GOVERNMENT SUPPORT
[0001] This invention was made with government support under HG005550 awarded by the National
Institutes of Health. The government has certain rights in the invention.
TECHNICAL FIELD OF THE DISCLOSURE
[0002] The invention provided herein relates to a method for detection, identification,
and/or quantification of analytes of a cell or tissue
in situ.
BACKGROUND
[0003] The need for multiplexing techniques in biology is often driven by the fact that
test samples are precious and those analyzing them either do not know in advance precisely
what to look for or must extract the most information from any single sample. Hence,
it is desirable for clinicians and researcher to subject each sample to a large set
of probes.
[0004] Optical readout is common in biology and can be very effective. However, it is typically
limited to a relatively small number of available fluorophores or chromophores (which
are referred to collectively as colors). In practice, multiplexing by fluorescence
is often limited to 4 or 5 colors, which by traditional methods implies that at most
4 or 5 probes can be detected in a single sample.
[0005] The common approach to improving multiplexing in optical methods is to increase the
number of available colors. To this end, quantum dots have been developed to provide
a larger range of colors. However, in reality, it is difficult to use more than 6
quantum dot colors simultaneously. Another approach is to use mixtures or ratio of
fluorophores as new colors. Such methods have extended multiplexing to hundreds of
analytes, but due to the size of the labels (e.g., microbeads), the technology has
thus far been limited to flow-cytometry based analyses. Yet another approach involves
nanostrings, which are essentially short strings of strung-up fluorophores creating
visible colorful barcodes. Unfortunately, nanostring readout requires very high-resolution
imaging and a special flow apparatus. Further, the nanostrings can only be used in
a sample where the probes' targets are sparse, or the barcodes will overlap and create
a blur.
[0006] US 2011/245111 A1 relates to an assay system comprising an assay capable of high levels of multiplexing
where reagents are provided to a biological sample in defined spatial patterns; instrumentation
capable of controlled delivery of reagents according to the spatial patterns; and
a decoding scheme providing a readout that is digital in nature.
US 2003/148335 A1 discloses methods and compositions for assaying a plurality of different non-nucleic
acid targets or for assaying activities of a plurality of enzymes using, inter alia,
oligonucleotide identification (ID) tags.
[0007] A simple workaround for the limited number of colors (e.g., 4 or 5 colors) in optical
readouts is to repeat the probing of the same sample with multiple small sets of different
probes. For example, the assay can involve probing the sample with 4 different antibodies
at a time and imaging after every assay. If the test requires probing the sample with
a total of 64 antibodies, the 4-probe procedure would have to be repeated 16 times
using the sample. As such, the order of detecting different target analytes in a single
sample may need to be prioritized, because some target analytes in the sample can
degrade during successive probings. Accordingly, there is still a strong need for
accurate and sensitive methods with a high throughput for detection, identification,
and/or quantification of target molecules in a sample, e.g., complex mixtures.
SUMMARY
[0008] The present invention is defined in the appended claims. Embodiments provided herein
are based on, at least in part, the development of a multiplexed biological assay
and readout, in which a multitude of detection reagents comprising one or more probes
and/or probe types are applied to a sample, allowing the detection reagents to bind
target molecules or analytes, which can then be identified. Accordingly, provided
herein are methods for detecting multiple analytes of a cell or tissue
in situ.
[0009] Accordingly, one aspect provided herein relates to a method for identifying a plurality
of analytes of a cell or tissue
in situ.
[0010] The method described herein but not defining the claimed invention, comprises: (a)
contacting the cell or tissue with a composition comprising a plurality of detection
reagents as described herein, wherein a detection reagent of said plurality of detection
reagents comprises (i) at least one probe targeting an analyte of said plurality of
analytes and (ii) at least one nucleic acid label comprising a plurality of predetermined
subsequences, wherein said at least one probe and said at least one nucleic acid label
are conjugated together; (b) removing any unbound detection reagents from said cell
or tissue; (c) while said detection reagent is bound to said analyte of said cell
or tissue, sequencing said plurality of predetermined subsequences
in situ; (d) using said plurality of predetermined subsequences identified in (c) to identify
said analyte.
[0011] In some embodiments, the cell or tissue can be a fixed cell or tissue.
[0012] In some embodiments, the detection reagent can be from a plurality of detection reagents
having probes that target different analytes.
[0013] In some embodiments, the method can further comprise processing the cell or tissue
before contacting with the composition comprising a plurality of detection reagents
described herein.
[0014] In some embodiments, the processing may comprise mechanical processing of said cell
or tissue, addition of at least one reagent to said cell or tissue, separation of
said cell or tissue, mounting said cell or tissue on a solid support, fixing said
cell or tissue, or any combination thereof.
[0015] In some embodiments, the cell may be a hematopoietic cell, a neural cell, a mesenchymal
cell, a cutaneous cell, a mucosal cell, a stromal cell, a muscle spleen cell, a reticuloendothelial
cell, an epithelial cell, an endothelial cell, a hepatic cell, a kidney cell, a gastrointestinal
cell, a pulmonary cell, or a T cell.
[0016] In some embodiments, the at least one probe and the nucleic acid label can be conjugated
together by at least one linker. The at least one linker can be a bond, a linker molecule,
a multivalent linker, or a particle
[0017] The at least one probe can include a nucleic acid, an antibody or a portion thereof,
an antibody-like molecule, an enzyme, a cell, a virus, an antigen, a small molecule,
a protein, a peptide, a peptidomimetic, a sugar, a lipid, a glycan, a glycoprotein,
an aptamer, and any combinations thereof.
[0018] In some embodiments, the nucleic acid label can be single-stranded, double-stranded,
partially double-stranded, a hairpin, linear, circular, branched, a concatemer (e.g.,
a concatemer with a 3D structure such as a rolony, i.e., rolling-circle colony, or
a DNA nanoball), or any combinations thereof.
[0019] The pre-determined subsequences with the nucleic acid label can be conjugated together
by at least one sequence linker. In some embodiments, the sequence linker can be a
direct bond, e.g., a phosphoester bond, which can allow conjugation of the pre-determined
subsequences to form a longer, contiguous sequence. In some embodiments, the sequence
linker can be a nucleotidic linker. The nucleotidic linker, in some embodiments, can
be single-stranded, double-stranded, partially double-stranded, a hairpin, or any
combinations thereof, optionally wherein said nucleotidic linker comprises a plurality
of nucleotides.
[0020] Depending on various applications and/or assay conditions (e.g., sensitivity, sample
volume/concentration), the detection reagent can comprise one probe and a plurality
of nucleic acid labels. Without wishing to be limiting, in other embodiments, the
detection reagent can comprise a plurality of probes and a nucleic acid label. In
some embodiments, the detection reagent can comprise a plurality of probes and a plurality
of nucleic acid labels.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021]
Fig. 1 shows three different embodiments of the detection reagents described herein producing
distinct sequencing readout. Pathogen-specific antibodies (e.g., anti-E-Coli, anti-S.
aureus, and anti-C. albicans) are individually conjugated to a nanoparticle with at least one nucleic acid label
as described herein. In accordance with one or more embodiments, the readout of the
nucleic acid label can take the form of a set of optical images or spot-readings of,
e.g., fluorescent or visible colors; the temporal sequence of optical images or spot-readings
can then be computationally analyzed to determine the identity of the corresponding
probe reagent, e.g., a pathogen-specific antibody.
Fig. 2 shows three different embodiments of the detection reagents described herein producing
distinct sequencing readout. DNA oligonucleotides complementary to target RNA expression
(e.g., OCT4, SOX2, or KLF4) are individually conjugated to a nanoparticle with at
least one nucleic acid label as described herein. In accordance with one or more embodiments,
the readout of the nucleic acid label can take the form of a set of optical images
or spot-readings of, e.g., fluorescent or visible colors; the temporal sequence of
optical images or spot-readings can then be computationally analyzed to determine
the identity of the corresponding probe reagent, e.g., a DNA aptamer specific for
a RNA expression.
Fig. 3 shows exemplary forms of a nucleic acid label of the detection reagent according
to one or more embodiments described herein.
Figs. 4A and 4B shows two exemplary configurations of probe reagents and nucleic acid labels on particles,
in accordance with one or more embodiments described herein.
Fig. 5 shows one embodiment of the detection reagents for an exemplary hybridization-based
readout method, in accordance with one or more embodiments described herein. Pathogen-specific
antibodies (e.g., anti-C. albicans) are individually conjugated to a nanoparticle comprising at least one nucleic acid
label as described herein. In accordance with one or more embodiments, the readout
of the nucleic acid label can be determined by hybridizing it with a small number
of, e.g., fluorescently-labeled decoder probes, imaging, and then advancing to the
next set of decoder probes. In order to allow the SeqTag to be read out quickly and
without the use of enzymes or chemical reactions, the DNA oligonucleotide (SeqTag)
is designed to include several hybridization sites, each corresponding to a particular
readout step. At each readout step, the sample is subjected to a mixture of fluorescently
labeled DNA probes that could potentially bind that step's hybridization site. Each
of the sites, however, is designed to bind only one of these probes, thus revealing
the SeqTag's identifying code.
Figs. 6A-6B show the readout images of DYNABEADS® beads (1 µm in size) localized on a sample using an exemplary hybridization-based
detection method. Each bead was conjugated to one of 6 nucleic acid labels, which
in turn hybridized with a different set of decoder probes conjugated to either a green,
red or blank optical label during each readout stage (Fig. 6A: Readout stage 1; Fig. 6B: Readout stage 2).
Fig. 7 is a set of images showing that each of the detection molecule constructs (SeqTag
labels) properly stained the yeast and fluorescenced in accordance with three predetermined
sets of decoder probes. SeqTag labels and oligonucleotide displacers were applied
as follow:
Step 1: Set 1 Probes only;
Step 2: Set 1 Displacement oligonucleotides and Set 2 Probes;
Step 3: Set 2 Displacement oligonucleotides and Set 3 Probes; and
Step 4: Set 3 Displacement oligonucleotides.
SeqTag Label and corresponding colors were as follow:
Set 1: SeqTag 1 - Green, SeqTag 2 - Red, and SeqTag 3 - Blue;
Set 2: SeqTag 4 - Green, SeqTag 5 - Red, and SeqTag 6 - Blue;
Set 3: SeqTag 7 - Green and SeqTag 8 - Red.
Fig. 8 shows SeqTag readout by a displacement-hybridization experiment according to an embodiment
of the method described herein. SeqTag DNA labels were incubated on a streptavidin-coated
microarray. This microarray was then exposed to a sequence of fluorescently labeled
detection probes and displacement oligonucleotidess, as per displacement-hybridization
readout. Imaging the array after each readout step demonstrated fluorescence corresponding
to the expected pattern (shown next to each image).
Fig. 9 is a schematic representation of displacement hybridization according to an embodiment
of the method. As the readout progresses, fluorescence from prior readout steps needst
be removed so as not to obstruct the current step's signal. As illustrated in Fig.
9, this can be accomplished using a displacement-hybridization method: each of the
SeqTag's hybridization sites can be preceded by a short "toehold" sequence. During
each readout step, the sample is subjected to a mixture of "displacer" DNA oligonucleotides.
One of these displacers is complementary to the preceding step's hybridization site
and, with the help of the toehold, is capable of displacing the fluorescent probe
that was bound there.
Fig. 10 is a schematic representation of a probe reagent according to an embodiment described
herein. Shown is an oligonucleotide-antibody-streptavidin construct. A convenient
and effective way to SeqTag-label antibodies is through a streptavidin bridge. The
antibody is biotinylated and the probe DNA oligonucleotides (SeqTag) are synthesized
with a 5'-biotin modification. Then, by taking advantage of streptavidin' s native
tetrameric form, three DNA strands are bound to each antibody. As opposed to chemical
conjugation methods, which can harm the antibody, this method proves gentle enough
to preserve antibody function. As shown a single streptavidin molecule (2) is bound
to three of the same DNA SeqTags (1) and a single antibody (3).
Fig. 11 is a schematic representation of detection of an analyte by the SeqTag labeled antibody
shown in Fig. 10.
Fig. 12 is a schematic representation of detection reagents for different analytes. As shown,
different infectious agent (analytes) can each be assigned their own SeqTag code to
enable multiplexed detection according to an embodiment described herein.
