Field of the Invention
[0001] The disclosure relates to recombinant protein expression systems comprising genetically
modified cells, excluding human germ cells, wherein the cells are transformed or transfected
with tRNA genes to reduce base mismatch due to genetic degeneracy in the genetic code
and hence reliance on wobble for decoding; the modified cells have so improved recombinant
protein expression.
Background to the Invention
[0002] The amino acid composition of proteins determines their properties and is encoded
by the DNA sequence of genes. The gene sequence is copied into messenger RNA (mRNA)
and decoded using transfer RNA (tRNA) that delivers amino acids in the specified order.
The code is written in contiguous triplets of bases, called codons and is decoded
by binding to the tRNAs' complementary base triplets, called anticodons. Each tRNA
has a single anticodon and delivers a specified amino acid. However, although the
combination of the four bases present in the DNA provides 64 codons, there are fewer
tRNAs and anticodons present.
[0003] DNA comprises four different bases whereby adenosine specifically binds with thymine
and guanine specifically binds with cytosine. All organisms have fewer species of
tRNA than codons and therefore some tRNA species must pair with more than one codon,
which led to the "Wobble" hypothesis postulating that the 5' base on the anticodon,
which binds to the 3' base on the mRNA, can have non-standard base pairing, with only
two of the three bases optimally matched. Suboptimal base pairing can lead to misincorporation
errors upon translation. The most frequent errors correspond to a G (mRNA)/U(tRNA)
base pair mismatch and additional wobble position mismatches (C/U and U/U) during
translation.
[0004] Heterologous expression of recombinant proteins provided a wealth of diagnostic and
therapeutic agents. Often bacterial systems are the preferred host for protein expression
due to the low maintenance and easy handling. However, inability to accommodate for
posttranslational modifications led to the usage of other expression systems such
as yeast, insect cells, plants or mammalian expression systems. Approximately 70%
of recombinant protein pharmaceuticals and most proteins used for vaccination, human
therapy or diagnostics are currently produced in mammalian cells or cell lines, such
as CHO or HEK293. However, although the choice of expression systems aids expression,
there are still significant misincorporation levels being reported when expressing
therapeutic monoclonal antibodies in CHO cells during clinical development. The impact
of such sequence variation affects not just the quality and efficacybut could compromise
patient safety by triggering an immunogenic response.
[0005] Optimal protein expression systems leading to error-free and soluble protein expression
are highly desired. As described above, no organism harbours a full set of tRNAs and
moreover, there are species-dependent differences. Expression of e.g. a human- derived
transgene in a bacterial system is often problematic, as the codon usage and frequency
can differ greatly, leading to inefficient expression. This problem is generally addressed
by optimising codons to the preferred codon usage by the expression hosts. However,
manipulating transgene sequence is extremely problematic, as it interferes with the
structure, folding, stability and regulation of the encoded mRNA transcript in ways
that are poorly understood and highly unpredictable. An alternative approach is to
introduce additional tRNA transgenes into the host so as to improve codon recognition;
this has been used successfully in
E. coli, but has not been attempted in eukaryotic hosts. In addition, this approach does not
deal with the problems associated with wobble such as inefficient translation and
reduced translational fidelity.
[0006] WO2007/103307 discloses the incorporation of non-natural amino acids into proteins.
WO2007/103307 discloses host cells that are modified to express modified tRNAs and modified aminoacyl-tRNA
synthetases.
WO2004/085463 discloses the incorporation of "unnatural amino acids" into proteins.
US2005/287639 discloses the use of a modified aminoacyl-tRNA synthetase to charge "non-standard
amino acids" onto modified tRNAs wherein the anticodon of said tRNA is also altered
so that strict Watson and Crick base-pairings are formed.
WO2014/160032 discloses a sequence 100% identical to the specific 7SL sequence.
EP1911840 discloses a process of producing proteins comprising "unnatural amino acids" expressing
an aminoacyl-tRNA synthetase.
EP2246428 discloses the introduction of "non-canonical" (unnatural) amino acids into proteins
and modified tRNAs to improve the aminoacylation of the tRNA with a non-natural amino
acid.
WO2004/024915 discloses gene expression systems based on codon translation efficiencies and wherein
one codon is replaced with a codon of higher translation efficiency through introduction
of iso-tRNAs in CHO cells.
US2013/149699 discloses the modification of codons in mRNA to improve the translational efficiency
by reducing the dependency on wobble to increase ribosome transit along a messenger
RNA.
Johansson et al (PNAS vol 109(1) p131-136, 2012) discloses an
in vitro method for analysing codon usage by tRNAs to discover the parameters that are relevant
to accuracy of tRNA recognition of codons in mRNAs.
Iben et al (RNA vol 18(7) 1358-1372, 2012) discloses the correlation between tRNA abundance and codon recognition in non-complex
organisms such as yeast.
Herve Seligmann (Computational Biology and Chemistry, vol 35(2), p81-95, 2011) discloses codon-anticodon mismatches and tRNA misloading leading to mis-insertion
of amino acids.
Wald et al (Nucleic Acids Research, vol 40(15), 2012) discloses degeneracy of the genetic code and codon usage bias in mRNA and how this
relates to the population of tRNAs within a cell.
WO2015/048989 is a systematic approach to codon selection for provision of a coding sequence for
functional expression of a heterologous protein in a host cell.
[0007] The present disclosure relates to the introduction of tRNA genes with anticodons
to optimally match codons that otherwise depend on wobble; in this way, unintended
heterogeneity can be reduced and efficiency of protein synthesis can be improved.
Statement of the Invention
[0008] According to an aspect of the invention there is provided an isolated eukaryotic
cell, wherein said isolated eukaryotic cell is not a human germ cell, characterized
in that said cell is modified by transfection or transformation with a nucleic acid
molecule comprising a transcription cassette, the transcription cassette comprising
at least one nucleotide sequence encoding a transfer RNA [tRNA],
the tRNA including an anticodon nucleotide sequence selected from the group consisting
of AGC, GGC, CGC, UGC, ACC, GCC, CCC, UCC, AGG, GGG, CGG, UGG, AGU, GGU, CGU, UGU,
AAC, GAC, CAC, UAC, AAA, GAA, AUU, GUU, CUU, UUU, AUC, GUC, CUC, UUC, AGA, GGA, CGA,
UGA, ACU, GCU, ACG, GCG, CCG, UCG, CCU, UCU, AAG, GAG, CAG, UAG, CAA, UAA, AAU, GAU,
UAU, CAU, AUA, GUA, ACA, GCA, AUG, GUG, CUG, UUG, CCA and
that is absent from said eukaryotic cell, wherein said anticodon sequence corrects
base mismatches at any one of the cognate first, second or third nucleotide position
in the corresponding messenger RNA [mRNA] codon to improve translation efficiency
and/or decrease amino acid mis-incorporation as a consequence of degeneracy in the
genetic code, and wherein said base mismatch correction reduces said cells reliance
on wobble during translation of said mRNA.
[0009] "Wobble" is a well-known natural phenomenon. The genetic code means that a cell would
need tRNAs with 61 different anticodons to complement the available 61 codons. However,
due to the degeneracy of the genetic code, the third base is less discriminatory for
the amino acid than the other two bases. This third position in the codon is referred
to as the "wobble" position. At this position Us and Cs may be read by a G in the
anticodon. Similarly, As and Gs may be read by a U or y (pseudouridine) in the anticodon,
and A, U or C can be read by inosine in the anticodon. This flexibility in codon recognition
can result in less efficient translation and potential mis-incorporation of amino
acids. The invention addresses these problems by genetically engineering cells to
reduce the reliance on "wobble" to enhance translation and increase translation fidelity.
The transcription cassette according to the invention is adapted for expression of
said tRNA. This includes the provision of a suitable RNA polymerase III promoter.
Alternatively, the transcription cassette can be intergrated into the genome of said
cell at a position near to a suitable promoter, for example an RNA polymerase III
promoter.
[0010] In a preferred embodiment of the invention said nucleic acid molecule is part of
an expression vector adapted for eukaryotic expression of said tRNA.
[0011] In a preferred embodiment of the invention said cell is further modified by transformation
or transfection with a nucleic acid molecule encoding a recombinant protein, polypeptide
or peptide.
[0012] In a preferred embodiment of the invention said expression vector is adapted for
expression in a mammalian cell.
[0013] Typically, said adaptation includes the provision of transcription control sequences
(promoter sequences) which mediate cell/tissue specific expression. These promoter
sequences may be cell/tissue specific, inducible or constitutive. "Promoter" is an
art recognised term and, for the sake of clarity, includes the following features
which are provided by example only. Enhancer elements are
cis acting nucleotide sequences often found 5' to the transcription initiation site of
a gene (enhancers can also be found 3' to a gene sequence or even located in intronic
sequences). Enhancers function to increase the rate of transcription of the gene to
which the enhancer is linked. Enhancer activity is responsive to
trans acting transcription factors (polypeptides) which have been shown to bind specifically
to enhancer elements. The binding/activity of transcription factors is responsive
to a number of physiological/environmental cues which include, by example and not
by way of limitation, intermediary metabolites (e.g. glucose, lipids), environmental
effectors (e.g. heat). Promoter elements also include so called TATA box and RNA polymerase
initiation selection sequences which function to select a site of transcription initiation.
