient for an FTI treatment, based
on KIR typing, expression level (either mRNA level or protein level) of one or more
of individual biomarkers selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5,
KIR2DL5, and GZMM, or either or both of the ratio of expression levels between biomarkers
(the 2DS2/2DL2 ratio; the 2DS5/2DL5 ratio). In some examples a cancer patient is selected
for FTI treatment if the cancer patient is a carrier of KIR2DS2 or KIR2DS5, or both.
In some examples a cancer patient is selected for FTI treatment if
- (i) the expression level of KIR2DS2 in a sample from the subject is higher than a
reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the subject is lower than a
reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the subject is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the subject is lower than a
reference expression level of KIR2DL5;
- (v) the expression level of GZMM in a sample from the subject is higher than a reference
expression level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in a sample from the subject is higher than a reference ratio of an expression level
of KIR2DS2 to an expression level of KIR2DL2; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in a sample from the subject is higher than a reference ratio of an expression level
of KIR2DS5 to an expression level of KIR2DL5; or any combination of (i)-(vii).
[0297] The methods disclosed herein can further include determining a reference expression
level of each individual biomarker selected from the group consisting of KIR2DS2,
KIR2DL2, KIR2DS5, KIR2DL5, and GZMM, or the reference ratio between expression level
of biomarkers, including the reference 2DS2/2DL2 ratio and the reference 2DS5/2DL5
ratio. In some examples the reference expression level of a biomarker is the expression
level of the biomarker in a sample from a healthy individual, or the average or median
expression level of the biomarker in multiple samples from one or multiple healthy
individuals. In some examples the reference expression level of a biomarker is the
average expression level of the biomarker in samples from 2, 3, 5, 10, 15, 20, 30,
40, 50 or more healthy individuals. In some examples the reference expression level
of a biomarker is the medium expression level of the biomarker in samples from 2,
3, 5, 10, 15, 20, 30, 40, 50 or more healthy individuals.
[0298] In some examples the reference expression level of KIR2DS2 is the expression level
of KIR2DS2 in a sample from a healthy individual, or the average or median expression
level of the KIR2DS2 in multiple samples from one or multiple healthy individuals.
In some examples the reference expression level of KIR2DL2 is the expression level
of KIR2DL2 in a sample from a healthy individual, or the average or median expression
level of the KIR2DL2 in multiple samples from one or multiple healthy individuals.
In some examples the reference expression level of KIR2DS5 is the expression level
of KIR2DS5 in a sample from a healthy individual, or the average or median expression
level of the KIR2DS5 in multiple samples from one or multiple healthy individuals.
In some examples the reference expression level of KIR2DL5 is the expression level
of KIR2DL5 in a sample from a healthy individual, or the average or median expression
level of the KIR2DL5 in multiple samples from one or multiple healthy individuals.
In some examples the reference expression level of GZMM is the expression level of
GZMM in a sample from a healthy individual, or the average or median expression level
of the GZMM in multiple samples from one or multiple healthy individuals.
[0299] In some examples methods disclosed herein further include determining a reference
ratio between expression levels of two biomarkers, such as the 2DS2/2DL2 reference
expression ratio, or the 2DS5/2DL5 reference expression ratio. In some examples the
reference expression ratio of biomarkers is the expression ratio of the biomarkers
in a sample from a healthy individual, or the average or median expression ratio of
the biomarkers in multiple samples from one or multiple healthy individuals. In some
examples the reference expression ratio of two biomarkers is the average expression
ratio of the biomarkers in samples from 2, 3, 5, 10, 15, 20, 30, 40, 50 or more healthy
individuals. In some examples the reference expression ratio of two biomarkers is
the medium expression ratio of the biomarkers in samples from 2, 3, 5, 10, 15, 20,
30, 40, 50 or more healthy individuals.
[0300] In some examples the reference 2DS2/2DL2 ratio is the 2DS2/2DL2 ratio in a sample
from a healthy individual, or the average or median 2DS2/2DL2 ratio in multiple samples
from one or multiple healthy individuals. In some examples the reference 2DS5/2DL5
ratio is the 2DS5/2DL5 in a sample from a healthy individual, or the average or median
2DS5/2DL5 in multiple samples from one or multiple healthy individuals.
[0301] In some examples the reference expression level of a biomarker or the reference ratio
between expression levels of two biomarkers can be determined based on statistical
analysis of data from previous clinical trials, including outcome of a group of patients,
namely, the patients' responsiveness to an FTI treatment, as well as the expression
levels of the biomarker or ratio of expression levels between biomarkers of the group
of patients. A number of statistical methods are well known in the art to determine
the reference level (or referred to as the "cut-off value") of one or more biomarkers
when used to predict the responsiveness of a patient to a particular treatment, or
to stratify patients for a particular treatment.
[0302] One method includes analyzing gene expression profiles for biomarkers identified
herein that distinguish responder from non-responder to determine the reference expression
level for one or more biomarkers. Comparisons between responders and non-responders
can be performed using the Mann- Whitney U-test, Chi-square test, or Fisher's Exact
test. Analysis of descriptive statistics and comparisons can be performed using SigmaStat
Software (Systat Software, Inc., San Jose, CA, USA).
[0303] In some examples a classification and regression tree (CART) analysis can be adopted
to determine the reference level. CART analysis is based on a binary recursive partitioning
algorithm and allows for the discovery of complex predictor variable interactions
that may not be apparent with more traditional methods, such as multiple linear regression.
Binary recursive partitioning refers to the analysis that is: 1) binary, meaning there
were two possible outcome variables, namely "responders"and "non-responders," with
the effect of splitting patients into 2 groups; 2) recursive, meaning the analysis
can be performed multiple times; and 3) partitioned, meaning the entire data set can
be split into sections. This analysis also has the ability to eliminate predictor
variables with poor performance. The classification tree can be built using Salford
Predictive Modeler v6.6 (Salford Systems, San Diego, CA, USA).
[0304] Articles disclosed herein are representations of the gene expression profiles useful
for predicting the responsiveness of a cancer patient to an FTI treatment that are
reduced to a medium that can be automatically read such as computer readable media
(magnetic, optical, and the like). The articles can also include instructions for
assessing the gene expression profiles in such media. For example, the articles may
comprise a CD-ROM having computer instructions for comparing gene expression profiles
of biomarkers described above. The articles may also have gene expression profiles
digitally recorded therein so that they may be compared with gene expression data
from patient samples. Alternatively, the profiles can be recorded in different representational
format. Clustering algorithms such as those incorporated in "OMNIVIZ" and "TREE VIEW"
computer programs mentioned above can best assist in the visualization of such data.
[0305] Receiver Operator Characteristic (ROC) analysis can be utilized to determine the
reference expression level, or reference expression ratio, or test the overall predictive
value of individual genes and/or multigene classifiers. A review of the ROC analysis
can be found in
Soreide, J Clin Pathol 10.1136 (2008).
[0306] The reference level can be determined from the ROC curve of the training set to ensure
both high sensitivity and high specificity. To determine how many biomarkers are needed
to be included in the predictor, leave-one-out cross validation (LOOCV) can be used.
The response scores for the 'left-out' samples based on different numbers of genes
are recorded. The performances of the predictors with different numbers of genes can
be assessed based on misclassification error rate, sensitivity, specificity, p values
measuring the separation of Kaplan-Meier curves of the two predicted groups.
[0307] The Top Scoring Pair (TSP) algorithm first introduced by Geman et al. (2004) can
be used. In essence, the algorithm ranks all the gene pairs (genes i and j) based
on the absolute difference (Dij) in the frequency of event where gene i has higher
expression value than gene j in samples among class C1 to C2. In the cases of there
are multiple top scoring pairs (all sharing the same Dij), the top pair by a secondary
rank score that measures the magnitude to which inversions of gene expression levels
occur from one class to the other within a pair of genes is selected. The top pair
with highest frequency of absolute Dij > 2 fold in all samples will be selected as
candidate pair. The candidate pair can then be assessed in an independent testing
data set. Leave-one-out cross validation (LOOCV) can be carried out in the training
data set to evaluate how the algorithm perform. The performances of the predictors
can be assessed based on maximum misclassification error rate. All the statistical
analyses can be done using R (R Development Core Team, 2006).
[0308] A review of the methods and statistic tools useful for determining a reference level
can be found in
James Westgard, Ph.D., Basic Methods Validation, 3d edition (2008). Specific references are made to Chapter 9 ("How is reportable range of a method
determined") and Chapter 15 ("How is a reference interval verified").
[0309] Clinically reportable range (CRR) is the range of analyte values that a method can
measure, allowing for specimen dilution, concentration, or other pretreatment used
to extend the direct analytical measurement range. As provided in the Basic Methods
Validation by Dr. Westgard, the experiment to be performed is often called a "linearity
experiment," though there technically is no requirement that a method provide a linear
response unless two-point calibration is being used. This range can also be referred
as the "linear range," "analytical range," or "working range" for a method.
[0310] The reportable range is assessed by inspection of the linearity graph. That inspection
can involve manually drawing the best straight line through the linear portion of
the points, drawing a point-to-point line through all the points then comparing with
the best straight line, or fitting a regression line through the points in the linear
range. There are more complicated statistical calculations that are recommended in
some guidelines, such as Clinical Laboratory Standards Institute (CLSI)'s EP-6 protocol
for evaluating the linearity of analytical methods. But it is commonly accepted that
the reportable range can be adequately determined from a "visual" assessment, i.e.,
by manually drawing the best straight line that fits the lowest points in the series.
The Clinical Laboratory Standards Institute (CLSI) recommends a minimum of at least
4- preferably 5-different levels of concentrations. More than 5 can be used, particularly
if the upper limit of reportable range needs to be maximized, but 5 levels are convenient
and almost always sufficient.
[0311] A reference interval is typically established by assaying specimens that are obtained
from individuals that meet carefully defined criteria (reference sample group). Protocols
such as those of the International Federation of Clinical Chemistry (IFCC) Expert
Panel on Theory of Reference Values and the CLSI delineate comprehensive systematic
processes that use carefully selected reference sample groups to establish reference
intervals. These protocols typically need a minimum of 120 reference individuals for
each group (or subgroup) that needs to be characterized.
[0312] The CLSI Approved Guideline C28-A2 describes different ways for a laboratory to validate
the transference of established reference intervals to the individual laboratory that
includes 1. Divine judgment, wherein the laboratory simply reviews the information
submitted and subjectively verifies that the reference intervals are applicable to
the adopting laboratory's patient population and test methods; 2. Verification with
20 samples, wherein experimental validation is performed by collecting and analyzing
specimens from 20 individuals who epresent the reference sample population; 3. Estimation
with 60 samples, wherein an experimental validation is performed by collecting and
analyzing specimens from 60 individuals who represent the reference sample population,
and the actual reference interval is estimated and compared to the claimed or reported
interval using a statistical formula comparing the means and standard deviations of
the two populations; and 4. Calculation from comparative method, wherein one can adjust
or correct the claimed or reported reference intervals on the basis of the observed
methodological bias and the mathematical relationship demonstrated between the analytical
methods being used.
[0313] A person of ordinary skill in the art would understand that the reference expression
level of the biomarkers disclosed herein as well as the reference ratios between two
biomarkers can be determined by one or more methods as disclosed herein or other methods
known in the art.
[0314] Accordingly, in some examples the methods disclosed herein include
- a) determining the reference expression level of a biomarker selected from the group
consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, GZMM; and
- b) administering a therapeutically effective amount of an FTI to a cancer patient
if
- (i) the expression level of KIR2DS2 in a sample from the cancer patient is higher
than the reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the cancer patient is lower
than the reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the cancer patient is higher
than the reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the cancer patient is lower
than the reference expression level of KIR2DL5; or
- (v) the expression level of GZMM in a sample from the cancer patient is higher than
the reference expression level of GZMM; or any combination of (i)-(v).
[0315] In some examples the expression level of KIR2DL5 is the total expression levels of
KIR2DL5A and KIR2DL5B. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5A. In some examples the expression level of KIR2DL5 is the expression
level of KIR2DL5B.
[0316] Accordingly, in some examples the methods disclosed herein include
- a) determining the reference mRNA level of a biomarker selected from the group consisting
of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, GZMM; and
- b) administering a therapeutically effective amount of an FTI to a cancer patient
if
- (i) the mRNA level of KIR2DS2 in a sample from the cancer patient is higher than the
reference mRNA level of KIR2DS2;
- (ii) the mRNA level of KIR2DL2 in a sample from the cancer patient is lower than the
reference mRNA level of KIR2DL2;
- (iii) the mRNA level of KIR2DS5 in a sample from the cancer patient is higher than
the reference mRNA level of KIR2DS5;
- (iv) the mRNA level of KIR2DL5 in a sample from the cancer patient is lower than the
reference mRNA level of KIR2DL5; or
- (v) the mRNA level of GZMM in a sample from the cancer patient is higher than the
reference mRNA level of GZMM; or any combination of (i)-(v).
[0317] In some examples the mRNA level of KIR2DL5 is the total mRNA levels of KIR2DL5A and
KIR2DL5B. In some examples the mRNA level of KIR2DL5 is the mRNA level of KIR2DL5A.
In some examples the mRNA level of KIR2DL5 is the mRNA level of KIR2DL5B.
[0318] Accordingly, in some examples the methods disclosed herein include
- a) determining the reference protein level of a biomarker selected from the group
consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, GZMM; and
- b) administering a therapeutically effective amount of an FTI to a cancer patient
if
- (i) the protein level of KIR2DS2 in a sample from the cancer patient is higher than
the reference protein level of KIR2DS2;
- (ii) the protein level of KIR2DL2 in a sample from the cancer patient is lower than
the reference protein level of KIR2DL2;
- (iii) the protein level of KIR2DS5 in a sample from the cancer patient is higher than
the reference protein level of KIR2DS5;
- (iv) the protein level of KIR2DL5 in a sample from the cancer patient is lower than
the reference protein level of KIR2DL5; or
- (v) the protein level of GZMM in a sample from the cancer patient is higher than the
reference protein level of GZMM; or any combination of (i)-(v).
[0319] In some examples the protein level of KIR2DL5 is the total protein levels of KIR2DL5A
and KIR2DL5B. In some examples the protein level of KIR2DL5 is the protein level of
KIR2DL5A. In some examples the protein level of KIR2DL5 is the protein level of KIR2DL5B.
[0320] In some examples the methods disclosed herein include
- a) determining the reference 2DS2/2DL2 ratio, or the reference 2DS5/2DL5 ratio; and
- b) administering a therapeutically effective amount of an FTI to a cancer patient
if
- (i) the 2DS2/2DL2 ratio in a sample from the cancer patient is higher than the reference
2DS2/2DL2 ratio; or
- (ii) the 2DS5/2DL5 ratio in a sample from the cancer patient is higher than the reference
2DS5/2DL5 ratio; or both (i) and (ii).
[0321] In some examples the 2DS2/2DL2 ratio is the ratio of KIR2DS2 mRNA level to KIR2DL2
mRNA level. In some examples the 2DS2/2DL2 ratio is the ratio of KIR2DS2 protein level
to KIR2DL2 protein level. In some examples the 2DS5/2DL5 ratio is the ratio of KIR2DS5
mRNA level to KIR2DL5 mRNA level. In some examples the 2DS5/2DL5 ratio is the ratio
of KIR2DS5 protein level to KIR2DL5 protein level.
3.5. Cancers
[0322] Disclosed herein is an FTI for use in methods to treat a cancer in a subject with
the FTI, and methods for selecting cancer patients for an FTI treatment. The cancer
can be a hematopoietic cancer or a solid tumor. Disclosed herein are also methods
to treat a premalignant condition in a subject with an FTI, and methods for selecting
patients with a premalignant condition for an FTI treatment. In some embodiments,
the FTI is tipifarnib.
[0323] In some examples, disclosed herein is an FTI for use in methods to treat a hematopoietic
cancer in a subject with the FTI or selecting cancer patients for an FTI treatment.
Hematologic cancers are cancers of the blood or bone marrow. Examples of hematological
(or hematogenous) cancers include leukemias, lymphoma, and myelodysplastic syndrome
(MDS).
[0324] Leukemia refers to malignant neoplasms of the blood-forming tissues. Various forms
of leukemias are described, for example, in
U.S. Patent No. 7,393,862 and
U.S. provisional patent application no. 60/380,842, filed May 17, 2002. Although viruses reportedly cause several forms of leukemia in animals, causes of
leukemia in humans are to a large extent unknown.
The Merck Manual, 944-952 (17th ed. 1999). Transformation to malignancy typically occurs in a single cell through two or more
steps with subsequent proliferation and clonal expansion. In some leukemias, specific
chromosomal translocations have been identified with consistent leukemic cell morphology
and special clinical features (
e.
g., translocations of 9 and 22 in chronic myelocytic leukemia, and of 15 and 17 in
acute promyelocytic leukemia). Acute leukemias are predominantly undifferentiated
cell populations and chronic leukemias more mature cell forms.
[0325] Acute leukemias are divided into lymphoblastic (ALL) and non-lymphoblastic (ANLL)
types.
The Merck Manual, 946-949 (17th ed. 1999). They may be further subdivided by their morphologic and cytochemical appearance
according to the French-American-British (FAB) classification or according to their
type and degree of differentiation. The use of specific B- and T-cell and myeloid-antigen
monoclonal antibodies are most helpful for classification. ALL is predominantly a
childhood disease which is established by laboratory findings and bone marrow examination.
ANLL, also known as acute myelogenous leukemia or AML, occurs at all ages and is the
more common acute leukemia among adults; it is the form usually associated with irradiation
as a causative agent. In some examples, disclosed herein is an FTI for use in methods
for treating a AML patient with the FTI, or methods for selecting patients for FTI
treatment.
[0326] Standard procedures treat AML patients usually include 2 chemotherapy (chemo) phases:
remission induction (or induction) and consolidation (post-remission therapy). The
first part of treatment (remission induction) is aimed at getting rid of as many leukemia
cells as possible. The intensity of the treatment can depend on a person's age and
health. Intensive chemotherapy is often given to people under the age of 60. Some
older patients in good health can benefit from similar or slightly less intensive
treatment. People who are much older or are in poor health are not suitable for intensive
chemotherapies.
[0327] In younger patients, such as those under 60, induction often involves treatment with
2 chemo drugs, cytarabine (ara-C) and an anthracycline drug such as daunorubicin (daunomycin)
or idarubicin. Sometimes a third drug, cladribine (Leustatin, 2-CdA), is given as
well. The chemo is usually given in the hospital and lasts about a week. In rare cases
where the leukemia has spread to the brain or spinal cord, chemo may also be given
into the cerebrospinal fluid (CSF). Radiation therapy might be used as well.
[0328] Induction is considered successful if remission is achieved. However, the AML in
some patients can be refractory to induction. In patients who respond to induction,
further treatment is then given to try to destroy remaining leukemia cells and help
prevent a relapse, which is called consolidation. For younger patients, the main options
for consolidation therapy are: several cycles of high-dose cytarabine (ara-C) chemo
(sometimes known as HiDAC); allogeneic (donor) stem cell transplant; and autologous
stem cell transplant.
[0329] Chronic leukemias are described as being lymphocytic (CLL) or myelocytic (CML).
The Merck Manual, 949-952 (17th ed. 1999). CLL is characterized by the appearance of mature lymphocytes in blood, bone marrow,
and lymphoid organs. The hallmark of CLL is sustained, absolute lymphocytosis (> 5,000/µL)
and an increase of lymphocytes in the bone marrow. Most CLL patients also have clonal
expansion of lymphocytes with B-cell characteristics. CLL is a disease of middle or
old age. In CML, the characteristic feature is the predominance of granulocytic cells
of all stages of differentiation in blood, bone marrow, liver, spleen, and other organs.
In the symptomatic patient at diagnosis, the total white blood cell (WBC) count is
usually about 200,000/µL, but may reach 1,000,000/µL. CML is relatively easy to diagnose
because of the presence of the Philadelphia chromosome. Bone marrow stromal cells
are well known to support CLL disease progression and resistance to chemotherapy.
Disrupting the interactions between CLL cells and stromal cells is an additional target
of CLL chemotherapy.
[0330] Additionally, other forms of CLL include prolymphocytic leukemia (PLL), Large granular
lymphocyte (LGL) leukemia, Hairy cell leukemia (HCL). The cancer cells in PLL are
similar to normal cells called prolymphocytes -- immature forms of B lymphocytes (B-PLL)
or T lymphocytes (T-PLL). Both B-PLL and T-PLL tend to be more aggressive than the
usual type of CLL. The cancer cells of LGL are large and have features of either T
cells or NK cells. Most LGL leukemias are slow-growing, but a small number are more
aggressive. HCL is another cancer of lymphocytes that tends to progress slowly, and
accounts for about 2% of all leukemias. The cancer cells are a type of B lymphocyte
but are different from those seen in CLL.
[0331] Chronic myelomonocytic leukemia (CMML) is classified as a myelodysplastic/myeloproliferative
neoplasm by the 2008 World Health Organization classification of hematopoietic tumors.
CMML patients have a high number of monocytes in their blood (at least 1,000 per mm
3). Two classes-myelodysplastic and myeloproliferative-have been distinguished upon
the level of the white blood cell count (threshold 13 G/L). Often, the monocyte count
is much higher, causing their total white blood cell count to become very high as
well. Usually there are abnormal cells in the bone marrow, but the amount of blasts
is below 20%. About 15% to 30% of CMML patients go on to develop acute myeloid leukemia.
The diagnosis of CMML rests on a combination of morphologic, histopathologic and chromosomal
abnormalities in the bone marrow. The Mayo prognostic model classified CMML patients
into three risk groups based on: increased absolute monocyte count, presence of circulating
blasts, hemoglobin<10 gm/dL and platelets<100 × 10
9/L. The median survival was 32 months, 18.5 months and 10 months in the low, intermediate,
and high-risk groups, respectively. The Groupe Francophone des (GFM) score segregated
CMML patients into three risk groups based on: age >65 years, WBC >15 × 10
9/L, anemia, platelets <100 × 10
9/L, and ASXL1 mutation status. After a median follow-up of 2.5 years, survival ranged
from not reached in the low-risk group to 14.4 months in the high-risk group.
[0332] Lymphoma refers to cancers that originate in the lymphatic system. Lymphoma is characterized
by malignant neoplasms of lymphocytes-B lymphocytes (B cell lymphoma), T lymphocytes
(T-cell lymphoma), and natural killer cells (NK cell lymphoma). Lymphoma generally
starts in lymph nodes or collections of lymphatic tissue in organs including, but
not limited to, the stomach or intestines. Lymphoma may involve the marrow and the
blood in some cases. Lymphoma may spread from one site to other parts of the body.
[0333] The treatments of various forms of lymphomas are described, for example, in
U.S. Patent No. 7,468,363. Such lymphomas include, but are not limited to, Hodgkin's lymphoma, non-Hodgkin's
lymphoma, cutaneous B-cell lymphoma, activated B-cell lymphoma, Diffuse Large B-Cell
Lymphoma (DLBCL), mantle cell lymphoma (MCL), follicular lymphoma (FL; including but
not limited to FL grade I, FL grade II), follicular center lymphoma, transformed lymphoma,
lymphocytic lymphoma of intermediate differentiation, intermediate lymphocytic lymphoma
(ILL), diffuse poorly differentiated lymphocytic lymphoma (PDL), centrocytic lymphoma,
diffuse small-cleaved cell lymphoma (DSCCL), peripheral T-cell lymphomas (PTCL), cutaneous
T-Cell lymphoma (CTCL) and mantle zone lymphoma and low grade follicular lymphoma.
[0335] DLBCL accounts for approximately one-third of non-Hodgkin's lymphomas. While some
DLBCL patients are cured with traditional chemotherapy, the remainders die from the
disease. Anticancer drugs cause rapid and persistent depletion of lymphocytes, possibly
by direct apoptosis induction in mature T and B cells.
See K. Stahnke. et al., Blood 2001, 98:3066-3073. Absolute lymphocyte count (ALC) has been shown to be a prognostic factor in follicular
non-Hodgkin's lymphoma and recent results have suggested that ALC at diagnosis is
an important prognostic factor in DLBCL.
[0336] DLBCL can be divided into distinct molecular subtypes according to their gene profiling
patterns: germinal-center B-cell-like DLBCL (GCB-DLBCL), activated B-cell-like DLBCL
(ABC-DLBCL), and primary mediastinal B-cell lymphoma (PMBL) or unclassified type.