Fig. 13 is a schematic representation of detection reagents for SeqTagged Fluorescence in situ hybridization (FISH). FISH permits microbes to be identified based on their ribosomal
RNA sequence. In the case of SeqTagged FISH, the FISH probe and its SeqTag can be
synthesized as a single DNA oligonucleotides as shown. Sequences shown are, from top
to bottom, SEQ ID NO: 1 (5'-CCTACACACCAGCGTGCC-3', probe for K. pneumonia); SEQ ID NO: 2 (5'-CCGCACTTTCATCTTCCG-3', probe for H. influenza); and SEQ ID NO: 3 (GCCAAGGCTTATACTCGC, probe for C. albicans).
DETAILED DESCRIPTION OF THE INVENTION
[0022] Described herein are methods, detection reagents (or detection molecules as used
interchangeably herein) and kits (wherein the kits are not part of the invention)
for detecting a plurality of analytes in a sample. In accordance with embodiments
described herein, a probe reagent (e.g., antibody or aptamers) can be directly or
indirectly labeled with a nucleic acid label. The nucleic acid information present
on the nucleic acid label can then be decoded and/or detected in a temporally-sequential
manner. The detection reagents and methods described herein significantly increase
the number of different probes (and corresponding analytes) that can be simultaneously
detected in a multiplex assay, as compared to an traditional assay where each probe
is labeled with only fluorescent labels or quantum dots, and thus multiplexing is
limited by the number of available and practically usable colors. Furthermore, because
the detection reagents described herein are detected and/or imaged in a temporal series
of steps, the number of probes (and corresponding analytes) that can be detected in
a multiplex assay grows multiplicatively with the number of detection steps in a time
series and the number of optical labels being used. By way of example only, 3 set
of images in which 4 distinct optical labels are used can encode 4 × 4 × 4 = 64 distinct
probe reagents (e.g., antibodies).
Methods of detecting a plurality of analytes in a sample
[0023] Described herein are methods for detecting a plurality of analytes in a sample, using
the detection reagents described herein. The method includes (a) contacting the sample
with a composition comprising a plurality of detection reagents (which will be described
in detail later), wherein each subpopulation of the detection reagents targets at
least one different analyte; and (b) detecting in a temporally-sequential manner said
plurality of the pre-determined subsequences of said detection reagents, wherein said
detection of the subsequences each generates a signal signature corresponding to said
subsequence, and wherein a temporal order of the signal signatures corresponding to
said plurality of the subsequences of said detection reagent identifies a subpopulation
of the detection reagents. In some embodiments, the signal signature is a temporal
signature. In some embodiments, the signal signature can further comprise a spatial
signature. A non-limiting example of a spatial signature includes spatial location
of a signal signature.
[0024] In some embodiments, the temporal order of the signal signatures corresponding to
the plurality of the subsequences of the detection reagent can be unique for each
subpopulation of the detection reagents. In some embodiments, at least two or more
signal signatures can be used to identify the same subpopulation of the detection
reagents.
[0025] In some embodiments, a detection reagent described herein can target at least two
(e.g., at least two, at least three or more) distinct analytes. In some embodiments,
a first subpopulation of the detection reagents can target at least one analyte different
from that of a second subpopulation of the detection reagents. By way of example only,
a first subpopulation of the detection reagents can target at least analyte A and
analyte B, whereas a second subpopulation of the detection reagents can target at
least analyate B and analyte C. The readout of these detection reagents can be distinct
but overlapping. Thus, different analytes can be identified by sampling them combinatorially
and determining which one binds.
[0026] As used herein, the term "temporal order of the signal signatures" refers to a sequence
of signal signatures determined in a temporally-sequential manner, i.e., the sequence
of signal signatures is progressed through by a number of active operations performed
in a temporally-sequential manner, e.g., using a different set of decoding reagents
or decoder probes in each active operation. In some embodiments, using a set of decoder
probes in each active operation can yield one signal signature corresponding to one
subsequence of the detection reagents.
[0027] The composition comprising a plurality of detection reagents can exist in any format.
In some embodiments, the composition comprising a plurality of detection reagents
can be in a form of a solution or suspension comprising the detection reagents. In
such embodiments, the composition can further comprise at least one agent. For example,
without wishing to be bound, the agent can be a blocking buffer, a surfactant, unconjugated
probe reagents, a stabilizer, an enzyme inhibitor, or any combinations thereof. In
some embodiments where the compositions are administered
in vivo, the composition can further comprise a pharmaceutically-acceptable carrier. In other
embodiments, the composition comprising a plurality of detection reagents can be contained
or immobilized in a device (e.g., a syringe, or a microfluidic device) or an assay
or reaction vessel (e.g., solid supports such as vials, and multi-well plates).
[0028] As used therein, the term "contacting" refers to any suitable means for delivering,
or exposing, a sample to a plurality of the detection reagents described herein. In
some embodiments, the term "contacting" refers to adding the detection reagents (e.g.,
suspended in a solution) directly to the sample. In some embodiments, the term "contacting"
can further comprise mixing the sample with the detection reagents by any means known
in the art (e.g., vortexing, pipetting, and/or agitating). In some embodiments, the
term "contacting" can further comprise incubating the sample together with the detection
reagents for a sufficient amount of time, e.g., to allow binding of the probe reagents
to the target analytes. The contact time can be of any length, depending on the binding
affinities and/or concentrations of the probe reagents and/or the analytes, concentrations
of the detection reagents, and/or incubation condition (e.g., temperature). For example,
the contact time can be reduced if the sample and detection reagents are incubated
at a higher temperature. In some embodiments, the contact time between the sample
and the detection reagents can be at least about 30 seconds, at least about 1 minute,
at least about 5 minutes, at least about 10 minutes, at least about 15 minutes, at
least about 30 minutes, at least about 1 hour, at least about 2 hours, at least about
3 hours, at least about 4 hours, at least about 6 hours, at least about 8 hours, at
least about 10 hours, at least about 12 hours, at least about 24 hours, at least about
48 hours or longer. One of skill in the art can adjust the contact time accordingly.
[0029] For in vivo applications, the term "contacting" can refer to administering the detection
reagents to a subject, e.g., by oral administration or by injection.
[0030] The sample can be contacted with at least one kind of the detection reagents. In
some embodiments, the sample can be contacted with at least 2, at least 3, at least
4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least
15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70,
at least 80, at least 90, at least 100 or more different kinds of the detection reagents.
In some embodiments, the sample can be contacted with at least 100, at least 500,
at least 1000, at least 5000, at least 10,000, at least 50,000, at least 100,000 or
more different kinds of the detection reagents. Various kinds of the detection reagents
described herein can differ in types of probe reagents (e.g., nucleic acids vs. antibodies),
target binding domains, and/or target analytes.
[0031] In some embodiments, the method described herein can further comprise processing
the sample before contacting with the composition comprising a plurality of detection
reagents described herein. Depending on the types and/or natures of the samples and/or
analytes, different sample processing techniques can be used with the methods described
herein. Exemplary sample processing techniques include, but are not limited to, mechanical
processing of a sample (e.g., without limitations, homogenizing, centrifuging, vortexing,
sectioning and shearing), addition of at least one reagent to a sample (e.g., without
limitations, lysis buffers, RNA or DNA extraction reagents, RNA or DNA digestion reagents,
enzyme inhibitors, fixing agents, organic solvents, antibodies, permeabilizing agents
and immunohistochemistry agents), separation of a sample (e.g., without limitations,
filtering, centrifuging, electrophoresis, western blot, and Northern blot), mounting
a sample on a solid support (e.g., a microscopic slide), and any combinations thereof.
[0032] By way of example only, if a sample is a tissue from a subject (e.g., a biopsy for
immunostaining), sample processing can include, but are not limited to, tissue sectioning,
mounting on a solid support, fixing the tissue, permeabilizing the tissue (if intracellular
proteins are to be detected), blocking non-specific reactions with the detection reagents.
In some embodiments, proteins or nucleic acids can be isolated from a tissue or fluid
sample and then separated electrophoretically on a separation medium (e.g., electrophoresis
gel), followed by transferring the proteins or nucleic acids to a blotting membrane.
The blotting membranes containing proteins or nucleic acids can then be contacted
with the detection reagents described herein. Methods of processing samples before
addition of various types of probe reagents for different kinds of assays are well
established in the art, and any of those methods can be performed prior to the contacting
step of the methods described herein.
[0033] In some embodiments, the method described herein can further comprise removing any
unbound detection reagents before detection of the pre-determined subsequences in
a temporally-sequential manner. The term "unbound detection reagents" as used herein
refers to detection reagents that have not bound to or interacted with target analytes.
The unbound detection reagents can be removed from the sample by any methods known
in the art, e.g., rinsing with the sample with a buffered solution at least once,
at least two times, at least three times or above.
[0034] After the detection reagents bind to the target analytes in a sample, the nucleic
acid labels of the detection reagents carrying nucleic-acid information can be decoded
to allow identification of respective probe reagent(s) conjugated to them, as opposed
to traditional optical labeling technologies, where an optical signature such as a
fluorophore is detected in the absence of providing any nucleic acid information.
In embodiments, the pre-determined subsequences within the nucleic acid labels are
detected in a temporally-sequential manner. The term "temporally-sequential manner"
is used in reference to detecting or decoding in a time series a plurality of the
pre-determined subsequences within the nucleic acid labels of any detection reagents
that are bound to target analytes in a sample. In some embodiments, one or more predetermined
subsequences within at least one nucleic acid label of each detection reagent can
be detected or decoded at each time point or detection step of a time series. In some
embodiments, one pre-determined subsequence within at least one nucleic acid label
of each detection reagent can be detected or decoded at each time point or detection
step of a time series. In some embodiments, at least one pre-determined subsequence
(e.g., 1, 2, 3, 4, 5, 6, or more predetermined subsequences) at the same corresponding
location within the nucleic acid label of each detection reagent can be detected or
decoded at each time point or detection step of a time series. The time period between
any two time points or detection steps can be of any length, e.g., seconds, minutes
and hours. For example, the time period between any two time points or detection steps
can vary from about 5 seconds to about 2 hours, from about 10 seconds to about 1 hour,
from about 30 seconds to about 30 mins, or from about 1 min to about 15 mins. In some
embodiments, the time period between any two time points or detection steps can be
less than 5 seconds. In other embodiments, the time period between any two time points
or detection steps can be longer than 2 hours, longer than 4 hours, longer than 6
hours, longer than 12 hours, longer than 1 day. For example, a sample containing the
detection reagents can be maintained at room temperature, at a fridge temperature
(e.g., between about 0 °C and about 10°C) or at sub-zero temperatures (e.g., between
-80°C or lower and 0°C) during the time period between detection steps. In some embodiments,
each subsequent detection step is performed substantially immediately one after another
(e.g., within less than 2 seconds, less than 1 second).
[0035] In some embodiments, the pre-determined subsequences can be detected in any temporal
orders. In some embodiments, the next pre-determined subsequence to be detected after
the previous one can be located closest to the previous one. In some embodiments,
the next predetermined subsequence to be detected after the previous one can be located
at least one, at least two, at least three, at least four, at least five or more pre-determined
subsequences apart from the previous one. In such embodiments, any pre-determined
subsequences that were bypassed in a previous detection step can be detected afterward.
In some embodiments of the methods described herein, a computer-implemented software
can be used to facilitate an analysis of the temporal readouts from the detection
steps, e.g., re-arranging the temporal readouts in an order corresponding to their
spatial locations within the nucleic acid label before further comparison and quantification
analyses.
[0036] In some embodiments, the detection or decoding of the pre-determined subsequences
can comprise nucleic acid sequencing. Methods for sequencing nucleic acids are well
established to a skilled artisan, e.g., but not limited to ligation, hybridization,
synthesis, amplification or single-base extension, or any combinations thereof. By
way of example only, as shown in
Fig. 1 or
Fig. 2, the nucleic acid labels each contain three pre-determined subsequences (each of one
nucleotide) conjugated together by a direct bond such as a phosphodiester bond. Each
sequencing step decodes or determines one nucleotide, wherein each nucleobase (A,
G, C or T) generates a distinct signal signature corresponding to the nucleobase.
Consequently, a temporal order or time series of the signal signatures generated from
each sequencing step corresponds to the respective probe reagent, and thus identify
the target analyte. Without wishing to be bound, in this embodiment, the number of
sequencing steps performed is not necessarily equal to the number of the pre-determined
sequences. In some embodiments, the number of sequencing steps performed can be less
than the number of the pre-determined sequences. For example, as shown in Fig. 1,
two sequencing steps could be sufficient to identify the three different probe reagents,
where each base is associated with a different color. However, additional nucleic
acid information can increase the accuracy of identifying different probe reagents.