These sequences also bind polypeptides which function,
inter alia, to facilitate transcription initiation selection by RNA polymerase II or III. The
vector may be a bi-functional expression vector which functions in multiple hosts.
In the case of genomic DNA, this may contain its own promoter or other regulatory
elements and in the case of cDNA this may be under the control of an appropriate promoter
or other regulatory elements for expression in the host cell.
[0014] Adaptations also include the provision of selectable markers and autonomous replication
sequences which facilitate the maintenance of said vector in either the eukaryotic
cell or prokaryotic host. Vectors which are maintained autonomously are referred to
as episomal vectors. Episomal vectors are desirable since these molecules can incorporate
large DNA fragments (30-50kb DNA). Episomal vectors of this type are described in
WO98/07876. Alternatively, vectors can be "integrating vectors" which recombine with chromosomal
DNA to stably transform the cell into which the integrating vector is incorporated.
[0015] Adaptations which facilitate the expression of vector encoded recombinant genes include
the provision of transcription termination/polyadenylation sequences. This also includes
the provision of internal ribosome entry sites (IRES) which function to maximise expression
of vector encoded genes arranged in bi-cistronic or multi-cistronic expression cassettes.
Expression control sequences also include so-called Locus Control Regions (LCRs).
These are regulatory elements which confer position-independent, copy number-dependent
expression to linked genes when assayed as transgenic constructs. LCRs include regulatory
elements that insulate transgenes from the silencing effects of adjacent heterochromatin,
Grosveld et al., Cell (1987), 51: 975-985. There is a significant amount of published literature with respect to expression
vector construction and recombinant DNA techniques in general. Please see,
Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour
Laboratory, Cold Spring Harbour, NY and references therein;
Marston, F (1987) DNA Cloning Techniques: A Practical Approach Vol III IRL Press,
Oxford UK; DNA Cloning:
F M Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
(1994).
[0016] Additionally, a number of viruses are commonly used as vectors for the delivery of
exogenous genes. Commonly employed vectors include recombinantly modified enveloped
or non-enveloped DNA and RNA viruses, preferably selected from baculoviridiae, parvoviridiae,
picornoviridiae, herpesveridiae, poxviridae, adenoviridiae, or picornnaviridiae. Chimeric
vectors may also be employed which exploit advantageous elements of each of the parent
vector properties (See e.g.,
Feng, et al.(1997) Nature Biotechnology 15:866-870). Such viral vectors may be wild-type or may be modified by recombinant DNA techniques
to be replication deficient, conditionally replicating or replication competent.
[0017] In a preferred embodiment of the invention said expression vector is adapted for
expression in a fungal cell.
[0018] In a preferred embodiment of the invention said expression vector is adapted for
expression in an insect cell.
[0019] In a preferred embodiment of the invention said expression vector is adapted for
expression in a plant cell.
[0020] Suitable promoters for expression of recombinant proteins or tRNAs in plant cells
include constitutive, tissue-specific, inducible, developmental or other promoters
for expression in plant cells. Such promoters include viral, fungal, bacterial, animal
and plant-derived promoters capable of functioning in plant cells. Constitutive promoters
include, for example CaMV 35S promoter (
Odell et al. (1985) Nature 313, 9810-812); rice actin (
McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (
Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (
Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (
Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (
U.S. Application Seriel No. 08/409,297), and the like. Other constitutive promoters include those in
U.S. Patent Nos. 5,608,149;
5,608,144;
5,604,121;
5,569,597;
5,466,785;
5,399,680,
5,268,463; and
5,608,142, Chemical-regulated plant promoters can be used to modulate the expression of a gene
in a plant cell through the application of an exogenous chemical regulator. Depending
upon the objective, the promoter may be a chemical-inducible promoter, where application
of the chemical induces gene expression, or a chemical-repressible promoter, where
application of the chemical represses gene expression. Chemical-inducible promoters
are known in the art of plant transgenic expression and include, but are not limited
to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners,
the maize GST promoter, which is activated by hydrophobic electrophilic compounds
that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is
activated by salicylic acid. Other chemical-regulated plant promoters of interest
include steroid-responsive promoters (see, for example, the glucocorticoid-inducible
promoter in
Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and
McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example,
Gatz et al. (1991) Mol. Gen. Genet. 227: 229-237, and
US Patent Nos. 5,814,618 and
5,789,156,
[0022] Particular of interest in the present context are nucleic acid constructs which operate
as plant vectors. Specific procedures and vectors previously used with wide success
in plants are described by
Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In:
Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp
121-148. Suitable vectors may include plant viral-derived vectors (see e.g.
EP194809). If desired, selectable genetic markers may be included in the construct, such as
those that confer selectable phenotypes such as resistance to herbicides (e.g. kanamycin,
hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin,
imidazolinones and glyphosate).
[0023] In a preferred embodiment of the invention said isolated eukaryotic cell is an insect,
plant, fungal or mammalian cell.
[0024] In a preferred embodiment of the invention said isolated mammalian cell is a non-human
mammalian cell.
[0025] In a further preferred embodiment of the invention said isolated mammalian cell is
selected from the group consisting of: Chinese Hamster Ovary, [CHO], HEK293, NS0 or
CAP cells.
[0026] In a further preferred embodiment of the invention said fungal cell is selected from
the group consisting of yeast:
Saccharomyces cerevisae, Schizosaccharomyces pombe Pichia pastoris, Aspergillus spp
[e.g A.nigerj, Kluyveromyces lactis and Trichoderma reesei and Yarrowia lipolytica.
[0027] In a preferred embodiment of the invention said plant cell is isolated from a plant
species selected from the group: corn (Zea mays), canola (Brassica napus, Brassica
rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum
(Sorghum bicolor, Sorghum vulgare), sunflower (helianthus annuas), wheat (Tritium
aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum),
peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (lopmoea batatus),
cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple
(Anana comosus), citris tree (Citrus spp.) cocoa (Theobroma cacao), tea (Camellia
senensis), banana (Musa spp.), avacado (Persea americana), fig (Ficus casica), guava
(Psidium guajava), mango (Mangifer indica), olive (Olea europaea), papaya (Carica
papaya), cashew (Anacardium occidentale), macadamia (Macadamia intergrifolia), almond
(Prunus amygdalus), sugar beets (Beta vulgaris), oats, barley, vegetables and ornamentals.
[0028] Preferably, plant cells of the present invention are crop plants (for example, cereals
and pulses, maize, wheat, potatoes, tapioca, rice, sorghum, millet, cassava, barley,
pea, and other root, tuber or seed crops). Important seed crops are oil-seed rape,
sugar beet, maize, sunflower, soybean, and sorghum. Horticultural plants to which
the present invention may be applied may include lettuce, endive, and vegetable brassicas
including cabbage, broccoli, and cauliflower, and carnations and geraniums. The present
invention may be applied in tobacco, cucurbits, carrot, strawberry, sunflower, tomato,
pepper, chrysanthemum. Grain plants that provide seeds of interest include oil-seed
plants and leguminous plants. Seeds of interest include grain seeds, such as corn,
wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower,
sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include
beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans,
cowpea, mungbean, lima bean, fava bean, lentils, chickpea.
[0029] In a further preferred embodiment of the invention said expression cassette comprises
nucleotide sequences encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15
different tRNAs.
[0030] In an embodiment of the invention said nucleic acid encodes a transfer RNA selected
from the group of Ala-tRNA, Arg-tRNA, Asp-tRNA, Asn-tRNA, Cys-tRNA, Glu-tRNA, Gln-tRNA,
Gly-tRNA, His-tRNA, Ile-tRNA, Leu-tRNA, Lys-tRNA, Met-tRNA, Phe-tRNA, Pro-tRNA, Ser-tRNA,
Thr-tRNA, Trp-tRNA, Tyr-tRNA and Val-tRNA.
[0031] In a preferred embodiment said anticodon is cytosine and/or adenine rich.
[0032] In a preferred embodiment said anticodon is uracil free.
[0033] In a preferred embodiment of the invention said modified cell is transformed or transfected
with a nucleic acid molecule encoding a therapeutic antibody.
[0034] In an alternative embodiment of the invention said modified cell is transformed or
transfected with a nucleic acid molecule encoding a pharmaceutical or therapeutic
protein or peptide.
[0035] In a further preferred embodiment of the invention said modified cell is transformed
or transfected with a nucleic acid molecule encoding an industrial enzyme.
[0036] In a preferred embodiment of the invention said modified cell is further modified
by transformation or transfection with a nucleic acid molecule comprising a 7SL nucleotide
sequence.
[0037] Secreted and membrane proteins contain signal sequences that are required to target
proteins to be secreted to the endoplasmic reticulum. The signal sequences of native
and recombinant proteins destined for secretion interact with a signal recognition
particle which is a ribonucleoprotein complex comprising six different proteins and
a structural RNA of around 300 nucleotides and is referred to as 7SL RNA. 7SL RNA
is conserved across species and although there is little homology at the level of
sequence identity the secondary structures of 7SL RNA are highly conserved comprising
a central double stranded region which is flanked at one end by two small stem loop
structures and at the other end by two relatively large stem loop structures. We disclose
that co-expression of 7SL nucleic acid in our modified cells greatly enhances expression
of recombinant protein.