These subtypes are characterized by distinct differences in survival, chemo-responsiveness,
and signaling pathway dependence, particularly the NF-κB pathway.
See D. Kim et al., Journal of Clinical Oncology, 2007 ASCO Annual Meeting Proceedings
Part I. Vol 25, No. 18S (June 20 Supplement), 2007: 8082.
See Bea S, et al., Blood 2005; 106: 3183-90;
Ngo V.N. et al., Nature 2011; 470: 115-9. Such differences have prompted the search for more effective and subtype-specific
treatment strategies in DLBCL. In addition to the acute and chronic categorization,
neoplasms are also categorized based upon the cells giving rise to such disorder into
precursor or peripheral.
See e.g.,
U.S. patent Publication No. 2008/0051379. Precursor neoplasms include ALLs and lymphoblastic lymphomas and occur in lymphocytes
before they have differentiated into either a T- or B-cell. Peripheral neoplasms are
those that occur in lymphocytes that have differentiated into either T- or B-cells.
Such peripheral neoplasms include, but are not limited to, B-cell CLL, B-cell prolymphocytic
leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma, follicular lymphoma, extranodal
marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue, nodal marginal
zone lymphoma, splenic marginal zone lymphoma, hairy cell leukemia, plasmacytoma,
Diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma. In over 95 percent of
CLL cases, the clonal expansion is of a B cell lineage.
See Cancer: Principles & Practice of Oncology (3rd Edition) (1989) (pp. 1843-1847). In less than 5 percent of CLL cases, the tumor cells have a T-cell phenotype. Notwithstanding
these classifications, however, the pathological impairment of normal hematopoiesis
is the hallmark of all leukemias.
[0337] PTCL consists of a group of rare and usually aggressive (fast-growing) NHLs that
develop from mature T-cells. PTCLs collectively account for about 4 to 10 percent
of all NHL cases, corresponding to an annual incidence of 2,800 - 7,200 patients per
year in the United States. By some estimates, the incidence of PTCL is growing significantly,
and the increasing incidence may be driven by an aging population. PTCLs are sub-classified
into various subtypes, each of which are typically considered to be separate diseases
based on their distinct clinical differences. Most of these subtypes are rare; the
three most common subtypes of PTCL not otherwise specified, anaplastic large-cell
lymphoma, or ALCL, and angioimmunoblastic T-cell lymphoma, that collectively account
for approximately 70 percent of all PTCLs in the United States. ALCL can be cutaneous
ALCL or systemic ALCL
[0338] For most PTCL subtypes, the frontline treatment regimen is typically combination
chemotherapy, such as CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone),
EPOCH (etoposide, vincristine, doxorubicin, cyclophosphamide, prednisone), or other
multidrug regimens. Patients who relapse or are refractory to frontline treatments
are typically treated with gemcitabine in combination with other chemotherapies, including
vinorelbine (Navelbine®) and doxorubicin (Doxil®) in a regimen called GND, or other
chemotherapy regimens such as DHAP (dexamethasone, cytarabine, cisplatin) or ESHAP
(etoposide, methylprednisolone, cytarabine, and cisplatin).
[0339] Because most patients with PTCL will relapse, some oncologists recommend giving high-dose
chemotherapy followed by an autologous stem cell transplant to some patients who had
a good response to their initial chemotherapy. Recent, non-cytotoxic therapies that
have been approved for relapsed or refractory PTCL, such as pralatrexate (Folotyn®),
romidepsin (Istodax®) and belinostat (Beleodaq®), are associated with relatively low
objective response rates (25-27% overall response rate, or ORR) and relatively short
durations of response (8.2-9.4 months). Accordingly, the treatment of relapsed/refractory
PTCL remains a significant unmet medical need.
[0340] Multiple myeloma (MM) is a cancer of plasma cells in the bone marrow. Normally, plasma
cells produce antibodies and play a key role in immune function. However, uncontrolled
growth of these cells leads to bone pain and fractures, anemia, infections, and other
complications. Multiple myeloma is the second most common hematological malignancy,
although the exact causes of multiple myeloma remain unknown. Multiple myeloma causes
high levels of proteins in the blood, urine, and organs, including but not limited
to M-protein and other immunoglobulins (antibodies), albumin, and beta-2-microglobulin.
M-protein, short for monoclonal protein, also known as paraprotein, is a particularly
abnormal protein produced by the myeloma plasma cells and can be found in the blood
or urine of almost all patients with multiple myeloma.
[0341] Skeletal symptoms, including bone pain, are among the most clinically significant
symptoms of multiple myeloma. Malignant plasma cells release osteoclast stimulating
factors (including IL-1, IL-6 and TNF) which cause calcium to be leached from bones
causing lytic lesions; hypercalcemia is another symptom. The osteoclast stimulating
factors, also referred to as cytokines, may prevent apoptosis, or death of myeloma
cells. Fifty percent of patients have radiologically detectable myeloma-related skeletal
lesions at diagnosis. Other common clinical symptoms for multiple myeloma include
polyneuropathy, anemia, hyperviscosity, infections, and renal insufficiency.
[0342] Bone marrow stromal cells are well known to support multiple myeloma disease progression
and resistance to chemotherapy. Disrupting the interactions between multiple myeloma
cells and stromal cells is an additional target of multiple myeloma chemotherapy.
[0343] Myelodysplastic syndrome (MDS) refers to a diverse group of hematopoietic stem cell
disorders. MDS can be characterized by a cellular marrow with impaired morphology
and maturation (dysmyelopoiesis), ineffective blood cell production, or hematopoiesis,
leading to low blood cell counts, or cytopenias, and high risk of progression to acute
myeloid leukemia, resulting from ineffective blood cell production.
See The Merck Manual 953 (17th ed. 1999) and
List et al., 1990, J Clin. Oncol. 8:1424.
[0344] As a group of hematopoietic stem cell malignancies with significant morbidity and
mortality, MDS is a highly heterogeneous disease, and the severity of symptoms and
disease progression can vary widely among patients. The current standard clinical
tool to evaluate risk stratification and treatment options is the revised International
Prognostic Scoring System, or IPSS-R. The IPSS-R differentiates patients into five
risk groups (Very Low, Low, Intermediate, High, Very High) based on evaluation of
cytogenetics, percentage of blasts (undifferentiated blood cells) in the bone marrow,
hemoglobin levels, and platelet and neutrophil counts. The WHO also suggested stratifying
MDS patients by a del (5q) abnormality.
[0345] According to the ACS, the annual incidence of MDS is approximately 13,000 patients
in the United States, the majority of which are 60 years of age or older. The estimated
prevalence is over 60,000 patients in the United States. Approximately 75% of patients
fall into the IPSS-R risk categories of Very Low, Low, and Intermediate, or collectively
known as lower risk MDS.
[0346] The initial hematopoietic stem cell injury can be from causes such as, but not limited
to, cytotoxic chemotherapy, radiation, virus, chemical exposure, and genetic predisposition.
A clonal mutation predominates over bone marrow, suppressing healthy stem cells. In
the early stages of MDS, the main cause of cytopenias is increased programmed cell
death (apoptosis). As the disease progresses and converts into leukemia, gene mutation
rarely occurs and a proliferation of leukemic cells overwhelms the healthy marrow.
The disease course differs, with some cases behaving as an indolent disease and others
behaving aggressively with a very short clinical course that converts into an acute
form of leukemia.
[0348] There are two subgroups of refractory anemia characterized by five percent or less
myeloblasts in bone marrow: (1) refractory anemia (RA) and; (2) RA with ringed sideroblasts
(RARS), defined morphologically as having 15% erythroid cells with abnormal ringed
sideroblasts, reflecting an abnormal iron accumulation in the mitochondria. Both have
a prolonged clinical course and low incidence of progression to acute leukemia.
Besa E. C., Med. Clin. North Am. 1992 May, 76(3): 599-617.
[0349] There are two subgroups of refractory anemias with greater than five percent myeloblasts:
(1) RA with excess blasts (RAEB), defined as 6-20% myeloblasts, and (2) RAEB in transformation
(RAEB-T), with 21-30% myeloblasts. The higher the percentage of myeloblasts, the shorter
the clinical course and the closer the disease is to acute myelogenous leukemia. Patient
transition from early to more advanced stages indicates that these subtypes are merely
stages of disease rather than distinct entities. Elderly patients with MDS with trilineage
dysplasia and greater than 30% myeloblasts who progress to acute leukemia are often
considered to have a poor prognosis because their response rate to chemotherapy is
lower than de novo acute myeloid leukemia patients. The fifth type of MDS, the most
difficult to classify, is CMML. This subtype can have any percentage of myeloblasts
but presents with a monocytosis of 1000/dL or more. It may be associated with splenomegaly.
This subtype overlaps with a myeloproliferative disorder and may have an intermediate
clinical course. It is differentiated from the classic CML that is characterized by
a negative Ph chromosome.
[0350] MDS is primarily a disease of elderly people, with the median onset in the seventh
decade of life. The median age of these patients is 65 years, with ages ranging from
the early third decade of life to as old as 80 years or older. The syndrome may occur
in any age group, including the pediatric population. Patients who survive malignancy
treatment with alkylating agents, with or without radiotherapy, have a high incidence
of developing MDS or secondary acute leukemia. About 60-70% of patients do not have
an obvious exposure or cause for MDS, and are classified as primary MDS patients.
[0351] The treatment of MDS is based on the stage and the mechanism of the disease that
predominates the particular phase of the disease process. Bone marrow transplantation
has been used in patients with poor prognosis or late-stage MDS.
Epstein and Slease, 1985, Surg. Ann. 17:125. An alternative approach to therapy for MDS is the use of hematopoietic growth factors
or cytokines to stimulate blood cell development in a recipient.
Dexter, 1987, J. Cell Sci. 88:1;
Moore, 1991, Annu. Rev. Immunol. 9:159; and
Besa E. C., Med. Clin. North Am. 1992 May, 76(3): 599-617. The treatment of MDS using immunomodulatory compounds is described in
U.S. Patent No. 7,189,740.
[0352] Therapeutic options fall into three categories including supportive care, low intensity
and high intensity therapy. Supportive care includes the use red blood cell and platelet
transfusions and hematopoietic cytokines such as erythropoiesis stimulating agents
or colony stimulating factors to improve blood counts. Low intensity therapies include
hypomethylating agents such as azacytidine (Vidaza®) and decitabine (Dacogen®), biological
response modifiers such as lenalidomide (Revlimid®), and immunosuppressive treatments
such as cyclosporine A or antithymocyte globulin. High intensity therapies include
chemotherapeutic agents such as idarubicin, azacytidine, fludarabine and topotecan,
and hematopoietic stem cell transplants, or HSCT.
[0353] National Comprehensive Cancer Network, or NCCN, guidelines recommend that lower risk
patients (IPSS-R groups Very Low, Low, Intermediate) receive supportive care or low
intensity therapies with the major therapeutic goal of hematologic improvement, or
HI. NCCN guidelines recommend that higher risk patients (IPSS-R groups High, Very
High) receive more aggressive treatment with high intensity therapies. In some cases,
high risk patients are unable to tolerate chemotherapy, and may elect lower intensity
regimens. Despite currently available treatments, a substantial portion of MDS patients
lack effective therapies and NCCN guidelines recommend clinical trials as additional
therapeutic options. Treatment of MDS remains a significant unmet need requiring the
development of novel therapies.
[0354] Accordingly, in some examples, disclosed herein is an FTI for use in methods to treat
hematopoietic cancer in a subject, or selecting a hematopoietic cancer patient for
an FTI treatment, wherein the hematopoietic cancer patient is a carrier of KIR2DS2
or a carrier of KIR2DS5, or both; or wherein
- (i) the expression level of KIR2DS2 in a sample from the hematopoietic cancer patient
is higher than a reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the hematopoietic cancer patient
is lower than a reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the hematopoietic cancer patient
is higher than a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the hematopoietic cancer patient
is lower than a reference expression level of KIR2DL5;
- (v) the expression level of GZMM in a sample from the hematopoietic cancer patient
is higher than a reference expression level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in a sample from the hematopoietic cancer patient is higher than a reference ratio
of an expression level of KIR2DS2 to an expression level of KIR2DL2; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in a sample from the hematopoietic cancer patient is higher than a reference ratio
of an expression level of KIR2DS5 to an expression level of KIR2DL5; or any combination
of (i)-(vii).
[0355] In some examples, disclosed herein is an FTI for use in methods to treat a hematopoietic
cancer in a subject, or selecting a hematopoietic cancer patient for an FTI treatment.
Hematological cancers include leukemias, including acute leukemias (such as acute
lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblasts,
promyeiocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such
as chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, chronic
myeloic leukemia, and chronic lymphocytic leukemia), chronic myelomonocytic leukemia,
juvenile myelomonocytic leukemia, polycythemia vera, NK cell leukemia, lymphoma, NK
cell lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade
forms), multiple myeloma, peripheral T-cell lymphomas, cutaneous T-Cell lymphoma,
Waldenstrom's macroglobulinemia, heavy chain disease, myeiodysplastic syndrome, agnogenic
myeloid metaplasia, familial erythrophagocytic lymphohistiocytosis, hairy cell leukemia
and myelodysplasia.
[0356] In some examples the hematopoietic cancer to be treated by methods disclosed herein
can be AML, MDS, CMML, NK cell lymphoma, NK cell leukemia, CTCL, PTCL, CML. In some
embodiments, the hematopoietic cancer is AML. In some examples the hematopoietic cancer
is MDS. In some examples the MDS is lower risk MDS. In some examples the hematopoietic
cancer is CMML. The CMML can be low risk CMML, intermediate risk CMML, or high risk
CMML. The CMML can be myelodysplastic CMML or myeloproliferative CMML. In some examples
the CMML is NRAS/KRAS wild type CMML. In some examples the hematopoietic cancer is
NK lymphoma. In some examples the hematopoietic cancer is NK leukemia. In some examples
the hematopoietic cancer is CTCL. In some examples the hematopoietic cancer is PTCL.
In some examples the PTCL is refractory or relapsed PTCL.
[0357] In some examples, disclosed herein is an FTI for use in methods to treat MDS in a
subject, or selecting a MDS patient for an FTI treatment, wherein the MDS patient
is a carrier of KIR2DS2, KIR2DS5, or HLA-C2, or any combination thereof; or wherein
- (i) the expression level of KIR2DS2 in a sample from the MDS patient is higher than
a reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the MDS patient is lower than
a reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the MDS patient is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the MDS patient is lower than
a reference expression level of KIR2DL5;
- (v) the expression level of GZMM in a sample from the MDS patient is higher than a
reference expression level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in a sample from the MDS patient is higher than a reference ratio of an expression
level of KIR2DS2 to an expression level of KIR2DL2; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in a sample from the MDS patient is higher than a reference ratio of an expression
level of KIR2DS5 to an expression level of KIR2DL5; or any combination thereof.
[0358] In some examples, disclosed herein is an FTI for use in methods to treat a lower
risk MDS in a subject, or selecting a lower risk MDS patient for an FTI treatment,
wherein the lower risk MDS patient is a carrier of KIR2DS2, KIR2DS5, or HLA-C2, or
any combination thereof; or wherein
- (i) the expression level of KIR2DS2 in a sample from the MDS patient is higher than
a reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the MDS patient is lower than
a reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the MDS patient is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the MDS patient is lower than
a reference expression level of KIR2DL5;
- (v) the expression level of GZMM in a sample from the MDS patient is higher than a
reference expression level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in a sample from the lower risk MDS patient is higher than a reference ratio of an
expression level of KIR2DS2 to an expression level of KIR2DL2; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in a sample from the lower risk MDS patient is higher than a reference ratio of an
expression level of KIR2DS5 to an expression level of KIR2DL5; or any combination
thereof.
[0359] In some examples, disclosed herein is an FTI for use in methods to treat AML in a
subject, or selecting a AML patient for an FTI treatment, wherein the AML patient
is a carrier of KIR2DS2, KIR2DS5, or HLA-C2, or any combination thereof; or wherein
- (i) the expression level of KIR2DS2 in a sample from the AML patient is higher than
a reference expression level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in a sample from the AML patient is lower than
a reference expression level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in a sample from the AML patient is higher than
a reference expression level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in a sample from the AML patient is lower than
a reference expression level of KIR2DL5;
- (v) the expression level of GZMM in a sample from the AML patient is higher than a
reference expression level of GZMM;
- (vi) the ratio of the expression level of KIR2DS2 to the expression level of KIR2DL2
in a sample from the AML patient is higher than a reference ratio of an expression
level of KIR2DS2 to an expression level of KIR2DL2; or
- (vii) the ratio of the expression level of KIR2DS5 to the expression level of KIR2DL5
in a sample from the AML patient is higher than a reference ratio of an expression
level of KIR2DS5 to an expression level of KIR2DL5; or any combination thereof.
[0360] In some examples the AML patient is post-remission induction. In some examples the
AML patient post-transplantation. In some examples the AML patient is over age 60
or otherwise unfit for remission induction. In some examples the AML patient is over
age 65, 70, or 75. In some examples the AML patient is refractory to standard chemotherapy.
In some examples the AML patient is a relapsed patient.
[0361] In some examples, disclosed herein is an FTI for use in methods to treat a solid
tumor. Solid tumors are abnormal masses of tissue that usually do not contain cysts
or liquid areas. Solid tumors can be benign or malignant. Different types of solid
tumors are named for the type of cells that form them (such as sarcomas, carcinomas,
and lymphomas). The solid tumor to be treated with the methods of the invention can
be sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma,
osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma,
rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast
cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous
cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary
thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland
carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms'
tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, melanoma, and
CNS tumors (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma
(also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, meduloblastoma,
Schwannoma craniopharyogioma, ependymoma, pineaioma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).
[0362] In some examples, disclosed herein is an FTI for use in methods to treat a solid
tumor, wherein the solid tumor is malignant melanoma, adrenal carcinoma, breast carcinoma,
renal cell cancer, carcinoma of the pancreas, non-small-cell lung carcinoma (NSCLC)
or carcinoma of unknown primary. Drugs commonly administered to patients with various
types or stages of solid tumors include, but are not limited to, celebrex, etoposide,
cyclophosphamide, docetaxel, apecitabine, IFN, tamoxifen, IL-2, GM-CSF, or a combination
thereof.
[0363] In some examples the solid tumor to be treated by methods disclosed herein can be
thyroid cancer, head and neck cancers, urothelial cancers, salivary cancers, cancers
of the upper digestive tract, bladder cancer, breast cancer, ovarian cancer, brain
cancer, gastric cancer, prostate cancer, lung cancer, colon cancer, skin cancer, liver
cancer, and pancreatic cancer. In some examples the bladder cancer to be treated by
methods disclosed herein can be transitional cell carcinoma.
[0364] In some examples the solid tumor to be treated by methods disclosed herein can be
selected from the groups consisting of carcinoma, melanoma, sarcoma, or chronic granulomatous
disease.
[0365] In some examples the premalignant conditions to be treated by methods disclosed herein
can be actinic cheilitis, Barrett's esophagus, atrophic gastritis, ductal carcinoma
in situ, Dyskeratosis congenita, Sideropenic dysphagia, Lichen planus, Oral submucous
fibrosis, Solar elastosis, cervical dysplasia, polyps, leukoplakia, erythroplakia,
squamous intraepithelial lesion, a pre-malignant disorder, or a pre-malignant immunoproliferative
disorder.
3.6. Exemplary FTIs and dosages
[0366] In some examples the methods for treating cancer in a subject include KIR typing
the subject, and administering a therapeutically effective amount of tipifarnib to
the subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5, or a carrier
of both KIR2DS2 and KIR2DS5. In some examples the subject is also a carrier of HLA-C2.
In some examples the methods include administering the subject with another FTI described
herein or otherwise known in the art. In some examples the FTI is selected from the
group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0367] In some examples the method for treating cancer in a subject includes determining
expression level of a biomarker in a sample from the subject, wherein the biomarker
is selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM,
and administering a therapeutically effective amount of tipifarnib to the subject
wherein
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; or any combination of (i)-(v). In some examples the methods include
administering the subject with another FTI described herein or otherwise known in
the art. In some examples the FTI is selected from the group consisting of tipifarnib,
arglabin, perrilyl alcohol, lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832,
CP-609,754, R208176, AZD3409, and BMS-214662.
[0368] Additionally, the method of treating cancer in a subject includes determining expression
levels of KIR2DS2 and KIR2DL2, or KIR2DS5 and KIR2DL5 in a sample from the subject,
and administering a therapeutically effective amount of tipifarnib to the subject,
wherein
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
or both (i) and (ii). In some examples the methods include administering the subject
with another FTI described herein or otherwise known in the art. In some examples
the FTI is selected from the group consisting of tipifarnib, arglabin, perrilyl alcohol,
lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409,
and BMS-214662.
[0369] In some examples the method for treating a hematological cancer in a subject include
KIR typing the subject, and administering a therapeutically effective amount of tipifarnib
to the subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5, or a carrier
of both KIR2DS2 and KIR2DS5. In some examples the subject is also a carrier of HLA-C2.
In some examples the methods include administering the subject with another FTI described
herein or otherwise known in the art. In some examples the FTI is selected from the
group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0370] In some examples the method for treating a hematological cancer in a subject includes
determining expression level of a biomarker in a sample from the subject, wherein
the biomarker is selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5,
KIR2DL5, and GZMM, and administering a therapeutically effective amount of tipifarnib
to the subject wherein
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; or any combination of (i)-(v). In some examples the methods include
administering the subject with another FTI described herein or otherwise known in
the art. In some examples the FTI is selected from the group consisting of tipifarnib,
arglabin, perrilyl alcohol, lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832,
CP-609,754, R208176, AZD3409, and BMS-214662.
[0371] In some examples the method of treating a hematological cancer in a subject includes
determining expression levels of KIR2DS2 and KIR2DL2, or KIR2DS5 and KIR2DL5 in a
sample from the subject, and administering a therapeutically effective amount of tipifarnib
to the subject, wherein
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
or both (i) and (ii). In some embodiments, the methods include administering the subject
with another FTI described herein or otherwise known in the art. In some embodiments,
the FTI is selected from the group consisting of tipifarnib, arglabin, perrilyl alcohol,
lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409,
and BMS-214662.
[0372] In some examples the method for treating a lower risk MDS in a subject include KIR
typing the subject, and administering a therapeutically effective amount of tipifarnib
to the subject, wherein the subject is a carrier of KIR2DS2 or KIR2DS5, or a carrier
of both KIR2DS2 and KIR2DS5. In some examples the subject is also a carrier of HLA-C2.
In some examples the methods include administering the subject with another FTI described
herein or otherwise known in the art. In some examples the FTI is selected from the
group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0373] In some examples the method for treating a lower risk MDS in a subject includes determining
expression level of a biomarker in a sample from the subject, wherein the biomarker
is selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM,
and administering a therapeutically effective amount of tipifarnib to the subject
wherein
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; or any combination of (i)-(v). In some examples the methods include
administering the subject with another FTI described herein or otherwise known in
the art. In some examples the FTI is selected from the group consisting of tipifarnib,
arglabin, perrilyl alcohol, lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832,
CP-609,754, R208176, AZD3409, and BMS-214662.
[0374] Additionally, the method of treating a lower risk MDS in a subject includes determining
expression levels of KIR2DS2 and KIR2DL2, or KIR2DS5 and KIR2DL5 in a sample from
the subject, and administering a therapeutically effective amount of tipifarnib to
the subject, wherein
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
or both (i) and (ii). In some examples the methods include administering the subject
with another FTI described herein or otherwise known in the art. In some examples
the FTI is selected from the group consisting of tipifarnib, arglabin, perrilyl alcohol,
lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409,
and BMS-214662.
[0375] In some examples the FTI is administered orally, parenterally, rectally, or topically.
In some examples the FTI is administered orally.
[0376] In some embodiments, tipifarnib is administered orally, parenterally, rectally, or
topically. In some embodiments, tipifarnib is administered orally.
[0377] In some examples the FTI is administered at a dose of 1-1000 mg/kg body weight. In
some examples the FTI is administered twice a day. In some examples the FTI is administered
at a dose of 200-1200 mg twice a day. In some examples the FTI is administered at
a dose of 600 mg twice a day. In some examples the FTI is administered at a dose of
900 mg twice a day.
[0378] In some embodiments, tipifarnib is administered at a dose of 1-1000 mg/kg body weight.