Further, if the sequencing of each base can yield one of 4 colors, the n-base subsequences
(e.g., 3-base subsequences shown in
Fig. 1 or
Fig. 2) can produce 4
n possible unique readouts, i.e., 4
n possible distinct probe reagents can be distinguished using such detection reagents
described herein.
[0037] While sequencing methods can convey single base difference, other detection or decoding
methods that convey information by the presence or absence of entire hybridization
"sites" or pre-determined subsequences on the nucleic acid label can also be used
for the methods described herein. In some embodiments, the detection step can comprise
hybridizing a decoder probe with a subsequence on the nucleic acid label of the detection
reagent, wherein the decoder probe can comprise a detectable label. In particular
embodiments, the detection method can comprise: (a) hybridizing a set of decoder probes
with a subsequence of the detection reagents, wherein each subpopulation of the decoder
probes can comprise a detectable label, each detectable label producing a signal signature;
(b) detecting said signal signature produced by the hybridization of said set of decoder
probes; and (d) repeating steps (a) and (b) for other subsequences of said detection
reagents.
[0038] In some embodiments, each subpopulation of the decoder probes can comprise a different
detectable label, each different detectable label producing a different signal signature.
In these embodiments, the different signal signature produced by the hybridization
of the set of decoder probes can be detected.
[0039] In some embodiments, each subpopulation of the decoder probes can be complementary
(e.g., partially complementary or completely complementary) to the subsequence of
the detection reagents. In some embodiments, a first subpopulation and a second subpopulation
of the decoder probes can be complementary (e.g., partially complementary or completely
complementary) to distinct subsequences of the detection reagents. In some embodiments,
at least two or more subpopulations of the decoder probes can bind to the same subsequence
of the detection reagents. For example, a first subpopulation and a second subpopulation
of the decoder probes can be complementary (e.g., partially complementary or completely
complementary) to the same subsequence of the detection reagents.
[0040] By way of example only, Fig. 5 shows an exemplary detection reagent comprising anti-
C. albicans probe reagents and nucleic acid labels containing three hybridization sites or pre-determined
subsequences conjugated together by sequence linkers. In the first hybridization step,
a first set of decoder probes each comprising a distinct detectable label (e.g., complementary
DNA readout probes shown in
Fig. 5, each comprising a distinct optical label) is hybridized with a first pre-determined
subsequence (e.g., Site 1 in
Fig. 5), followed by detection of a first signal signature produced by the hybridization.
In the second hybridization step, a second set of decoder probes each comprising a
distinct detectable label is hybridized with a second pre-determined subsequence (e.g.,
Site 2 in
Fig. 5), followed by detection of a second signal signature produced by the hybridization.
The second pre-determined subsequence can be the same or different from the first
pre-determined subsequence. However, in preferred embodiments, the second pre-determined
subsequence is different from the first pre-determined subsequence, e.g., to minimize
cross-hybridization with each other. Accordingly, the hybridization and signal detection
steps are repeated for other subsequences of the detection reagents with a different
set of decoder probes, thereby producing a temporal order or time series of the signal
signatures corresponding to the respective probe reagent (and detection reagent).
[0041] As used herein, the term "decoder probe" refers an oligonucleotide with a sequence
complementary to a pre-determined sequence of the nucleic acid label. By "complementary"
is meant that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence
by either traditional Watson-Crick or other non- traditional types. The decoder probe
sequence can be completely or partially complementary to a pre-determined sequence.
In some embodiments, partial complementarity is indicated by the percentage of contiguous
residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick
base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9,10 out of 10
being 50%, 60%, 70%, 80%, 90%, and 100% complementary). "completely complementary"
or 100% complementarity means that all the contiguous residues of a nucleic acid sequence
will hydrogen bond with the same number of contiguous residues in a second nucleic
acid sequence. Less than perfect complementarity refers to the situation in which
some, but not all, nucleoside units of two strands can hydrogen bond with each other.
[0042] The decoder probe can have a sequence of any length. In some embodiments, the decoder
probe can have a sequence length of about 1 to about 100 nucleotides, about 1 to about
50 nucleotides, about 2 to about 50 nucleotides, about 5 to about 30 nucleotides,
or about 5 to about 20 nucleotides.
[0043] In some embodiments, the decoder probe can comprise at least one detectable label
described herein. In some embodiments, the detectable label can be an optical label
selected from the group consisting of a small-molecule dye, a fluorescent molecule
or protein, a quantum dot, a colorimetric reagent, a chromogenic molecule or protein,
a Raman label, and any combinations thereof. In some embodiments, the detectable label
or optical label can be a fluorescent molecule or protein.
[0044] In some embodiments, the decoder probe can be modified, e.g., base modification or
activated with a functional group for linkage to a detectable label.
[0045] The number of decoder probes in each set can vary, depending on the number of distinct
subsequences in each hybridization. In some embodiments, there can be about 1 to about
100 decoder probes, about 2 to about 50 decoder probes, about 4 to about 20 decoder
probes in each set. In some embodiments, there can be about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or more decoder probes in
each set. In some embodiments, while each subsequence site can hybridize with a large
number of decoder probes, each
set of decoder probes added in each readout step to hybridize with the subsequence site
within the detection reagents can generally have as many as the number of available
fluorescent colors. For example, each set of the decoder probes added in each readout
step to hybridize with the subsequence site of the detection reagents can contain
about 3-4 decoder probes, each of which is labeled with a distinct fluorescent color.
In the case of using quantum dots or Raman labels as detection labels, there can be
more than 3-4 decoder probes in each set added during each readout step.
[0046] Without wishing to be bound, an example of "non-overlapping nucleic acid labels"
or "non-overlapping SeqTag labels" (i.e., no two decoder probes will hybridize with
the same spatial site of the nucleic acid label) is shown herein for illustrative
purposes. Assuming there are 12 pre-determined subsequences (e.g., nucleic acid sequences)
designed for minimal cross-hybridization with each other and each others' complements
(e.g., A1, A2, A3, A4, B1, B2, B3, B4, C1, C2, C3, and C4). Consider a detection reagent
comprising a nucleic acid label of the form:
5' ------A[1-4]----B[1-4]----C[1-4]---- 3'
where each position (e.g., A[1-4]) holds only one of the subsequences (e.g., A2).
Now, this subsequence is decoded or detected by using decoder probes or complementary
probes A1
∗ - A4* each labeled in one of four fluorescent colors. After readout, the signal produced
by the fluorophore can be removed (e.g., denaturing to undo the hybridization (and
thus removing the fluorophore)) before continuing with B1
∗ - B4*. Since each step yields one of four outcomes, this coding scheme can provide
4 × 4 × 4 = 64 unique readouts. These hybridization-based probes can be used to label
64 different probe reagents that can be read out in three cycles.
[0047] In the case where two decoder probes can overlap, a single site (e.g., A in the above
nucleic acid label form), which can accept one of the different decoder probes, can
be used. This single site can be read out by subjecting it to the different decoder
probes, e.g., in sets of 4 using the nucleic acid label form as shown above. When
the correct set is reached, the nucleic acid label, e.g., SeqTag label, should be
dark (no-color). This example is not construed to be limiting.
[0048] The advantage of readout by hybridization is that it can be quick: hybridization
can take place in minutes or less. Furthermore, no chemistry or enzymes are required
during the readout process, as the readout process can be performed by similar methods
as used in nucleic acid sequencing, microscopy, spectroscopy, or any combinations
thereof. Thus, hybridization-based readout method can reduce cost, reduce reagent
storage and/or simplify the process.
[0049] In some embodiments of the methods described herein, there can be no limit in the
spatial movement of an analyte in a sample during a temporal detection of the detection
reagents, for example, provided that the analyte stay within the field of detection
and there is at least one same distinguishable feature in each image taken during
a temporal detection so that the images can be aligned to each other based on the
same distinguishable feature. In some embodiments where there is no such distinguishable
feature, the spatial movement of an analyte in a sample can be less than 100 µm, including
less than 50 µm, less than 25 µm, less than 10 µm, less than 1 µm or smaller, over
a time period, during which a temporal detection of the detection reagents occurs.
In some embodiments, the spatial movement of an analyte in a sample can be less than
1000 nm, including less than 500 nm, less than 250 nm, less than 100 nm, less than
50 nm, less than 10 nm or smaller, over a time period, during which a temporal detection
of the detection reagents occurs. More importantly, the spatial movement limit of
an analyte in a sample during a temporal detection is determined by the ability of
matching distinguishable features between images taken during a temporal detection,
which can be affected by imaging conditions. In some embodiments, the analyte can
be fixed on a solid substrate or support. In some embodiments where there is or expects
to be a spatial movement of an analyte during temporal detection, the location of
the analyte with respect to a sample during each detection step can be determined
and registered. Such spatial shift can then be corrected afterward during signal analysis
using any art-recognized computer-implemented algorithms.
[0050] The length of time required to perform a temporal detection of the detection reagents
(e.g., the length of time it takes to obtain a temporal sequence of signal signatures
for the detection reagents) can vary, depending on the number of pre-determined subsequences
to be detected or read and/or the number of available detection signals (e.g., fluorescent
color and/or brightfield) to be read. In some embodiments, the length of time required
to perform a temporal detection of the detection reagents can be, for example, but
not limited to, 5 seconds, 10 seconds, 15 seconds, 20 seconds, 30 seconds, 1 mins,
2 mins, 3 mins, 4 mins, 5 mins, 15 mins, 30 mins, 1 hour, 2 hours, 4 hours, 6 hours,
or longer.
[0051] The detection reagents can be detected by any means available in the art that is
capable of detecting the specific signals on a given detection reagent generated during
sequencing- or hybridization-based methods. Where the detection reagents (e.g., hybridized
with decoder probes) are fluorescently labeled, suitable consideration of appropriate
excitation sources can be readily determined. Possible sources can include but are
not limited to arc lamp, xenon lamp, lasers, light emitting diodes or some combination
thereof. The appropriate excitation source is used in conjunction with an appropriate
optical detection system, for example an inverted fluorescent microscope, an epi-fluorescent
microscope or a confocal microscope. Preferably, a microscope is used that can allow
for detection with enough spatial resolution to separate distinct signals from individual
detection reagents.
[0053] Additional methods that can be used to detect optical signatures include, but are
not limited to, any spectroscopic techniques, flow cytometry, or any art-recognized
methods involving an optical scanner and/or a photodetector (e.g., without limitations,
a charge-coupled devices, active pixel sensors, photodiode light sensors (e.g., LEDs),
optical detectors, and any combinations thereof). Non-limiting examples of spectroscopic
techniques can include absorption spectroscopy, emission spectroscopy, elastic scattering
spectroscopy, reflection spectroscopy, impedance spectroscopy, inelastic spectroscopy,
coherent or resonance spectroscopy, surface plasmon fluorescence spectroscopy, Raman
spectroscopy, and any combinations thereof. Spectroscopy techniques can be used to
detect light of any wavelengths, including, but not limited to, microwave, terahertz,
infrared, near infrared, visible, ultraviolet, x-ray, gamma, and any combinations
thereof.
[0054] Without wishing to be limited, in some embodiments, at least one pre-determined subsequence
(e.g., individual bases or hybridization regions) can correspond to no optical signature;
that is the absence of color can be considered as an additional color. In other embodiments,
at least one pre-determined subsequence (e.g., individual bases or hybridization regions)
can correspond to a compound optical signature, e.g., two or more simultaneous fluorescence
in multiple channels during detection (e.g., by microscopy).
[0055] While a single area of a sample can interact with more than one probe reagents, the
nucleic acid label can be designed such that any known or potential overlaps could
be teased apart from the signal output. In the case where any probe may potentially
overlap with all others, one can use the readout-by-hybridization variation and assign
each probe a single unique hybridization sequence. Such approach can avoid multiple
lengthy probe incubations and damaging stripping steps.
[0056] In some embodiments of the methods described herein, the signal signatures produced
during any readout step (e.g., sequencing-based or hybridization-based) should be
removed before advancing to the next pre-determined subsequence of the detection reagents.
The removal of the signal signatures can be done by any methods known in the art,
including, but not limited to, washing, heating, photo-bleaching, displacement, cleavage,
enzymatic digestion, quenching, chemical degradation, bleaching, oxidation, and any
combinations thereof.
[0057] In some embodiments, the decoder probes can be designed such that they can be simply
washed out either with a plain buffer, or they can be modified by varying salt concentrations
or using detergents or denaturants such as formamide or dimethyl sulfoxide (DMSO).