[0038] In a preferred embodiment of the invention said nucleic acid molecule comprises the
nucleotide sequence set forth in SEQ ID NO: 10, or a nucleotide sequence variant that
has at least 90% nucleotide sequence identity over the full length to the nucleotide
sequence set forth in SEQ ID NO: 10.
[0039] In a preferred embodiment of the invention there is provided a nucleic acid molecule
that comprises a nucleotide sequence that has at least 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98% or 99% nucleotide sequence identity over the full length to the nucleotide
sequence set forth in SEQ ID NO: 10.
[0040] Preferably, said nucleic acid molecule comprises or consists of a nucleotide sequence
as set forth in SEQ ID NO: 10.
[0041] In a preferred embodiment of the invention translation efficiency is enhanced by
greater than 1-fold when compared to a non-modified cell of the same species.
[0042] In a preferred embodiment of the invention translation efficiency is enhanced at
least two fold when compared to a non-modified cell of the same species.
[0043] Preferably, translational efficiency is enhanced at least 3-fold, 4-fold, 5-fold,
6-fold, 7-fold, 8-fold, 9-fold or at least 10-fold when compared to a non-modified
cell of the same species. Preferably, translation is enhanced by greater than 10-fold
when compared to a non- modified cell of the same species.
[0044] In a preferred embodiment of the invention the mis-incorporation of amino acids in
said recombinant protein is suppressed by greater than 1-fold when compared to the
amino acid mis-incorporation rate in a non-modified cell of the same species.
[0045] In a preferred embodiment of the invention the mis-incorporation of amino acids in
said recombinant protein is suppressed by at least 2-fold when compared to the amino
acid mis-incorporation rate in a non-modified cell of the same species.
[0046] Preferably, mis-incorporation is suppressed by at least 3-fold, 4-fold, 5-fold, 6-fold,
7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold or at
least 40-fold when compared to the amino acid mis-incorporation rate in a non-modified
cell of the same species.
[0047] According to an aspect of the invention there is provided a modified cell according
to the invention for use in reducing tRNA mismatch as a consequence of the degeneracy
in the genetic code in the production of recombinant protein.
[0048] Preferably, said reduction in tRNA mismatch reduces said cell's reliance on wobble
during translation of said mRNA by said modified cell.
[0049] According to a further aspect of the invention there is provided a method for reducing
tRNA mismatch as a consequence of the degeneracy in the genetic code comprising the
steps:
- i) providing a modified cell according to the invention;
- ii) incubating the cell in i) under cell culture conditions suitable for expression
of one or more recombinant proteins/peptides expressed by said modified cell; and
optionally
- iii) isolating the expressed recombinant proteins/peptides from the modified cell
or cell culture medium.
[0050] According to a further aspect of the invention there is provided a method to customise
expression of a selected recombinant protein in a cell expression system comprising
the steps:
- i) analysing the nucleotide sequence of a nucleic acid molecule encoding a recombinant
protein to be expressed to identify one or more codon/anticodon tRNA mismatches;
- ii) transfecting or transforming a cell with one or more transcription cassettes comprising
one or more tRNA genes that correct at least one base pairing mismatch in at least
one codon to provide a modified cell;
- iii) transfecting or transforming said modified cell with the recombinant protein
to be expressed; and optionally
- iv) providing cell culture conditions to express said recombinant protein.
[0051] In a preferred method of the invention said cell is a eukaryotic cell.
[0052] Preferably, said cell is a mammalian cell, a fungal cell, an insect cell or a plant
cell.
[0053] In an alternative preferred method of the invention said cell is a prokaryotic cell,
for example a bacterial cell.
[0054] According to an aspect of the invention there is provided a modified cell obtained
or obtainable by the method according to the invention.
[0055] According to a further aspect of the invention there is provided a cell culture vessel
comprising a modified cell according to the invention. In a preferred embodiment of
the invention said cell culture vessel is a bioreactor such as a fermenter.
[0056] If eukaryotic microbial or prokaryotic expression is preferred in the methods according
to the invention they are grown or cultured in the manner with which the skilled worker
is familiar, depending on the host organism. As a rule, microorganisms are grown in
a liquid medium comprising a carbon source, usually in the form of sugars, a nitrogen
source, usually in the form of organic nitrogen sources such as yeast extract or salts
such as ammonium sulfate, trace elements such as salts of iron, manganese and magnesium
and, if appropriate, vitamins, at temperatures of between 0°C and 100°C, preferably
between 10°C and 60°C, while gassing in oxygen.
[0057] The pH of the liquid medium can either be kept constant, that is to say regulated
during the culturing period, or not. The cultures can be grown batch wise, semi-batch
wise or continuously. Nutrients can be provided at the beginning of the fermentation
or fed in semi-continuously or continuously. Recombinant protein produced can be isolated
from the organisms as described above by processes known to the skilled worker, for
example by extraction, if appropriate precipitation with salt, and/or chromatography.
To this end, the organisms can advantageously be disrupted beforehand.
[0059] As described above, these media which can be employed in accordance with the invention
usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins
and/or trace elements. Preferred carbon sources are sugars, such as mono-, di- or
polysaccharides. Examples of carbon sources are glucose, fructose, mannose, galactose,
ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose.
Sugars can also be added to the media via complex compounds such as molasses or other
by-products from sugar refining. The addition of mixtures of a variety of carbon sources
may also be advantageous. Other possible carbon sources are oils and fats such as,
for example, soya oil, sunflower oil, peanut oil and/or coconut fat, fatty acids such
as, for example, palmitic acid, stearic acid and/or linoleic acid, alcohols and/or
polyalcohols such as, for example, glycerol, methanol and/or ethanol, and/or organic
acids such as, for example, acetic acid and/or lactic acid.
[0060] Nitrogen sources are usually organic or inorganic nitrogen compounds or materials
comprising these compounds. Examples of nitrogen sources comprise ammonia in liquid
or gaseous form or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium
phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or
complex nitrogen sources such as cornsteep liquor, soya meal, soya protein, yeast
extract, meat extract and others. The nitrogen sources can be used individually or
as a mixture.
[0061] Inorganic salt compounds which may be present in the media comprise the chloride,
phosphorus and sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium,
manganese, zinc, copper and iron. Inorganic sulfur-containing compounds such as, for
example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides,
or else organic sulfur compounds such as mercaptans and thiols may be used as sources
of sulfur for the production of sulfur-containing fine chemicals, in particular of
methionine. Phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate
or the corresponding sodium-containing salts may be used as sources of phosphorus.
[0062] The fermentation media used according to the invention for culturing microorganisms
usually also comprise other growth factors such as vitamins or growth promoters, which
include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate
and pyridoxine. Growth factors and salts are frequently derived from complex media
components such as yeast extract, molasses, cornsteep liquor and the like. It is moreover
possible to add suitable precursors to the culture medium.
[0063] Throughout the description and claims of this specification, the words "comprise"
and "contain" and variations of the words, for example "comprising" and "comprises",
means "including but not limited to", and is not intended to (and does not) exclude
other moieties, additives, components, integers or steps. "Consisting essentially"
means having the essential integers but including integers which do not materially
affect the function of the essential integers.
[0064] Throughout the description and claims of this specification, the singular encompasses
the plural unless the context otherwise requires. In particular, where the indefinite
article is used, the specification is to be understood as contemplating plurality
as well as singularity, unless the context requires otherwise.
[0065] Features, integers, characteristics, compounds, chemical moieties or groups described
in conjunction with a particular aspect, embodiment or example of the invention are
to be understood to be applicable to any other aspect, embodiment or example described
herein unless incompatible therewith.
Preferred Embodiments
[0066] Antibodies include polyclonal, monoclonal antibodies, humanised and chimeric antibodies
and derived fragments comprising CDRs.
[0067] Chimeric antibodies are recombinant antibodies in which all of the V-regions of a
mouse or rat antibody are combined with human antibody C-regions. Humanised antibodies
are recombinant hybrid antibodies which fuse the complementarity determining regions
from a rodent antibody V-region with the framework regions from the human antibody
V-regions. The C-regions from the human antibody are also used. The complementarity
determining regions (CDRs) are the regions within the N-terminal domain of both the
heavy and light chain of the antibody to where the majority of the variation of the
V-region is restricted. These regions form loops at the surface of the antibody molecule.
These loops provide the binding surface between the antibody and antigen.
[0068] Antibodies from non-human animals provoke an immune response to the foreign antibody
and its removal from the circulation. Both chimeric and humanised antibodies have
reduced antigenicity when injected to a human subject because there is a reduced amount
of rodent (i.e. foreign) antibody within the recombinant hybrid antibody, while the
human antibody regions do not elicit an immune response. This results in a weaker
immune response and a decrease in the clearance of the antibody. This is clearly desirable
when using therapeutic antibodies in the treatment of human diseases. Humanised antibodies
are designed to have less "foreign" antibody regions and are therefore thought to
be less immunogenic than chimeric antibodies.