In some embodiments, tipifarnib is administered twice a day. In some embodiments,
tipifarnib is administered at a dose of 200-1200 mg twice a day. In some embodiments,
tipifarnib is administered at a dose of 600 mg twice a day. In some embodiments, tipifarnib
is administered at a dose of 900 mg twice a day.
[0379] In some examples the FTI is administered in treatment cycles. In some examples the
FTI is administered in alternative weeks. In some examples the FTI is administered
on days 1-7 and 15-21 of a 28-day treatment cycle. In some examples the FTI is administered
orally at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle.
[0380] In some embodiments, tipifarnib is administered in treatment cycles. In some embodiments,
tipifarnib is administered in alternative weeks. In some embodiments, tipifarnib is
administered on days 1-7 and 15-21 of a 28-day treatment cycle. In some embodiments,
tipifarnib is administered orally at a dose of 900 mg twice a day on days 1-7 and
15-21 of a 28-day treatment cycle.
[0381] In some examples the FTI is administered for at least 3 cycles. In some embodiments,
the FTI is administered for at least 6 cycles. In some examples the FTI is administered
for up to 12 cycles. In some examples the FTI is administered orally at a dose of
900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment cycle for at least
three cycles.
[0382] In some embodiments, tipifarnib is administered for at least 3 cycles. In some embodiments,
tipifarnib is administered for at least 6 cycles. In some embodiments, tipifarnib
is administered for up to 12 cycles. In some embodiments, tipifarnib is administered
orally at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle for at least three cycles.
[0383] In some examples the method for treating a lower risk MDS in a subject include KIR
typing the subject, and administering tipifarnib to the subject, wherein the subject
is a carrier of KIR2DS2 or KIR2DS5, or a carrier of both KIR2DS2 and KIR2DS5, and
wherein th tipifarnib is administered orally at a dose of 900 mg twice a day on days
1-7 and 15-21 of a 28-day treatment cycle. In some examples the subject is also a
carrier of HLA-C2.
[0384] In some examples the method for treating a lower risk MDS in a subject includes determining
expression level of a biomarker in a sample from the subject, wherein the biomarker
is selected from the group consisting of KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and GZMM,
and administering tipifarnib to the subject wherein
- (i) the expression level of KIR2DS2 in the sample is higher than a reference expression
level of KIR2DS2;
- (ii) the expression level of KIR2DL2 in the sample is lower than a reference expression
level of KIR2DL2;
- (iii) the expression level of KIR2DS5 in the sample is higher than a reference expression
level of KIR2DS5;
- (iv) the expression level of KIR2DL5 in the sample is lower than a reference expression
level of KIR2DL5; or
- (v) the expression level of GZMM in the sample is higher than a reference expression
level of GZMM; or any combination of (i)-(v); and wherein tipifarnib is administered
orally at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle.
[0385] Additionally, the method of treating a lower risk MDS in a subject includes determining
expression levels of KIR2DS2 and KIR2DL2, or KIR2DS5 and KIR2DL5 in a sample from
the subject, and administering tipifarnib to the subject, wherein
- (i) the 2DS2/2DL2 ratio in the sample is higher than a reference 2DS2/2DL2 ratio;
or
- (ii) the 2DS5/2DL5 ratio in the sample is higher than a reference 2DS5/2DL5 ratio;
or both (i) and (ii); and wherein tipifarnib is administered orally at a dose of 900
mg twice a day on days 1-7 and 15-21 of a 28-day treatment cycle.
3.7. Kits
[0386] In certain examples disclosed herein is a kit for KIR typing a subject. In some examples
the kit includes one or more probes that bind specifically to the genomic DNA, cDNA,
or mRNA of the one or more KIR genes. The KIR genes can include KIR2DS2, KIR2DL2,
KIR2DS5, KIRDL5, or any combination thereof. In some examples the kits can further
include an agent for HLA typing. The agent for HLA typing can be one or more probes
that bind specifically to the genomic DNA, cDNA, or mRNA of the one or more HLA genes.
The HLA genes can include HLA-C1, HLA-C2, or both.
[0387] In certain examples the kit further includes a washing solution. In certain examples
the kit further comprises reagents for genomic DNA isolation or purification means,
detection means, as well as positive and negative controls. In certain examples the
kit further includes an instruction for using the kit. In some examples the kit further
includes an FTI or a pharmacological composition having an FTI. The kit can be tailored
for in-home use, clinical use, or research use.
[0388] In certain examples disclosed herein is a kit for detecting the mRNA level of one
or more biomarkers. The one or more biomarker are selected from the group consisting
of can include KIR2DS2, KIR2DL2, KIR2DS5, KIRDL5, and GZMM. In certain examples the
kit includes one or more probes that bind specifically to the mRNAs of the one or
more biomarkers. In certain examples the kit further includes a washing solution.
In certain examples the kit further includes reagents for performing a hybridization
assay, mRNA isolation or purification means, detection means, as well as positive
and negative controls. In certain examples the kit further includes an instruction
for using the kit. In some examples the kit further includes an FTI or a pharmacological
composition having an FTI. The kit can be tailored for in-home use, clinical use,
or research use.
[0389] In certain examples disclosed herein is a kit for detecting the protein level of
one or more biomarkers. The one or more biomarker are selected from the group consisting
of can include KIR2DS2, KIR2DL2, KIR2DS5, KIRDL5, and GZMM. In certain examples the
kits includes a dipstick coated with an antibody that recognizes the protein biomarker,
washing solutions, reagents for performing the assay, protein isolation or purification
means, detection means, as well as positive and negative controls. In certain examples
the kit further includes an instruction for using the kit. In some examples the kit
further includes an FTI or a pharmacological composition having an FTI. The kit can
be tailored for in-home use, clinical use, or research use.
[0390] The kits disclosed herein can employ, for example, a dipstick, a membrane, a chip,
a disk, a test strip, a filter, a microsphere, a slide, a multiwell plate, or an optical
fiber. The solid support of the kit can be, for example, a plastic, silicon, a metal,
a resin, glass, a membrane, a particle, a precipitate, a gel, a polymer, a sheet,
a sphere, a polysaccharide, a capillary, a film, a plate, or a slide. The sample can
be, for example, a blood sample, a bone marrow sample, a cell culture, a cell line,
a tissue, an oral issue, gastrointestinal tissue, an organ, an organelle, a biological
fluid, a urine sample, or a skin sample. The biological sample can be, for example,
a lymph node biopsy, a bone marrow biopsy, or a sample of peripheral blood tumor cells.
[0391] In some examples the kits disclosed herein include one or more containers and components
for conducting RT-PCR, qPCR, deep sequencing, NGS, or a microarray. In certain examples
the kits disclosed herein employ means for detecting the expression of a biomarker
by flow cytometry or immunofluorescence. In other examples the expression of the biomarker
is measured by ELISA-based methodologies or other similar methods known in the art.
[0392] In certain examples the kits disclosed herein include components for isolating protein.
In another specific examples the pharmaceutical or assay kit includes, in a container,
an FTI or a pharmaceutical composition having an FTI, and further includes, in one
or more containers, components for conducting flow cytometry or an ELISA.
[0393] In some examples disclosed herein are kits for measuring biomarkers providing the
materials necessary to measure the presence of certain genes, or abundance of one
or more of the gene products of the genes or a subset of genes (
e.
g., one, two, three, four, five or more genes) of the biomarkers disclosed herein.
Such kits can include materials and reagents required for measuring DNA, RNA or protein.
In some examples such kits include microarrays, wherein the microarray is comprised
of oligonucleotides and/or DNA and/or RNA fragments which hybridize to one or more
of the DNA or mRNA transcripts of one or more of the genes or a subset of genes of
the biomarkers disclosed herein, or any combination thereof. In some examples such
kits can include primers for PCR of either the DNA, RNA product or the cDNA copy of
the RNA product of the genes or subset of genes. In some examples such kits can include
primers for PCR as well as probes for Quantitative PCR. In some examples such kits
can include multiple primers and multiple probes wherein some of the probes have different
fluorophores so as to permit multiplexing of multiple products of a gene product or
multiple gene products. In some examples such kits can further include materials and
reagents for synthesizing cDNA from RNA isolated from a sample. In some examples such
kits can include antibodies specific for the protein products of a gene or subset
of genes of the biomarkers provided herein. Such kits can additionally include materials
and reagents for isolating RNA and/or proteins from a biological sample. In some examples
such kits can include, a computer program product embedded on computer readable media
for predicting whether a patient is clinically sensitive to an FTI. In some examples
the kits can include a computer program product embedded on a computer readable media
along with instructions.
[0394] In some examples kits for measuring the expression of one or more nucleic acid sequences
of a gene or a subset of genes of the biomarkers disclosed herein. In a specific examples
such kits measure the expression of one or more nucleic acid sequences associated
with a gene or a subset of genes of the biomarkers disclosed herein. In accordance
with this examples the kits may comprise materials and reagents that are necessary
for measuring the expression of particular nucleic acid sequence products of genes
or a subset of genes of the biomarkers disclosed herein. For example, a microarray
or RT-PCR kit may be produced for a specific condition and contain only those reagents
and materials necessary for measuring the levels of specific RNA transcript products
of the genes or a subset of genes of the biomarkers disclosed herein to predict whether
a hematological cancer in a patient is clinically sensitive to a compound. Alternatively,
in some examples the kits can comprise materials and reagents that are not limited
to those required to measure the expression of particular nucleic acid sequences of
any particular gene of the biomarkers disclosed herein. For example, in certain examples
the kits comprise materials and reagents necessary for measuring the levels of expression
of 1, 2, 3, 4, or 5 of the biomarkers disclosed herein, in addition to reagents and
materials necessary for measuring the levels of the expression of at least 1, at least
2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least
9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at
least 40, at least 45, at least 50 or more genes other than those of the biomarkers
disclosed herein. In other examples the kits contain reagents and materials necessary
for measuring the levels of expression of at least 1, at least 2, at least 3, at least
4, at least 5, or more of the genes of the biomarkers disclosed herein, and 1, 2,
3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,
125, 150, 175, 200, 225, 250, 300, 350, 400, 450, or more genes that are genes not
of the biomarkers disclosed herein, or 1-10, 1-100, 1-150, 1-200, 1-300, 1-400, 1-500,
1-1000, 25-100, 25-200, 25-300, 25-400, 25-500, 25-1000, 100-150, 100-200, 100-300,
100-400, 100-500, 100-1000 or 500-1000 genes that are genes not of the biomarkers
disclosed herein.
[0395] For nucleic acid microarray kits, the kits generally include probes attached to a
solid support surface. In one such examples probes can be either be oligonucleotides
or longer length probes including probes ranging from 150 nucleotides in length to
800 nucleotides in length. The probes can be attached to a detectable label. In a
specific examples the probes are specific for one or more of the gene products of
the biomarkers disclosed herein. The microarray kits can include instructions for
performing the assay and methods for interpreting and analyzing the data resulting
from the performance of the assay. In a specific examples the kits include instructions
for predicting whether a hematological cancer in a patient is clinically sensitive
to an FTI. The kits can also include hybridization reagents and/or reagents necessary
for detecting a signal produced when a probe hybridizes to a target nucleic acid sequence.
Generally, the materials and reagents for the microarray kits are in one or more containers.
Each component of the kit is generally in its own a suitable container.
[0396] In certain examples a nucleic acid microarray kit includes materials and reagents
necessary for measuring the levels of expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
15, 20, 25, 30, 35, 40, 45, 50 or more of the genes identified of the biomarkers disclosed
herein, or a combination thereof, in addition to reagents and materials necessary
for measuring the levels of the expression of at least 1, at least 2, at least 3,
at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10,
at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least
45, at least 50 or more genes other than those of the biomarkers disclosed herein.
In other examples a nucleic acid microarray kit contains reagents and materials necessary
for measuring the levels of expression of at least 1, at least 2, at least 3, at least
4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least
15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45,
at least 50 or more of the genes of the biomarkers disclosed herein, or any combination
thereof, and 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, or more genes
that are not of the biomarkers disclosed herein, or 1-10, 1-100, 1-150, 1-200, 1-300,
1-400, 1-500, 1-1000, 25-100, 25-200, 25-300, 25-400, 25-500, 25-1000, 100-150, 100-200,
100-300, 100-400, 100-500, 100-1000 or 500-1000 genes that are not of the biomarkers
disclosed herein.
[0397] For Quantitative PCR, the kits can include pre-selected primers specific for particular
nucleic acid sequences. The Quantitative PCR kits can also include enzymes suitable
for amplifying nucleic acids (e.g., polymerases such as Taq), and deoxynucleotides
and buffers needed for the reaction mixture for amplification. The Quantitative PCR
kits can also include probes specific for the nucleic acid sequences associated with
or indicative of a condition. The probes can be labeled with a fluorophore. The probes
can also be labeled with a quencher molecule. In some examples the Quantitative PCR
kits can also include components suitable for reverse-transcribing RNA including enzymes
(e.g., reverse transcriptases such as AMV, MMLV and the like) and primers for reverse
transcription along with deoxynucleotides and buffers needed for the reverse transcription
reaction. Each component of the quantitative PCR kit is generally in its own suitable
container. Thus, these kits generally include distinct containers suitable for each
individual reagent, enzyme, primer and probe. Further, the quantitative PCR kits can
include instructions for performing the assay and methods for interpreting and analyzing
the data resulting from the performance of the assay. In a specific examples the kits
contain instructions for predicting whether a hematological cancer in a patient is
clinically sensitive to a compound.
[0398] For antibody based kits, the kit can include, for example: (1) a first antibody which
binds to a polypeptide or protein of interest; and, optionally, (2) a second, different
antibody which binds to either the polypeptide or protein, or the first antibody and
is conjugated to a detectable label (
e.
g., a fluorescent label, radioactive isotope or enzyme). The first antibody can be
attached to a solid support. In a specific examples the polypeptide or protein of
interest is a biomarker disclosed herein. The antibody-based kits can also include
beads for conducting an immunoprecipitation. Each component of the antibody-based
kits is generally in its own suitable container. Thus, these kits generally include
distinct containers suitable for each antibody. Further, the antibody-based kits can
include instructions for performing the assay and methods for interpreting and analyzing
the data resulting from the performance of the assay. In a specific examples the kits
contain instructions for predicting whether a hematological cancer in a patient is
clinically sensitive to an FTI.
[0399] In some examples a kit disclosed herein includes an FTI provided herein, or a pharmaceutically
composition having an FTI. Kits can further include additional active agents, including
but not limited to those disclosed herein, such as a DNA-hypomethylating agent, a
therapeutic antibody that specifically binds to a cancer antigen, a hematopoietic
growth factor, a cytokine, an anti-cancer agent, an antibiotic, a cox-2 inhibitor,
an immunomodulatory agent, an anti-thymocyte globulin, an immunosuppressive agent,
or a corticosteroid.
[0400] Kits disclosed herein can further include devices that are used to administer the
FTI or other active ingredients. Examples of such devices include, but are not limited
to, syringes, drip bags, patches, and inhalers.
[0401] Kits can further include cells or blood for transplantation as well as pharmaceutically
acceptable vehicles that can be used to administer one or more active ingredients.
For example, if an active ingredient is provided in a solid form that must be reconstituted
for parenteral administration, the kit can comprise a sealed container of a suitable
vehicle in which the active ingredient can be dissolved to form a particulate-free
sterile solution that is suitable for parenteral administration. Examples of pharmaceutically
acceptable vehicles include, but are not limited to: Water for Injection USP; aqueous
vehicles such as, but not limited to, Sodium Chloride Injection, Ringer's Injection,
Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's
Injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene
glycol, and polypropylene glycol; and non-aqueous vehicles such as, but not limited
to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate,
and benzyl benzoate.
[0402] In certain examples of the methods and kits disclosed herein, solid phase supports
are used for purifying proteins, labeling samples or carrying out the solid phase
assays. Examples of solid phases suitable for carrying out the methods disclosed herein
include beads, particles, colloids, single surfaces, tubes, multiwell plates, microtiter
plates, slides, membranes, gels and electrodes. When the solid phase is a particulate
material (e.g., beads), it is, in one examples distributed in the wells of multi-well
plates to allow for parallel processing of the solid phase supports.
[0403] The kit of this disclosure can include an ancillary reagent. In some examples the
ancillary reagent can be a secondary antibody, a detection reagent, a detection buffer,
an immobilization buffer, a dilution buffer, a washing buffer, or any combination
thereof.
[0404] Secondary antibodies can be monoclonal or polyclonal antibodies. Secondary antibodies
can be derived from any mammalian organism, including bovine, mice, rats, hamsters,
goats, camels, chicken, rabbit, and others. Secondary antibodies can include, for
example, an anti-human IgA antibody, an anti-human IgD antibody, an anti-human IgE
antibody, an anti-human IgG antibody, or an anti-human IgM antibody. Secondary antibodies
can be conjugated to enzymes (e.g., horseradish peroxidase (HRP), alkaline phosphatase
(AP), luciferase, and the like) or dyes (e.g., colorimetric dyes, fluorescent dyes,
fluorescence resonance energy transfer (FRET)-dyes, time-resolved (TR)-FRET dyes,
and the like). In some examples the secondary antibody is a polyclonal rabbit-anti-human
IgG antibody, which is HRP-conjugated.
[0405] Any detection reagent known in the art can be included in a kit of this disclosure.
In some examples the detection reagent is a colorimetric detection reagent, a fluorescent
detection reagent, or a chemiluminescent detection reagent. In some examples the colorimetric
detection reagent includes PNPP (p-nitrophenyl phosphate), ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic
acid)) or OPD (o-phenylenediamine). In some examples the fluorescent detection reagent
includes QuantaBluTM or QuantaRedTM (Thermo Scientific, Waltham, MA). In some examples
the luminescent detection reagent includes luminol or luciferin. In some examples
the detection reagent includes a trigger (e.g., H2O2) and a tracer (e.g., isoluminol-conjugate).
[0406] Any detection buffer known in the art can be included in a kit of this disclosure.
In some examples the detection buffer is a citrate-phosphate buffer (e.g., about pH
4.2).
[0407] Any stop solution known in the art can be included in a kit of this disclosure. The
stop solutions of this disclosure terminate or delay the further development of the
detection reagent and corresponding assay signals. Stop solutions can include, for
example, low-pH buffers (e.g., glycine-buffer, pH 2.0), chaotrophic agents (e.g.,
guanidinium chloride, sodium-dodecylsulfate (SDS)) or reducing agents (e.g., dithiothreitol,
mecaptoethanol), or the like.
[0408] In some examples the ancillary reagent is an immobilization reagent, which can be
any immobilization reagent known in the art, including covalent and non-covalent immobilization
reagents. Covalent immobilization reagents can include any chemical or biological
reagent that can be used to covalently immobilize a peptide or a nucleic acid on a
surface. Covalent immobilization reagents can include, for example, a carboxyl-to-amine
reactive group (e.g., carbodiimides such as EDC or DCC), an amine reactive group (e.g.,
N-hydroxysuccinimide (NHS) esters, imidoesters), a sulfhydryl-reactive crosslinker
(e.g., maleimides, haloacetyls, pyridyl disulfides), a carbonyl-reactive crosslinker
groups (e.g., hydrazides, alkoxyamines), a photoreactive crosslinker (e.g., aryl azides,
dizirines), or a chemoselective ligation group (e.g., a Staudinger reaction pair).
Non-covalent immobiliazation reagents include any chemical or biological reagent that
can be used to immobilize a peptide or a nucleic acid non-covalently on a surface,
such as affinity tags (e.g., biotin) or capture ragents (e.g., streptavidin or anti-tag
antibodies, such as anti-His6 or anti-Myc antibodies).
[0409] The kits of this disclosure can include combinations of immobilization reagents.
Such combinations include, for example, EDC and NHS, which can be used, for example,
to immobilize a protein of this disclosure on a surface, such as a carboxylated dextrane
matrix (e.g., on a BIAcoreTM CM5 chip or a dextrane-based bead). Combinations of immobilization
reagents can be stored as premixed reagent combinations or with one or more immobilization
reagents of the combination being stored separately from other immobilization reagents.
[0410] A large selection of washing buffers are known in the art, such as tris(hydroxymethyl)aminomethane
(Tris)-based buffers (e.g., Tris-buffered saline, TBS) or phosphate buffers (e.g.,
phosphate-buffered saline, PBS). Washing buffers can include detergents, such as ionic
or non-ionic detergents. In some examples the washing buffer is a PBS buffer (e.g.,
about pH 7.4) including Tween®20 (e.g., about 0.05% Tween®20).
[0411] Any dilution buffer known in the art can be included in a kit of this disclosure.
Dilution buffers can include a carrier protein (e.g., bovine serum albumin, BSA) and
a detergent (e.g., Tween®20). In some examples the dilution buffer is PBS (e.g., about
pH 7.4) including BSA (e.g., about 1% BSA) and Tween®20 (e.g., about 0.05% Tween®20).
[0412] In some examples the kit of this disclosure includes a cleaning reagent for an automated
assay system. An automated assay system can include systems by any manufacturer. In
some examples the automated assay systems include, for example, the BIO-FLASHTM, the
BEST 2000TM, the DS2TM, the ELx50 WASHER, the ELx800 WASHER, and the ELx800 READER.
A cleaning reagent can include any cleaning reagent known in the art.
[0413] It is noted that any combination of the above-listed examples for example, with respect
to one or more reagents, such as, without limitation, nucleic acid primers, solid
support and the like, are also contemplated in relation to any of the various methods
and/or kits provided herein.
4. Wild type K-Ras and N-Ras as Biomarkers for FTI Treatment
[0414] Disclosed herein are methods of selection of cancer patients for treatment with an
FTI are based, in part, on the discovery that the mutation status in Ras is associated
with clinical benefits of FTI, and can be used to predict the responsiveness of a
cancer patient to an FTI treatment. Accordingly, disclosed herein are methods for
predicting responsiveness of a cancer patient to an FTI treatment, methods for cancer
patient population selection for an FTI treatment, and methods for treating cancer
in a subject with a therapeutically effective amount of an FTI, based on the mutation
status of Ras in a sample from the patient.
4.1. Ras mutation status
[0415] In some examples provided herein is a method of treating a cancer in a subject based
on the mutation status of K-Ras, N-Ras, or both. The method disclosed herein includes
(a) determining the presence or absence of a Ras mutation in a sample from the subject,
wherein the Ras mutation includes a K-Ras mutation or a N-Ras mutation, and subsequently
(b) administering a therapeutically effective amount of an FTI to said subject if
said sample is determined to lack the K-Ras mutation or the N-Ras mutation.
[0416] In some examples the method provided herein includes (a) determining the presence
or absence of a K-Ras mutation in a sample from the subject, , and subsequently (b)
administering a therapeutically effective amount of an FTI to said subject if said
sample is determined to lack the K-Ras mutation. In some examples the sample is determined
to have wild type K-Ras.
[0417] In some examples the method provided herein includes (a) determining the presence
or absence of a N-Ras mutation in a sample from the subject, , and subsequently (b)
administering a therapeutically effective amount of an FTI to said subject if said
sample is determined to lack the N-Ras mutation. In some examples the sample is determined
to have wild type N-Ras.
[0418] In some examples the K-Ras mutation is K
A-Ras mutation. In some examples the K-Ras mutation is K
B-Ras mutation. In some examples the K-Ras mutation is a combination of K
A-Ras mutation and a K
B-Ras mutation. The K-Ras mutation can include a mutation at a codon selected from
the group consisting of G12, G13, and Q61 of K
A-Ras, K
B-Ras, or both. In some examples the K
A-Ras mutation can include a mutation selected from the group consisting of the amino
acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C, G13D, G13R,
G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 R and A146V. In some examples the K
B-Ras mutation can include a mutation selected from the group consisting of the amino
acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C, G13D, G13R,
G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 R and A146V.
[0419] In some examples the Ras mutation is an N-Ras mutation. In some examples the N-Ras
mutation can include at least one mutation at a codon selected from the group consisting
of G12, G13, G15, G60 and Q61. In some examples the N-Ras mutation can include at
least one mutation at a codon selected from the group consisting of G12, G13, and
Q61. In some examples the N-Ras mutation can include at least one mutation selected
from the group consisting of the amino acid substitutions of G12C, G12D, G12F, G12S,
G12A, G12V, G12R, G13C, G13R, G13A, G13D, G13V, G15W, G60E, Q61P, Q61L, Q61R, Q61K,
Q61H and Q61E.