[0058] In other embodiments, the fluorescence or color signature of a readout step can be
attenuated or eliminated by photo-bleaching the signal using sufficient optical exposure.
In alternative embodiments, the fluorescence or color signature of a readout step
can be attenuated or eliminated by subjecting the fluorescence or color signature
to chemical degradation under appropriate conditions, e.g., using a reducing agent
or oxidizing solution such as 0.01 M sodium periodate.
[0059] In some embodiments, the decoder probes can be displaced from their hybridization
sites by introducing other reagents or probe displacers that have stronger binding
affinities to those same sites. This can be done, for example, by using nucleic acid
sequences that are longer than and/or have better complementarity than the decoder
probe sequences. For example, to create "better complementarity" of the probe displacers,
in some embodiments, mismatches can be seeded in the hybridization region. In other
embodiments, the hybridization region can be preceded and/or post-ceded with a "toe-hold"
of around 3-8 bases (e.g., 6 bases). In such embodiments, the "better complementarity"
of the probe displacer can be outside of the hybridization region, which can make
the design of the hybridization regions easier.
[0060] In some embodiments, enzymes can be used to displace, digest, cut and/or cleave the
detectable labels, the decoder probe sequence, the hybridized complex (formed by the
decoder probe and pre-determined subsequence), and/or the cleavable sequence linker
to the hybridized complex, in order to remove the signal signatures. One example is
to introduce a deoxyuridine into the decoder probe. This modified base can be cleaved
using the enzyme mix known as USER, thereby cutting the decoder probe sequence into
two parts. Since each part is now shorter, it is characterized by a lower melting
temperature and can melt off the hybridization sites of the detection reagents. Alternatively,
one of skill in the art can employ one of numerous art-recognized sequence-specific
nucleases or restriction enzymes, which can cut either the decoder probe sequence,
the pre-determined subsequence that has been hybridized with decoder probes, the cleavable
sequence linker attached to the hybridized subsequence and/or the hybridized complex
thereof, thereby removing the signal signature.
[0061] In some embodiments, thermal denaturing can be used to remove the signal signature
from a previous readout. In some embodiments where sequencing is involved, thermal
denaturing can be reduced or avoided by using a sequencing-by-ligation approach and
by setting the nucleic acid label base that immediately follows the sequencing primer
(in the direction of ligation) to an adenine. Correspondingly, the ligation probes
should then include a (deoxy-)uracil in the primer-proximal position. Without wishing
to be bound by theory, an enzyme such as USER, which cleaves DNA at uracils can be
used to remove the ligation probe and ready the system for the next sequencing step.
These fragments will have lower melting temperatures than their parent probes, and
these temperatures can be designed to fall below the operating temperature (or require
an acceptable denaturing temperature).
[0062] After detection of the pre-determined subsequences is completed in a temporally-sequential
manner, in some embodiments, the method described herein can further comprise comparing
the temporal order of the signal signatures with different identifiers of said at
least one probe reagent, wherein an agreement between the temporal order of the signal
signatures and a particular identifier of said at least one probe reagent identifies
the analyte in the sample. In some embodiments, the method can further comprise measuring
the intensity of the signal signatures generated from each subpopulation of the detection
reagents. In some embodiments, the intensity of the signal signatures generated from
each subpopulation of the detection reagents can indicate an amount of the analyte.
In some embodiments, the relative intensity of the signal signatures can be used in
identification of each subpopulation of the detection reagents. Thus, the intensity
of the signal signatures can be used as part of a coding scheme of the detection reagents
described herein. The comparing and intensity measuring steps can be performed, e.g.,
by a computer-implemented software or algorithm.
[0063] Types of signal signature(s) can vary upon different embodiments of detection reagents
and/or decoder probes described herein. As used herein, the term "signal signature"
refers to a change in, or occurrence of, a response or indicator that is detectable
either by observation or instrumentally. In certain instances, the signal signature
is fluorescence or a change in fluorescence, e.g., a change in fluorescence intensity,
fluorescence excitation or emission wavelength distribution, fluorescence lifetime,
and/or fluorescence polarization. By way of example only, the fluorescence can be
produced by binding a fluorophore to a decoder probe, and/or by detecting the hybridization
using a fluorescent dye, e.g., SYBR Gold, that lights up when nucleic acid sequence
becomes double-stranded. In certain other instances, the signal signature can be radioactivity
(i.e., radiation), including alpha particles, beta particles, nucleons, electrons,
positrons, neutrinos, and gamma rays emitted by a radioactive substance such as a
radionuclide. By way of example, the detection reagents and/or decoder probes can
comprise an optical molecule or label, thus producing optical signatures. Examples
of optical signatures can include, without limitations, signatures of fluorescent
color, visible light, no-color, and any combinations thereof. In such embodiments,
the optical signatures can be detected by optical imaging or spectroscopy.
Detection reagents (or detection molecules as used interchangeably herein)
[0064] Also described herein is a detection reagent, which can be, for example, used in
the methods described herein for any multiplexing assays. The detection reagent comprises
at least one probe reagent and at least one nucleic acid label, wherein said at least
one nucleic acid label comprises at least one pre-determined subsequence to be detected
in a temporally-sequential manner; wherein said at least one pre-determined subsequence
forms an identifier of said at least one probe reagent; and wherein said at least
one probe reagent and said at least one nucleic acid label are conjugated together.
[0065] The detection reagents described herein can exist in different forms. By way of example
only, in some embodiments, the detection reagent can be a detection molecule. In some
embodiments, the detection reagent can be a detection particle. In some embodiments,
the detection reagent can be multi-molecular.
[0066] As used herein, the term "conjugated" refers to two molecules being linked to each
other, e.g., attaching a probe reagent to a nucleic acid label. The conjugation process
can be performed, e.g., via a chemical reaction, or via a linker, which will be described
later.
[0067] Depending on various applications and/or assay conditions (e.g., sensitivity, sample
volume/concentration), a readout signal of a detection reagent can be amplified by
increasing the number of the nucleic acid labels present in the detection reagent,
e.g., by conjugating at least one probe reagent to a plurality of nucleic acid labels.
In such embodiments, a plurality of the nucleic acid labels present in the detection
reagent can range from about 2 to about 100,000, about 2 to about 10,000, about 2
to about 1,000, or about 2 to about 100. In some embodiments where the detection reagent
comprises a particle as a hub, the number of possible nucleic acid labels present
in the detection reagent can depend on the size of a particle. Generally, the larger
the particle it is, the more nucleic acid labels can be incorporated into the detection
reagent. For example, a particle of about 1-2 µm in size can allow incorporation of
about 100,000 nucleic acid labels into the detection reagent. In some embodiments,
there can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 50,
100, 500, 1000, 5000, 10000, 50000, 100000 nucleic acid labels present in the detection
reagent. One of skill in the art can determine the optimum number of nucleic acid
labels present the detection reagent without any undue experimentation.
[0068] The detection reagents described herein can be used in any biological assays for
detection, identification and/or quantification of target molecules or analytes, including
counting marked cells such as bacteria or cancer cells, in a sample. By way of example
only, in some embodiments, the detection reagent can be adapted for use in immunofluorescence.
In alternative embodiments, the detection reagent can be adapted for use in immunohistochemistry.
In other embodiments, the detection reagent can be adapted for use in fluorescence
in situ hybridization. In some embodiments, the detection reagent can be adapted for
use in western blot. Depending on the nature of the sample and/or applications, the
detection reagent can be adapted to be in any format, e.g., immobilized on a solid
support, or in a solution or suspension phase. In certain embodiments, the detection
reagent can be adapted to be present in a solution or suspension phase. The phrase
"in a solution or suspension phase" as used herein generally refers to suspending
the detection reagents in a liquid fluid, e.g., an aqueous buffer solution. Additional
applications of the detection reagents and/or methods described herein will be discussed.
Probe reagents (or probe molecules as used interchangeably herein)
[0069] Each of the detection reagents described herein can comprise any number of probe
reagents. In some embodiments, the detection reagent can comprise one or more probe
reagents, e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least
6, at least 7, at least 8, at least 9, at least 10 or more probe reagents. In one
embodiment, the detection reagent can comprise one probe reagent. In other embodiments,
the detection reagent can comprise a plurality of probe reagents, e.g., ranging from
about 2 to about 100,000 probe reagents, about 2 to about 10,000 probe reagents, about
2 to about 1,000 probe reagents, or about 2 to about 100 probe reagents. In some embodiments
where the detection reagent comprises a particle as a hub, the number of possible
probe reagents present in the detection reagent can depend on the size of a particle.
Generally, the larger the particle it is, the more probe reagents can be incorporated
into the detection reagent. For example, a particle of about 1-2 µm in size can allow
incorporation of about 100,000 probe reagents into the detection reagent. In some
embodiments, there can be about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 50, 100, 500, 1000, 5000, 10000, 50000, 100000 probe reagents present
in the detection reagent. One of skill in the art can determine the optimum number
of probe reagents present the detection reagent without any undue experimentation.
[0070] As used interchangeably herein, the term "probe," "probe reagent" or "probe molecule"
refers to an entity (e.g., but not limited to, a molecule, a particle, a composite
entity, or a multi-molecular entity) that interacts with or binds to a target molecule
or an analyte for the analysis of the target or the analyte. Typically the nature
of the interaction or binding is noncovalent, e.g., by hydrogen, electrostatic, or
van der Waals interactions, however, binding can also be covalent. Probe reagents
can be entities (e.g., but not limited to, molecules, a particles, composite entities,
or multi-molecular entities) capable of undergoing binding or molecular recognition
events with target molecules. Probe reagents can be naturally-occurring, recombinant
or synthetic. Examples of the probe reagent can include, but are not limited to, a
nucleic acid, an antibody or a portion thereof, an antibody-like molecule, an enzyme,
a cell, an antigen, a small molecule, a protein, a peptide, a peptidomimetic, an aptamer,
and any combinations thereof. By way of example only, in immunohistochemistry, the
probe reagent can include an antibody specific to the target antigen to be analyzed.
An ordinary artisan can readily identify appropriate probe reagents for the target
molecules or analytes of interest to be detected in various bioassays. In some embodiments,
the probe reagent can be multi-molecular. For example, in one embodiment, the probe
reagent can comprise a particle, an antibody, biotin and/or streptavidin, or any combinations
thereof.
[0071] In some embodiments, the probe reagents can be modified by any means known to one
of ordinary skill in the art. Methods to modify each type of probe reagents are well
recognized in the art. Depending on the types of probe reagents, an exemplary modification
includes, but is not limited to genetic modification, biotinylation, labeling (for
detection purposes), chemical modification (e.g., to produce derivatives or fragments
of the probe reagent), and any combinations thereof. In some embodiments, the probe
reagent can be genetically modified. In some embodiments, the probe reagent can be
biotinylated.
[0072] As used herein, the terms "proteins" and "peptides" are used interchangeably herein
to designate a series of amino acid residues connected to the other by peptide bonds
between the alpha-amino and carboxy groups of adjacent residues. The terms "protein",
and "peptide", which are used interchangeably herein, refer to a polymer of protein
amino acids, including modified amino acids (e.g., phosphorylated, glycated, etc.)
and amino acid analogs, regardless of its size or function. Although "protein" is
often used in reference to relatively large polypeptides, and "peptide" is often used
in reference to small polypeptides, usage of these terms in the art overlaps and varies.
The term "peptide" as used herein refers to peptides, polypeptides, proteins and fragments
of proteins, unless otherwise noted. The terms "protein" and "peptide" are used interchangeably
herein when referring to a gene product and fragments thereof. Thus, exemplary peptides
or proteins include gene products, naturally occurring proteins, homologs, orthologs,
paralogs, fragments and other equivalents, variants, fragments, and analogs of the
foregoing.
[0073] As used herein, the term "peptidomimetic" refers to a molecule capable of folding
into a defined three-dimensional structure similar to a natural peptide
[0074] The term "nucleic acids" used herein refers to polymers (polynucleotides) or oligomers
(oligonucleotides) of nucleotide or nucleoside monomers consisting of naturally occurring
bases, sugars and intersugar linkages. The term "nucleic acid" also includes polymers
or oligomers comprising non-naturally occurring monomers, or portions thereof, which
function similarly. Exemplary nucleic acids include, but are not limited to, deoxyribonucleic
acid (DNA), ribonucleic acid (RNA), locked nucleic acid (LNA), peptide nucleic acids
(PNA), and polymers thereof in either single- or double-stranded form. Locked nucleic
acid (LNA), often referred to as inaccessible RNA, is a modified RNA nucleotide. The
ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the
2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo conformation.