[0069] Various fragments of antibodies are known in the art. A Fab fragment is a multimeric
protein consisting of the immunologically active portions of an immunoglobulin heavy
chain variable region and an immunoglobulin light chain variable region, covalently
coupled together and capable of specifically binding to an antigen. Fab fragments
are generated via proteolytic cleavage (with, for example, papain) of an intact immunoglobulin
molecule. A Fab
2 fragment comprises two joined Fab fragments. When these two fragments are joined
by the immunoglobulin hinge region, a F(ab')
2 fragment results. An Fv fragment is multimeric protein consisting of the immunologically
active portions of an immunoglobulin heavy chain variable region and an immunoglobulin
light chain variable region covalently coupled together and capable of specifically
binding to an antigen. A fragment could also be a single chain polypeptide containing
only one light chain variable region, or a fragment thereof that contains the three
CDRs of the light chain variable region, without an associated heavy chain variable
region, or a fragment thereof containing the three CDRs of the heavy chain variable
region, without an associated light chain moiety; and multi specific antibodies formed
from antibody fragments, this has for example been described in
US patent No 6,248,516. Fv fragments or single region (domain) fragments are typically generated by expression
in host cell lines of the relevant identified regions. These and other immunoglobulin
or antibody fragments are within the scope of the invention and are described in standard
immunology textbooks such as
Paul, Fundamental Immunology or
Janeway et al. Immunobiology (cited above). Molecular biology now allows direct synthesis (via expression in cells
or chemically) of these fragments, as well as synthesis of combinations thereof. A
fragment of an antibody or immunoglobulin can also have bispecific function as described
above.
Pharmaceutical Proteins & Peptides
[0070] Examples of pharmaceutical proteins include "cytokines". Cytokines are involved in
a number of diverse cellular functions. These include modulation of the immune system,
regulation of energy metabolism and control of growth and development. Cytokines mediate
their effects via receptors expressed at the cell surface on target cells. Examples
of cytokines include the interleukins such as: IL1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
and 33. Other examples include growth hormone, leptin, erythropoietin, prolactin,
tumour necrosis factor [TNF] granulocyte colony stimulating factor (GCSF), granulocyte
macrophage colony stimulating factor (GMCSF), ciliary neurotrophic factor (CNTF),
cardiotrophin-1 (CT-1), leukemia inhibitory factor (LlF) and oncostatin M (OSM), interferon
α, interferon β, interferon ε, interferon κ and ω interferon.
[0071] Examples of pharmaceutically active peptides include GLP-1, anti-diuretic hormone;
oxytocin; gonadotropin releasing hormone, corticotrophin releasing hormone; calcitonin,
glucagon, amylin, A-type natriuretic hormone, B-type natriuretic hormone, ghrelin,
neuropeptide Y, neuropeptide YY
3-36, growth hormone releasing hormone, somatostatin; or homologues or analogues thereof.
[0072] The term "chemokine" refers to a group of structurally related low-molecular weight
factors secreted by cells having mitogenic, chemotactic or inflammatory activities.
They are primarily cationic proteins of 70 to 100 amino acid residues that share four
conserved cysteine residues. These proteins can be sorted into two groups based on
the spacing of the two amino-terminal cysteines. In the first group, the two cysteines
are separated by a single residue (C-x-C), while in the second group they are adjacent
(C-C). Examples of members of the 'C-x-C' chemokines include but are not limited to
platelet factor 4 (PF4), platelet basic protein (PBP), interleukin-8 (IL-8), melanoma
growth stimulatory activity protein (MGSA), macrophage inflammatory protein 2 (MIP-2),
mouse Mig (m119), chicken 9E3 (or pCEF-4), pig alveolar macrophage chemotactic factors
I and II (AMCF-I and -II), pre-B cell growth stimulating factor (PBSF),and IP10. Examples
of members of the 'C-C' group include but are not limited to monocyte chemotactic
protein 1 (MCP-1), monocyte chemotactic protein 2 (MCP-2), monocyte chemotactic protein
3 (MCP-3), monocyte chemotactic protein 4 (MCP-4), macrophage inflammatory protein
1 α (MIP-1-α), macrophage inflammatory protein 1β (MIP-1-β), macrophage inflammatory
protein 1-γ (MIP-1-γ), macrophage inflammatory protein 3 α (MIP-3-α, macrophage inflammatory
protein 3 β (MIP-3-β), chemokine (ELC), macrophage inflammatory protein-4 (MIP-4),
macrophage inflammatory protein 5 (MIP-5), LD78 β, RANTES, SIS-epsilon (p500), thymus
and activation-regulated chemokine (TARC), eotaxin, I-309, human protein HCC-1/NCC-2,
human protein HCC-3.
[0073] A number of growth factors have been identified which promote/activate endothelial
cells to undergo angiogenesis. These include vascular endothelial growth factor (VEGF
A); VEGF B, VEGF C, and VEGF D; transforming growth factor (TGFb); acidic and basic
fibroblast growth factor (aFGF and bFGF); and platelet derived growth factor (PDGF).
VEGF is an endothelial cell-specific growth factor which has a very specific site
of action, namely the promotion of endothelial cell proliferation, migration and differentiation.
VEGF is a complex comprising two identical 23 kD polypeptides. VEGF can exist as four
distinct polypeptides of different molecular weight, each being derived from an alternatively
spliced mRNA. bFGF is a growth factor that functions to stimulate the proliferation
of fibroblasts and endothelial cells. bFGF is a single polypeptide chain with a molecular
weight of 16.5Kd. Several molecular forms of bFGF have been discovered which differ
in the length at their amino terminal region. However the biological function of the
various molecular forms appears to be the same.
[0074] An embodiment of the invention will now be described by example only and with reference
to the following figures:
Figure 1: Illustrates expression vector pcDNA3 Tyr-ATA carrying a 570bp insert that
includes a tRNA TyrATA gene that is absent from CHO cells;
Figure 2: Illustrates RT-PCR assay demonstrating expression of human tRNA Tyr-ATA
gene in stably-transfected CHO cells;
Figure 3: Illustrates a transgenic cluster carrying three human tRNA genes with no
equivalent in the CHO genome. These were incorporated cloned into pcDNA3 to create
pcDNA.YIN, and stably transfected into CHO cells;
Figure 4: Illustrates RT-PCR assay demonstrating expression of human tRNA Tyr-ATA,
tRNA Asn-ATT and tRNA !!e-GAT genes in CHO cells transfected with pcDNA.YIN;
Figure 5: Illustrates the expression vector pCET1006L&H encoding Herceptin light and
heavy chains;
Figure 6: Illustrates the effects on relative expression of secreted Herceptin (trastuzumab)
of transiently transfecting cloned cells carrying stably incorporated pCET1006L&H
with empty vector, pcDNA.YIN + pSUPER.7SL, pcDNA.YIN + vector, or pSUPER-7SL + vector.
Mean relative expression (n=3) was vector 1.00, pcDNA.YIN + pSUPER-7SL 1.49, pcDNA.YIN
+ vector 1.20, pSUPER-7SL + vector 1.24;
Figure 7: Illustrates the relative expression of secreted Herceptin (trastuzumab)
by matched clones of cells stably transfected with pCET1006L&H with or without pcDNA.YIN.
The ratio of secreted Herceptin (trastuzumab) relative to secreted fibronectin (a
CHO gene product, control) was increased by -59% with pcDNA.YIN (n=4);
Figure 8: Illustrates the percentage of Herceptin (trastuzumab) polypeptides secreted
by matched clones of cells stably transfected with pCET1006L&H with or without pcDNA.YIN
that have lysine erroneously incorporated instead of asparagine at residue 156 of
the light chain and residues 307, 336 and 405 of the heavy chain;
Figure 9: Illustrates vector pRS426, which received a 300bp fragment of Schizosaccharomyces pombe genomic sequence containing the tRNA49-LeuCAG gene (SEQ ID NO 9), to create pAU39;
Figure 10: Illustrates expression of COG8 and Pgk1, as determined by western blot,
in S. cerevisiae with or without plasmid pAU39 expressing tRNA-LeuCAG (n=3);
Figure 11: Illustrates vector pESC-TRP, which was used to express in S. cerevisiae
the turmeric enzyme diketide-CoA synthase (DCS); and
Figure 12: Illustrates expression of DCS and Pgk1, as determined by western blot,
in S. cerevisiae with or without plasmid pAU39 expressing tRNA-LeuCAG.
Materials and Methods
Cloning a human tRNA-Tyr-ATA gene into pcDNA3
[0075] A 500bp genomic DNA fragment (sequence ID NO 1) containing the human tRNA-Tyr-ATA
gene (chr2:219110270-219110770) with the addition of an
attB sequence at the 5' end and flanked by
Bg/II (5') and
XhoI (3') restriction enzyme sequences was synthesised by Life Technologies and provided
in the vector pMK-Tyr_ATA. The sequence was released by digestion with
BglII and
XhoI at 37°C and gel purified. The eukaryotic expression vector pcDNA3 was digested with
BgIII and Xhol to remove the CMV promoter, and gel purified. The two DNA fragments
were joined using T4 ligase (NEB) and introduced into chemically induced competent
E.coli by heat shock for 1 minute at 42°C. Plasmid was subsequently isolated from the resulting
carbenicillin resistant (50µg/ml) colonies and the presence of the insert confirmed
by restriction digest and subsequent sequencing.