[0420] In some examples the sample is determined to not have amino acid substitution at
G12, G13, and Q61 of K-Ras, and also not have amino acid substitution at G12, G13,
and Q61 of N-Ras. In some examples the sample is determined to not have any K-Ras
mutation or any N-Ras mutation. In some examples the sample is determined to have
wild type K-Ras and wild type N-Ras.
[0421] The method provided herein can further includes determining the presence or absence
of an H-Ras mutation in a sample from the subject, and administering a therapeutically
effective amount of an FTI to said subject if said sample is determined to have an
H-Ras mutation.
[0422] In some embodiments, the H-Ras mutation is a mutation at a codon selected from the
group consisting of G12, G13, and Q61. In some embodiments, the H-Ras mutation can
be a mutation selected from the group consisting of the amino acid substitutions of
G12R, G12V, G13C, G13R, Q61L and Q61R.
[0423] In some examples disclosed herein is a method of treating a cancer in a subject based
on the mutation status of K-Ras and N-Ras, which includes (a) determining the presence
or absence of a K-Ras mutation and a N-Ras mutation in a sample from the subject,
and subsequently (b) administering a therapeutically effective amount of an FTI to
the subject if the sample does not have any K-Ras mutation or any N-Ras mutation.
In some examples the method includes administering a therapeutically effective amount
of an FTI to the subject if the sample has wild type K-Ras and wild type N-Ras. In
some examples the method further includes determining the mutation status of H-Ras,
and subsequently administering a therapeutically effective amount of an FTI to the
subject if the sample of the subject does not have any K-Ras mutation or any N-Ras
mutation, but has a H-Ras mutation.
[0424] Disclosed herein are methods for predicting responsiveness of a cancer patient to
an FTI treatment, methods for cancer patient population selection for an FTI treatment,
and methods for treating cancer in a subject with a therapeutically effective amount
of an FTI, based on the mutation status of Ras in a sample from the patient. In some
examples the method includes determining the presence or absence of a Ras mutation
in a sample from the subject prior to beginning treatment. Tumors or cancers that
do not have K-Ras mutation or N-Ras mutation indicate that the patients will likely
be responsive to the FTI treatment. In some examples patients are selected for FTI
treatment based on the lack of K-Ras mutation or N-Ras mutation. In some examples
patients are selected for FTI treatment based on the lack of K-Ras mutation and N-Ras
mutation. In some embodiments, patients are further selected based on the presence
of H-Ras mutation. The mutation status of Ras can be detected at the nucleic acid
or protein level. In some embodiments, the Ras mutation status is determined by analyzing
nucleic acids obtained from the sample. In some embodiments, the Ras mutation status
is determined by analyzing protein obtained from the sample.
[0425] Techniques can be used in methods provided herein include in situ hybridization (
Stoler, Clin. Lab. Med. 12:215- 36 (1990), using radioisotope or fluorophore-labeled probes; polymerase chain reaction (PCR);
quantitative Southern blotting, dot blotting and other techniques for quantitating
individual genes. In some embodiments, probes or primers selected for gene amplification
evaluation are highly specific to avoid detecting closely related homologous genes.
Alternatively, antibodies can be employed that can recognize specific duplexes, including
DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The
antibodies in turn can be labeled and the assay may be carried out where the duplex
is bound to a surface, so that upon the formation of duplex on the surface, the presence
of antibody bound to the duplex can be detected.
[0426] In some embodiments, the Ras mutation status is determined by analyzing nucleic acids
obtained from the sample. The nucleic acids may be mRNA or genomic DNA molecules from
the test subject. Methods for determining Ras mutation status by analyzing nucleic
acids are well known in the art. In some embodiments, the methods include sequencing,
Polymerase Chain Reaction (PCR), DNA microarray, Mass Spectrometry (MS), Single Nucleotide
Polymorphism (SNP) assay, denaturing high-performance liquid chromatography (DHPLC),
or Restriction Fragment Length Polymorphism (RFLP) assay. In some embodiments, the
Ras mutation status is determined using standard sequencing methods, including, for
example, Sanger sequencing, next generation sequencing (NGS). In some embodiments,
the Ras mutation status is determined using MS.
[0427] In some embodiments, the method includes determining the presence or absence of a
Ras mutation by amplifying Ras nucleic acid from a sample by PCR. For example, PCR
technology and primer pairs that can be used are known to the person skilled in the
art. (
e.
g.,
Chang et al., Clinical Biochemistry, 43 (2010), 296-301;
WO2015144184). For example, a multiplex PCR can be used to amplify codons 12 and 13 of exon 2
and codon 61 of exon 3 of N-, H-, or K-Ras genes with two pairs of universal primers
for exons 2 and 3. For example, the following primers can be used:
| SEQ ID NO |
Exon |
Primer Sequence |
| 21 |
2 |
5'-CYKRBKDRMRATGACKGARTAYAARCTKGTGGT-3' |
| 22 |
2 |
5'-ACCTCTATDGTKGGRTCRTATTC-3' |
| 23 |
3 |
5'-CAGGATTCYTACMGRAARCARGT-3' |
| 24 |
4 |
5'-TTKATGGCAAAYACACAVAGRAAGC -3' |
[0428] As used herein, the letters are used according to the IUPAC notation, e.g. "Y" denotes
pyrimidine, "K"denotes keto, e.g. G or C, "R"denotes purine, "B" C, G, or T, "D" denotes
A, G, or T, "M" denotes A, C, "V" denotes A, C, or G.
[0429] Following multiplex PCR amplification, the products can be purified to remove the
primers and unincorporated deoxynucleotide triphosphates using PCR-M™ Clean Up System
(Viogenebiotek Co., Sunnyvale, CA, USA). Purified DNA can then be semiquantified on
a 1 % agarose gel in 0.5xTBE and visualized by staining with ethidium bromide. The
products can then be subjected to primer extension analysis using primers as disclosed
in
Chang et al., Clinical Biochemistry 43 (2010), 296-301,
e.g., such as the following:
| SEQ ID NO |
RAS |
Primer Sequence |
| 25 |
K |
5'-AACTTGTGGTAGTTGGAGCT |
| 26 |
K |
5'-ACTGAATATAAACTTGTGGTAGTTGGAGCTG |
| 27 |
K |
 |
| 28 |
K |
 |
| 29 |
K |
 |
| 30 |
K |
 |
| 31 |
K |
5'-T45ATTCTCGACACAGCAGGTCA |
| 32 |
N |
5'-AACTGGTGGTGGTTGGAGCA-3' |
| 33 |
N |
5'-T7AACTGGTGGTGGTTGGAGCAG-3' |
| 34 |
N |
5'-T14AGTGCGCTTTTCCCAACAC-3' |
| 35 |
N |
5'-T22GTGGTGGTTGGAGCAGGTG-3' |
| 36 |
N |
5'-T29CTCATGGCACTGTACTCTTCTT-3' |
| 37 |
N |
5'-T36CTCATGGCACTGTACTCTTCT-3' |
| 38 |
N |
5'-T43CTCTCATGGCACTGTACTCTTC-3' |
| 39 |
H |
5'-AGCTGGTGGTGGTGGGCGCC-3' |
| 40 |
H |
5'-T7AGCTGGTGGTGGTGGGCGCCG-3' |
| 41 |
H |
5'-T14TGGTGGTGGTGGGCGCCGGC-3' |
| 42 |
H |
5'-T22GTGGTGGTGGGCGCCGGCG-3' |
| 43 |
H |
5'-T29ACATCCTGGATACCGCCGGC-3' |
| 44 |
H |
5'-T36ACATCCTGGATACCGCCGGCC-3' |
| 45 |
H |
5'-T43CGCATGGCGCTGTACTCCTC-3' |
[0430] Various concentrations of probe for either codon 12, 13, or 61 can be employed (e.g.
0.03 - 0.6 µM) in the reactions containing 1.5 µl of purified PCR products, as well
as 4 µI of ABI PRISM SNaPshot Multiplex Kit (Applied Biosystems, Foster City, CA)
containing AmpliTaq® DNA polymerase and fluorescently labeled dideoxynucleotide triphosphates
(ddNTPs) (RGG-labeled dideoxyadenosine triphosphate, TAMRA-labeled dideoxycytidine
triphosphate, ROX-labeled dideoxythymidine triphosphate, and R1 10-labeled dideoxyguanosine
triphosphate). Each 10-µI mixture can then be subjected to 25 single-base extension
cycles consisting of a denaturing step at 96 °C for 10 s and primer annealing and
extension at 55 °C for 35 s. After cycle extension, unincorporated fluorescent ddNTPs
can then be incubated with 1 µI of shrimp alkaline phosphatase (United States Biochemical
Co., Cleveland, USA) at 37 °C for 1 h, followed by enzyme deactivation at 75 °C for
15 min. The primer extension reaction products can then be resolved by automated capillary
electrophoresis on a capillaryelectrophoresis platform, e.g. 14 µl of Hi-Di™ Formamide
(Applied Biosystems) and 0.28 µl of GeneScan™- 120LIZ® Size Standard (Applied Biosystems)
were added to 6 µI of primer extension products. All samples may then e.g. be analyzed
on an ABI Prism 310 DNA Genetic Analyzer (Applied Biosystems) according to manufacturer's
instructions using GeneScan™ 3.1 (Applied Biosystems).
[0431] Disclosed herin are methods of selecting a cancer patient who is likely to benefit
from an FTI treatment, include determining the presence or absence of a Ras mutation
by amplifying Ras nucleic acid from the patient's tumor sample and sequencing the
amplified nucleic acid. Accordingly, Ras nucleic acid can be amplified using primers
as disclosed above and sequenced. For example, K-Ras, N-Ras and H-Ras nucleic acid
can be amplified by PCR as disclosed above and subsequently subcloned using
e.g. the TOPO TA Cloning Kit for sequencing (Invitrogen).
[0432] In the above method, RAS nucleic acid can be obtained from the patient's tumor sample
by any method known to the person skilled in the art. For example, any commercial
kit may be used to isolate the genomic DNA, or mRNA from a tumor sample, such as
e.g. the Qlamp DNA mini kit, or RNeasy mini kit (Qiagen, Hilden, Germany). For example,
if mRNA was isolated from the patient's tumor sample, cDNA synthesis can be carried
out prior to the methods as disclosed herein, according to any known technology in
the art.
[0433] For example, the nucleic acid to be isolated from a tumor can for example be one
of genomic DNA, total RNA, mRNA or poly(A)+ mRNA. For example, if mRNA has been isolated
from the the patient's tumor sample, the mRNA (total mRNA or poly(A)+ mRNA) may be
used for cDNA synthesis according to well established technologies in prior art, such
as those provided in commercial cDNA synthesis kits,
e.
g. Superscript® III First Strand Synthesis Kit. The cDNA can then be further amplified
by means of
e.g. PCR and subsequently subjected to sequencing by
e.g. Sanger sequencing or pyro-sequencing to determine the nucleotide sequence of
e.g. codons 12 and 13 of the RAS gene,
e.g. H-RAS, N-RAS or KRAS. Alternatively, the PCR product can
e.g. also be subcloned into a TA TOPO cloning vector for sequencing. Other technologies
than sequencing to determine the absence or presence of Ras mutations can be used
in the methods provided herein such as
e.g. Single Nucleotide Primer Extension (SNPE) (
PLoS One. 2013 Aug 21 ;8(8):e72239); DNA microarray, Mass Spectrometry (MS) (e.g. matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF) mass spectrometry), Single Nucleotide Polymorphism (SNP),
denaturing high-performance liquid chromatography (DHPLC), or Restriction Fragment
Length Polymorphism (RFLP) assay.
[0434] For example, Single Nucleotide Polymorphism (SNP) Assay can be used for determining
the Ras mutation status in a sample. The SNP assay can be performed on the HT7900
from Applied Biosystems, following the allelic discrimination assay protocol provided
by the manufacturer. Ras mutation status can also be determined by DHPLC or RFLP,
or any other methods known in the art.
Bowen et al., Blood, 106:2113-2119 (2005);
Bowen et al., Blood, 101:2770-2774 (2003);
Nishikawa et al., Clin Chim Acta., 318:107-112 (2002);
Lin SY et al., Am J Clin Pathol. 100:686-689 (1993);
O'Leary JJ et al., J Clin Pathol. 51:576-582 (1998).
[0435] In some embodiments, the Ras mutation status is determined by analyzing protein obtained
from the sample. The mutated Ras protein can be detected by a variety of immunohistochemistry
(IHC) approaches or other immunoassay methods known in the art. IHC staining of tissue
sections has been shown to be a reliable method of assessing or detecting presence
of proteins in a sample. Immunohistochemistry techniques utilize an antibody to probe
and visualize cellular antigens in situ, generally by chromogenic or fluorescent methods.
Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably
monoclonal antibodies that specifically target mutant K-Ras or N-Ras can be used to
detect expression. As discussed in greater detail below, the antibodies can be detected
by direct labeling of the antibodies themselves, for example, with radioactive labels,
fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish
peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used
in conjunction with a labeled secondary antibody, comprising antisera, polyclonal
antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry
protocols and kits are well known in the art and are commercially available. Automated
systems for slide preparation and IHC processing are available commercially. The Ventana®
BenchMark XT system is an example of such an automated system.
[0436] Standard immunological and immunoassay procedures can be found in
Basic and Clinical Immunology (Stites & Terr eds., 7th ed. 1991). Moreover, the immunoassays can be performed in any of several configurations, which
are reviewed extensively in
Enzyme Immunoassay (Maggio, ed., 1980); and Harlow & Lane, supra. For a review of the general immunoassays, see also
Methods in Cell Biology: Antibodies in Cell Biology, volume 37 (Asai, ed. 1993);
Basic and Clinical Immunology (Stites & Ten, eds., 7th ed. 1991).
[0437] Assays to detect K-Ras mutations or N-Ras mutations include noncompetitive assays,
e.g., sandwich assays, and competitive assays. Typically, an assay such as an ELISA
assay can be used. ELISA assays are known in the art, e.g., for assaying a wide variety
of tissues and samples, including blood, plasma, serum or bone marrow.
[0438] A wide range of immunoassay techniques using such an assay format are available,
see, e.g.,
U.S. Pat. Nos. 4,016,043,
4,424,279, and
4,018,653. These include both single-site and two-site or "sandwich" assays of the non-competitive
types, as well as in the traditional competitive binding assays. These assays also
include direct binding of a labeled antibody to a target mutant Ras protein. Sandwich
assays are commonly used assays. A number of variations of the sandwich assay technique
exist. For example, in a typical forward assay, an unlabelled antibody is immobilized
on a solid substrate, and the sample to be tested brought into contact with the bound
molecule. After a suitable period of incubation, for a period of time sufficient to
allow formation of an antibody-antigen complex, a second antibody specific to the
antigen, labeled with a reporter molecule capable of producing a detectable signal
is then added and incubated, allowing time sufficient for the formation of another
complex of antibody-antigen-labeled antibody. Any unreacted material is washed away,
and the presence of the antigen is determined by observation of a signal produced
by the reporter molecule. The results may either be qualitative, by simple observation
of the visible signal, or may be quantitated by comparing with a control sample.
[0439] Variations on the forward assay include a simultaneous assay, in which both sample
and labeled antibody are added simultaneously to the bound antibody. These techniques
are well known to those skilled in the art, including any minor variations as will
be readily apparent. In a typical forward sandwich assay, a first antibody having
specificity for the mutant Ras protein is either covalently or passively bound to
a solid surface. The solid surface may be glass or a polymer, the most commonly used
polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride,
or polypropylene. The solid supports may be in the form of tubes, beads, discs of
microplates, or any other surface suitable for conducting an immunoassay. The binding
processes are well-known in the art and generally consist of cross-linking covalently
binding or physically adsorbing, the polymer-antibody complex is washed in preparation
for the test sample. An aliquot of the sample to be tested is then added to the solid
phase complex and incubated for a period of time sufficient (e.g. 2-40 minutes or
overnight if more convenient) and under suitable conditions (e.g., from room temperature
to 40°C. such as between 25°C and 32 °C inclusive) to allow binding of any subunit
present in the antibody. Following the incubation period, the antibody subunit solid
phase is washed and dried and incubated with a second antibody specific for a portion
of the mutant Ras protein. The second antibody is linked to a reporter molecule which
is used to indicate the binding of the second antibody to the mutant Ras protein.
[0440] In some examples flow cytometry (FACS) can be used to detect the mutant K-Ras or
N-Ras using antibodies specific target the mutant K-Ras or N-Ras. The flow cytometer
detects and reports the intensity of the fluorichrome-tagged antibody, which indicates
the presence of the mutant K-Ras or N-Ras. Non-fluorescent cytoplasmic proteins can
also be observed by staining permeablized cells. The stain can either be a fluorescence
compound able to bind to certain molecules, or a fluorichrome-tagged antibody to bind
the molecule of choice.
[0441] An alternative method involves immobilizing the target Ras protein in the sample
and then exposing the immobilized target to mutant specific antibody which may or
may not be labeled with a reporter molecule. Depending on the amount of target and
the strength of the reporter molecule signal, a bound target can be detectable by
direct labeling with the antibody. Alternatively, a second labeled antibody, specific
to the first antibody is exposed to the target-first antibody complex to form a target-first
antibody-second antibody tertiary complex. The complex is detected by the signal emitted
by a labeled reporter molecule.
[0442] In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody,
generally by means of glutaraldehyde or periodate. As will be readily recognized,
however, a wide variety of different conjugation techniques exist, which are readily
available to the skilled artisan. Commonly used enzymes include horseradish peroxidase,
glucose oxidase, beta-galactosidase, and alkaline phosphatase, and other are discussed
herein. The substrates to be used with the specific enzymes are generally chosen for
the production, upon hydrolysis by the corresponding enzyme, of a detectable color
change. Examples of suitable enzymes include alkaline phosphatase and peroxidase.
It is also possible to employ fluorogenic substrates, which yield a fluorescent product
rather than the chromogenic substrates noted above. In all cases, the enzyme-labeled
antibody is added to the first antibody-molecular marker complex, allowed to bind,
and then the excess reagent is washed away. A solution containing the appropriate
substrate is then added to the complex of antibody-antigen-antibody. The substrate
will react with the enzyme linked to the second antibody, giving a qualitative visual
signal, which may be further quantitated, usually spectrophotometrically, to give
an indication of the amount of mutant Ras protein which was present in the sample.
Alternately, fluorescent compounds, such as fluorescein and rhodamine, can be chemically
coupled to antibodies without altering their binding capacity. When activated by illumination
with light of a particular wavelength, the fluorochrome-labeled antibody adsorbs the
light energy, inducing a state to excitability in the molecule, followed by emission
of the light at a characteristic color visually detectable with a light microscope.
As in the EIA, the fluorescent labeled antibody is allowed to bind to the first antibody-molecular
marker complex. After washing off the unbound reagent, the remaining tertiary complex
is then exposed to the light of the appropriate wavelength, the fluorescence observed
indicates the presence of the molecular marker of interest. Immunofluorescence and
EIA techniques are both very well established in the art and are discussed herein.
[0443] In some embodiments, the determination of the Ras mutation status is performed as
a companion diagnostic to the FTI treatment. The companion diagnostic can be performed
at the clinic site where the subject is treated. The companion diagnostic can also
be performed at a site separate from the clinic site where the subject is treated.
[0444] As a person of ordinary skill in the art would understand, methods disclosed herein
are for predicting responsiveness of a cancer patient to an FTI treatment, methods
for cancer patient population selection for an FTI treatment, and methods for treating
cancer in a subject with a therapeutically effective amount of an FTI, based on the
mutation status of Ras in a sample from the patient. Any methods described herein
or otherwise known in the art for determining the mutation status of Ras can be applied
in the methods.
4.2. Samples
[0445] In some examples methods disclosed herein include obtaining a sample from the subject.
The sample used in the methods provided herein includes body fluids from a subject.
Non-limiting examples of body fluids include blood (
e.
g., peripheral whole blood, peripheral blood), blood plasma, bone marrow, amniotic
fluid, aqueous humor, bile, lymph, menses, serum, urine, cerebrospinal fluid surrounding
the brain and the spinal cord, synovial fluid surrounding bone joints.
[0446] In one embodiment, the sample is a bone marrow sample. Procedures to obtain a bone
marrow sample are well known in the art, including but not limited to bone marrow
biopsy and bone marrow aspiration. Bone marrow has a fluid portion and a more solid
portion. In bone marrow biopsy, a sample of the solid portion is taken. In bone marrow
aspiration, a sample of the fluid portion is taken. Bone marrow biopsy and bone marrow
aspiration can be done at the same time and referred to as a bone marrow exam.
[0447] In some embodiments, the sample is a blood sample. The blood sample can be obtained
using conventional techniques as described in,
e.g. Innis et al, editors, PCR Protocols (Academic Press, 1990). White blood cells can be separated from blood samples using convention techniques
or commercially available kits,
e.
g. RosetteSep kit (Stein Cell Technologies, Vancouver, Canada). Sub-populations of
white blood cells,
e.
g. mononuclear cells, NK cells, B cells, T cells, monocytes, granulocytes or lymphocytes,
can be further isolated using conventional techniques,
e.
g. magnetically activated cell sorting (MACS) (Miltenyi Biotec, Auburn, California)
or fluorescently activated cell sorting (FACS) (Becton Dickinson, San Jose, California).
[0448] In one embodiment, the blood sample is from about 0.1 mL to about 10.0 mL, from about
0.2 mL to about 7 mL, from about 0.3 mL to about 5 mL, from about 0.4 mL to about
3.5 mL, or from about 0.5 mL to about 3 mL. In another embodiment, the blood sample
is about 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5,
5.0, 6.0, 7.0, 8.0, 9.0 or 10.0 mL.
[0449] In some embodiments, the sample used in the present methods includes a biopsy (e.g.,
a tumor biopsy). The biopsy can be from any organ or tissue, for example, skin, liver,
lung, heart, colon, kidney, bone marrow, teeth, lymph node, hair, spleen, brain, breast,
or other organs. Any biopsy technique known by those skilled in the art can be used
for isolating a sample from a subject, for instance, open biopsy, close biopsy, core
biopsy, incisional biopsy, excisional biopsy, or fine needle aspiration biopsy.
[0450] In certain embodiments, the sample used in the methods provided herein includes a
plurality of cells. Such cells can include any type of cells,
e.
g., stem cells, blood cells (
e.
g., PBMCs), lymphocytes, NK cells, B cells, T cells, monocytes, granulocytes, immune
cells, or tumor or cancer cells. Specific cell populations can be obtained using a
combination of commercially available antibodies (e.g., Quest Diagnostic (San Juan
Capistrano, Calif.); Dako (Denmark)).
[0451] In certain embodiments, the sample used in the methods provided herein is from a
diseased tissue,
e.
g., from an individual having cancer (
e.
g., lymphoma, MDS, or leukemia). In some embodiments, the cells can be obtained from
the tumor or cancer cells or a tumor tissue, such as a tumor biopsy or a tumor explants.
In certain embodiments, the number of cells used in the methods provided herein can
range from a single cell to about 10
9 cells. In some embodiments, the number of cells used in the methods provided herein
is about 1 x 10
4, 5 x 10
4, 1 x 10
5, 5 x 10
5, 1 x 10
6, 5 x 10
6, 1 x 10
7, 5 x 10
7, 1 x 10
8, or 5 x 10
8.
[0452] The number and type of cells collected from a subject can be monitored, for example,
by measuring changes in morphology and cell surface markers using standard cell detection
techniques such as flow cytometry, cell sorting, immunocytochemistry (
e.
g., staining with tissue specific or cell-marker specific antibodies) fluorescence
activated cell sorting (FACS), magnetic activated cell sorting (MACS), by examination
of the morphology of cells using light or confocal microscopy, and/or by measuring
changes in gene expression using techniques well known in the art, such as PCR and
gene expression profiling. These techniques can be used, too, to identify cells that
are positive for one or more particular markers. Fluorescence activated cell sorting
(FACS) is a well-known method for separating particles, including cells, based on
the fluorescent properties of the particles (
Kamarch, 1987, Methods Enzymol, 151:150-165). Laser excitation of fluorescent moieties in the individual particles results in
a small electrical charge allowing electromagnetic separation of positive and negative
particles from a mixture. In one embodiment, cell surface marker-specific antibodies
or ligands are labeled with distinct fluorescent labels. Cells are processed through
the cell sorter, allowing separation of cells based on their ability to bind to the
antibodies used. FACS sorted particles may be directly deposited into individual wells
of 96-well or 384-well plates to facilitate separation and cloning.