LNA nucleotides can be mixed with DNA or RNA residues in the oligonucleotide whenever
desired. Such LNA oligomers are generally synthesized chemically. Peptide nucleic
acid (PNA) is an artificially synthesized polymer similar to DNA or RNA. DNA and RNA
have a deoxyribose and ribose sugar backbone, respectively, whereas PNA's backbone
is composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. PNA
is generally synthesized chemically. Unless specifically limited, the term "nucleic
acids" encompasses nucleic acids containing known analogs of natural nucleotides,
which have similar binding properties as the reference nucleic acid and are metabolized
in a manner similar to naturally occurring nucleotides. Unless otherwise indicated,
a particular nucleic acid sequence also implicitly encompasses conservatively modified
variants thereof (e.g., degenerate codon substitutions) and complementary sequences,
as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions
may be achieved by generating sequences in which the third position of one or more
selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues
(
Batzer, et al., Nucleic Acid Res. 19:5081 (1991);
Ohtsuka, et al., J. Biol. Chem. 260:2605-2608 (1985), and
Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994)). The term "nucleic acid" should also be understood to include, as equivalents,
derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs,
and, single (sense or antisense) and double-stranded polynucleotides.
[0075] In some embodiments, the term "nucleic acid" described herein can include a modified
nucleic acid. Modified nucleic acids are well known in the art. Thus, a nucleic acid
described herein can comprise one or more nucleic acid modifications known in the
art. For example, the nucleic acid can comprise one or more nucleic acid modifications
selected from the group consisting of internucleotide linkage modifications (intersugar
linkage modifications), sugar modifications, nucleobase modifications, backbone modifications/replacements,
and any combinations thereof. Exemplary internucleotide linkage modifications include,
but are not limited to, phosphorothioate, phosphorodithioate, phosphotriester (e.g.
alkyl phosphotriester), aminoalkylphosphotriester, alkyl-phosphonate (e.g., methyl-phosphonate),
selenophosphate, phosphoramidate (e.g., N-alkylphosphoramidate), boranophosphonate,
and the like. Exemplary sugar modifications include, but are not limited to, 2'-O-Me
(2'-O-methyl), 2'-O-MOE (2'-O-methoxyethyl), 2'-F, 2'-O-[2-(methylamino)-2-oxoethyl]
(2'-O-NMA), 2'-
S-methyl, 2'-O-CH
2-(4'-C) (LNA), 2'-O-CH
2CH
2-(4'-C) (ENA), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl
(2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), arabinose sugar, and the
like. Exemplary nucleobase modifications include, but are not limited to, inosine,
xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 5-methylcytosine (5-me-C);
5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other
6-alkyl derivatives of adenine and guanine; 2-propyl and other 2-alkyl derivatives
of adenine and guanine; 2-thiouracil; 2-thiothymine; 2-thiocytosine; 5-propynyl uracil;
5-propynyl cytosine; 6-azouracil; 6-azocytosine; 6-azothymine; 5-uracil (pseudouracil);
4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines; 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted
uracils and cytosines; 7-methyl and other 7-alkyl derivatives of adenine and guanine;
8-azaguanine; 8-azaadenine; 7-deazaguanine; 7-deazaadenine; 3-deazaguanine; 3-deazaadenin;
universal base; and any combinations thereof. Exemplary backbone modifications include,
but are not limited to, morpholino, cyclobutyl, pyrrolidine, peptide nucleic acid
(PNA), aminoethylglycyl PNA (
aegPNA), backnone-extended pyrrolidine PNA (bepPNA), and the like.
[0076] The term "enzymes" as used here refers to a protein molecule that catalyzes chemical
reactions of other substances without it being destroyed or substantially altered
upon completion of the reactions. The term can include naturally occurring enzymes
and bioengineered enzymes or mixtures thereof. Examples of enzyme families include
kinases, dehydrogenases, oxidoreductases, GTPases, carboxyl transferases, acyl transferases,
decarboxylases, transaminases, racemases, methyl transferases, formyl transferases,
and α-ketodecarboxylases.
[0077] As used herein, the term "aptamers" means a single-stranded, partially single-stranded,
partially double-stranded or double-stranded nucleotide sequence capable of specifically
recognizing a selected non-oligonucleotide molecule or group of molecules. In some
embodiments, the aptamer recognizes the non-oligonucleotide molecule or group of molecules
by a mechanism other than Watson-Crick base pairing or triplex formation. Aptamers
can include, without limitation, defined sequence segments and sequences comprising
nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides
and nucleotides comprising backbone modifications, branchpoints and nonnucleotide
residues, groups or bridges. Methods for selecting aptamers for binding to a molecule
are widely known in the art and easily accessible to one of ordinary skill in the
art.
[0078] As used herein, the term "antibody" or "antibodies" refers to an intact immunoglobulin
or to a monoclonal or polyclonal antigen-binding fragment with the Fc (crystallizable
fragment) region or FcRn binding fragment of the Fc region. The term "antibodies"
also includes "antibody-like molecules", such as fragments of the antibodies, e.g.,
antigen-binding fragments. Antigen-binding fragments can be produced by recombinant
DNA techniques or by enzymatic or chemical cleavage of intact antibodies. "Antigen-binding
fragments" include, inter alia, Fab, Fab', F(ab')2, Fv, dAb, and complementarity determining
region (CDR) fragments, single-chain antibodies (scFv), single domain antibodies,
chimeric antibodies, diabodies, and polypeptides that contain at least a portion of
an immunoglobulin that is sufficient to confer specific antigen binding to the polypeptide.
Linear antibodies are also included for the purposes described herein. The terms Fab,
Fc, pFc', F(ab') 2 and Fv are employed with standard immunological meanings (
Klein, Immunology (John Wiley, New York, N.Y., 1982);
Clark, W. R. (1986) The Experimental Foundations of Modern Immunology (Wiley & Sons,
Inc., New York); and
Roitt, I. (1991) Essential Immunology, 7th Ed., (Blackwell Scientific Publications,
Oxford)). Antibodies or antigen-binding fragments specific for various antigens are available
commercially from vendors such as R&D Systems, BD Biosciences, e-Biosciences and Miltenyi,
or can be raised against these cell-surface markers by methods known to those skilled
in the art.
[0079] As used herein, the term "Complementarity Determining Regions" (CDRs; i.e. , CDR1,
CDR2, and CDR3) refers to the amino acid residues of an antibody variable domain the
presence of which are necessary for antigen binding. Each variable domain typically
has three CDR regions identified as CDR1, CDR2 and CDR3. Each complementarity determining
region may comprise amino acid residues from a "complementarity determining region"
as defined by Kabat ( i.e. about residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) in
the light chain variable domain and 31-35 (H1), 50-65 (H2) and 95-102 (H3) in the
heavy chain variable domain;
Kabat et al. , Sequences of Proteins of Immunological Interest, 5th Ed. Public Health
Service, National Institutes of Health, Bethesda, Md. (1991)) and/or those residues from a "hypervariable loop" ( i.e. about residues 26-32 (L1),
50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26-32 (H1), 53-55
(H2) and 96-101 (H3) in the heavy chain variable domain;
Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). In some instances, a complementarity determining region can include amino acids
from both a CDR region defined according to Kabat and a hypervariable loop.
[0080] The expression "linear antibodies" refers to the antibodies described in
Zapata et al. , Protein Eng., 8(10):1057-1062 (1995). Briefly, these antibodies comprise a pair of tandem Fd segments (VH -CH1-VH-CH1)
which, together with complementary light chain polypeptides, form a pair of antigen
binding regions. Linear antibodies can be bispecific or monospecific.
[0081] The expression "single-chain Fv" or "scFv" antibody fragments, as used herein, is
intended to mean antibody fragments that comprise the VH and VL domains of antibody,
wherein these domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the VH and VL domains which
enables the scFv to form the desired structure for antigen binding. (Plϋckthun, The
Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-
Verlag, New York, pp. 269-315 (1994)).
[0082] The term "diabodies," as used herein, refers to small antibody fragments with two
antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH)
Connected to a light-chain variable domain (VL) in the same polypeptide chain (VH
- VL). By using a linker that is too short to allow pairing between the two domains
on the same chain, the domains are forced to pair with the complementary domains of
another chain and create two antigen-binding sites. (
EP 404,097;
WO 93/11161;
Hollinger et ah, Proc. Natl. Acad. Sd. USA, P0:6444-6448 (1993)).
[0083] As used herein, the term "small molecules" refers to natural or synthetic molecules
including, but not limited to, peptides, peptidomimetics, amino acids, amino acid
analogs, polynucleotides, polynucleotide analogs, aptamers, nucleotides, nucleotide
analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic
compounds) having a molecular weight less than about 10,000 grams per mole, organic
or inorganic compounds having a molecular weight less than about 5,000 grams per mole,
organic or inorganic compounds having a molecular weight less than about 1,000 grams
per mole, organic or inorganic compounds having a molecular weight less than about
500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms
of such compounds.
[0084] The term "cells" used herein refers to any cell, prokaryotic or eukaryotic, including
plant, yeast, worm, insect and mammalian. Mammalian cells include, without limitation;
primate, human and a cell from any animal of interest, including without limitation;
mouse, hamster, rabbit, dog, cat, domestic animals, such as equine, bovine, murine,
ovine, canine, feline, etc. The cells may be a wide variety of tissue types without
limitation such as; hematopoietic, neural, mesenchymal, cutaneous, mucosal, stromal,
muscle spleen, reticuloendothelial, epithelial, endothelial, hepatic, kidney, gastrointestinal,
pulmonary, T-cells etc. Stem cells, embryonic stem (ES) cells, ES- derived cells and
stem cell progenitors are also included, including without limitation, hematopoeitic,
neural, stromal, muscle, cardiovascular, hepatic, pulmonary, gastrointestinal stem
cells, etc. Yeast cells may also be used as cells in some embodiments of the methods
described herein. In some embodiments, the cells can be ex vivo or cultured cells,
e.g. in vitro. For example, for ex vivo cells, cells can be obtained from a subject,
where the subject is healthy and/or affected with a disease. Cells can be obtained,
as a non-limiting example, by biopsy or other surgical means know to those skilled
in the art.
[0085] As used herein, the term "antigens" refers to a molecule or a portion of a molecule
capable of being bound by a selective binding agent, such as an antibody, and additionally
capable of being used in an animal to elicit the production of antibodies capable
of binding to an epitope of that antigen. An antigen may have one or more epitopes.
The term "antigen" can also refer to a molecule capable of being bound by an antibody
or a T cell receptor (TCR) if presented by MHC molecules. The term "antigen", as used
herein, also encompasses T-cell epitopes. An antigen is additionally capable of being
recognized by the immune system and/or being capable of inducing a humoral immune
response and/or cellular immune response leading to the activation of B- and/or T-lymphocytes.
This may, however, require that, at least in certain cases, the antigen contains or
is linked to a Th cell epitope and is given in adjuvant. An antigen can have one or
more epitopes (B- and T-epitopes). The specific reaction referred to above is meant
to indicate that the antigen will preferably react, typically in a highly selective
manner, with its corresponding antibody or TCR and not with the multitude of other
antibodies or TCRs which may be evoked by other antigens. Antigens as used herein
may also be mixtures of several individual antigens.
[0086] In some embodiments, the probe reagent can be an antibody or a portion thereof, or
an antibody-like molecule. In such embodiments, the probe reagents can be used to,
for example, detect and/or identify pathogen type or speices, the presence of cell
or disease markers, cellular protein expression levels, phosphorylation or other post-translation
modification state, or any combinations thereof. By way of example only,
Fig. 1 shows three different embodiments of the detection reagents comprising at least one
(e.g., 1, 2, 3, 4, 5 or more) pathogen-specific antibodies (e.g., anti-E. Coli, anti-S.
aureus, and anti-C. albicans).
[0087] In some embodiments, the probe reagent can be a nucleic acid (e.g., DNA, RNA, LNA,
PNA, or any combinations thereof). In such embodiments, the nucleic acids can be used
to determine, for example, the existence of characteristic cellular DNA or RNA sequences
(such as in fluorescent in situ hybridization), RNA expression levels, miRNA presence
and expression, and any combinations thereof, in various applications, e.g., for pathogen
detection and/or identification.
[0088] In some embodiments, the probe reagent can be a protein or a peptide. In such embodiments,
the protein or peptide can be essentially any proteins with known binding targets.