[0076] Sequence 1 - Sequence of synthesised genomic fragment containing the human Tyr-ATA
gene (green text) with the lambda
Attb integration site fused at the 3' end for targeted genomic integration (yellow highlight).
Transfection of pcDNA-Tyr-ATA into CHO cells
[0077] CHO-KI cells were grown in Ham's F12 media supplemented with 10% foetal calf serum
and cultured at 37°C in 5% CO
2. For transfection, 350,000 cells were plated per well in a 6 well plate containing
3ml of media. The next day the media was removed and replaced by 1ml fresh media and
5µg of plasmid was introduced to the cells using the X-fect reagent (Clontech) according
to the manufacturer's instructions. After 24hrs, all cells from 3 wells were collected
and re-plated into a T75 flask containing 15ml media supplemented with 400µg/ml G418
as the pcDNA vector carries a neomycin resistance gene. These cells were split 1:4
three days later and the G418 increased to 600µg/ml. The cells were subsequently split
1:4 every 2-3 days and the G418 increased further to 800µg/ml at day 12. Selection
was continued at 800µg/ml until no further cell death occurred, indicating fully transformed
and resistant cell lines. Untransformed cells cultured in the presence of G418 did
not expand and steadily dwindled in number.
Expression Analysis of pcDNA-Tyr-ATA
[0078] RNA was extracted from CHO cells using 1ml/well Trizol (Life technologies) according
to the manufacturer's instructions. Following precipitation, the RNA pellet was suspended
in 30µl 1X DNase1 buffer containing 4u RNase free DNase1 (NEB M0303S), the RNA was
incubated at 37°C for 30min before stopping the reaction at 70°C for 10 minutes. 1µg
of RNA was then reverse transcribed to cDNA using SuperScript IV (Life Technologies)
and random nonomers (Sigma) as follows [mix 1µg of RNA, 1µl random nonomers, 1µl 10mM
dNTP mix, RNase free water to 14µl, heat to 70°C for 5min then chill on ice, add 4µl
5X SSIV buffer, 1µl 100mM DTT and 1µl SuperScript IV reverse transcriptase, leave
to stand at room temperature for 10min, then 55°C for 30min before stopping the reaction
at 80°C for 10min]. The cDNA was subsequently diluted to 100µl with DNase/RNase free
water and was used in PCR reactions with OneTaq polymerase 2X mix (NEB) and gene-specific
primers (SEQ ID NO 2: ATA forward-GCTGGTAGAGCAGAGGACTAT, SEQ ID NO 3: ATA(2) reverse
- TCGAACCAGCAACCTAAGGAC). [OneTaq 2X with standard buffer - 10µl, cDNA -2µl, 10µM
primers - 0.2µl, dH
2O to 20µl]. PCR conditions-[94°C-3min,( 94°C-30s, 62°C-12s, 68°C-12s)X35,68°C-3min]
The results of the PCR were visualised on 3% TBE Agarose gel with SYBR Safe DNA stain
(Invitrogen).
Construction of YIN Cluster of Human tRNA Genes (tRNA-IIeGAT1-1, tRNA-AsnATT1-1 and
tRNA-TyrATA), .
[0079] Sequence was obtained for each tRNA gene as follows - Ile-GAT 1-1 hg19_dna range
ChrX: 3756418-3756491, Asn-ATT1-1 hg19_dna range chr1:147718729-147719202. The sequences
were synthesised as one fragment of DNA with
HindIII site separating them (sequence ID NO 4), and flanked by
BamHI sites for cloning adjacent to the Tyr-ATA tRNA sequence in pcDNA-Tyr-ATA (Figure
3). The resultant construct was named pcDNA.YIN.,

Introduction of YIN tRNA Gene Cluster into CHO cells and Confirmation of Expression.
[0080] pcDNA-YIN was transfected stably into CHO K1 cells, as described above for pcDNA-Tyr-ATA.
Expression of each tRNA was confirmed in transfectants (Figure 4), as described above
for tRNA-Tyr-ATA. Primer sequences were (SEQ ID NO 5: Forward-TCAGGCGGCCGGTTAGC, SEQ
ID NO 6: Reverse - GCTAACGCCGTGGCCGGTG) for tRNA-Ile-GAT and (SEQ ID NO 7 Forward
- TCGCTAGTACCTGTCTCTGTGG and SEQ ID NO 8: Reverse - CCTGGGTGGTCTTGAACTACTC) for tRNA-Asn-ATT.
Creation of Stably-Transfected Clones Expressing Herceptin (Trastuzumab)
[0081] One day prior to the transfection, 3×10
5 CHO cells were plated in 1ml of complete growth medium (F12/DMEM) in 6-well Costar
clear TC treated cell culture plates (Corning) so that the cells were 50-70% confluent
at the time of transfection. In a microcentrifuge tube, 5µg of plasmid pCET1006L+H
(Figure 5) DNA encoding Herceptin (trastuzumab) was diluted with Xfect Reaction Buffer
to a final volume of 100µl and mixed by vortexing for 5 sec at high speed. 1.5µl Xfect
Polymer was added to the diluted plasmid DNA, mixed well by vortexing for 10 sec at
high speed (the ratio of Polymer:DNA held constant: 0.3µl of Xfect Polymer per 1µg
of plasmid DNA). The mixture was incubated for 10 min at room temperature to allow
nanoparticle complexes to form. The entire 100µl of nanoparticle complex solution
was added dropwise to the cell culture medium in a well. Plates were incubated at
37°C, 5% CO
2 for 4 hr to overnight, then nanoparticle complexes were removed from cells by aspiration,
replaced with 2-3 ml fresh complete growth medium and the plates were returned to
the 37°C incubator. After 24hrs, the cells were trypsinised, counted and resuspended
at 200, 500 or 1000 cells/ml in ClonaCell
™ semi-solid media (Stem Cell Technologies) supplemented with Glutamax (Gibco) and
puromycin (10µg/ml) in untreated plates. The plates were incubated at 37°C, 5% CO
2 for 14-21 days until the colonies were clearly visible. Individual colonies were
pipetted off into liquid F12 media, supplemented with 10% FCS and 10ug/ml puromycin,
and expanded, before analysis by Western blot.
[0082] To assay expression of Herceptin (trastuzumab), 1ml of medium was removed to an Eppendorf
tube and spun at 1200rpm to pellet any cellular debris. Supernatant (880µl) was taken
off and frozen at -80°C. Samples of medium (30µl) were mixed with 10µl alkylating
loading buffer, (125mM Tris, 20% glycerol 2% SDS, 90mM N-Ethylmaleimide (NEM) Bromophenol
blue) and incubated at RT for 15 mins. Samples were then heated at 95°C for 10 mins
and cooled on ice before SDS-PAGE. Protein was transferred to membrane (Amersham Protran
0.45micron NC # 10600003) pre-soaked in transfer buffer (Towbin-25mM Tris-HCl, 192mM
Glycine, pH8.3, 20% MeOH) using a Hoefer Semiphor semi-dry blotter. The membrane was
rinsed in 1X PBS and blocked O/N at 4 °C in 5% milk powder, 1% PVP-40 (Sigma 101616021),
0.05% Tween-20 (Applichem GmbH A4974) in 1X PBS). Blocking buffer was then removed
and replaced with an HRP conjugated anti-human IgG antibody at a dilution of 1/5000.
(Abcam 97165 1mg/ml Goat pAb to human IgG HRP) and incubated for 1 hr at RT with shaking.
The membrane was then washed 3x 10 mins in 1x PBS + 0.05% Tween 20. Proteins were
detected by adding #34087 Thermo Super-Signal Western Pico Chemi substrate. Excess
reagent was removed and signal detected with a SynGene G box chemiimager with GeneSnap
software. Membranes were then rinsed in 1X PBS and Fibronectin antibody Ab 2413 (Abcam)
added at a 1/10000 dilution in blocking buffer or Sigma F6140 Fibronectin mouse monoclonal
1/4000 dilution blocked in 5% BSA (Sigma A7906) and incubated O/N at 4
0C. Membranes then were washed 3x 10 mins 1x PBS + 0.05% Tween 20, then secondary antibody
added in milk blocking buffer (Anti-rabbit IgG HRP 7074S Cell Signalling at a dilution
of 1/5000 or anti-mouse HRP 1/5000 dilution #7076P2 Cell Signalling) and incubated
1hr at RT with shaking.
[0083] Membrane was washed 3x10 mins in PBS/Tween and developed using high sensitivity substrate
as above. Chemiimages were analysed using image J (https://imagej.nih.gov/ij/index.html).
Effects of Wobble Suppression by YIN on Expression of Herceptin (Trastuzumab)
[0084] Clones stably transfected with pCET1006L+H were used to test how expression of Herceptin
(trastuzumab) responds to wobble suppression by transient or stable introduction of
human tRNA-lleGAT1-1, tRNA-AsnATT1-1 and tRNA-TyrATA genes using pcDNA.YIN. CHO cells
do not have these three tRNAs and therefore rely on wobble to decode ATC, AAT and
TAT codons for Ile, Asn and Tyr, respectively.