[0453] In certain embodiments, subsets of cells are used in the methods provided herein.
Methods to sort and isolate specific populations of cells are well-known in the art
and can be based on cell size, morphology, or intracellular or extracellular markers.
Such methods include, but are not limited to, flow cytometry, flow sorting, FACS,
bead based separation such as magnetic cell sorting, size-based separation (
e.
g., a sieve, an array of obstacles, or a filter), sorting in a microfluidics device,
antibody-based separation, sedimentation, affinity adsorption, affinity extraction,
density gradient centrifugation, laser capture microdissection,
etc.
[0454] The sample can be a whole blood sample, a bone marrow sample, a partially purified
blood sample, or PBMC. The sample can be a tissue biopsy or a tumor biopsy. In some
embodiments, the sample is a bone marrow sample from a cancer patient. In some embodiments,
the sample is PBMCs from a cancer patient.
4.3 Cancers
[0455] Disclosed herein is an FTI for use in methods to treat a cancer in a subject with
the FTI, and methods for selecting cancer patients for an FTI treatment based on the
lack of K-Ras mutation and N-Ras mutation. The cancer can be a hematopoietic cancer
or a solid tumor. Disclosed herein are also methods to treat a premalignant condition
in a subject with an FTI, and methods for selecting patients with a premalignant condition
for an FTI treatment based on the lack of K-Ras mutation and N-Ras mutation.
[0456] In some examples, disclosed herein is an FTI for use in methods to treat a solid
tumor with the FTI based on the lack of K-Ras mutation and N-Ras mutation. Solid tumors
are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid
tumors can be benign or malignant. Different types of solid tumors are named for the
type of cells that form them (such as sarcomas, carcinomas, and lymphomas). The solid
tumor to be treated can be sarcomas and carcinomas, include fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma,
Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy,
pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular
carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas
sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder
carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem glioma and
mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma,
CNS lymphoma, germinoma, meduloblastoma, Schwannoma craniopharyogioma, ependymoma,
pineaioma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma,
retinoblastoma and brain metastases). In some embodiments, the FTI is tipifarnib.
[0457] In some examples, disclosed herein is an FTI for use in methods to treat a solid
tumor with the FTI based on the lack of K-Ras mutation and N-Ras mutation, wherein
the solid tumor is malignant melanoma, adrenal carcinoma, breast carcinoma, renal
cell cancer, carcinoma of the pancreas, non-small-cell lung carcinoma (NSCLC) or carcinoma
of unknown primary. In some examples the FTI is tipifarnib. Drugs commonly administered
to patients with various types or stages of solid tumors include, but are not limited
to, celebrex, etoposide, cyclophosphamide, docetaxel, apecitabine, IFN, tamoxifen,
IL-2, GM-CSF, or a combination thereof.
[0458] In some examples the solid tumor to be treated by methods disclosed herein can be
thyroid cancer, urothelial cancers, salivary cancers, cancers of the upper digestive
tract, bladder cancer, breast cancer, ovarian cancer, brain cancer, gastric cancer,
prostate cancer, lung cancer, colon cancer, skin cancer, liver cancer, and pancreatic
cancer. In some examples the bladder cancer to be treated by methods provided herein
can be transitional cell carcinoma. According to to the invention the cancer is head
and neck squemous cell carcinoma (HNSCC). In some embodiments, the FTI is tipifarnib.
[0459] In some examples the solid tumor to be treated by methods disclosed herein can be
selected from the groups consisting of carcinoma, melanoma, sarcoma, or chronic granulomatous
disease.
[0460] In some examples the premalignant conditions to be treated by methods disclosed herein
can be actinic cheilitis, Barrett's esophagus, atrophic gastritis, ductal carcinoma
in situ, Dyskeratosis congenita, Sideropenic dysphagia, Lichen planus, Oral submucous
fibrosis, Solar elastosis, cervical dysplasia, polyps, leukoplakia, erythroplakia,
squamous intraepithelial lesion, a pre-malignant disorder, or a pre-malignant immunoproliferative
disorder.
[0461] In some examples, disclosed herein is an FTI for use in methods to treat a hematopoietic
cancer in a subject with the FTI or selecting cancer patients for an FTI treatment
based on the lack of K-Ras mutation and N-Ras mutation. Hematologic cancers are cancers
of the blood or bone marrow. Examples of hematological (or hematogenous) cancers include
myeloproliferative neoplasm (MPN), myelodysplastic syndrome (MDS), leukemia, and lymphoma.
In some examples the cancer is acute myeloid leukemia (AML), natural killer cell lymphoma
(NK lymphoma), natural killer cell leukemia (NK leukemia), cutaneous T-Cell lymphoma
(CTCL), juvenile myelomonocytic leukemia (JMML), peripheral T-cell lymphoma (PTCL),
chronic myeloid leukemia (CML) or chronic myelomonocytic leukemia (CMML). In some
examples the cancer is CMML. In some examples the cancer is JMML.
[0462] In some examples, disclosed herein is an FTI for use in methods to treat CMML in
a subject with the FTI or selecting CMML patients for an FTI treatment based on the
lack of K-Ras mutation and N-Ras mutation. CMML is classified as a myelodysplastic/myeloproliferative
neoplasm by the 2008 World Health Organization classification of hematopoietic tumors.
The CMML can be myelodysplastic CMML or myeloproliferative CMML. CMML patients have
a high number of monocytes in their blood (at least 1,000 per mm
3). Two classes-myelodysplastic and myeloproliferative-have been distinguished upon
the level of the white blood cell count (threshold 13 G/L). Often, the monocyte count
is much higher, causing their total white blood cell count to become very high as
well. Usually there are abnormal cells in the bone marrow, but the amount of blasts
is below 20%. About 15% to 30% of CMML patients go on to develop acute myeloid leukemia.
The diagnosis of CMML rests on a combination of morphologic, histopathologic and chromosomal
abnormalities in the bone marrow. The Mayo prognostic model classified CMML patients
into three risk groups based on: increased absolute monocyte count, presence of circulating
blasts, hemoglobin <10 gm/dL and platelets <100 × 10
9/L. The median survival was 32 months, 18.5 months and 10 months in the low, intermediate,
and high-risk groups, respectively. The Groupe Francophone des (GFM) score segregated
CMML patients into three risk groups based on: age >65 years, WBC >15 × 10
9/L, anemia, platelets <100 × 10
9/L, and ASXL1 mutation status. After a median follow-up of 2.5 years, survival ranged
from not reached in the low-risk group to 14.4 months in the high-risk group.
[0463] In some examples, disclosed herein is an FTI for use in methods of treating CMML
in a subject by determining the presence or absence of a K-Ras mutation and a N-Ras
mutation in a sample from the subject, and subsequently administering a therapeutically
effective amount of the FTI to the subject if the sample is determined to lack a K-Ras
mutation and to lack N-Ras mutation. In some examples the FTI is tipifarnib. In some
examples the sample is determined to have wild type K-Ras and wild type N-Ras.
[0464] In some examples, disclosed herein is an FTI for use in methods of treating CMML
in a subject by determining the presence or absence of a K-Ras mutation in a sample
from the subject, and subsequently administering a therapeutically effective amount
of the FTI to the subject if the sample is determined to lack the K-Ras mutation.
In some examples the FTI is tipifarnib. In some examples the sample is determined
to have wild type K-Ras.
[0465] In some examples, disclosed herein is an FTI for use in methods of treating CMML
in a subject by determining the presence or absence of a N-Ras mutation in a sample
from the subject, and subsequently administering a therapeutically effective amount
of the FTI to the subject if the sample is determined to lack the N-Ras mutation.
In some examples the FTI is tipifarnib. In some examples the sample is determined
to have wild type N-Ras.
[0466] In some examples, disclosed herein is an FTI for use in methods of treating CMML
in a subject by determining the presence or absence of a K-Ras mutation and a N-Ras
mutation in a sample from the subject, and subsequently administering tipifarnib to
the subject if the sample is determined to have wild type K-Ras and wild type N-Ras.
[0467] In some examples, disclosed herein is an FTI for use in methods to treat MDS in a
subject with the FTI or selecting MDS patients for an FTI treatment. MDS refers to
a diverse group of hematopoietic stem cell disorders. MDS can be characterized by
a cellular marrow with impaired morphology and maturation (dysmyelopoiesis), ineffective
blood cell production, or hematopoiesis, leading to low blood cell counts, or cytopenias
(including anemia, leukopenia, and thrombocytopenia), and high risk of progression
to acute myeloid leukemia, resulting from ineffective blood cell production.
See The Merck Manual 953 (17th ed. 1999) and
List et al., 1990, J Clin. Oncol. 8:1424.
[0468] MDS can be divided into a number of subtypes depending on at least 1) whether increased
numbers of blast cells are present in bone marrow or blood, and what percentage of
the marrow or blood is made up of these blasts; 2) whether the marrow shows abnormal
growth (dysplasia) in only one type of blood cell (unilineage dysplasia) or in more
than one type of blood cell (multilineage dysplasia); and 3) whether there are chromosome
abnormalities in marrow cells and, if so, which type or types of abnormalities. MDS
can also categorized based on the surface markers of the cancer cells. According to
the World Health Organization, MDS subtypes include refractory cytopenia with unilineage
dysplasia (RCUD), also known as refractory anemia, refractory neutropenia, or refractory
thrombocytopenia; refractory anemia with ring sideroblasts (RARS); refractory cytopenia
with multilineage dysplasia (RCMD), which includes RCMD-RS if multilineage dysplasia
and ring sideroblasts both are present; refractory anemia with excess blasts-1 (RAEB-1)
and refractory anemia with excess blasts-2 (RAEB-2) (These subtypes mean that the
patients have at least 5 percent (RAEB-1) or at least 10 percent (RAEB-2) but less
than 20 percent blasts in their marrow); MDS associated with isolated abnormality
of chromosome 5 [del(5q)]; and unclassifiable MDS (MDS-U).
[0469] As a group of hematopoietic stem cell malignancies with significant morbidity and
mortality, MDS is a highly heterogeneous disease, and the severity of symptoms and
disease progression can vary widely among patients. The current standard clinical
tool to evaluate risk stratification and treatment options is the revised International
Prognostic Scoring System, or IPSS-R. The IPSS-R differentiates patients into five
risk groups (Very Low, Low, Intermediate, High, Very High) based on evaluation of
cytogenetics, percentage of blasts (undifferentiated blood cells) in the bone marrow,
hemoglobin levels, and platelet and neutrophil counts. The WHO also suggested stratifying
MDS patients by a del (5q) abnormality.
[0470] According to the ACS, the annual incidence of MDS is approximately 13,000 patients
in the United States, the majority of which are 60 years of age or older. The estimated
prevalence is over 60,000 patients in the United States. Approximately 75% of patients
fall into the IPSS-R risk categories of Very Low, Low, and Intermediate, or collectively
known as lower risk MDS.
[0471] The initial hematopoietic stem cell injury can be from causes such as, but not limited
to, cytotoxic chemotherapy, radiation, virus, chemical exposure, and genetic predisposition.
A clonal mutation predominates over bone marrow, suppressing healthy stem cells. In
the early stages of MDS, the main cause of cytopenias is increased programmed cell
death (apoptosis). As the disease progresses and converts into leukemia, gene mutation
rarely occurs and a proliferation of leukemic cells overwhelms the healthy marrow.
The disease course differs, with some cases behaving as an indolent disease and others
behaving aggressively with a very short clinical course that converts into an acute
form of leukemia.
[0473] There are two subgroups of refractory anemia characterized by five percent or less
myeloblasts in bone marrow: (1) refractory anemia (RA) and; (2) RA with ringed sideroblasts
(RARS), defined morphologically as having 15% erythroid cells with abnormal ringed
sideroblasts, reflecting an abnormal iron accumulation in the mitochondria. Both have
a prolonged clinical course and low incidence of progression to acute leukemia.
Besa E. C., Med. Clin. North Am. 1992 May, 76(3): 599-617.
[0474] There are two subgroups of refractory anemias with greater than five percent myeloblasts:
(1) RA with excess blasts (RAEB), defined as 6-20% myeloblasts, and (2) RAEB in transformation
(RAEB-T), with 21-30% myeloblasts. The higher the percentage of myeloblasts, the shorter
the clinical course and the closer the disease is to acute myelogenous leukemia. Patient
transition from early to more advanced stages indicates that these subtypes are merely
stages of disease rather than distinct entities. Elderly patients with MDS with trilineage
dysplasia and greater than 30% myeloblasts who progress to acute leukemia are often
considered to have a poor prognosis because their response rate to chemotherapy is
lower than de novo acute myeloid leukemia patients. The fifth type of MDS, the most
difficult to classify, is CMML. This subtype can have any percentage of myeloblasts
but presents with a monocytosis of 1000/dL or more. It may be associated with splenomegaly.
This subtype overlaps with a myeloproliferative disorder and may have an intermediate
clinical course. It is differentiated from the classic CML that is characterized by
a negative Ph chromosome.
[0475] MDS is primarily a disease of elderly people, with the median onset in the seventh
decade of life. The median age of these patients is 65 years, with ages ranging from
the early third decade of life to as old as 80 years or older. The syndrome may occur
in any age group, including the pediatric population. Patients who survive malignancy
treatment with alkylating agents, with or without radiotherapy, have a high incidence
of developing MDS or secondary acute leukemia. About 60-70% of patients do not have
an obvious exposure or cause for MDS, and are classified as primary MDS patients.
[0476] In some examples, disclosed herein is an FTI for use in methods to treat MPN in a
subject with the FTI or selecting MPN patients for an FTI treatment. MPN is a group
of diseases that affect blood-cell formation. In all forms of MPN, stem cells in the
bone marrow develop genetic defects (called acquired defects) that cause them to grow
and survive abnormally. This results in unusually high numbers of blood cells in the
bone marrow (hypercellular marrow) and in the bloodstream. Sometimes in MPN, the abnormal
stem cells cause scarring in the marrow, called myelofibrosis. Myelofibrosis can lead
to low levels of blood cells, especially low levels of red blood cells (anemia). In
MPN, the abnormal stem cells can also grow in the spleen, causing the spleen to enlarge
(splenomegaly), and in other sites outside the marrow, causing enlargement of other
organs.
[0477] There are several types of chronic MPN, based on the cells affected. Three classic
types of MPN include polycythemia vera (PV), in which there are too many RBCs; essential
thrombocythemia (ET), in which there are too many platelets; primary myelofibrosis
(PMF), in which fibers and blasts (abnormal stem cells) build up in the bone marrow.
Other types of MPN include: chronic myeloid leukemia, in which there are too many
white blood cells; chronic neutrophilic leukemia, in which there are too many neutrophils;
chronic eosinophilic leukemia, not otherwise specified, in which there are too many
eosinophils (hypereosinophilia); mastocytosis, also called mast cell disease, in which
there are too many mast cells, which are a type of immune system cell found in tissues,
like skin and digestive organs, rather than in the bloodstream; myeloid and lymphoid
neoplasms with eosinophilia and abnormalities of the PDGFRA, PDGFRB, and FGFR1 genes;
and other unclassifiable myeloproliferative neoplasms.
[0478] In some examples, disclosed herein is an FTI for use in methods to treat leukemia
in a subject with the FTI or selecting leukemia patients for an FTI treatment. Leukemia
refers to malignant neoplasms of the blood-forming tissues. Various forms of leukemias
are described, for example, in
U.S. Patent No. 7,393,862 and
U.S. provisional patent application no. 60/380,842, filed May 17, 2002. Although viruses reportedly cause several forms of leukemia in animals, causes of
leukemia in humans are to a large extent unknown.
The Merck Manual, 944-952 (17th ed. 1999). Transformation to malignancy typically occurs in a single cell through two or more
steps with subsequent proliferation and clonal expansion. In some leukemias, specific
chromosomal translocations have been identified with consistent leukemic cell morphology
and special clinical features (e.g., translocations of 9 and 22 in chronic myelocytic
leukemia, and of 15 and 17 in acute promyelocytic leukemia). Acute leukemias are predominantly
undifferentiated cell populations and chronic leukemias more mature cell forms.
[0479] Acute leukemias are divided into lymphoblastic (ALL) and non-lymphoblastic (ANLL)
types.
The Merck Manual, 946-949 (17th ed. 1999). They may be further subdivided by their morphologic and cytochemical appearance
according to the French-American-British (FAB) classification or according to their
type and degree of differentiation. The use of specific B- and T-cell and myeloid-antigen
monoclonal antibodies are most helpful for classification. ALL is predominantly a
childhood disease which is established by laboratory findings and bone marrow examination.
ANLL, also known as acute myelogenous leukemia or AML, occurs at all ages and is the
more common acute leukemia among adults; it is the form usually associated with irradiation
as a causative agent. In some examples, disclosed herein is an FTI for use in methods
for treating a AML patient with the FTI, or methods for selecting patients for FTI
treatment.
[0480] Standard procedures treat AML patients usually include 2 chemotherapy (chemo) phases:
remission induction (or induction) and consolidation (post-remission therapy). The
first part of treatment (remission induction) is aimed at getting rid of as many leukemia
cells as possible. The intensity of the treatment can depend on a person's age and
health. Intensive chemotherapy is often given to people under the age of 60. Some
older patients in good health can benefit from similar or slightly less intensive
treatment. People who are much older or are in poor health are not suitable for intensive
chemotherapies.
[0481] In younger patients, such as those under 60, induction often involves treatment with
2 chemo drugs, cytarabine (ara-C) and an anthracycline drug such as daunorubicin (daunomycin)
or idarubicin. Sometimes a third drug, cladribine (Leustatin, 2-CdA), is given as
well. The chemo is usually given in the hospital and lasts about a week. In rare cases
where the leukemia has spread to the brain or spinal cord, chemo may also be given
into the cerebrospinal fluid (CSF). Radiation therapy might be used as well.
[0482] Induction is considered successful if remission is achieved. However, the AML in
some patients can be refractory to induction. In patients who respond to induction,
further treatment is then given to try to destroy remaining leukemia cells and help
prevent a relapse, which is called consolidation. For younger patients, the main options
for consolidation therapy are: several cycles of high-dose cytarabine (ara-C) chemo
(sometimes known as HiDAC); allogeneic (donor) stem cell transplant; and autologous
stem cell transplant.
[0483] Chronic leukemias are described as being lymphocytic (CLL) or myelocytic (CML).
The Merck Manual, 949-952 (17th ed. 1999). CLL is characterized by the appearance of mature lymphocytes in blood, bone marrow,
and lymphoid organs. The hallmark of CLL is sustained, absolute lymphocytosis (> 5,000/µL)
and an increase of lymphocytes in the bone marrow. Most CLL patients also have clonal
expansion of lymphocytes with B-cell characteristics. CLL is a disease of middle or
old age. In CML, the characteristic feature is the predominance of granulocytic cells
of all stages of differentiation in blood, bone marrow, liver, spleen, and other organs.
In the symptomatic patient at diagnosis, the total white blood cell (WBC) count is
usually about 200,000/µL, but may reach 1,000,000/µL. CML is relatively easy to diagnose
because of the presence of the Philadelphia chromosome. Bone marrow stromal cells
are well known to support CLL disease progression and resistance to chemotherapy.
Disrupting the interactions between CLL cells and stromal cells is an additional target
of CLL chemotherapy.
[0484] Additionally, other forms of CLL include prolymphocytic leukemia (PLL), Large granular
lymphocyte (LGL) leukemia, Hairy cell leukemia (HCL). The cancer cells in PLL are
similar to normal cells called prolymphocytes -- immature forms of B lymphocytes (B-PLL)
or T lymphocytes (T-PLL). Both B-PLL and T-PLL tend to be more aggressive than the
usual type of CLL. The cancer cells of LGL are large and have features of either T
cells or NK cells. Most LGL leukemias are slow-growing, but a small number are more
aggressive. HCL is another cancer of lymphocytes that tends to progress slowly, and
accounts for about 2% of all leukemias. The cancer cells are a type of B lymphocyte
but are different from those seen in CLL.
[0485] Juvenile myelomonocytic leukemia (JMML) is a serious chronic leukemia that affects
children mostly aged 4 and under. The average age of patients at diagnosis is 2 years
old. The World Health Organization has categorized JMML as a mixed myelodysplastic
and myeloproliferative disorder. The JMML encompasses diagnoses formerly referred
to as Juvenile Chronic Myeloid Leukemia (JCML), Chronic Myelomonocytic Leukemia of
Infancy, and Infantile Monosomy 7 Syndrome.
[0486] Lymphoma refers to cancers that originate in the lymphatic system. Lymphoma is characterized
by malignant neoplasms of lymphocytes-B lymphocytes (B cell lymphoma), T lymphocytes
(T-cell lymphoma), and natural killer cells (NK cell lymphoma). Lymphoma generally
starts in lymph nodes or collections of lymphatic tissue in organs including, but
not limited to, the stomach or intestines. Lymphoma may involve the marrow and the
blood in some cases. Lymphoma may spread from one site to other parts of the body.
[0487] The treatments of various forms of lymphomas are described, for example, in
U.S. Patent No. 7,468,363. Such lymphomas include, but are not limited to, Hodgkin's lymphoma, non-Hodgkin's
lymphoma, cutaneous B-cell lymphoma, activated B-cell lymphoma, Diffuse Large B-Cell
Lymphoma (DLBCL), mantle cell lymphoma (MCL), follicular lymphoma (FL; including but
not limited to FL grade I, FL grade II), follicular center lymphoma, transformed lymphoma,
lymphocytic lymphoma of intermediate differentiation, intermediate lymphocytic lymphoma
(ILL), diffuse poorly differentiated lymphocytic lymphoma (PDL), centrocytic lymphoma,
diffuse small-cleaved cell lymphoma (DSCCL), peripheral T-cell lymphomas (PTCL), cutaneous
T-Cell lymphoma (CTCL) and mantle zone lymphoma and low grade follicular lymphoma.
[0489] DLBCL accounts for approximately one-third of non-Hodgkin's lymphomas. While some
DLBCL patients are cured with traditional chemotherapy, the remainders die from the
disease. Anticancer drugs cause rapid and persistent depletion of lymphocytes, possibly
by direct apoptosis induction in mature T and B cells.
See K. Stahnke. et al., Blood 2001, 98:3066-3073. Absolute lymphocyte count (ALC) has been shown to be a prognostic factor in follicular
non-Hodgkin's lymphoma and recent results have suggested that ALC at diagnosis is
an important prognostic factor in DLBCL.
[0490] DLBCL can be divided into distinct molecular subtypes according to their gene profiling
patterns: germinal-center B-cell-like DLBCL (GCB-DLBCL), activated B-cell-like DLBCL
(ABC-DLBCL), and primary mediastinal B-cell lymphoma (PMBL) or unclassified type.
These subtypes are characterized by distinct differences in survival, chemo-responsiveness,
and signaling pathway dependence, particularly the NF-κB pathway.
See D. Kim et al., Journal of Clinical Oncology, 2007 ASCO Annual Meeting Proceedings
Part I. Vol 25, No. 18S (June 20 Supplement), 2007: 8082.
See Bea S, et al., Blood 2005; 106: 3183-90;
Ngo V.N. et al., Nature 2011; 470: 115-9. Such differences have prompted the search for more effective and subtype-specific
treatment strategies in DLBCL. In addition to the acute and chronic categorization,
neoplasms are also categorized based upon the cells giving rise to such disorder into
precursor or peripheral.
See e.g., U.S. patent Publication No. 2008/0051379. Precursor neoplasms include ALLs and lymphoblastic lymphomas and occur in lymphocytes
before they have differentiated into either a T- or B-cell. Peripheral neoplasms are
those that occur in lymphocytes that have differentiated into either T- or B-cells.
Such peripheral neoplasms include, but are not limited to, B-cell CLL, B-cell prolymphocytic
leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma, follicular lymphoma, extranodal
marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue, nodal marginal
zone lymphoma, splenic marginal zone lymphoma, hairy cell leukemia, plasmacytoma,
Diffuse large B-cell lymphoma (DLBCL) and Burkitt lymphoma. In over 95 percent of
CLL cases, the clonal expansion is of a B cell lineage.
See Cancer: Principles & Practice of Oncology (3rd Edition) (1989) (pp. 1843-1847). In less than 5 percent of CLL cases, the tumor cells have a T-cell phenotype. Notwithstanding
these classifications, however, the pathological impairment of normal hematopoiesis
is the hallmark of all leukemias.