Examples include, but are not limited to, innate-immune proteins (e.g., without limitations,
MBL, Dectin-1, TLR2, and TLR4 ) and proteins comprising the chitin-binding domain.
Such innate-immune proteins and chitin-binding domain proteins can be used to detect
their corresponding pattern-recognition targets (e.g., microbes such as bacteria)
and fungus, respectively. By way of example only, instead of using pathogen-specific
antibodies as probe reagents in the detection reagents as shown in
Fig. 1, innate-immune proteins (e.g., MBL) or chitin-binding domain proteins can be used
as probe reagents for detection of pathogens. While such detection reagents can be
used to detect pathogens, they may not be pathogen-specific, as compared to the ones
using pathogen-specific antibodies as probes molecules.
[0089] In some embodiments, the probe reagent can be an aptamer. In some embodiments, the
probe reagent can be a DNA or RNA aptamer. The aptamers can be used in various bioassays,
e.g., in the same way as antibodies or nucleic acids described herein. By way of example
only,
Fig. 2 shows some exemplary embodiments of the detection reagents comprising at least one
(e.g., 1, 2, 3, 4, 5 or more) DNA aptamers (e.g., with a nucleotide sequence complementary
to nuclear reprogramming factors, such as Oct4, Sox2, and Klf4). Such detection reagents
can be used to determine RNA expression level of nuclear reprogramming factors in
somatic cells for detecting, screening, or identifying stem cells (e.g., induced pluripotency
stem cells).
[0090] In some embodiments, the probe reagent can be a cell surface receptor ligand. As
used herein, a "cell surface receptor ligand" refers to a molecule that can bind to
the outer surface of a cell. Exemplary, cell surface receptor ligand includes, for
example, a cell surface receptor binding peptide, a cell surface receptor binding
glycopeptide, a cell surface receptor binding protein, a cell surface receptor binding
glycoprotein, a cell surface receptor binding organic compound, and a cell surface
receptor binding drug. Additional cell surface receptor ligands include, but are not
limited to, cytokines, growth factors, hormones, antibodies, and angiogenic factors.
[0091] When the detection reagents described herein are used as targeted delivery vehicles,
e.g., for a diagnostic agent, in some embodiments, the probe reagent can be an endosomolytic
ligand. As used herein, the term "endosomolytic ligand" refers to molecules having
endosomolytic properties. Endosomolytic ligands can promote the lysis of and/or transport
of the composition described herein, or its components, from the cellular compartments
such as the endosome, lysosome, endoplasmic reticulum (ER), Golgi apparatus, microtubule,
peroxisome, or other vesicular bodies within the cell, to the cytoplasm of the cell.
Some exemplary endosomolytic ligands include, but are not limited to, imidazoles,
poly or oligoimidazoles, linear or branched polyethyleneimines (PEIs), linear and
branched polyamines, e.g. spermine, cationic linear and branched polyamines, polycarboxylates,
polycations, masked oligo or poly cations or anions, acetals, polyacetals, ketals/polyketals,
orthoesters, linear or branched polymers with masked or unmasked cationic or anionic
charges, dendrimers with masked or unmasked cationic or anionic charges, polyanionic
peptides, polyanionic peptidomimetics, pH-sensitive peptides, natural and synthetic
fusogenic lipids, natural and synthetic cationic lipids.
[0092] In other embodiments, the probe reagent for use in delivery of an agent (e.g., a
diagnostic agent) encapsulated within the detection reagents described herein can
be a PK modulating ligand. As used herein, the terms "PK modulating ligand" and "PK
modulator" refers to molecules which can modulate the pharmacokinetics of the composition
described herein. Some exemplary PK modulator include, but are not limited to, lipophilic
molecules, bile acids, sterols, phospholipid analogues, peptides, protein binding
agents, vitamins, fatty acids, phenoxazine, aspirin, naproxen, ibuprofen, suprofen,
ketoprofen, (S)-(+)-pranoprofen, carprofen, PEGs, biotin, and transthyretia-binding
ligands (e.g., tetraiidothyroacetic acid, 2, 4, 6-triiodophenol and flufenamic acid).
[0093] In various embodiments, the detection reagent described herein can comprise one kind/species
of probe reagents or different kinds/species of probe reagents. In some embodiments,
the kind/species of the probe reagents present in the detection reagent can be the
same. In other embodiments, the detection reagent can include at least one different
kind/species of the probe reagents (e.g., 1, 2, 3, 4, 5, or 6 probe reagent species).
In such embodiments, the distinct probe reagent species can be different from the
others by types (e.g., antibodies vs. DNA aptamers), binding domains, and/or target
analytes.
Nucleic acid labels
[0094] In accordance with embodiments, the nucleic acid label or nucleic acid tag comprises
at least one pre-determined nucleic acid subsequence, which is used to identify an
analyte or target. In some embodiments, the nucleic acid label or nucleic acid tag
can comprise any number of the pre-determined nucleic acid subsequences, e.g., ranging
from about 1 to about 100, from about 2 to about 80, or from about 3 to about 50.
In some embodiments, the nucleic acid label or nucleic acid tag can comprise at least
about 1, at least about 2, at least about 3, at least about 4, at least about 5, at
least about 6, at least about 7, at least about 8, at least about 9, at least about
10, at least about 15, at least about 20, at least about 30, at least about 40, at
least about 50, at least about 60, at least about 70 or more pre-determined nucleic
acid subsequences. In some embodiments, the nucleic acid label or nucleic acid tag
can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70 or more pre-determined
nucleic acid subsequences. Without wishing to be bound, the minimum number of pre-determined
nucleic acid subsequences (n) required in the detection reagent can vary upon the
number of distinct probes to be detected (X) and/or the number of distinct detectable
labels (e.g., optical labels such as fluorescent labels or quantum dots) available
to be used (Y), and n can be determined by the equation:

, where the mathematical function "ceiling" refers to rounding up a non-integer number
to the nearest integer, when needed. For example, if 4 distinct detectable labels
(Y) are used to distinguish 62 distinct probe reagents (X), n = ceiling (2.98) ~3.
Therefore, at least three predetermined nucleic acid subsequences are required in
this example.
[0095] In some embodiments where the detectable labels include no-color (dark), the number
of distinct detectable label available to be used can become Y+1. In such embodiments,
n can be determined by the equation:

, and thus fewer pre-determined nucleic acid subsequences can be used. However, the
combination in which all readout cycles are dark should not be allowed.
[0096] Further, the pre-determined nucleic acid subsequences can be designed such that each
readout cycle can light up in multiple colors. Thus, 2
Y instead of Y is used in the equation for n above and fewer pre-determined nucleic
acid subsequences can thus be required. However, the combination in which all readout
cycles are dark should not be allowed.
[0097] Additionally, while colors are generally used in a binary fashion, i.e., whether
the color is present or not, in the above examples, the color intensity can also be
used as a parameter of a signal signature. For example, if one detectable label is
allowed to light up twice as brightly in a different color than another, the multiplexing
capacity can be even further expanded.
[0098] The pre-determined nucleic acid subsequences can be constructed from any types of
nucleic acids, including, but not limited to, DNA, RNA, PNA, LNA and any combinations
thereof.
[0099] Each of the pre-determined subsequences of the nucleic acid label can be independently
of any length. In certain embodiments, the pre-determined subsequences can each independently
comprise a length of about 1 nucleobase to about 100 nucleobases, from about 1 nucleobase
to about 50 nucleobases, from about 2 nucleobases to about 50 nucleobases, from about
5 nucleobases to about 30 nucleobases, or from about 5 nucleobases to about 20 nucleobases.
In some embodiments, the pre-determined subsequences can each independently comprise
one or more nucleobases, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20 or more nucleobases.
[0100] The achievable length of the pre-determined subsequences can affect the degree of
multiplexibility. In some embodiments, the achievable length of the pre-determined
subsequences can be a function of the decreasing fluorescence intensity over many
cycles of stripped and rehybridization (i.e. diffusion of the sequenceable particles,
degradation, increasing background noise). In the case of DNA or RNA based nucleic
acid labels that are amplified in situ, modified base is incorporated during its synthesis
(i.e., dUTP, biotin, Acrydite, aminoallele), enabling these detection reagents to
be permanently embedded in a film (regardless of the film thickness) of functionalized
polyacrylamide (i.e. Acrydite streptavidin, NHS ester Acrydite). The embedded material
can then be stripped and rehybridized for many more cycles without altering its spatial
architecture and minimizing the background noise.
[0101] Two or more pre-determined subsequences can be conjugated together within a nucleic
acid label using any methods known in the art. In some embodiments, two or more predetermined
subsequences can be conjugated together by a sequence linker. The term "sequence linker"
as used herein generally refers to an entity that connects two sequences or subsequences
as described herein together.
[0102] In some embodiments, the sequence linker can be a direct bond or an atom such as
nitrogen, oxygen or sulfur; a unit such as NR
1, C(O), C(O)NH, SO, SO
2, SO
2NH; or a chain of atoms. If needed, the two ends of the pre-determined subsequences
can be linked together by providing on the two ends of the pre-determined subsequences
complementary chemical functionalities that undergo a coupling reaction. In particular
embodiments, the sequence linker is a direct bond, including, but not limited to,
a phosphodiester bond. For example, a 3' carbon atom of a sugar base at the 5' end
nucleotide of a first pre-determined subsequence can interact with the 5' carbon atom
of another sugar base at the 3' end nucleotide of a second predetermined subsequence
to form a covalent bond, e.g., a phosphodiester bond. As such, two or more pre-determined
subsequences can be bonded together to form a longer and contiguous predetermined
subsequence.
[0103] In some embodiments, the sequence linker can be a nucleotidic linker. The term "nucleotidic
linker" as used herein refers to a linker of one nucleotide long or a sequence substantially
comprising a plurality of nucleotides. In some embodiments, the nucleotidic linker
can have a sequence length of at least 1, at least 2, at least 3, at least 4, at least
5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least
20, at least 30 or more nucleotides. The sequence length of the nucleotidic linker
can vary with a number of factors, e.g., detection methods, and/or properties of optical
labels. Without wishing to be bound by theory, in some embodiments, increasing the
length of the nucleotidic linker can increase the flexibility of the nucleic acid
label, e.g., to increase the binding frequency between a pre-determined sequence and
a decoder probe, the term of which will be discussed later. However, too long a nucleotidic
linker can result in a too long nucleic acid label, which could overlap with other
nucleic acid labels of the detection reagents during an assay and thus reduce the
quality and/or accuracy of the signal detection. One of skill in the art can determine
the optimum length of the nucleotidic linker without undue experimentations.
[0104] The nucleotidic linker can be in any structure or conformation. In some embodiments,
the nucleotidic linker can be in a structure selected from the group consisting of
single-stranded, double-stranded, partially double-stranded, a hairpin, or any combinations
thereof.
[0105] In some embodiments, the sequence linker can be a bead or a nanoparticle acting as
a hub. Accordingly, two or more pre-determined subsequences can be independently conjugated
together via a bead or a nanoparticle.
[0106] Without wishing to be bound, while the sequence linker can be a direct bond, an atom,
a nucleotidic linker, or any combinations thereof, the sequence linker can also include
a sequence of amino acids, a polymer chain, a microbead, a nanobead, or any combinations
thereof. To provide for the linkages between sequence linker, in some embodiments,
different functionalities can be introduced to the ends of sequence linker and/or
the pre-determined subsequences. Examples of functionalities include, but are not
limited to, amide groups, including carbonic acid derivatives, ethers, esters, including
organic and inorganic esters, amino, urethane, urea and any combinations thereof.
[0107] In some embodiments, the nucleic acid label is substantially a polynucleotide sequence
containing one or more pre-determined subsequences. In such embodiments, any two pre-determined
subsequences are either joined or conjugated together by a direct bond such as a phosphodiester
bond (to produce longer contiguous subsequence), a nucleotidic linker of any desirable
length, or any combinations thereof.
[0108] In such embodiments, the nucleic acid label of the detection reagent can be adapted
to any configuration or structure. In some embodiments, the nucleic acid label can
be single-stranded, double-stranded, partially double-stranded, a hairpin, linear,
circular, branched, a concatemer, or any combinations thereof. In some embodiments,
the nucleic acid label can be a linear polynucleotide sequence.
[0109] In some embodiments, the nucleic acid label can be a circular polynucleotide sequence.