[0085] Clones expressing stably transfected pCET1006L+H were grown at 37°C in 5% CO
2 in Hams F12 medium with L-glutamine (Lonza BE12615F), supplemented with 10 % foetal
calf serum (Gibco 10270), 100 U/ml Pen/Strep (Gibco 15140122) and 10µg/ml Puromycin
(Gibco A11138) and transfected with pcDNA.YIN or equal amounts of pcDNA.3 empty vector,
using Genecelin. Response to overexpression of 7SL RNA was tested in parallel, by
cotransfection of pSUPER-7SL (
Misra et al. (2005) J. Biol. Chem 280, 29364), with equal amounts of pcDNA.YIN or empty vector. Levels of Herceptin (trastuzumab)
secreted into medium were determined by western blot, as above, 3 days after transfection
(Figure 6).
[0086] To test the effect of stably expressing tRNA-lleGAT1-1, tRNA-AsnATT1-1 and tRNA-TyrATA,
clones stably transfected with pCET1006L+H were further transfected with pcDNA.YIN,
as above. After 24hrs, the cells were trypsinised, counted and resuspended at 200,
500 or 1000 cells/ml in ClonaCell
™ semi-solid media (Stem Cell Technologies) supplemented with Glutamax (Gibco) and
puromycin (10µg/ml) (Gibco A11138), for continued selection of pCET1006L+H integration,
and 800µg/ml G418 (Sigma
A1720) for selection of pcDNA.YIN integration. The plates were incubated at 37°C, 5% CO
2 for 14-21 days until the colonies were clearly visible. Individual colonies were
pipetted off into liquid F12 media, supplemented with 10% FCS, 800µg/ml G418 and 10ug/ml
puromycin, and expanded. These and parental clones were cultured in T25 cell culture
flasks (Starsted) at 37°C in 5% CO
2 in Hams F12 medium with L-glutamine (Lonza BE12615F), supplemented with 10 % foetal
calf serum (Gibco 10270), 100 U/ml Pen/Strep (Gibco 15140122) and 10µg/ml Puromycin
(Gibco A11138), with or without 800µg/ml G418 (Sigma
A1720), as appropriate. To assay expression of Herceptin (trastuzumab), 500,000 cells (at
passages 4-8) were plated in 5ml of medium in a T25 flask, as above. After 72hrs,
a 1ml aliquot of medium was removed to an Eppendorf tube and spun at 1200rpm to pellet
any cellular debris. Supernatant (880µl) was taken off and frozen at -80. Expression
was assayed subsequently by western blot, as described above (Figure 7).
Effects of Wobble Suppression on Misincorporation of Lysine for Asparagine in Herceptin
(Trastuzumab)
[0087] For analysis by mass spectrometry (MS), Herceptin was purified from cell culture
supernatant (F12:DMEM medium with 10% Ultra-Low IgG FBS [Thermo Scientific]) harvested
72-96 hr after plating of single cell clones of stably expressing CHO cells, using
Pierce Protein A Magnetic Beads. (Thermo Scientific Pierce 50µl, 0.5mg) Magnetic Beads
were pipetted to a microcentrifuge tube. The tube was placed on the magnet to separate
the beads from the storage solution. The Magnetic Beads were washed with 1ml wash
buffer (TBS containing 0.05% Tween-20 Detergent), the beads were collected by magnet
and the supernatant removed. 30ml of the cell culture supernatant was concentrated
to 1.5ml using Amicon Ultra-15 Centrifugal Filter Units with Ultracel-50 membrane
(Merck Millipore), added to the beads and incubated with rotation for 60 min at room
temperature. The tube was placed on the magnet and the supernatant removed. The beads/antibody
complex was resuspended in 500µl wash buffer and washed by gentle pipetting. The beads/antibody
complex was washed in total 3 times and separated on the magnet between each wash.
The bead suspension was transferred to a clean tube to avoid co-elution of proteins
bound to the tube wall. 100µl of elution buffer (50mM glycine pH 2.8) was added to
the beads for 10 min to elute the antibody and the buffer was neutralised by adding
15µl 1M TRIS pH 7.5. The eluted protein was mixed with LDS sample buffer (Biorad,
4:1) and reduced by DTT (final concentration 100mM). The mixture was heated for 10
min at 95°C and loaded onto a 4-15% SDS-PAGE gel (Biorad). The gel was run according
to the manufacturer's instructions (180V, 30-40 min). The SDS-PAGE gel was stained
using InstantBlue Coomasie-based protein stain (Expedeon). In-gel tryptic digestion
was performed after reduction with DTE and S-carbamidomethylation with iodoacetamide.
Gel pieces were washed twice with 50% (v:v) aqueous acetonitrile containing 25 mM
ammonium bicarbonate, then once with acetonitrile and dried in a vacuum concentrator
for 20 min. Sequencing-grade, modified porcine trypsin (Promega) was dissolved in
50 mM acetic acid, then diluted 5-fold with 25 mM ammonium bicarbonate to give a final
trypsin concentration of 0.02 µg/µL. Gel pieces were rehydrated by adding 25 µL of
trypsin solution, and after 10 min enough 25 mM ammonium bicarbonate solution was
added to cover the gel pieces. Digests were incubated overnight at 37°C. Peptides
were extracted by washing three times with 50% (v:v) aqueous acetonitrile containing
0.1% trifluoroacetic acid (v:v), before drying in a vacuum concentrator and reconstituting
in aqueous 0.1% trifluoroacetic acid (v:v). Peptides were loaded onto an UltiMate
3000 RSLCnano HPLC system (Thermo) equipped with a PepMap 100 Å C
18, 5 µm trap column (300 µm × 5 mm, Thermo) and an Acclaim PepMap RSLC or EasyNano
column, 2 µm, 100 Å, (C
18, 75 µm × 150 mm, Thermo). The trap wash solvent was aqueous 0.05% (v:v) trifluoroacetic
acid and the trapping flow rate was 15 µl/min. The trap was washed for 3 min before
switching flow to the capillary column. The separation used a gradient elution of
two solvents (solvent A: aqueous 1% (v:v) formic acid; solvent B: aqueous 80% (v:v)
acetonitrile containing 1% (v:v) formic acid). The flow rate for the capillary column
was 300 nl/min. Column temperature was 40°C and the gradient profile was: linear 3-10%
B over 7 mins, linear 10-35% B over 30 mins, linear 35-99% B over 5 mins then proceeded
to wash with 99% solvent B for 4 min. The column was returned to initial conditions
and re-equilibrated for 15 min before subsequent injections.
[0088] The nanoLC system was interfaced with an Orbitrap Fusion hybrid mass spectrometer
(Thermo) with a Nanospray Flex or EasyNano ionisation source (Thermo). Positive ESI-MS
and MS
2 spectra were acquired using Xcalibur software (version 4.0, Thermo). Instrument source
settings were: ion spray voltage, 1,900-2,400 V; sweep gas, 2 Arb; ion transfer tube
temperature; 275°C. MS
1 spectra were acquired in the Orbitrap with common acquisition parameters among all
acquisitions, specifically: 120,000 resolution; scan range, m/z 375-1,500; AGC target,
4e
5; max fill time, 100 ms and data type, profile. MS
2 spectra were acquired in top speed mode maintaining a fixed cycle time of 1 s; quadrupole
isolation window, m/z 1.6; activation type, HCD; collision energy, 32%; first mass,
m/
z 110 and data type, centroid. To maximise peptide identifications, multiple MS
2 acquisition regimes were performed using both the linear ion trap and Orbitrap mass
analysers. Linear ion trap MS
2 acquisitions specified scan rate, rapid; AGC target, 5e
3 and max injection time, 100 ms. Orbitrap MS
2 acquisitions used resolution, 30,000; AGC target, 5e
4 and max injection time, 54 ms. Data dependent precursor selection was selected either
the most or least (separate acquisitions) intense precursor above a threshold of 5e
3. Dynamic exclusion was applied for 50 s post precursor selection and a minimum threshold
for fragmentation was set at 5e
3. Latterly, a targeted approach was taken for MS
2 acquisitions using a fixed inclusion list containing the theoretical 2+ and 3+
m/
z values for peptides previously identified as containing Asn to Lys modification.
[0089] Peak lists were generated in MGF format using MSConvert (proteowizard, version 3.0.9967).
MGF files were searched against the expected protein sequences, appended to an in-house
database, using a locally-running copy of the Mascot program (Matrix Science Ltd.,
version 2.5.1). Search criteria specified: Enzyme, semi-trypsin; Fixed modifications,
Carbamidomethyl (C); Variable modifications, Oxidation (M), Asn -> Lys (N); Peptide
tolerance, 3 ppm; MS/MS tolerance, 0.5 Da for linear ion trap or 10 mDa for Orbitrap;
Instrument, ESI-TRAP or ESI-ORBITRAP-HCD. Peptides classified as containing amino
acid substitutions were required to have expect scores <0.05 and were manually validated
to ensure the presence of sequence ions localising the position of substitution to
the suggested amino acid.
[0090] Extracted ion chromatogram peak areas were generated using Qual Browser (Xcalibur,
version 4.0, Thermo), setting a 2 mDa window around expected precursor m/z values.