[0491] PTCL consists of a group of rare and usually aggressive (fast-growing) NHLs that
develop from mature T-cells. PTCLs collectively account for about 4 to 10 percent
of all NHL cases, corresponding to an annual incidence of 2,800 - 7,200 patients per
year in the United States. By some estimates, the incidence of PTCL is growing significantly,
and the increasing incidence may be driven by an aging population. PTCLs are sub-classified
into various subtypes, each of which are typically considered to be separate diseases
based on their distinct clinical differences. Most of these subtypes are rare; the
three most common subtypes of PTCL not otherwise specified, anaplastic large-cell
lymphoma, or ALCL, and angioimmunoblastic T-cell lymphoma, that collectively account
for approximately 70 percent of all PTCLs in the United States. ALCL can be cutaneous
ALCL or systemic ALCL.
[0492] For most PTCL subtypes, the frontline treatment regimen is typically combination
chemotherapy, such as CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone),
EPOCH (etoposide, vincristine, doxorubicin, cyclophosphamide, prednisone), or other
multidrug regimens. Patients who relapse or are refractory to frontline treatments
are typically treated with gemcitabine in combination with other chemotherapies, including
vinorelbine (Navelbine®) and doxorubicin (Doxil®) in a regimen called GND, or other
chemotherapy regimens such as DHAP (dexamethasone, cytarabine, cisplatin) or ESHAP
(etoposide, methylprednisolone, cytarabine, and cisplatin).
[0493] Because most patients with PTCL will relapse, some oncologists recommend giving high-dose
chemotherapy followed by an autologous stem cell transplant to some patients who had
a good response to their initial chemotherapy. Recent, non-cytotoxic therapies that
have been approved for relapsed or refractory PTCL, such as pralatrexate (Folotyn®),
romidepsin (Istodax®) and belinostat (Beleodaq®), are associated with relatively low
objective response rates (25-27% overall response rate, or ORR) and relatively short
durations of response (8.2-9.4 months). Accordingly, the treatment of relapsed/refractory
PTCL remains a significant unmet medical need.
[0494] Multiple myeloma (MM) is a cancer of plasma cells in the bone marrow. Normally, plasma
cells produce antibodies and play a key role in immune function. However, uncontrolled
growth of these cells leads to bone pain and fractures, anemia, infections, and other
complications. Multiple myeloma is the second most common hematological malignancy,
although the exact causes of multiple myeloma remain unknown. Multiple myeloma causes
high levels of proteins in the blood, urine, and organs, including but not limited
to M-protein and other immunoglobulins (antibodies), albumin, and beta-2-microglobulin.
M-protein, short for monoclonal protein, also known as paraprotein, is a particularly
abnormal protein produced by the myeloma plasma cells and can be found in the blood
or urine of almost all patients with multiple myeloma.
[0495] Skeletal symptoms, including bone pain, are among the most clinically significant
symptoms of multiple myeloma. Malignant plasma cells release osteoclast stimulating
factors (including IL-1, IL-6 and TNF) which cause calcium to be leached from bones
causing lytic lesions; hypercalcemia is another symptom. The osteoclast stimulating
factors, also referred to as cytokines, may prevent apoptosis, or death of myeloma
cells. Fifty percent of patients have radiologically detectable myeloma-related skeletal
lesions at diagnosis. Other common clinical symptoms for multiple myeloma include
polyneuropathy, anemia, hyperviscosity, infections, and renal insufficiency.
[0496] Bone marrow stromal cells are well known to support multiple myeloma disease progression
and resistance to chemotherapy. Disrupting the interactions between multiple myeloma
cells and stromal cells is an additional target of multiple myeloma chemotherapy.
[0497] In some examples disclosed herein are methods for predicting responsiveness of a
MDS patient to an FTI treatment, methods for MDS patient population selection for
an FTI treatment, and methods for treating MDS in a subject with a therapeutically
effective amount of an FTI, based on the mutation status of Ras in a sample from the
patient. In some examples disclosed herein are methods for predicting responsiveness
of a MPN patient to an FTI treatment, methods for MDS patient population selection
for an FTI treatment, and methods for treating MPN in a subject with a therapeutically
effective amount of an FTI, based on the mutation status of Ras in a sample from the
patient. In some examples disclosed herein are methods for predicting responsiveness
of a AML patient to an FTI treatment, methods for AML patient population selection
for an FTI treatment, and methods for treating AML in a subject with a therapeutically
effective amount of an FTI, based on the mutation status of Ras in a sample from the
patient. In some examples disclosed herein are methods for predicting responsiveness
of a JMML patient to an FTI treatment, methods for JMML patient population selection
for an FTI treatment, and methods for treating JMML in a subject with a therapeutically
effective amount of an FTI, based on the mutation status of Ras in a sample from the
patient.
[0498] In some examples disclosed herein are methods for predicting responsiveness of a
CMML patient to an FTI treatment, methods for CMML patient population selection for
an FTI treatment, and methods for treating CMML in a subject with a therapeutically
effective amount of an FTI, based on the mutation status of Ras in a sample from the
patient. In some examples disclosed herein is a method of treating CMML in a subject
based on the mutation status of K-Ras, N-Ras, or both. The method disclosed herein
includes (a) determining the presence or absence of a Ras mutation in a sample from
the subject, wherein the Ras mutation includes a K-Ras mutation or a N-Ras mutation,
and subsequently (b) administering a therapeutically effective amount of an FTI to
said subject if said sample is determined to lack the K-Ras mutation or the N-Ras
mutation. In some examples, the sample is determined to not have any K-Ras mutation
or any N-Ras mutation. In some examples, the sample is determined to have wild type
K-Ras. In some examples the sample is determined to have wild type N-Ras. In some
examples the sample is determined to have wild type K-Ras and wild type N-Ras. In
some examples the FTI is tipifarnib.
[0499] In some examples disclosed herein are methods for predicting responsiveness of a
CMML patient to tipifarnib, methods for CMML patient population selection for tipifarnib
treatment, and methods for treating CMML in a subject with a therapeutically effective
amount of an tipifarnib, based on the mutation status of K-Ras and N-Ras in a sample
from the patient. In some examples disclosed herein is a method of treating CMML in
a subject based on the mutation status of K-Ras, N-Ras, or both. The method disclosed
herein includes (a) determining the presence or absence of a Ras mutation in a sample
from a subject having CMML, wherein the Ras mutation includes a K-Ras mutation or
a N-Ras mutation, and subsequently (b) administering a therapeutically effective amount
of tipifarnib to the subject if the sample is determined to lack the K-Ras mutation
or the N-Ras mutation. In some examples, the sample is determined to not have any
K-Ras mutation or any N-Ras mutation. In some examples, the sample is determined to
have wild type K-Ras. In some examples, the sample is determined to have wild type
N-Ras. In some examples, the sample is determined to have wild type K-Ras and wild
type N-Ras.
4.4. Exemplary FTIs and dosages
[0500] In some examples, disclosed herein is tipifarnib for use in a method of treating
a cancer in a subject based on the mutation status of K-Ras, N-Ras, or both. The method
disclosed herein includes (a) determining the presence or absence of a Ras mutation
in a sample from the subject, wherein the Ras mutation includes a K-Ras mutation or
a N-Ras mutation, and subsequently (b) administering a therapeutically effective amount
of tipifarnib to said subject if said sample is determined to lack the K-Ras mutation
or the N-Ras mutation. In some examples the sample is determined to have wild type
K-Ras. In some examples the sample is determined to have wild type N-Ras. In some
examples the sample is determined to have wild type K-Ras and wild type N-Ras. In
some examples the methods include administering the subject with another FTI described
herein or otherwise known in the art. In some examples the FTI is selected from the
group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0501] In some examples disclosed herein is tipifarnib for use in a method of treating a
hematological cancer in a subject based on the mutation status of K-Ras, N-Ras, or
both. The method disclosed herein includes (a) determining the presence or absence
of a Ras mutation in a sample from the subject, wherein the Ras mutation includes
a K-Ras mutation or a N-Ras mutation, and subsequently (b) administering a therapeutically
effective amount of tipifarnib to said subject if said sample is determined to lack
the K-Ras mutation or the N-Ras mutation. In some examples the sample is determined
to have wild type K-Ras. In some examples the sample is determined to have wild type
N-Ras. In some examples the sample is determined to have wild type K-Ras and wild
type N-Ras. In some examples the methods include administering the subject with another
FTI described herein or otherwise known in the art. In some examples the FTI is selected
from the group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0502] In some examples, disclosed herein is tipifarnib for use in a method of treating
CMML in a subject based on the mutation status of K-Ras, N-Ras, or both. The method
disclosed herein includes (a) determining the presence or absence of a Ras mutation
in a sample from the subject, wherein the Ras mutation includes a K-Ras mutation or
a N-Ras mutation, and subsequently (b) administering a therapeutically effective amount
of tipifarnib to said subject if said sample is determined to lack the K-Ras mutation
or the N-Ras mutation. In some examples the sample is determined to have wild type
K-Ras. In some examples the sample is determined to have wild type N-Ras. In some
examples the sample is determined to have wild type K-Ras and wild type N-Ras. In
some examples, the methods include administering the subject with another FTI described
herein or otherwise known in the art. In some examples the FTI is selected from the
group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0503] In some embodiments, tipifarnib is administered orally, parenterally, rectally, or
topically. In some embodiments, tipifarnib is administered orally.
[0504] In some embodiments, tipifarnib is administered at a dose of 1-1000 mg/kg body weight.
In some embodiments, tipifarnib is administered twice a day. In some embodiments,
tipifarnib is administered at a dose of 200-1200 mg twice a day. In some embodiments,
tipifarnib is administered at a dose of 600 mg twice a day. In some embodiments, tipifarnib
is administered at a dose of 900 mg twice a day.
[0505] In some embodiments, tipifarnib is administered in treatment cycles. In some embodiments,
tipifarnib is administered in alternative weeks. In some embodiments, tipifarnib is
administered on days 1-7 and 15-21 of a 28-day treatment cycle. In some embodiments,
tipifarnib is administered orally at a dose of 900 mg twice a day on days 1-7 and
15-21 of a 28-day treatment cycle.
[0506] In some embodiments, tipifarnib is administered for at least 3 cycles. In some embodiments,
tipifarnib is administered for at least 6 cycles. In some embodiments, tipifarnib
is administered for up to 12 cycles. In some embodiments, tipifarnib is administered
orally at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle for at least three cycles.
[0507] In some embodiments, provided herein are methods for treating CMML in a subject with
a therapeutically effective amount of an tipifarnib, based on the mutation status
of K-Ras in a sample from the patient. In some embodiments, provided herein is a method
of treating CMML in a subject including (a) determining a sample from the subject
to have wild type K-Ras, and subsequently (b) administering tipifarnib to the subject
at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment cycle.
[0508] In some examples, disclosed herein is tipifarnib for use in methods for treating
CMML in a subject with a therapeutically effective amount of an tipifarnib, based
on the mutation status of N-Ras in a sample from the patient. In some examples provided
herein is a method of treating CMML in a subject including (a) determining a sample
from the subject to have wild type N-Ras, and subsequently (b) administering tipifarnib
to the subject at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle.
[0509] In some examples disclosed herein is tipifarnib for use on methods for treating CMML
in a subject with a therapeutically effective amount of an tipifarnib, based on the
mutation status of K-Ras and N-Ras in a sample from the patient. In some examples
disclosed herein is a method of treating CMML in a subject including (a) determining
a sample from the subject to have wild type K-Ras and wild type N-Ras, and subsequently
(b) administering tipifarnib to the subject at a dose of 900 mg twice a day on days
1-7 and 15-21 of a 28-day treatment cycle.
5. Mutant H-Ras as Biomarkers for FTI Treatment
5.1. H-ras mutation status
[0510] The H-ras protein is involved in regulating cell division in response to growth factor
stimulation. Growth factors act by binding cell surface receptors that span the cell's
plasma membrane. Once activated, receptors stimulate signal transduction events in
the cytoplasm, a process by which proteins and second messengers relay signals from
outside the cell to the cell nucleus and instruct the cell to grow or divide. H-ras
is localized in the plasma membrane, and is an early player in many signal transduction
pathways. H-ras acts as a molecular on/off switch - once it is turned on it recruits
and activates proteins necessary for the propagation of the receptor's signal. In
certain tumors, mutations in H-ras or its upstream effectors cause it to be permanently
on, resulting in persistent activation of downstream growth and proliferation signals
that drive tumor cell growth. FTIs work to prevent the aberrant growth and proliferation
of cells that are dependent on these signaling pathways by inhibiting protein farnesylation
and subsequent membrane localization of H-ras, thereby switching H-ras off.
[0511] FTIs such as tipifarnib prevent protein farnesylation, a type of protein modification
known as prenylation, which along with other protein modifications, allows membrane
localization of H-ras where it can receive and transmit extracellular signals implicated
in cancer initiation and development. FTIs such as tipifarnib can block H-ras farnesylation
and subsequent membrane localization, and inhibit oncogenic, H-ras-driven cellular
transformation
in vitro and
in vivo. While K-ras and N-ras similarly utilize protein farnesylation, they can also utilize
a related prenylation pathway that also leads to membrane localization. Meanwhile,
H-ras membrane localization is solely dependent on protein farnesylation.
[0512] In some embodiments, the cancer to be treated by methods provided herein can have
H-ras mutations. In some embodiments, the cancer to be treated by methods provided
herein can be head and neck cancers, with H-ras mutation. Methods provided herein
or otherwise known in the art can be used to determine the mutation status of a ras
gene. In some embodiments, the mutation status of a ras gene can be determined an
NGS-based assay. In some embodiments, the mutation status of a ras gene can be determined
by a qualitative PCR-based assay. A qualitative PCR based assay can be technically
similar to the PCR-based assays already developed and approved by the FDA for K-ras.
In some embodiments, mutation status of a ras gene can be determined in the form of
a companion diagnostic to the FTI treatment, such as the tipifarnib treatment. The
companion diagnostic can be performed at the clinic site where the patient receives
the tipifarnib treatment, or at a separate site.
[0513] Disclosed herein are methods of selection of cancer patients for treatment with an
FTI based on the presence of a H-Ras mutation. These methods are based, in part, on
the discovery that H-Ras mutation is associated with clinical benefits of FTI treatment,
and thus can be used to predict the responsiveness of a cancer patient to an FTI treatment.
Accordingly, disclosed herein are methods for predicting responsiveness of a cancer
patient to an FTI treatment, methods for cancer patient population selection for an
FTI treatment, and methods for treating cancer in a subject with a therapeutically
effective amount of an FTI, based on the presence of H-Ras mutation in a sample from
the patient. The cancer can be a hematopoietic cancer or a solid tumor. In some examples
the cancer is a solid tumor.
[0514] Disclosed herein is an FTI for use in a method of treating a cancer in a subject
based on the presence of a H-Ras mutation. The method provided herein includes (a)
determining the presence or absence of a H-Ras mutation in a sample from the subject,
and subsequently (b) administering a therapeutically effective amount of the FTI to
the subject if the sample is determined to have a H-Ras mutation. The sample can be
a tumor sample. In some embodiments, the methods include (a) determining a cancer
patient to have a H-Ras mutation, and subsequently (b) administering a therapeutically
effective amount of an FTI to the subject.
[0515] In some embodiments, the H-Ras mutation is a mutation at a codon selected from the
group consisting of G12, G13, and Q61. In some embodiments, the H-Ras mutation can
be a mutation selected from the group consisting of the amino acid substitutions of
G12R, G12V, G13C, G13R, Q61L and Q61R. In some embodiments, the mutation can be mutation
at other codon that result in activation of H-Ras protein.
[0516] The methods provided herein further include (a) determining the presence or absence
of a K-Ras mutation and a N-Ras mutation in a sample from the subject, and subsequently
(b) administering a therapeutically effective amount of an FTI to the subject if the
sample does not have the K-Ras mutation or the N-Ras mutation. In some examples the
method includes administering a therapeutically effective amount of an FTI to the
subject if the sample has wild type K-Ras and wild type N-Ras.
[0517] In some examples the K-Ras mutation is K
A-Ras mutation. In some examples the K-Ras mutation is K
B-Ras mutation. In some examples the K-Ras mutation is a combination of K
A-Ras mutation and a K
B-Ras mutation. The K-Ras mutation can include a mutation at a codon selected from
the group consisting of G12, G13, and Q61 of K
A-Ras, K
B-Ras, or both. In some examples the K
A-Ras mutation can include a mutation selected from the group consisting of the amino
acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C, G13D, G13R,
G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 R and A146V. In some examples the K
B-Ras mutation can include a mutation selected from the group consisting of the amino
acid substitutions G12C, G12D, G12A, G12V, G12S, G12F, G12R, G12N, G13C, G13D, G13R,
G13S, G13N, Q61 K, Q61 H, Q61 L, Q61 P, Q61 R and A146V.
[0518] In some examples, the N-Ras mutation can include at least one mutation at a codon
selected from the group consisting of G12, G13, G15, G60 and Q61. In some examples,
the N-Ras mutation can include at least one mutation at a codon selected from the
group consisting of G12, G13, and Q61. In some examples, the N-Ras mutation can include
at least one mutation selected from the group consisting of the amino acid substitutions
of G12C, G12D, G12F, G12S, G12A, G12V, G12R, G13C, G13R, G13A, G13D, G13V, G15W, G60E,
Q61P, Q61L, Q61R, Q61K, Q61H and Q61E.
[0519] In some examples the sample is determined to not have amino acid substitution at
G12, G13, and Q61 of K-Ras, and also not have amino acid substitution at G12, G13,
and Q61 of N-Ras. In some examples, the sample is determined to not have any K-Ras
mutation or any N-Ras mutation. In some examples, the sample is determined to have
wild type K-Ras and wild type N-Ras.
[0520] In some examples, the method provided herein includes (a) determining the presence
or absence of a H-Ras mutation, a K-Ras mutation, and a N-Ras mutation in a sample
from the subject, and subsequently (b) administering a therapeutically effective amount
of an FTI to the subject if the sample is determined to have a H-Ras mutation, but
no K-Ras mutation or N-Ras mutation. The sample can be a tumor sample. In some examples,
the methods include (a) determining a cancer patient to have a H-Ras mutation and
wild type K-Ras and wild type N-Ras, and subsequently (b) administering a therapeutically
effective amount of an FTI to the subject. In some embodiments, the FTI is tipifarnib.
[0521] Disclosed herein is an FTI for use in methods to treat a cancer in a subject with
an FTI, and methods for selecting cancer patients for the FTI treatment based on the
presence of a H-Ras mutation. The cancer can be a hematopoietic cancer or a solid
tumor. Disclosed herein is also an FTI for use in methods to treat a premalignant
condition in a subject with the FTI, and methods for selecting patients with a premalignant
condition for an FTI treatment based on H-Ras mutation status.
[0522] In some examples, disclosed herein is an FTI for use in methods to treat a cancer
in a subject with the FTI or selecting cancer patients for an FTI treatment based
on the presence of a H-Ras mutation. The cancer can be a hematopoietic cancer or a
solid tumor. The cancer can be related to Human papillomavirus (HPV+ or HPV positive),
or unrelated to HPV (HPV- or HPV negative).
[0523] Disclosed herein are methods for predicting responsiveness of a cancer patient to
an FTI treatment, methods for cancer patient population selection for an FTI treatment,
and methods for treating cancer in a subject with a therapeutically effective amount
of an FTI, based on the presence of a H-Ras mutation in a sample from the patient.
The mutation status of H-Ras can be detected at the nucleic acid or protein level.
In some examples the H-Ras mutation status is determined by analyzing nucleic acids
obtained from the sample. In some examples the H-Ras mutation status is determined
by analyzing protein obtained from the sample.
[0524] In some embodiments, the H-Ras mutation status is determined by analyzing nucleic
acids obtained from the sample. The nucleic acids may be mRNA or genomic DNA molecules
from the test subject. Methods for determining Ras mutation status by analyzing nucleic
acids are well known in the art. In some embodiments, the methods include sequencing,
Polymerase Chain Reaction (PCR), DNA microarray, Mass Spectrometry (MS), Single Nucleotide
Polymorphism (SNP) assay, denaturing high-performance liquid chromatography (DHPLC),
or Restriction Fragment Length Polymorphism (RFLP) assay. In some embodiments, the
Ras mutation status is determined using standard sequencing methods, including, for
example, Sanger sequencing, next generation sequencing (NGS). In some embodiments,
the Ras mutation status is determined using MS.
[0525] In some embodiments, the H-Ras mutation status is determined by analyzing protein
obtained from the sample. The mutated Ras H-protein can be detected by a variety of
immunohistochemistry (IHC) approaches, Immunoblotting assay, Enzyme-Linked Immunosorbent
Assay (ELISA) or other immunoassay methods known in the art.
[0526] As a person of ordinary skill in the art would understand, any methods described
herein or otherwise known in the art for analyzing Ras mutation can be used to determining
the presence or absence of a H-Ras mutation.
5.2. Samples
[0527] In some examples methods provided herein include obtaining a sample from the subject.
In some embodiments, the sample is a tumor sample. In some embodiments, the sample
used in the present methods includes a biopsy (
e.g., a tumor biopsy). The biopsy can be from any organ or tissue, for example, skin,
liver, lung, heart, colon, kidney, bone marrow, teeth, lymph node, hair, spleen, brain,
breast, or other organs. Any biopsy technique known by those skilled in the art can
be used for isolating a sample from a subject, for instance, open biopsy, close biopsy,
core biopsy, incisional biopsy, excisional biopsy, or fine needle aspiration biopsy.
[0528] The sample used in the methods provided herein includes body fluids from a subject.
Non-limiting examples of body fluids include blood (
e.g., peripheral whole blood, peripheral blood), blood plasma, bone marrow, amniotic
fluid, aqueous humor, bile, lymph, menses, serum, urine, cerebrospinal fluid surrounding
the brain and the spinal cord, synovial fluid surrounding bone joints.
[0529] In one embodiment, the sample is a bone marrow sample. Procedures to obtain a bone
marrow sample are well known in the art, including but not limited to bone marrow
biopsy and bone marrow aspiration. Bone marrow has a fluid portion and a more solid
portion. In bone marrow biopsy, a sample of the solid portion is taken. In bone marrow
aspiration, a sample of the fluid portion is taken. Bone marrow biopsy and bone marrow
aspiration can be done at the same time and referred to as a bone marrow exam.
[0530] In some embodiments, the sample is a blood sample. The blood sample can be obtained
using conventional techniques as described in,
e.g. Innis et al, editors, PCR Protocols (Academic Press, 1990). White blood cells can be separated from blood samples using convention techniques
or commercially available kits,
e.g. RosetteSep kit (Stein Cell Technologies, Vancouver, Canada). Sub-populations of white
blood cells,
e.g. mononuclear cells, NK cells, B cells, T cells, monocytes, granulocytes or lymphocytes,
can be further isolated using conventional techniques,
e.g. magnetically activated cell sorting (MACS) (Miltenyi Biotec, Auburn, California)
or fluorescently activated cell sorting (FACS) (Becton Dickinson, San Jose, California).
[0531] In certain embodiments, the sample used in the methods provided herein includes a
plurality of cells. Such cells can include any type of cells,
e.g., stem cells, blood cells (
e.g., PBMCs), lymphocytes, NK cells, B cells, T cells, monocytes, granulocytes, immune
cells, or tumor or cancer cells. Specific cell populations can be obtained using a
combination of commercially available antibodies (
e.g., Quest Diagnostic (San Juan Capistrano, Calif.); Dako (Denmark)).
[0532] In certain embodiments, the sample used in the methods provided herein is from a
diseased tissue,
e.g., from an individual having cancer (a head and neck cancer). In some embodiments,
the cells can be obtained from the tumor or cancer cells or a tumor tissue, such as
a tumor biopsy or a tumor explants. In certain embodiments, the number of cells used
in the methods provided herein can range from a single cell to about 10
9 cells. In some embodiments, the number of cells used in the methods provided herein
is about 1 x 10
4, 5 x 10
4, 1 x 10
5, 5 x 10
5, 1 x 10
6, 5 x 10
6, 1 x 10
7, 5 x 10
7, 1 x 10
8, or 5 x 10
8.