The advantage of using a circular nucleic acid label is that it can be amplified using
rolling-circle amplification or hyperbranched rolling-circle amplification to generate
a long continuous nucleic acid molecule that contains multiple copies of the same
nucleic acid label sequences linked in series (also known as concatemer), thus resulting
in an amplified signal. In some embodiments, instead of pre-forming the detection
reagents comprising the circular nucleic acid label(s) and the probe reagent(s), detection
reagents comprising linear polynucleotide(s) and the probe reagent(s) can be first
synthesized. The circular nucleic acid labels can then added to hybridize with the
linear polynucleotide(s) before or after the probe reagent(s) bind to the analytes.
In such embodiments, while requiring an extra step, this approach can have the advantage
over direct attachment of circular nucleic acid labels in that it does not require
chemical modification of the nucleic acid label for conjugation with the probe reagents,
thus resulting in a circular nucleic acid label that is compatible with a broader
range of amplification enzymes. Furthermore, the linear polynucleotides can be smaller
than the secondary circular nucleic acid labels, facilitating diffusion of the probe
reagents (and the detection reagents) to their targets. In other embodiments, the
linear polynucleotides can be circularized using a suitable double-stranded or single-stranded
ligase, with or without the addition of a suitable ligation template. Without wishing
to be bound by theory, such embodiments can avoid the extra hybridization that is
required when a pre-circularized oligonucleotide is used instead.
[0110] When the detection reagents described herein are used as FISH probes, the nucleic
acid labels and the FISH probes can be part of the same nucleic acid sequence construct,
and thus the circularization can encompass the entire construct (e.g., both the nucleic
acid labels and FISH probes). A schematic representation of exemplary FISH probes
for SeqTagged FISH is shown in
Fig. 13.
[0111] In some embodiments, the method described herein can be used to identify a class
an analyte, e.g., a pathogen belongs to. For example, the method can be used to identify
if a pathogen is a Gram-negative, Gram-positive, or some other class of pathogen,
e.g., yeast. Thus, the method described herein can be used to as Gram test to determine
whether a suspected pathogen is Gram positive, Gram negative or yeast. This can be
useful for quickly identifying the type of infection in a subject and administering
appropriate therapy. By way of example only, this can be accomplished using a detection
reagent comprising a class-specific probe, also referred to as "Gram-stain like probe"
herein. Again by way of example only, the probe can be a DNA probe for FISH.
[0112] In some embodiment, the FISH probe for identifying eubacteria can comprise the nucleotide
sequence of SEQ ID NO: 4 (GCTGCCTCCCGTAGGAGT). An exemplary SeqTag labeled FISH-probe
for identifying eubacteria can comprise the nucleotide sequence of SEQ ID NO: 5 (CTGCCTCCCGTAGGAGTTTTTTCGCTTTAGCCTAAGTGAAATC).
[0113] In some embodiments, the FISH probe for identifying yeast can comprise the nucleotide
sequence of SEQ ID NO: 6 (CTCTGGCTTCACCCTATTC. An exemplary SeqTag labeled FISH-probe
for identifying yeast can comprise the nucleotide sequence of SEQ ID NO: 7 (CTCTGGCTTCACCCTATTCTTTTTCGCTTTTTTGGGGAAAAGACA).
[0114] In some embodiments, the FISH probe for identifying firmicutes can comprise the nucleotide
sequence of SEQ ID NO: 8 (CGGAAGATTCCCTACTGC). An exemplary SeqTag labeled FISH-probe
for identifying yeast can comprise the nucleotide sequence of SEQ ID NO: 9 (CGGAAGATTCCCTACTGCTTTTTCGCTTTCTGTAATGGAGTGGA).
[0115] In the SeqTag labeled FISH probes discussed above, each probe can be assigned a particular
"signal signature" for each of the three readout steps. For example, colors can be
labeled at B, C, and D. In some embodiments, each color can be from a different fluorophore,
such as FAM, Cy3 and Cy5. Each signal signature can take advantage of multiple fluorophores
simultaneously or even the same fluorophore multiple times, e.g., a SeqTag with signal
signature corresponding to "DDDC."
[0116] An exemplary signal signature for identifying eubacteria, yeast or firmicutes is
shown in
Table 1. As shown, each class has a different assigned code for the first readout step. For
example, for the first readout, eubacteria are assigned color C' yeast color D and
firmicutes color B. On readout, eubacteria will show up as color C, yeast as color
D, firmicutes as both colors B and C.
Table 1
| Name |
Assigned code |
Effective code |
|
| |
S1 |
S2 |
S3 |
|
S1 |
S2 |
S3 |
|
| Eubacteria-Kempf |
C |
|
|
|
C |
|
|
|
| All_yeast-Kempf |
D |
|
|
|
D |
|
|
|
| Firmicutes-pB-00196 |
B |
|
|
|
BC |
|
|
|
[0117] After identifying the class of pathogens, the pathogens can be further probed for
identifying the specific pathogen or genus using the method described herein. For
example, the detection reagent can comprise a pathogen specific probe that binds to
a specific pathogen or genus of pathogens. For example, the probe can be a FISH probe
that specifically binds to a specific pathogen. Some exemplary pathogen specific FISH
probes are shown in
Table 2.
Table 2
| |
Name |
probeBase FISH Sequence |
Assigned code |
|
Effective code |
| SEQ ID NO: |
Gram + |
| 10 |
Staph spp-Kempf |
TCCTCCATATCTCTGCGC |
|
DD |
B |
|
BC |
DD |
B |
| 11 |
S_Aureus-Kempf |
GAAGCAAGCTTCTCGTCCG |
|
CD |
B |
|
BC |
CDDD |
BB |
| 12 |
Streptococcus_spp-Kempf |
CACTCTCCCCTTCTGCAC |
|
DD |
D |
|
BC |
DD |
D |
| 13 |
S Pneumoniae-Kempf |
GTGATGCAAGTGCACCTT |
|
B |
DC |
|
BC |
DDB |
DDC |
| 14 |
S_Pyogenes-Kempf |
TTCCAAAGCGTACATTGGTT |
|
C |
DB |
|
BC |
DDC |
DDB |
| 15 |
S_Agalactiae-Kempf |
GTAAACACCAAACMTCAGCG |
|
D |
DC |
|
BC |
DDD |
DDC |
| 16 |
B_subtilis-pB-00401 |
CGA AGG GGA CGT CCT ATC T |
|
C |
DD |
|
BC |
C |
DD |
| 17 |
L_acidophilus-pB-00711 |
CAG GCT TGC TCC TCG TTG |
|
DD |
C |
|
BC |
DD |
C |
| |
Gram - |
| 18 |
P_Aeruginosa-Kempf |
TCTCGGCCTTGAAACCCC |
|
B |
B |
|
C |
B |
B |
| 19 |
K Pneumoniae-Kempf |
CCTACACACCAGCGTGCC |
|
B |
DD |
|
C |
B |
DD |
| 20 |
H _influenzae-pB-00348 |
CCG CAC TTT CAT CTT CCG |
|
B |
BC |
|
C |
B |
BC |
| 21 |
B_cepacia-pB-00346 |
CTG TGC GCC GGT TCT CTT |
|
DD |
B |
|
C |
DD |
B |
| 22 |
K_oxytoca-pB-01681 |
CTA CAA GAC TCC AGC CTG CC |
|
DD |
C |
|
C |
DD |
C |
| 23 |
E_coli-pB-02569-compl |
ATG AGC AAA GGT ATT AAC TTT ACT CCC |
|
B |
C |
|
C |
B |
C |
| 24 |
Shewanella spppB-01191-mod |
AGC TAA TCC CAC CTA GGT TCA TC |
|
BC |
B |
|
C |
BC |
B |
| 25 |
H_pylori-pB-00361 |
CACACCTGACTGACTATCCCG |
|
C |
B |
|
C |
C |
B |
| |
Yeast |
| 26 |
C_Albicans-Kempf |
GCCAAGGCTTATACTCGCT |
|
C |
BC |
|
D |
C |
BC |
| 27 |
C_Glabrata_Kempf |
CCGCCAAGCCACAAGGACT |
|
C |
CD |
|
D |
C |
CD |
| 28 |
C_Krusei-Kempf |
GATTCTCGGCCCCATGGG |
|
BC |
C |
|
D |
BC |
C |
| 29 |
C_Parapsilosis-Kempf |
CCTGGTTCGCCAAAAAGGC |
|
CD |
C |
|
D |
CD |
C |
[0119] As shown in
Table 3, the "signal signature" can comprise multiple fluorescence "colors" in each step.
For example,
E. coli can be marked as red in step 1 and red+green in step 2 and blue in step 3. The "signal
signature" can also be encoded in the brightness of the color at each step. For example,
E. coli could be marked as red in step 1 and 3 times brighter red in step 2.
[0120] Exemplary hybridization sites for generating the different signal signatures at different
steps using the exemplary SeqTag labeled FISH-probes described above are shown in
Table 4.
Table 4
| SEQ ID NO: |
Assigned "Color" |
|
| |
Set1 |
| 50 |
B |
CGCTTTCTGTAATGGAGTGGA |
| 51 |
C |
CGCTTTAGCCTAAGTGAAATC |
| 52 |
D |
CGCTTTTTTGGGGAAAAGACA |
| |
|
Set 2 |
| 53 |
B |
CGCTTTTAGGCATTAGCATTG |
| 54 |
C |
CGCTTTGGAAGCACCTATTCC |
| 55 |
D |
CGCTTTCTGGAGAAAGGGCCA |
| |
|
Set 3 |
| 56 |
B |
CGCTTTCGGTTCCAAAGACAC |
| 57 |
C |
CGCTTTGAAGCCGGTTATAGC |
| 58 |
D |
CGCTTTTCACGATCCCATGTA |
[0121] In some embodiments, multiple detection reagents can be used to identify a specific
analyte. For example, a first set of probes can be used to identify whether the potential
pathogen is gram-position, gram-negative and then another set of probes to identify
it more specifically. Both probes would need to produce a detectable signal, allowing
one to use, for example,
Table 3 to uniquely identify the pathogen.
[0122] In some embodiments, the nucleic acid label can be a concatemer, including a rolony
or a DNA nanoball that is large enough to act as a particle rather than simply a strand
of nucleic acid. Using a concatemer as a nucleic acid label can eliminate the need
for in-situ enzymatic treatment of circular nucleic acid amplification, but it can
also increase the overall molecular weight of the detection reagent and thus retard
diffusion. Similar to the circular nucleic acid labels as described above, an exemplary
approach of hybridizing concatemers with the linear polypeptides of the detection
reagents after probe reagents bind to the analytes can be used to facilitate diffusion
of the probe reagents (and the detection reagents) to their targets.
[0123] To increase the accuracy and/or specificity of the methods described herein, in various
embodiments, the nucleic acid label can be designed for minimal cross-hybridization
of bases with each other. Various art-recognized computational programs or algorithms
are available to design nucleic acid sequences with minimal cross-hybridization. Thus,
one of skill in the art can optimize the nucleic acid label sequence using any methods
or algorithms known in the art.
[0124] In some embodiments, the nucleic acid labels described herein can be synthetic nucleic
acid molecules (e.g., DNA, RNA, or DNA/RNA hybrids), and can be rationally-designed
to have features that optimize labeling and detection of the detection reagents, and
that prevent secondary structure formation. In some embodiments, a nucleic acid label
is a designed polynucleotide sequence from about 50 to 50,000 bases long.
[0125] In some embodiments, the nucleic acid labels described herein can be designed to
minimize predictable secondary structures, and/or be designed such that each nucleic
acid label can hybridize only against its own target. In some embodiments, the nucleic
acid labels described herein can be designed to be devoid of any secondary structure.
Putative secondary structures (e.g. hairpins, folding, or internal base pairing) can
be predicted by methods known in the art such as MFOLD. Without intending to be limited
to any theory, in some embodiments, predictable secondary structure in the nucleic
acid label can be minimized by avoiding inverted repeats and by skewing the backbone-specific
content such that the backbone of the nucleic acid label is CT or GA-rich. Any art-recognized
methods, e.g., MFOLD, can be used to verify if each nucleic acid label can hybridize
only against its own target.
[0126] Sequences can also be screened to avoid common six-base-cutter restriction enzyme
recognition sites. Selected sequences can be additionally subjected to predicted secondary
structure analysis, and those with the least secondary structure may be chosen for
further evaluation. Any program known in the art can be used to predict secondary
structure, such as the MFOLD program (
Zuker, 2003, Nucleic Acids Res. 31 (13):3406-15;
Mathews et al., 1999, J. Mol. Biol. 288:911-940).