XICs were Gaussian smoothed and peak picking parameters specified: baseline window,
100; area noise factor, 5; peak noise factor, 100. Percentage of amino acid substitution
was estimated by comparing the peptide XIC areas of the substituted form with the
sum of the substituted and expected forms.
[0091] Figure 8 shows the frequency of lysine misincorporation in matched clones with or
without pcDNA.YIN. Data are given for four sites where misincorporation of lysine
was detected consistently. In each case, the correct residue, asparagine, is encoded
by an AAT codon that depends on wobble in native CHO cells, but can be decoded without
wobble by tRNA-AsnATT in cells transfected with pcDNA.YIN.
Cloning a fission yeast tRNA-LeuCAG gene into pRS426
[0092] A 300bp fragment (sequence ID NO 9) of genomic DNA from chromosome I of the fission
yeast
Schizosaccharomyces pombe containing the tRNA49-LeuCAG gene (chr1:1527350-1527050) flanked by
BamHI and
Spel restriction enzyme sites at the upstream and downstream ends, respectively, was synthesised
by Life Technologies. The sequence was released by digestion with
BamHI and
SpeI at 37°C and gel purified. The DNA fragment was introduced into vector pRS426 (Figure
9) cut with
BamHI- and
Spel, to create plasmid pAU39, using T4 ligase (NEB) at room temperature for 2hrs, and
introduced into chemically-induced competent
E.coli (DH5α) by heat shock for 0.5 minutes at 42°C. Plasmid pAU39 was subsequently isolated from
the resulting ampicillin-resistant (100µg/ml) colonies and the presence of the insert
confirmed by restriction digest and subsequent sequencing.

Effect of fission yeast tRNA-LeuCAG on transgene expression in budding yeast
[0093] Saccharomyces cerevisiae strain COG8-TAP (genotype
his3Δ1 leu2Δ0 met15Δ0 ura3Δ0, COG8-TAP::HIS3, Mat a) was transformed using lithium acetate with pAU39 or empty
pRS426 vector. Transformants were grown in standard minimal media (SD, lacking amino
acids where appropriate for plasmid selection). 5 OD
600 unit equivalents of cells were harvested from liquid cultures in log phase and resuspended
in 120µ! lysis buffer prior to incubation at 95°C for 2 min and vortexing for 3min
in the presence of 100µg glass beads (425-600 µm, acid washed). Lysates were resolved
by 8% SDS PAGE and then analysed by western blotting with antibodies against COG8
and loading control Pgk1, as above (Figure 10).
[0094] Strain G175 (
ADE2 MET his3 leu2 ura3 trp1 TAG+ SE+, Mat α) was also transformed with pAU39 or empty pRS426, along with vector
pESC-TRP (Figure 11) with or without a transgene containing the coding sequence of
diketide-CoA synthase (DCS; AB495006.1), taken from turmeric (
Curcuma Ionga), attached to a Myc tag. This sequence contains 17 CTG codons that depend on wobble
for expression in native S. cerevisiae, but not after introduction of the exogenous
tRNA-LeuCAG gene on pAU39. Expression of DCS was measured by western blotting, as
above, with antibody against the Myc tag (Figure 12).
Example 1
[0095] CHO cells do not have genes for tRNA-lleGAT, tRNA-AsnATT or tRNA-TyrATA and therefore
rely on wobble to decode TAT, AAT and ATC codons. To allow wobble-independent decoding
of these codons, we made and introduced a construct, pcDNA.YIN, carrying human tRNA-IleGAT,
tRNA-AsnATT and tRNA-TyrATA genes. A DNA fragment containing the tRNA14-TyrATA gene
from human chromosome 2 was synthesized and cloned (Fig 1). The construct was stably
transfected into CHO cells and RT-PCR analysis confirmed expression of the transgene
(Fig. 2). The same approach was used to introduce a synthetic assembly (Fig 3), in
pcDNA.YIN, expressing human tRNA-TyrATA, tRNA-AsnATT and tRNA-lleGAT. Expression of
all three human tRNAs in recipient CHO cells was confirmed by RT-PCR (Fig. 4). The
effect of these tRNAs was tested on expression of Herceptin (trastuzumab) in CHO cells
stably transfected with pCET1006L+H expression vector (Fig. 5). These cells were transfected
with empty vector, pcDNA.YIN and/or pSUPER-7SL and secreted Herceptin (trastuzumab)
was harvested and quantified (Fig. 6). Transient transfection of pcDNA.YIN was found
to raise Herceptin expression by -20%. This enhancement was boosted to -49% by cotransfection
of pSUPER-7SL, a construct containing the human RN7SL1 gene, that encodes 7SL RNA.
In stable transfectants, genomic incorporation of pcDNA.YIN was found to raise by
-59% expression of Herceptin (trastuzumab), relative to the parental clone without
pcDNA.YIN (Figure 7)..Mass spectrometry was used to ascertain rates of lysine misincorporation
in the secreted antibody due to misreading of the wobble-dependent AAT codon for asparagine.
Such errors were detected at 4 positions, with frequencies up to -0.28%. These errors
were suppressed by 4- to 32-fold in matched cells carrying the pcDNA.YIN, where the
exogenous tRNAAsn-ATT allows direct decoding of the AAT codon without wobble (Figure
8). Overall, these experiments with a therapeutic antibody demonstrate increased production
and decreased misincorporation following introduction into CHO cells of exogenous
tRNAs that reduce dependence on wobble.
Example 2
[0096] S. cerevisiae relies on wobble to decode the CTG codon for leucine, as it has no
tRNA-LeuCAG. To remove the wobble-dependence of this codon, we created a strain of
S. cerevisiae that carries an exogenous tRNA-LeuCAG gene from Schizosaccharomyces
pombe. The effect of this tRNA was measured on expression of genes that are rich in
CTG codons. A DNA fragment containing the trna49-LeuCAG gene from chromosome 1 of
S. pombe was synthesized and cloned into pRS426 (Figure 9) to create plasmid pAU39.
Western blotting was used to determine the effect of pAU39 on expression in S. cerevisiae
of COG8 (Figure 10) and DCS (Figure 12). There are 10 CTG codons in COG8 and 17 in
DCS, but none in Pgk1, an endogenous protein that was used as control. For both COG8
and DCS, expression was enhanced by the tRNA-LeuCAG gene on pAU39 relative to the
empty vector control. We conclude that the efficacy of S. cerevisiae as a platform
for expressing transgenes can be improved by introduction of exogenous tRNA to reduce
dependence on wobble.
1. Isolierte eukaryontische Zelle, wobei die isolierte eukaryontische Zelle keine menschliche
Keimzelle ist, dadurch gekennzeichnet, dass die Zelle durch Transfektion oder Transformation mit einem Nukleinsäuremolekül modifiziert
ist, das eine Transkriptionskassette umfasst, wobei die Transkriptionskassette mindestens
eine Nukleotidsequenz umfasst, die eine [tRNA] codiert,
wobei die tRNA eine Anticodon-Nukleotidsequenz beinhaltet, ausgewählt aus der Gruppe
bestehend aus AGC, GGC, CGC, UGC, ACC, GCC, CCC, UCC, AGG, GGG, CGG, UGG, AGU, GGU,
CGU, UGU, AAC, GAC, CAC, UAC, AAA, GAA, AUU, GUU, CUU, UUU, AUC, GUC, CUC, UUC, AGA,
GGA, CGA, UGA, ACU, GCU, ACG, GCG, CCG, UCG, CCU, UCU, AAG, GAG, CAG, UAG, CAA, UAA,
AAU, GAU, UAU, CAU, AUA, GUA, ACA, GCA, AUG, GUG, CUG, UUG, CCA, und das in der eukaryontischen
Zelle fehlt, wobei die Anticodonsequenz Basenfehlpaarungen an einer beliebigen Position
des verwandten ersten, zweiten oder dritten Nukleotids in dem entsprechenden Messenger-RNA-[mRNA-]Codon
korrigiert, um die Translationseffizienz zu verbessern und/oder die fehlerhafte Integrierung
von Aminosäuren als Folge einer Degeneration des genetischen Codes zu verringern,
und wobei die Basenfehlpaarungskorrektur die Abhängigkeit der Zellen von Wobble während
der Translation der mRNA reduziert.
2. Isolierte eukaryontische Zelle nach Anspruch 1, wobei das Nukleinsäuremolekül Teil
eines Expressionsvektors ist, der für die eukaryontische Expression der tRNA angepasst
ist.
3. Isolierte eukaryontische Zelle nach einem der Ansprüche 1 bis 2, wobei die Zelle durch
Transformation oder Transfektion mit einem Nukleinsäuremolekül, das ein rekombinantes
Protein, Polypeptid oder Peptid codiert, weiter modifiziert ist.
4. Isolierte eukaryontische Zelle nach Anspruch 3, wobei die modifizierte Zelle mit einem
Nukleinsäuremolekül, das einen therapeutischen Antikörper, ein pharmazeutisches oder
therapeutisches Protein oder Peptid oder ein industrielles Enzym codiert, transformiert
oder transfiziert ist.