[0533] The number and type of cells collected from a subject can be monitored, for example,
by measuring changes in morphology and cell surface markers using standard cell detection
techniques such as flow cytometry, cell sorting, immunocytochemistry (
e.g., staining with tissue specific or cell-marker specific antibodies) fluorescence
activated cell sorting (FACS), magnetic activated cell sorting (MACS), by examination
of the morphology of cells using light or confocal microscopy, and/or by measuring
changes in gene expression using techniques well known in the art, such as PCR and
gene expression profiling. These techniques can be used, too, to identify cells that
are positive for one or more particular markers. Fluorescence activated cell sorting
(FACS) is a well-known method for separating particles, including cells, based on
the fluorescent properties of the particles (
Kamarch, 1987, Methods Enzymol, 151:150-165). Laser excitation of fluorescent moieties in the individual particles results in
a small electrical charge allowing electromagnetic separation of positive and negative
particles from a mixture. In one embodiment, cell surface marker-specific antibodies
or ligands are labeled with distinct fluorescent labels. Cells are processed through
the cell sorter, allowing separation of cells based on their ability to bind to the
antibodies used. FACS sorted particles may be directly deposited into individual wells
of 96-well or 384-well plates to facilitate separation and cloning.
[0534] In certain embodiments, subsets of cells are used in the methods provided herein.
Methods to sort and isolate specific populations of cells are well-known in the art
and can be based on cell size, morphology, or intracellular or extracellular markers.
Such methods include, but are not limited to, flow cytometry, flow sorting, FACS,
bead based separation such as magnetic cell sorting, size-based separation (
e.g., a sieve, an array of obstacles, or a filter), sorting in a microfluidics device,
antibody-based separation, sedimentation, affinity adsorption, affinity extraction,
density gradient centrifugation, laser capture microdissection,
etc.
5.3. Cancers
[0535] In some examples, disclosed herein is an FTI for use in methods to treat a hematopoietic
cancer in a subject with the FTI or selecting cancer patients for an FTI treatment
based on the presence of a H-Ras mutation. In some examples, the hematopoietic cancer
is HPV negative. In some examples the methods include (a) determining a HPV negative
hematopoietic cancer patient to have a H-Ras mutation, and subsequently (b) administering
a therapeutically effective amount of tipifarnib to the patient.
[0536] Hematologic cancers are cancers of the blood or bone marrow. Examples of hematological
(or hematogenous) cancers include myeloproliferative neoplasm (MPN), myelodysplastic
syndrome (MDS), leukemia, and lymphoma. In some examples the cancer is acute myeloid
leukemia (AML), natural killer cell lymphoma (NK lymphoma), natural killer cell leukemia
(NK leukemia), cutaneous T-Cell lymphoma (CTCL), juvenile myelomonocytic leukemia
(JMML), peripheral T-cell lymphoma (PTCL), chronic myeloid leukemia (CML) or chronic
myelomonocytic leukemia (CMML). In some examples the cancer is CMML. In some examples
the cancer is JMML.
[0537] In some examples, disclosed herein is an FTI for use in methods to treat a solid
tumor with the FTI based on the presence of a H-Ras mutation. In some embodiments,
the solid tumor is HPV negative. In some embodiments, the FTI is tipifarnib. In some
embodiments, the methods include (a) determining a HPV negative solid tumor patient
to have a H-Ras mutation, and subsequently (b) administering a therapeutically effective
amount of tipifarnib to the patient.
[0538] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid
areas. Solid tumors can be benign or malignant. Different types of solid tumors are
named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas).
The solid tumor to be treated with the methods of the invention can be sarcomas and
carcinomas, include head and neck carcinoma, fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic
cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular
carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, thyroid carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma,
pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas,
medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile
duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor,
seminoma, bladder carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem
glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma,
CNS lymphoma, germinoma, meduloblastoma, Schwannoma craniopharyogioma, ependymoma,
pineaioma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma,
retinoblastoma and brain metastases).
[0539] Disclosed herein are methods to treat a solid tumor with an FTI based on the presence
of a H-Ras mutation, wherein the solid tumor is thyroid cancer, head and neck cancers,
salivary gland cancers, malignant melanoma, adrenal carcinoma, breast carcinoma, renal
cell cancer, carcinoma of the pancreas, non-small-cell lung carcinoma (NSCLC) or carcinoma
of unknown primary. According to the invention, the FTI is tipifarnib. Drugs commonly
administered to patients with various types or stages of solid tumors include, but
are not limited to, celebrex, etoposide, cyclophosphamide, docetaxel, apecitabine,
IFN, tamoxifen, IL-2, GM-CSF, or a combination thereof.
[0540] In some examples the solid tumor to be treated by methods disclosed herein can be
thyroid cancer, urothelial cancers, salivary cancers, cancers of the upper digestive
tract, bladder cancer, breast cancer, ovarian cancer, brain cancer, gastric cancer,
prostate cancer, lung cancer, colon cancer, skin cancer, liver cancer, and pancreatic
cancer. In some examples the bladder cancer to be treated by methods provided herein
can be transitional cell carcinoma. In some examples the FTI is tipifarnib.
[0541] In some examples the solid tumor to be treated by methods disclosed herein can be
selected from the groups consisting of carcinoma, melanoma, sarcoma, or chronic granulomatous
disease.
[0542] In some examples the premalignant conditions to be treated by methods herein can
be actinic cheilitis, Barrett's esophagus, atrophic gastritis, ductal carcinoma in
situ, Dyskeratosis congenita, Sideropenic dysphagia, Lichen planus, Oral submucous
fibrosis, Solar elastosis, cervical dysplasia, polyps, leukoplakia, erythroplakia,
squamous intraepithelial lesion, a pre-malignant disorder, or a pre-malignant immunoproliferative
disorder.
[0543] Disclosed herein are methods to treat a solid tumor in a subject with an FTI and
methods to select a solid tumor patients for FTI treatment based on the presence of
a H-Ras mutation in the subject, wherein the solid tumor is thyroid cancer, head and
neck cancers, or salivary gland cancer. In some examples the solid tumor is thyroid
cancer. In some embodiments, the solid tumor is head and neck squamous cell carcinoma
(HNSCC). In some examples the solid tumor is salivary gland cancer.
[0544] Head and neck squamous cell carcinoma (HNSCC) is the 6
th most common cancer worldwide, with about 650,000 cases and 200,000 deaths per year
worldwide, and about 54,000 new cases per year in the US. It is also the most common
cancer in central Asia.
[0545] HNSCC has 2 different etiologies and corresponding tumor types. The first subtype
is associated with tobacco smoking and alcohol consumption, and unrelated to Human
papillomavirus (HPV- or HPV negative). The second subtype is associated with infection
with high-risk HPV (HPV+ or HPV positive). The second subtype is largely limited to
oropharyngeal cancers. HPV+ tumors are distinct entity with better prognosis and may
require differential treatments.
[0546] Significant proportion of HNSCC, particularly oropharyngeal cancers, are caused by
HPV infection. High-risk HPV subtype 16 accounts for 85% of all HPV+ tumors in HNSCC.
P16 can be used as surrogate marker of HPV infection in HNSCC, particularly in the
oropharynx. More accurate HPV testing is available and based on E6/E7 detection (
Liang C, et al. Cancer Res. 2012;72:5004-5013).
[0547] HPV+ HNSCC show significantly lower EGFR expression levels than HPV-HNSCC. EGFR amplification
only occurs in HPV-HNSCC. High EGFR gene copy number and protein expression are associated
with poor clinical outcome in advanced HNSCC.
[0548] Currently, first-line therapy for recurrent/metastatic HNSCC include platinum-based
doublet (e.g., cisplatin/5-FU or carboplatin/paclitaxel), optionally in combination
with anti-EGFR antibody therapy (e.g. Cetuximab, Panitumumab, Afatinib). Second-line
therapy includes taxanes, methotrexate, and/or cetuximab. Anti-EGFR antibody therapy,
such as Cetuximab (a chimeric IgG1) or Panitumumab can be used as a single agent,
with chemotherapy (e.g. Platinum/5-FU, Cisplatin), or with radiation therapy. Despite
high EGFR expression levels in HNSCC, single-agent response rate for Cetuximab is
only 13% with SD rate of 33%, and there is currently no predictive biomarker available.
[0549] Drugs in development for HNSCC include those targeting PI3K pathway: BKM120 (buparlisib)
+ cetuximab, BYL719 + cetuximab, Temsirolimus + cetuximab, Rigosertib + cetuximab;
those targeting MET pathway: Tivantinib + cetuximab, Ficlatuzumab + cetuximab; those
targeting EGFR/HER3 pathway Afatinib + cetuximab ± paclitaxel, Patritumab; those targeting
FGFR pathway: BGJ398; those targeting CDK4/6-cell cycle pathway: Palbociclib, LEE011;
RTK inhibitor: Anlotinib and chemotherapy: Oral Azacitidine. More recent therapeutic
options for HNSCC include immunotherapy, such as anti-PD1 or anti-PDL1 antibodies.
[0550] While high cure rates have been achieved for localized and loco-regional disease
using surgery, radiation, chemoradiation, and induction chemotherapy, survival rates
for recurrent/metastatic diseases remain very poor, and better treatment options are
necessary.
[0551] In some embodiments, provided herein is a method of treating a HNSCC in a subject
based on the presence of a H-Ras mutation. In some embodiments, the HNSCC can be HPV
negative HNSCC. In some embodiments, the HNSCC can be relapsed/recurrent HNSCC. In
some embodiments, the HNSCC can be metastatic HNSCC. The method provided herein includes
(a) determining the presence or absence of a H-Ras mutation in a sample from the subject,
and subsequently (b) administering a therapeutically effective amount of an FTI to
the subject if the sample is determined to have a H-Ras mutation. The sample can be
a tumor sample. In some embodiments, the methods include (a) determining a HNSCC patient
to have a H-Ras mutation, and subsequently (b) administering a therapeutically effective
amount of an FTI to the subject. In some embodiments, the FTI is tipifarnib.
[0552] In some examples discloed herein is a method of treating a salivary gland cancer
in a subject based on the presence of a H-Ras mutation. In some examples the salivary
gland cancer can be advanced salivary gland cancer. In some examples the salivary
gland cancer can be metastatic salivary gland cancer. The method disclosed herein
includes (a) determining the presence or absence of a H-Ras mutation in a sample from
the subject, and subsequently (b) administering a therapeutically effective amount
of an FTI to the subject if the sample is determined to have a H-Ras mutation. The
sample can be a tumor sample. In some examples the methods include (a) determining
a salivary gland cancer patient to have a H-Ras mutation, and subsequently (b) administering
a therapeutically effective amount of an FTI to the subject. In some examples the
FTI is tipifarnib.
[0553] In some examples disclosed herein is a method of treating a thyroid cancer in a subject
based on the presence of a H-Ras mutation. In some examples the thyroid cancer can
be relapsed/recurrent thyroid cancer. In some examples the thyroid cancer can be metastatic
thyroid cancer. In some examples the thyroid cancer can be advanced thyroid cancer.
The method disclosed herein includes (a) determining the presence or absence of a
H-Ras mutation in a sample from the subject, and subsequently (b) administering a
therapeutically effective amount of an FTI to the subject if the sample is determined
to have a H-Ras mutation. The sample can be a tumor sample. In some embodiments, the
methods include (a) determining a HNSCC patient to have a H-Ras mutation, and subsequently
(b) administering a therapeutically effective amount of an FTI to the subject. In
some embodiments, the FTI is tipifarnib.
5.4. Exemplary FTIs and dosages
[0554] Provided herein are methods to treat a cancer in a subject with an tipifarnib or
selecting cancer patients for tipifarnib treatment based on the presence of a H-Ras
mutation according to the claims. In some embodiments, the methods include treaing
the subject with another FTI described herein or otherwise known in the art. In some
examples, the FTI is selected from the group consisting of arglabin, perrilyl alcohol,
lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409,
and BMS-214662. In one embodiment, the FTI is tipifarnib.
[0555] In some embodiments, tipifarnib is administered orally, parenterally, rectally, or
topically. In some embodiments, tipifarnib is administered orally.
[0556] In some embodiments, tipifarnib is administered at a dose of 1-1000 mg/kg body weight.
In some embodiments, tipifarnib is administered twice a day. In some embodiments,
tipifarnib is administered at a dose of 200-1200 mg twice a day. In some embodiments,
tipifarnib is administered at a dose of 600 mg twice a day. In some embodiments, tipifarnib
is administered at a dose of 900 mg twice a day.
[0557] In some embodiments, tipifarnib is administered in treatment cycles. In some embodiments,
tipifarnib is administered in alternative weeks. In some embodiments, tipifarnib is
administered on days 1-7 and 15-21 of a 28-day treatment cycle. In some embodiments,
tipifarnib is administered orally at a dose of 900 mg twice a day on days 1-7 and
15-21 of a 28-day treatment cycle.
[0558] In some embodiments, tipifarnib is administered for at least 3 cycles. In some embodiments,
tipifarnib is administered for at least 6 cycles. In some embodiments, tipifarnib
is administered for up to 12 cycles. In some embodiments, tipifarnib is administered
orally at a dose of 900 mg twice a day on days 1-7 and 15-21 of a 28-day treatment
cycle for at least three cycles.
[0559] In some embodiments, provided herein is a method of treating a HNSCC in a subject
with tipifarnib based on the presence of a H-Ras mutation. In some embodiments, the
HNSCC can be HPV negative HNSCC. In some embodiments, the HNSCC can be relapsed/recurrent
HNSCC. In some embodiments, the HNSCC can be metastatic HNSCC. The method provided
herein includes (a) determining the presence or absence of a H-Ras mutation in a sample
from the subject, and subsequently (b) administering a therapeutically effective amount
of a tipifarnib to the subject if the sample is determined to have a H-Ras mutation.
The sample can be a tumor sample. In some embodiments, the methods include (a) determining
a HNSCC patient to have a H-Ras mutation, and subsequently (b) administering a therapeutically
effective amount of a tipifarnib to the subject.
[0560] In some examples, disclosed herein is tipifarnib for use in a method of treating
a salivary gland cancer in a subject with tipifarnib based on the presence of a H-Ras
mutation. In some examples the salivary gland cancer can be advanced salivary gland
cancer. In some examples the salivary gland cancer can be metastatic salivary gland
cancer. The method disclosed herein includes (a) determining the presence or absence
of a H-Ras mutation in a sample from the subject, and subsequently (b) administering
a therapeutically effective amount of tipifarnib to the subject if the sample is determined
to have a H-Ras mutation. The sample can be a tumor sample. In some examples the methods
include (a) determining a salivary gland cancer patient to have a H-Ras mutation,
and subsequently (b) administering a therapeutically effective amount of tipifarnib
to the subject. In some examples the methods include administering the subject with
another FTI described herein or otherwise known in the art. In some examples the FTI
is selected from the group consisting of tipifarnib, arglabin, perrilyl alcohol, lonafarnib(SCH-66336),
L778123, L739749, FTI-277, L744832, CP-609,754, R208176, AZD3409, and BMS-214662.
[0561] In some examples, disclosed herein is tipifarnib for use in a method of treating
a thyroid cancer in a subject with tipifarnib based on the presence of a H-Ras mutation.
In some examples the thyroid cancer can be relapsed/recurrent thyroid cancer. In some
examples the thyroid cancer can be metastatic thyroid cancer. In some examples the
thyroid cancer can be advanced thyroid cancer. The method disclosed herein includes
(a) determining the presence or absence of a H-Ras mutation in a sample from the subject,
and subsequently (b) administering a therapeutically effective amount of tipifarnib
to the subject if the sample is determined to have a H-Ras mutation. The sample can
be a tumor sample. In some embodiments, the methods include (a) determining a HNSCC
patient to have a H-Ras mutation, and subsequently (b) administering a therapeutically
effective amount of tipifarnib to the subject. In some examples the methods include
administering the subject with another FTI described herein or otherwise known in
the art. In some examples the FTI is selected from the group consisting of tipifarnib,
rglabin, perrilyl alcohol, lonafarnib(SCH-66336), L778123, L739749, FTI-277, L744832,
CP-609,754, R208176, AZD3409, and BMS-214662.
[0562] In some embodiments, the methods include (a) determining a HNSCC patient to have
a H-Ras mutation, and subsequently (b) administering tipifarnib to the subject, wherein
the tipifarnib is administered orally at a dose of 900 mg twice a day on days 1-7
and 15-21 of a 28-day treatment cycle. In some embodiments, the HNSCC patient has
relapsed/refractory HNSCC. In some embodiments, the HNSCC patient has HPV negative
HNSCC.
[0563] In some examples the methods include (a) determining a salivary gland cancer patient
to have a H-Ras mutation, and subsequently (b) administering tipifarnib to the subject,
wherein the tipifarnib is administered orally at a dose of 900 mg twice a day on days
1-7 and 15-21 of a 28-day treatment cycle.
[0564] In some examples the methods include (a) determining a thyroid cancer patient to
have a H-Ras mutation, and subsequently (b) administering tipifarnib to the subject,
wherein the tipifarnib is administered orally at a dose of 900 mg twice a day on days
1-7 and 15-21 of a 28-day treatment cycle.
[0565] The methods can further comprise administering a second therapy to the patient having
a solid tumor with a H-Ras mutation. In some embodiments, the second therapy is a
chemotherapy, such as cisplatin, 5-FU, carboplatin, paclitaxel, or platinum-based
doublet (e.g., cisplatin/5-FU or carboplatin/paclitaxel). In some embodiments, the
second therapy is an anti-EGFR antibody therapy (e.g. Cetuximab, Panitumumab, Afatinib).
In some embodiments, the second therapy is taxanes, methotrexate, and/or cetuximab.
In some embodiments, the second therapy is a radiation therapy. In some embodiments,
the second therapy include those targeting PI3K pathway: BKM120 (buparlisib) + cetuximab,
BYL719 + cetuximab, Temsirolimus + cetuximab, Rigosertib + cetuximab; those targeting
MET pathway: Tivantinib + cetuximab, Ficlatuzumab + cetuximab; those targeting EGFR/HER3
pathway Afatinib + cetuximab ± paclitaxel, Patritumab; those targeting FGFR pathway:
BGJ398; those targeting CDK4/6-cell cycle pathway: Palbociclib, LEE011; RTK inhibitor:
Anlotinib and chemotherapy: Oral Azacitidine. In some embodiments, the second therapy
is an immunotherapy, such as anti-PD1 or anti-PDL1 antibodies.
6. Examples
[0566] It is understood that modifications which do not substantially affect the activity
of the various embodiments of this invention are also provided within the definition
of the invention provided herein. Accordingly, the following examples are intended
to illustrate but not limit the present invention.
EXAMPLE I (Reference Example)
Identification of Immunological Biomarkers Associated with Clinical Benefit of Tipifarnib
[0567] Analyses of gene expression profiling in bone marrow samples from two AML studies
as well as the tipifarnib IC50 data in multiple cells lines revealed that multiple
immunologically related genes, especially NK cells related genes, were associated
with better prognosis for tipifarnib. While some of these genes appeared to be non-specific
to tipifarnib treatment, others including KIR2DS2, KIR2DL2, KIR2DS5, KIR2DL5, and
GZMM were specifically associated with clinical benefits of tipifarnib but not other
non-FTI chemotherapy agents, such as cytarabine and mitoxantrone.
[0568] The current study used microarray data generated from global gene expression assay
of bone marrow samples collected in two clinical studies investigating the efficacy
and safety of FTI tipifarnib. One clinical study was conducted in adult patients aged
65 years or older with previously untreated AML, and the other conducted in relapsed
and refractory AML. The clinical results for these studies were previously published
(
Lancet et al., Blood 109:1387-1394 (2007);
Harousseau et al., Blood 9:9 (2007);
Raponi et al., Clin. Cancer Res. 13:2254-2260 (2007)), and the gene profiling data were publically available in NCBI's Gene Expression
Omnibus (GEO,
http://www.ncbi.nlm.nih.gov/geo) and are assessable through GEO Series accession numbers GSE8970 and GSE5122.
[0569] As described in
Raponi et al., Blood 111:2589-96 (2008), BM samples were collected from consenting patients before treatment with tipifarnib,
and mononuclear cells were processed on site. Total RNA was extracted from cell samples,
quality controlled, and further processed for microarray analysis. DNA was isolated
from the same sample. Samples were assayed for global gene expression, and/or quantitative
polymerase chain reaction (QPCR) of specific genes).
[0570] Response to tipifarnib is reported in the clinical study report and was defined as
patients who had a complete remission (CR), a partial remission (PR), or hematologic
improvement (HI). PR and HI patients were included as responders, since it was previously
shown that they had a similar survival benefit to those achieving a CR. Briefly, CR
was defined as BM showing less than 5% myeloblasts with normal maturation of all cell
lines, absolute neutrophil count (ANC) of at least 10
9/L (1000/µL), and a platelet count of 100×10
9/L (100 000/µL). PR was defined as the presence of recovery of ANC and platelets to
the above stated levels, but with 5% to 19% BM blasts, and a greater than 50% decrease
in BM blast percentage from baseline. HI was defined as the same as PR, except with
recovery of ANC to 0.5 to 1×10
9/L (500 to 1000/µL) and platelet count to 20 to 100×10
9/L (20 000 to 100 000/µL). Progressive disease (PD) was defined as any of the following:
more than 50% increase in BM blast percentage from baseline (more than 5% blasts if
baseline is less than 5%, more than 10% blasts if baseline is 5% to 10%, and more
than 20% blasts if baseline 10% to 20%); greater than 50% increase in circulating
blasts; new appearance of circulating blasts on at least 2 consecutive occasions;
or development of extramedullary leukemia. Stable disease (SD) was defined as any
response not meeting CR, PR, HI, or PD criteria.
[0571] Kaplan Meier curves were used to investigate the relationship between biomarker values
and clinical benefit. The identification of multiple NK cell related genes, the long
duration of response observed in some tipifarnib patients, and the role of RAS mediated
signal transduction in NK cells support that the responsiveness of AML patients to
tipifarnib treatment could be resulted from bone marrow infiltrates of immune cells.
1. Correlation of KIR2DS5 Expression Level with Clinical Benefit of Tipifarnib
[0572] As shown in FIG. 1A, the expression level of KIR2DS5 is associated with the outcome
of AML patients treated with tipifarnib. When categorizing patients based on different
clinical responses, it was found that the PD patients were clustered in the lower
end of the KIR2DS5 expression continuum; the CR patients were clustered in the higher
end of the KIR2DS5 expression continuum; and the HI and SD patients were clustered
between the CR and PD groups.
[0573] Additionally, a strong correlation was identified between the expression level of
KIR2DS5 and the PFS of AML patients treated with tipifarnib (FIG. 1B). The patients
whose KIR2DS5 expression levels were at the highest (4
th) quartile had statistically significant longer PFS compared to the rest of the patients.
The correlation supports that AML patients can be selected based on the expression
level of KIR2DS5 for tipifarnib treatment in order to increase the likelihood of responsiveness
to the treatment.
2. Specific Correlation between the Ratio of Expression of KIR2DS2 to KIR2DL2 with
Clinical Benefit of Tipifarnib
[0574] As shown in FIGs. 2A and 2B, the ratio of expression level of KIR2DS2 to the expression
level of KIR2DL2 (the 2DS2/2DL2 ratio) was strongly correlated with both the PFS (FIG.
2A) and the OS (FIG. 2B) of AML patients treated with tipifarnib. As shown, the patients
with the 2DS2/2DL2 ratio at the highest (4th) quartile had statistically significantly
longer PFS (median =431 days) and OS (median=750 days) compared to the rest of the
patient population.
[0575] In addition, the correlation between 2DS2/2DL2 ratio and clinic benefit was specific
to tipifarnib and was not observed for other non-FTI chemotherapy agents, such as
cytarabine and mitoxantrone (Chemotherapy data from
Metzeler KH et al., Blood, 112:4193-201 (2008)). As shown in FIGs. 3A and 3B, as well as the table below, the survival probability
of AML patients treated with high dose cytarabine and mitoxantrone were not distinguishable
between those with the 2DS2/2DL2 ratio at the highest quintile and the rest of the
patients.
| Study |
5th Q/1-4th Q/all Median (days) |
Setting |
Treatment |
HR |
N/5th Q |
| GSE12417-GPL96 |
233/321/294 |
Front Line |
high-dose cytarabine plus mitoxantrone |
1.39 |
163/33 |
| GSE12417-GPL570 |
308/624/538 |
Front Line |
high-dose cytarabine plus mitoxantrone / intense chemo in 17 pts |
1.38 |
79/16 |
| GSE8970 (CTEP-20) |
754/179/233 |
Front Line Elderly |
Tipifarnib |
0.21 |
34/7 |
[0576] The specific correlation between 2DS2/2DL2 ratio and clinic benefit of tipifarnib
supports that AML patients can be selected based on the 2DS2/2DL2 ratio for tipifarnib
treatment in order to increase the overall response to the treatment.
3. Specific Correlation between the Ratio of Expression of KIR2DS5 to KIR2DL5 with
Clinical Benefit of Tipifarnib
[0577] As shown in FIG. 4A, the ratio of expression level of KIR2DS5 to the expression level
of KIR2DL5A (the 2DS5/2DL5 ratio) was strongly correlated with both the PFS and the
OS of AML patients treated with tipifarnib. As shown, the patients with the 2DS5/2DL5A
ratio at the highest (4th) quartile had statistically significantly longer PFS and
OS compared to the rest of the patient population.
[0578] In addition, the correlation between 2DS5/2DL5 ratio and clinic benefit was specific
for tipifarnib and not observed for other non-FTI chemotherapy agents, such as cytarabine
and mitoxantrone (Chemotherapy data from
Metzeler KH et al., Blood, 112:4193-201 (2008)) (FIG. 4B). As shown in FIG. 4B, the survival probability of AML patients treated
with high dose cytarabine and mitoxantrone were not distinguishable among patients
with different 2DS5/2DL5 ratio.
[0579] The specific correlation between 2DS5/2DL5 ratio and clinic benefit of tipifarnib
supports that AML patients can be selected based on the 2DS5/2DL5 ratio for tipifarnib
treatment in order to increase the overall response to the treatment.
4. Specific Correlation of GZMM Expression Level with Clinical Benefit of Tipifarnib
[0580] As shown in FIG. 5, the expression level of GZMM is associated with the outcome of
AML patients treated with tipifarnib. When categorizing patients based on different
clinical responses, it was found that the PD patients were clustered in the lower
end of the GZMM expression continuum and had the lowest median expression level of
GZMM among the four groups (CR, HI, SD and PD). The CR patients were clustered in
the higher end of the GZMM expression continuum and had the highest median expression
level of GZMM among the four groups.
[0581] Additionally, a strong correlation was also identified between the expression level
of GZMM and the OS and PFS of AML patients treated with tipifarnib (FIG. 6A). The
patients whose GZMM expression levels were at the highest (4
th) quartile had statistically significant longer OS and PFS compared to the rest of
the patients. The correlation between GZMM expression level and clinic benefit was
specific for tipifarnib and not observed for other non-FTI chemotherapy agents, such
as cytarabine and mitoxantrone (FIG. 6B). The specific correlation supports that AML
patients can be selected based on the expression level of GZMM for tipifarnib treatment
in order to increase the overall response to the treatment.
5. Specific Correlation of KIR2DS2 Expression Level with Clinical Benefit of Tipifarnib
[0582] As shown in FIG. 7A, the expression level of KIR2DS2 is associated with the outcome
of AML patients treated with tipifarnib. A strong correlation was identified between
the expression level of KIR2DS2 and the OS of AML patients treated with tipifarnib
(FIG. 7A). The patients whose KIR2DS2 expression levels were at the highest (4
th) quartile had statistically significant longer OS compared to the rest of the patients
(FIG. 7A and FIG. 7B, upper left panel).
[0583] As shown in FIG. 7B and the table below, expression of KIR2DS2 strongly correlated
with clinical benefit, including complete response rate and survival endpoints. Patients
in the upper (4
th) quartile of KIR2DS2 expression had a median survival of 564 days whereas those in
the 1
st -3
rd quartile of KIR2DS2 expression had a median survival of 153 days. In contrast, no
correlation was identified between the expression of NK cell markers, including KIR2DS2,
and the clinical benefit derived from chemotherapy treatment in a subset of 51 previously
untreated and elderly (>65 years) AML patients enrolled in the German AML Cooperative
Group 1999 study (AMLCG 1999) (FIG. 7B, right panel). Of the 34 previously untreated
poor-risk and elderly AML patients who were treated with tipifarnib in a prior Phase
2 clinical trial, 25 had prior MDS. This specific correlation supports that cancer
patients can be selected based on the expression level of KIR2DS2 for tipifarnib treatment
in order to increase the likelihood of responsiveness to the treatment for AML and
MDS.
| Treatment (n) |
Median Overall Survival (days) |
KIR2DS2 Low 1st - 3rd Quartile Median Survival (days) |
KIR2DS2 High 4th Quartile (Upper) Median Survival (days) |
Hazards Ratio |
| Tipifarnib (34) |
233 |
153 |
564 |
0.303 |
| Chemotherapy (51) |
240 |
176 |
284 |
0.83 |
EXAMPLE II (Reference Example)
A. Stratification of AML Patients for Tipifarnib Clinical Trials
[0584] A clinical trial can be conducted that includes KIR typing as part of the patient
inclusion criterion. For example, a study can be conducted for tipifarnib treatment
in AML patients who are older than 60 or otherwise unfit for standard chemotherapy,
or have refractory or relapsed AML.
[0585] Before an AML patient is admitted to the clinical trial, a bone marrow sample or
blood sample is obtained from the patient. The sample is then subjected to microarray
analysis. DNA is isolated from the sample of Trizol-processed bone marrow as per the
manufacturer's instructions (Qiagen). Samples are assayed for global gene expression,
and quantitative polymerase chain reaction (QPCR) of specific genes, including KIR2DS2,
KIR2DL2, KIR2DS5 and KIR2DL5. Among other things, the microarray analysis provides
the genotype of KIR genes of the patient. If the patient is identified to be a carrier
of KIR2DS2 gene, or a carrier of KIR2DS5 gene, the patient is then admitted for the
tipifarnib trial. An exemplary inclusion criterion can be as follows:
- Pathologic confirmation of the diagnosis of AML (>= 20% marrow blasts)
- ECOG performance status 0 or 1
- Patients must be able to give informed consent
- SGOT and SGPT =< 2.5 x normal limits (grade 1)
- Serum creatinine =< 1.5 x normal limits (grade 1)
- AML (any of the following):
- Newly diagnosed AML in adults >= 70 years
- Newly diagnosed AML arising from MDS in adults >= 60 years
- Biopsy-proven relapsed or refractory AML
- Hyperleukocytosis with >= 30,000 leukemic blasts/uL
- Carrier of KIR2DS2, or KIR2DS5, confirmed by bone marrow biopsy.
[0586] An exemplary dosage regime can be: Patients receive 600 mg tipifarnib orally (PO)
twice daily (B.I.D.) on days 1-21. Courses repeat every 28 days in the absence of
disease progression or unacceptable toxicity.
[0587] Complete remission (CR) rate and Partial remission (PR) rate can be primary outcome
measures of the trial.
B. MDS Patients for Tipifarnib Clinical Trials with Immune Cell Markers as Secondary
Endpoints
[0588] A clinical trial can be conducted that includes KIR typing as part of the patient
inclusion criterion. For example, a study can be conducted for tipifarnib treatment
in AML patients who have MDS, or specifically lower risk MDS. The primary endpoint
of the study is transfusion independence according to the adult Myelodysplastic/Myeloproliferative
Neoplasms International Working Group criteria or related response assessment system.
Secondary endpoints could include the analysis of immune cell markers, especially
NK cell markers such as KIR2DS2, KIR2DS5, KIR2DL2, KIR2DL5 and GZMM
[0589] When a patient with lower risk MDS is admitted to the clinical trial, a bone marrow
sample or blood sample is obtained from the patient. The sample is then subjected
to microarray analysis. DNA is isolated from the sample of Trizol-processed bone marrow
as per the manufacturer's instructions (Qiagen). Samples are assayed for global gene
expression, and quantitative polymerase chain reaction (QPCR) of specific genes, such
as KIR2DS2, KIR2DS5, KIR2DL2, KIR2DL5 and GZMM. Among other things, the microarray
analysis provides the genotype of KIR genes of the patient.
[0590] An exemplary dosage regime can be: Patients receive 600 mg tipifarnib orally (PO)
twice daily (B.I.D.) on days 1-21. Courses repeat every 28 days in the absence of
disease progression or unacceptable toxicity.
[0591] A companion diagnostic test can also be used to aid in the selection of patients
in clinical trials of tipifarnib in patient population with lower risk MDS. Genetic
assays detecting the presence or absence of the KIR genes in NK cells as described
herein or otherwise known in the art can be used. Assays described herein (
e.g. a PCR based assay), or otherwise known in the art to determine biomarker expression
levels can also be used, and optimal biomarker cut-off criterion for patient selection
can be determined for subsequence clinical studies.
EXAMPLE III (Reference Example)
Individualized Treatment Decisions for CMML Patients
[0592] The following procedures can be taken to determine whether a CMML patient is suitable
for an FTI treatment, such as a tipifarnib treatment.
[0593] BM sample is collected from the patient before treatment, and mononuclear cells were
processed on site. Total RNA is extracted from cell samples using the Trizol Kit (Qiagen,
Santa Clarita, CA). RNA quality is determined by assessing the presence of ribosomal
bands on an Agilent Bioanalyzer (Agilent, Palo Alto, CA). Good-quality samples are
further processed for microarray analysis.
[0594] For each sample, 1 g total RNA (as assessed by OD260) is reverse transcribed using
the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City,
CA) according to the manufacturer's instructions. Samples can then incubated at 25°C
for 10 minutes and then 37°C for 30 minutes for optimum RNA conversion. QPCR is performed
using the ABI Prism 7900HT sequence detection system (Applied Biosystems) with all
samples run in triplicate. Each reaction contains 5 µL Taqman Universal PCR Master
Mix containing uracil-
N-glycosylase (Applied Biosystems), 4.5 µL cDNA template, and 0.5 µL of 20X Assay on
Demand Gene Expression Assay Mix (Applied Biosystems) or 9 pmol both forward and reverse
primer and 2.5 pmol probe in a total reaction volume of 10 µL. All primer and fluorescein
amidite (FAM) fluorogenic probe sets are chosen to generate amplicons less than 100
nucleotides, allowing for amplification of transcripts from degraded RNA samples.
Primers and probes are designed for specific amplification of KIR2DS2 and KIR2DL2.
All primer sets span exon boundaries and thus specifically amplify mRNA transcripts
and not genomic DNA.
[0595] The KIR2DS2/KIR2DL2 expression ratio is then calculated using methods known in the
art (
e.g. Ma et al., Cancer Cell, 5:607-616 (2004)). The raw Ct values are normalized by subtracting the mean Ct from the sample set,
dividing by the standard deviation, and then calculating the difference of the normalized
Ct values of each gene.
[0596] As described herein, a reference expression ratio of KIR2DS2/KIR2DL2 can be determined
by statistic analysis. As shown in FIGs. 2A and 2B (Example I. II above), for example,
a reference expression ratio can be the expression ratio that distinguish the patients
with 2DS2/2DL2 ratio at the highest (4th) quartile from the rest of the patients.
Accordingly, if the 2DS2/2DL2 ratio of the CMML patient is determined to be higher
than the reference ratio (namely, the 2DS2/2DL2 ratio of the CMML patient is in the
highest (4th) quartile), and the patient is not otherwise prevented from receiving
a tipifarnib treatment, then a tipifarnib treatment is prescribed. On the other hand,
if the 2DS2/2DL2 ratio of the CMML patient is determined to be lower than the reference
ratio, a tipifarnib treatment is not recommended.
[0597] If a tipifarnib treatment is prescribed to the CMML patient, the CMML patient can
simultaneously receive another treatment, such as ionizing radiation, or a second
active agent or a support care therapy, as deemed fit by the oncologist. The second
active agent can be a DNA-hypomethylating agent, such as azacitidine or decitabine.
EXAMPLE IV (Reference Example)
Lower IC50 for Tipifarnib in Myeloid and Lymphoid Cell Lines with Wild Type K-RAS/N-RAS
Status
[0598] As shown in the table below, analyses of tipifarnib IC50 data in multiple myeloid
and lymphoid cells lines revealed that cell lines carrying codon 12, 13 and/or 61
N-RAS or K-RAS mutations are resistant to tipifarnib, while cell lines that do not
carry these mutations, including those that have wild type N-RAS and K-RAS are more
sensitive to tipifarnib treatments.
Tipifarnib IC 50 for Myeloid and Lymphoid cell lines.
| Cell Line |
NRAS |
KRAS |
Tipifarnib IC50 (log µM) |
| ML-2 |
wt |
A146T |
-4.29 |
| SIG-M5 |
wt |
wt |
-4.23 |
| QIMR-WIL |
wt |
wt |
-4.12 |
| CMK |
wt |
wt |
-1.89 |
| GDM-1 |
wt |
wt |
-1.04 |
| HEL |
wt |
wt |
-0.93 |
| NKM-1 |
wt |
wt |
-0.26 |
| CESS |
wt |
wt |
0.70 |
| OCI-AML2 |
wt |
wt |
0.71 |
| KG-1 |
wt |
wt |
1.12 |
| MONO-MAC-6 |
wt |
wt |
1.21 |
| CTV-1 |
wt |
wt |
1.52 |
| HL-60 |
Q61L |
wt |
1.94 |
| KMOE-2 |
Q61R |
wt |
2.14 |
| K052 |
G13R |
wt |
2.77 |
| NOMO-1 |
wt |
G13D |
6.84 |
| THP-1 |
G12D |
wt |
7.67 |
| P31-FUJ |
G12C |
wt |
7.76 |
Data from Genomics of Drug Sensitivity in Cancer ("GDSC").
EXAMPLE V (Reference Example)
Durable Responses in MDS/CMML Patients with N-RAS/K-RAS Wild Type Tumor Status Treated
with Tipifarnib
[0599] Twenty-one patients with MDS were treated with tipifarnib in the Phase 1 dose escalation
study. Tipifarnib was administered twice daily (3-weeks-on/1-week-off schedule for
8 weeks) (starting dosage, 300 mg by mouth twice daily; total, 600 mg).
[0600] Objective response 3 HI, 2PR and 1 CR were observed in 6 of 20 (30%) evaluable patients.
As shown in Table 2 below, MDS patients with wild type N-RAS and K-RAS are more likely
to have durable responses (
Kurzrock et al., Blood, 102(13):4527- 34 (2003)).
| Diagnosis |
Response |
Duration (Month) |
Total daily dose, mg |
Ras Mutation |
| RAEB |
HI |
16 |
300* |
No |
| CMML |
HI |
2 |
600 |
Yes (K-RAS) |
| CMML |
PR |
6 |
600 |
Yes (N-RAS) |
| CMML |
PR |
16+ |
800 |
No |
| RAEB |
HI |
3 |
900 |
No |
| RAEB-T |
CR |
9+ |
800 |
No |
* Patient started at a total daily dose of 600 mg/d, but dose was reduced after 2
weeks.
RAEB: refractory anemia with excess blasts. |
EXAMPLE VI (Reference Example)
Prolonged PFS and Higher Response Rate in AML Patients with N-RAS Wild Type Status
Treated with Tipifarnib
[0602] N-RAS gene status was determined for 32 patients. As shown in FIG. 8, a trend for
better PFS was observed in AML patients with wild type N-RAS (PFS=157 days) as compared
to those with mutant N-RAS (PFS=65 days). As shown in FIG. 9, patients with wild type
N-RAS (43% ORR) has a higher response rate compared to those with mutant N-RAS (27%
ORR). Accordingly, AML patients can be selected based on mutation status of RAS gene
for tipifarnib treatment in order to increase the responsiveness to the treatment.
EXAMPLE VII (Reference Example)
Tipifarnib Clinical Trial in CMML Patients Stratified Based on RAS Mutation Status
[0603] This example describes a Phase 2 clinical study of tipifarnib with the primary objective
being to assess the antitumor activity of tipifarnib, in terms of Objective Response
Rate (ORR) using the Myelodysplastic/Myeloproliferative International Working Group
(MDS/MPN IWG) criteria, of tipifarnib in subjects with chronic myelomonocytic leukemia
(CMML) and in subjects with CMML whose disease is KRAS/NRAS wild type. Secondary objectives
include accessing the effect of tipifarnib on CR rate, complete cytogenetic remission,
partial remission, marrow response, and clinical benefit; duration of response; rate
of PFS at 1 year; rate of survival at 1 year; adverse event (AE) profile according
to National Cancer Institute Common Terminology Criteria for Adverse Events version
4.03 (NCI CTCAE v 4.03).
[0604] This Phase 2 study investigates the antitumor activity in terms of ORR of tipifarnib
in subjects with CMML. Up to 20 eligible subjects are enrolled and retrospectively
stratified into one of two strata (approximately 10 subjects per stratum) based on
subject KRAS and/or NRAS mutational status. The first stratum can enroll subjects
with tumor KRAS and NRAS wild type status. The second stratum can enroll subjects
with either tumor KRAS mutant, NRAS mutant or double mutant status.
[0605] Subjects can receive tipifarnib administered at a starting dose of 900 mg, orally
with food, twice a day (b.i.d.) for 7 days in alternating weeks (Days 1-7 and 15-21)
in 28 day cycles. At the discretion of the investigator, the dose of tipifarnib can
be increased to 1200 mg b.i.d. if the subject has not experienced dose limiting toxicities
at the 900 mg dose level. Subjects who develop serious adverse events (SAE) or ≥ grade
2 treatment-emergent adverse events (TEAE) that are deemed related to tipifarnib and
lasting ≥ 14 days will not undergo dose escalation. Stepwise 300 mg dose reductions
to control treatment-related, treatment-emergent toxicities are also allowed.
[0606] In the absence of unmanageable toxicities, subjects can continue to receive tipifarnib
treatment until disease progression. If a complete response is observed, therapy with
tipifarnib can be maintained for at least 6 months beyond the start of response.
[0607] Disease assessments (bone marrow, hematology and quality of life evaluations) can
be performed at screening and at the Day 22 visit (± 5 days) performed during Cycles
2, 4, 6 and every approximately 12 weeks thereafter (Cycles 9, 12, 15, etc.). Hematologic
assessments, including peripheral blood evaluations and review of transfusion requirements,
can be performed at screening and at least monthly until disease progression. A screening
bone marrow aspirate/biopsy is not necessary to initiate treatment in subjects who
have had a bone marrow aspirate/biopsy confirming their diagnosis within 4 weeks prior
to Cycle 1 Day 1 and can provide samples for the completion of study objectives. If
the bone marrow aspirate is inadequate for the scheduled disease assessment, a bone
marrow biopsy can be performed. Additional disease or hematologic assessments can
be conducted if deemed necessary by the Investigator. The timing of the disease and
hematologic assessments are maintained as much as possible independently of potential
treatment cycle delays.
EXAMPLE VIII (Reference Example)
Individualized Treatment Decisions for CMML Patients
[0608] The following procedures can be taken to determine whether a CMML patient is suitable
for an FTI treatment, such as a tipifarnib treatment.
[0609] DNA can be extracted predominantly from bone marrow cells (mononuclear cells or buffy
coat) or the peripheral blood of the patient at CMML presentation. The mutation status
of N-Ras and K-Ras is determined by DNA sequencing, using a fluorescent primer-adapted
chaintermination method on an ABI 3100 sequencer (Applied Biosystems, Foster City,
CA). When direct sequencing is negative, PCR products are cloned (Original TA Cloning
Kit; Invitrogen, Groningen, the Netherlands) and sequenced.
[0610] If the CMML patient is determined to have not any mutations at codons 12, 13, and
61 of K-Ras or N-Ras, or if the CMML patient is determined to have wildtype K-Ras
and N-Ras, and if the patient is not otherwise prevented from receiving a tipifarnib
treatment, a tipifarnib treatment is prescribed. On the other hand, if the CMML patient
is determined to have either a N-Ras or K-Ras mutation that results in the activation
of either N-Ras or K-Ras, a tipifarnib treatment is not recommended.
[0611] If a tipifarnib treatment is prescribed to the CMML patient, the CMML patient can
simultaneously receive another treatment, such as ionizing radiation, or a second
active agent or a support care therapy, as deemed fit by the oncologist. The second
active agent can be a DNA-hypomethylating agent, such as azacitidine or decitabine.
EXAMPLE IX
Tipifarnib Clinical Trial in Solid Tumor Patients Stratified Based on HRAS Mutation
[0612] A Phase 2 clinical trial was initiated to use tipifarnib in the treatment of advanced
tumors with a known HRAS mutation. The clinical trial design includes enrolling 2
cohorts of 18 patients each. Cohort 1 enrolls subjects with malignant thyroid tumors
with HRAS mutations, independent of thyroid histology. Cohort 2 enrolls any subject
with a non-hematological HRAS mutant tumor other than thyroid cancer who meets eligibility
criteria.
[0613] This clinical trial was designed to include two stages, with the first stage including
11 evaluable patients, and the second stage including 7 additional evaluable patients,
and a cohort would not proceed to the second stage if one or no objective response
is observed in a cohort in the first stage. The clinical trial is considered positive
if at least 4 responses are observed in a cohort out of 18 subjects. The primary endpoint
is objective response rate, and tumor response assessments are conducted according
to the Response Evaluation Criteria in Solid Tumors version 1.1 criteria (confirmation
of response is required).
[0614] According to the protocol, tipifarnib is administered to enrolled patients at a starting
dose of 900 mg, orally with food, twice a day (b.i.d.) for 7 days in alternating weeks
(Days 1-7 and 15-21) in 28 day cycles. At the discretion of the investigator, the
dose of tipifarnib can be increased to 1200 mg b.i.d. if the subject has not experienced
dose limiting toxicities at the 900 mg dose level. Subjects who develop serious adverse
events (SAE) or ≥ grade 2 treatment-emergent adverse events (TEAE) that are deemed
related to tipifarnib and lasting ≥ 14 days will not undergo dose escalation. Stepwise
300 mg dose reductions to control treatment-related, treatment-emergent toxicities
are also allowed.
[0615] Four (4) evaluable patients were enrolled in the first cohort (patients with malignant
thyroid tumors with HRAS mutations) and eleven (11) evaluable patients were enrolled
in the second cohort (patients with non-hematologic malignancies other than thyroid
cancer with HRAS mutations). In the second cohort, three (3) of those patients have
relapsed/refractory head-and-neck carcinoma and two (2) of those three (3) experienced
confirmed objective partial responses (PR) and a third patient experienced disease
stabilization beyond six months (>8 months). All three head and neck carcinoma patients
are HPV negative. All head and neck patients remain on study. The responses were observed
in two PR patients after 3 cycles of treatment, six cycles for one and three for the
other. In addition, five (5) patients enrolled patients have salivary gland cancers
with HRAS mutations, and three (3) of them experienced disease stabilization beyond
six months (>7, 9 and >11 months). Cohort 2 was proceeded into the second stage of
the trial for enrolment of additional seven patients per the trial protocol.
EXAMPLE X
Individualized Treatment Decisions for Solid Tumor Patients
[0616] The following procedures can be taken to determine whether a patient having a solid
tumor is suitable for an FTI treatment, such as a tipifarnib treatment. The patient
can have a thyroid tumor. The patient can have a salivary tumor. The patient can also
have a head and neck tumor. The head and neck tumor can be a head and neck tumor squamous
carcinoma.
[0617] DNA can be extracted from tumor sample of the patient. The mutation status of H-Ras
is determined by DNA sequencing, using a fluorescent primer-adapted chaintermination
method on an ABI 3100 sequencer (Applied Biosystems, Foster City, CA). When direct
sequencing is negative, PCR products are cloned (Original TA Cloning Kit; Invitrogen,
Groningen, the Netherlands) and sequenced.
[0618] If the patient having a solid tumor is determined to have a mutation at codons 12,
13, and 61 of H-Ras, or another mutation that results in activation in H-Ras, and
if the patient is not otherwise prevented from receiving a tipifarnib treatment, a
tipifarnib treatment is prescribed. On the other hand, if the patient is determined
to not have any mutation that results in the activation of H-Ras, or to have wild
type H-Ras, a tipifarnib treatment is not recommended.
[0619] If a tipifarnib treatment is prescribed to the patient, the patient can simultaneously
receive another treatment, such as ionizing radiation, or a second active agent or
a support care therapy, as deemed fit by the oncologist. In a head and neck squamous
carcinoma patient, the additional treatment can be an anti-EGFR antibody treatment,
an anti-PD1/PDL1 treatment.