5. Isolierte eukaryontische Zelle nach Anspruch 3, wobei die modifizierte Zelle mit einem
Nukleinsäuremolekül, das einen therapeutischen Antikörper codiert, transformiert oder
transfiziert ist.
6. Isolierte eukaryontische Zelle nach Anspruch 5, wobei der therapeutische Antikörper
ein chimärer oder humanisierter therapeutischer Antikörper ist.
7. Isolierte eukaryontische Zelle nach einem der Ansprüche 1 bis 6, wobei die isolierte
eukaryontische Zelle eine Insekten-, Pflanzen-, Pilz- oder Säugetierzelle ist.
8. Isolierte eukaryontische Zelle nach Anspruch 7, wobei die isolierte eukaryontische
Zelle eine Säugetierzelle ist.
9. Isolierte eukaryontische Zelle nach Anspruch 8, wobei die Säugetierzelle eine Eierstockzelle
des chinesischen Hamsters, HEK293, NS0- oder CAP-Zelle ist.
10. Isolierte eukaryontische Zelle nach einem der Ansprüche 1 bis 9, wobei die Nukleinsäure
eine Transfer-RNA codiert, ausgewählt aus der Gruppe bestehend aus Ala-tRNA, Arg-tRNA,
Asp-tRNA, Asn-tRNA, Cys-tRNA, Glu-tRNA, Gln-tRNA, Gly-tRNA, His-tRNA, Ile-tRNA, Leu-tRNA,
Lys-tRNA, Met-tRNA, Phe-tRNA, Pro-tRNA, Ser-tRNA, Thr-tRNA, Trp-tRNA, Tyr-tRNA und
Val-tRNA.
11. Isolierte eukaryontische Zelle nach einem der Ansprüche 1 bis 10, wobei die modifizierte
Zelle durch Transformation oder Transfektion mit einem Nukleinsäuremolekül, das eine
7SL-Nukleotidsequenz umfasst, weiter modifiziert ist.
12. Verfahren zum Reduzieren von tRNA-Fehlpaarung als Folge der Degeneration im genetischen
Code, umfassend die folgenden Schritte:
i) Bereitstellen einer modifizierten Zelle nach einem der Ansprüche 1 bis 11;
ii) Inkubieren der Zelle aus i) unter Zellkulturbedingungen, die für die Expression
eines oder mehrerer rekombinanter Proteine/Peptide geeignet sind, die von der modifizierten
Zelle exprimiert werden; und optional
iii) Isolieren der exprimierten rekombinanten Proteine/Peptide aus der modifizierten
Zelle oder dem Zellkulturmedium.
13. Verfahren zum individuellen Anpassen der Expression eines ausgewählten rekombinanten
Proteins in einem Zellexpressionssystem, umfassend die folgenden Schritte:
i) Analysieren der Nukleotidsequenz eines Nukleinsäuremoleküls, das ein zu exprimierendes
rekombinantes Protein codiert, um eine oder mehrere Codon/Anticodon-tRNA-Fehlpaarungen
zu identifizieren;
ii) Transfizieren oder Transformieren einer Zelle mit einer oder mehreren Transkriptionskassetten,
die ein oder mehrere tRNA-Gene umfassen, die mindestens eine Fehlpaarung der Basenpaarung
in mindestens einem Codon korrigieren, um eine modifizierte Zelle bereitzustellen;
iii) Transfizieren oder Transformieren der modifizierten Zelle mit dem zu exprimierenden
rekombinanten Protein; und optional
iv) Bereitstellen von Zellkulturbedingungen zum Exprimieren des rekombinanten Proteins.
14. Zellkulturgefäß, umfassend eine modifizierte Zelle nach einem der Ansprüche 1 bis
11.
1. Cellule eucaryote isolée, ladite cellule eucaryote isolée n'étant pas une cellule
germinale humaine, caractérisée en ce que ladite cellule est modifiée par transfection ou transformation avec une molécule
d'acide nucléique comprenant une cassette de transcription, la cassette de transcription
comprenant au moins une séquence nucléotidique codant un ARN de transfert [ARNt],
l'ARNt comprenant une séquence nucléotidique d'anticodon choisie dans le groupe constituée
par AGC, GGC, CGC, UGC, ACC, GCC, CCC, UCC, AGG, GGG, CGG, UGG, AGU, GGU, CGU, UGU,
AAC, GAC, CAC, UAC, AAA, GAA, AUU, GUU, CUU, UUU, AUC, GUC, CUC, UUC, AGA, GGA, CGA,
UGA, ACU, GCU, ACG, GCG, CCG, UCG, CCU, UCU, AAG, GAG, CAG, UAG, CAA, UAA, AAU, GAU,
UAU, CAU, AUA, GUA, ACA, GCA, AUG, GUG, CUG, UUG, CCA et qui est absente de ladite
cellule eucaryote, ladite séquence d'anticodon corrigeant les mésappariements de bases
au niveau de l'une quelconque parmi la première, la deuxième ou la troisième position
de nucléotide analogue dans le codon d'ARN messager [ARNm] correspondant pour améliorer
l'efficacité de traduction et/ou diminuer la mésincorporation d'acides aminés à la
suite de la dégénérescence du code génétique, et ladite correction de mésappariements
de bases réduisant ladite dépendance des cellules à l'égard de l'oscillation pendant
la traduction dudit ARNm.
2. Cellule eucaryote isolée selon la revendication 1, ladite molécule d'acide nucléique
faisant partie d'un vecteur d'expression adapté à l'expression eucaryote dudit ARNt.
3. Cellule eucaryote isolée selon l'une quelconque des revendications 1 à 2, ladite cellule
étant en outre modifiée par transformation ou transfection avec une molécule d'acide
nucléique codant une protéine recombinante ou un polypeptide ou peptide recombinant.
4. Cellule eucaryote isolée selon la revendication 3, ladite cellule modifiée étant transformée
ou transfectée avec une molécule d'acide nucléique codant un anticorps thérapeutique,
une protéine ou un peptide pharmaceutique ou thérapeutique, ou une enzyme industrielle.
5. Cellule eucaryote isolée selon la revendication 3, ladite cellule modifiée étant transformée
ou transfectée avec une molécule d'acide nucléique codant un anticorps thérapeutique.
6. Cellule eucaryote isolée selon la revendication 5, ledit anticorps thérapeutique étant
un anticorps thérapeutique chimérique ou humanisé.
7. Cellule eucaryote isolée selon l'une quelconque des revendications 1 à 6, ladite cellule
eucaryote isolée étant une cellule d'insecte, de plante, de champignon ou de mammifère.
8. Cellule eucaryote isolée selon la revendication 7, ladite cellule eucaryote isolée
étant une cellule de mammifère.
9. Cellule eucaryote isolée selon la revendication 8, ladite cellule de mammifère étant
une cellule d'ovaire de hamster chinois, des cellules HEK293, NS0 ou CAP.
10. Cellule eucaryote isolée selon l'une quelconque des revendications 1 à 9, ledit acide
nucléique codant un ARN de transfert choisi dans le groupe de Ala-ARNt, Arg-ARNt,
Asp-ARNt, Asn-ARNt, Cys-ARNt, Glu-ARNt, Gln-ARNt, Gly-ARNt, His-ARNt, Ile-ARNt, Leu-ARNt,
Lys-ARNt, Met-ARNt, Phe-ARNt, Pro-ARNt, Ser-ARNt, Thr-ARNt, Trp-ARNt, Tyr-ARNt et
Val-ARNt.
11. Cellule eucaryote isolée selon l'une quelconque des revendications 1 à 10, ladite
cellule modifiée étant en outre modifiée par transformation ou transfection avec une
molécule d'acide nucléique comprenant une séquence de nucléotide 7SL.
12. Méthode permettant de réduire un mésappariement d'ARNt à la suite de la dégénérescence
du code génétique comprenant les étapes de :
i) fourniture d'une cellule modifiée selon l'une quelconque des revendications 1 à
11 ;
ii) incubation de la cellule en i) dans des conditions de culture cellulaire appropriées
à l'expression d'une ou plusieurs protéines/d'un ou plusieurs peptides exprimés par
ladite cellule modifiée ; et éventuellement
iii) isolement des protéines recombinantes/peptides recombinants exprimés de la cellule
modifiée ou du milieu de culture cellulaire.
13. Méthode permettant d'adapter l'expression d'une protéine recombinante choisie dans
un système d'expression cellulaire comprenant les étapes de :
i) analyse de la séquence nucléotidique d'une molécule d'acide nucléique codant une
protéine recombinante destinée à être exprimée pour identifier un ou plusieurs mésappariements
d'ARNt de codon/anticodon ;
ii) transfection ou transformation d'une cellule avec une ou plusieurs cassettes de
transcription comprenant un ou plusieurs gènes d'ARNt qui corrigent au moins un mésappariement
de paire de bases dans au moins un codon pour fournir une cellule modifiée ;
iii) transfection ou transformation de ladite cellule modifiée avec la protéine recombinante
destinée à être exprimée ; et éventuellement
iv) fourniture de conditions de culture cellulaire pour exprimer ladite protéine recombinante.
14. Cuve de culture cellulaire comprenant une cellule modifiée selon l'une quelconque
des revendications 1 à 11.