[0127] In some embodiments, the nucleic acid label can comprise only a subset of the A,
G, C, T (and/or U) nucleotides or modified nucleotides thereof. In some embodiments,
the nucleic acid label can comprise only one of the A, G, C, T (and/or U) nucleotides
or modified nucleotides thereof. In some embodiments, the nucleic acid can comprise
two of the A, C, T (and/or U) nucleotides or modified nucleotides thereof. In some
embodiments, the nucleic acid label can comprise only three of the A, G, C, and T
(and/or U) nucleotides or modified nucleotides thereof. In some embodiments, the nucleic
acid label can comprise only four of the A, G, C, and T (and/or U) nucleotides or
modified nucleotides thereof. The subset of the A, G, C and T (and/or U) nucleotides
or modified nucleotide thereof can be selected from the group consisting of A; G;
C; T; U; (A,G); (A,C); (G,T); (G,U); (C,T); (C,U); (G,T,U); (C,T,U); (A,C,G); (A,G,T);
(A,G,U); (A,C,T); (A,C,U); (C,G,T); (C,G,U); (A,C,T,U); and (C,G,T,U).
[0128] Without wishing to be bound, the nucleic acid label can be a modified nucleic acid
label. An exemplary modification of the nucleic acid label includes, without limitations,
attaching one or more detectable molecules to the nucleic acid label (either to one
end of or along the nucleic acid label sequence). The detectable molecule can be any
optical molecule, including, but not limited to, a small-molecule dye, a fluorescent
protein, a quantum dot, or any combinations thereof. In another embodiment, at least
one end of the nucleic acid label can be modified to include a chemical functional
group and/or a protein or peptide to facilitate the conjugation between the nucleic
acid label and the probe reagent.
[0129] In some embodiments, at least one (including, e.g., at least two, at least three,
at least four, at least five, at least six or more) nucleic acids or nucleotides present
in the nucleic acid label can be modified. For example, the nucleic acid can comprise
one or more nucleic acid modifications as described herein, e.g., selected from the
group consisting of internucleotide linkage modifications (intersugar linkage modifications),
sugar modifications, nucleobase modifications, backbone modifications/replacements,
and any combinations thereof.
Conjugation between a nucleic acid label and a probe reagent
[0130] In accordance with embodiments, the detection reagent comprises at least one probe
reagent and at least one nucleic acid label, wherein the probe reagent and the nucleic
acid label can be conjugated together by any methods known in the art.
[0131] In some embodiments, the probe reagent and the nucleic acid label can be attached
or conjugated together by a linker. As used herein, the term "linker" generally refers
to an entity that connects the probe reagent and the nucleic acid label together.
The linker can be monovalent or multivalent. The term "monovalent" as used herein
refers to the capacity of a linker to join one probe reagent to one nucleic acid label.
The term "multivalent" as used herein refers to the capacity of a linker to bind with
one or more probe reagents and/or nucleic acid labels. In some embodiments, a multivalent
linker can join at least one probe reagent to a plurality of nucleic acid labels (e.g.,
2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid labels).
[0132] In some embodiments, the term "linker" means an organic moiety that connects two
parts of a compound. Such linkers typically comprise a direct bond or an atom such
as oxygen or sulfur, a unit such as NH, C(O), C(O)NH, SO, SO
2, SO
2NH, SS, or a chain of atoms, such as substituted or unsubstituted C
1-C
6 alkyl, substituted or unsubstituted C
2-C
6 alkenyl, substituted or unsubstituted C
2-C
6 alkynyl, substituted or unsubstituted C
6-C
12 aryl, substituted or unsubstituted C
5-C
12 heteroaryl, substituted or unsubstituted C
5-C
12 heterocyclyl, substituted or unsubstituted C
3-C
12 cycloalkyl, where one or more methylenes can be interrupted or terminated by O, S,
S(O), SO
2, NH, C(O).
[0133] In some embodiments, the linker is a branched linker. The branchpoint of the branched
linker may be at least trivalent, but can be a tetravalent, pentavalent or hexavalent
atom, or a group presenting such multiple valencies. In some embodiments, the branchpoint
is - N, -N(R)-C, -O-C, -S-C, -SS-C, -C(O)N(R)-C, -OC(O)N(R)-C, -N(R)C(O)-C, or -N(R)C(O)O-C;
wherein R is independently for each occurrence H or optionally substituted alkyl.
In some embodiments, the branchpoint is glycerol or derivative thereof.
[0134] In some embodiments, linker comprises a cleavable linking group. As used herein,
a "cleavable linking group" is a chemical moiety which is sufficiently stable outside
the cell, but which upon entry into a target cell is cleaved to release the two parts
the linker is holding together. In a preferred embodiment, the cleavable linking group
is cleaved at least 10 times or more, preferably at least 100 times faster in the
target cell or under a first reference condition (which can, e.g., be selected to
mimic or represent intracellular conditions) than in the blood or serum of a subject,
or under a second reference condition (which can, e.g., be selected to mimic or represent
conditions found in the blood or serum).
[0135] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential
or the presence of degradative molecules. Generally, cleavage agents are more prevalent
or found at higher levels or activities inside cells than in serum or blood. Examples
of such degradative agents include: redox agents which are selected for particular
substrates or which have no substrate specificity, including, e.g., oxidative or reductive
enzymes or reductive agents such as mercaptans, present in cells, that can degrade
a redox cleavable linking group by reduction; esterases; amidases; endosomes or agents
that can create an acidic environment, e.g., those that result in a pH of five or
lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting
as a general acid, peptidases (which can be substrate specific) and proteases, and
phosphatases.
[0136] A linker can include a cleavable linking group that is cleavable by a particular
enzyme. The type of cleavable linking group incorporated into a linker can depend
on the cell to be targeted. For example, for liver targeting, cleavable linking groups
can include an ester group. Liver cells are rich in esterases, and therefore the linker
will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich.
Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
[0137] Linkers that contain peptide bonds can be used when targeting cell types rich in
peptidases, such as liver cells and synoviocytes.
[0138] In some embodiments, cleavable linking group is cleaved at least 1.25, 1.5, 1.75,
2, 3, 4, 5, 10, 25, 50, or 100 times faster in the cell (or under in vitro conditions
selected to mimic intracellular conditions) as compared to blood or serum (or under
in vitro conditions selected to mimic extracellular conditions). In some embodiments,
the cleavable linking group is cleaved by less than 90%, 80%, 70%, 60%, 50%, 40%,
30%, 20%, 10%, 5%, or 1% in the blood (or in vitro conditions selected to mimic extracellular
conditions) as compared to in the cell (or under in vitro conditions selected to mimic
intracellular conditions).
[0139] Exemplary cleavable linking groups include, but are not limited to, redox cleavable
linking groups (e.g., -S-S- and -C(R)
2-S-S-, wherein R is H or C
1-C
6 alkyl and at least one R is C
1-C
6 alkyl such as CH
3 or CH
2CH
3); phosphate-based cleavable linking groups (e.g., -OP(O)(OR)-O-, -O-P(S)(OR)-O-,
-O-P(S)(SR)-O-, -S-P(O)(OR)-O-, -O-P(O)(OR)-S-, -S-P(O)(OR)-S-, -O-P(S)(ORk)-S-, -S-P(S)(OR)-O-,
-O-P(O)(R)-O-, -O-P(S)(R)-O-, -S-P(O)(R)-O-, -S-P(S)(R)-O-, -S-P(O)(R)-S-, -O-P(S)(
R)-S-,. -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -OP(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-,
-S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O-,
-S-P(S)(H)-O-, -S-P(O)(H)-S-, and -O-P(S)(H)-S-, wherein R is optionally substituted
linear or branched C
1-C
10 alkyl); acid celavable linking groups (e.g., hydrazones, esters, and esters of amino
acids, -C=NN- and - OC(O)-); ester-based cleavable linking groups (e.g., -C(O)O-);
peptide-based cleavable linking groups, (e.g., linking groups that are cleaved by
enzymes such as peptidases and proteases in cells, e.g., - NHCHR
AC(O)NHCHR
BC(O)-, where R
A and R
B are the R groups of the two adjacent amino acids). A peptide based cleavable linking
group comprises two or more amino acids. In some embodiments, the peptide-based cleavage
linkage comprises the amino acid sequence that is the substrate for a peptidase or
a protease found in cells.
[0140] In some embodiments, an acid cleavable linking group is cleaveable in an acidic environment
with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents
such as enzymes that can act as a general acid.
[0141] In addition to covalent linkages, two parts of a compound can be linked together
by an affinity binding pair. The term "affinity binding pair" or "binding pair" refers
to first and second molecules that specifically bind to each other. One member of
the binding pair is conjugated with first part to be linked while the second member
is conjugated with the second part to be linked. As used herein, the term "specific
binding" refers to binding of the first member of the binding pair to the second member
of the binding pair with greater affinity and specificity than to other molecules.
[0142] Exemplary binding pairs include any haptenic or antigenic compound in combination
with a corresponding antibody or binding portion or fragment thereof (e.g., digoxigenin
and antidigoxigenin; mouse immunoglobulin and goat antimouse immunoglobulin) and nonimmunological
binding pairs (e.g., biotin-avidin, biotin-streptavidin, biotin-neutravidin, hormone
[e.g., thyroxine and cortisol-hormone binding protein, receptor-receptor agonist,
receptor-receptor antagonist (e.g., acetylcholine receptor-acetylcholine or an analog
thereof), IgG-protein A, IgG-protein G, IgG-synthesized protein AG, lectin-carbohydrate,
enzyme-enzyme cofactor, enzyme-enzyme inhibitor, and complementary oligonucleotide
pairs capable of forming nucleic acid duplexes), and the like. The binding pair can
also include a first molecule which is negatively charged and a second molecule which
is positively charged.
[0143] One example of using binding pair conjugation is the biotin-avidin, biotin-streptavidin
or biotin-neutravidin conjugation. In this approach, one of the molecule or the peptide
is biotinylated and the other is conjugated with avidin or streptavidin. Many commercial
kits are also available for biotinylating molecules, such as proteins.
[0144] Another example of using binding pair conjugation is the biotin-sandwich method.
See,
e.g., example
Davis et al., Proc. Natl. Acad. Sci. USA, 103: 8155-60 (2006). The two molecules to be conjugated together are biotinylated and then conjugated
together using at least one tetravalent avidin-like molecule (e.g., avidin, streptavidin,
or neutravidin) as a linker.
[0145] Accordingly, in some embodiments, both the nucleic acid label(s) and probe reagent(s)
can be biotinylated and then linked together using an avidin-like molecule (e.g.,
avidin, streptavidin, or neutravidin). In one embodiment, neutravidin and/or streptavidin
is used as a linker to bridge together the biotinylated nucleic acid label(s), e.g.,
DNA sequence(s), and biotinylated probe reagent(s), e.g., antibody. Without wishing
to be bound by theory, each avidin-like molecule (e.g., avidin, streptavidin, or neutravidin)
generally has four binding sites, so at most four molecules can be linked together.
For example, one biotinylated probe reagent can be linked, via an avidin-like molecule
(e.g., avidin, streptavidin or neutravidin), to three biotinylated nucleic acid labels,
or in any other combinations (e.g., two biotinylated probe reagents linked to two
biotinylated nucleic acid labels).
[0146] Biotinylation of a nucleic acid label (i.e., attaching a biotin to a nucleic acid
label) can occur at any location of the nucleic acid label. In some embodiments, the
nucleic acid label can by synthesized or modified with a terminal biotin, i.e., the
nucleic acid label can have a biotin at its 5' end and/or 3' end. In other embodiments,
the nucleic acid label can by synthesized or modified with an internal biotin, i.e.,
the nucleic acid label can have a biotin anywhere between its 5' and 3' ends, but
not at its 5' and/or 3' ends. Such internal biotinylation can leave at least one end
(e.g., both ends) of the nucleic acid label accessible, allowing the nucleic acid
label to be circularized after the nucleic acid label has bound, which can in turn,
for example, enable rolling circle amplification as described earlier. Chemical modification
of the nucleic acid label, e.g., to attach a terminal and/or an internal biotin to
the nucleic acid label after synthesis, is within one of skill in the art.
[0147] For some embodiments where the probe reagent is a nucleic acid, an example of using
binding pair conjugation is double-stranded nucleic acid conjugation. In this approach,
the first part to be linked is conjugated is with linked a first strand first strand
of the double-stranded nucleic acid and the second part to be linked is conjugated
with the second strand of the double-stranded nucleic acid. Nucleic acids can include,
without limitation, defined sequence segments and sequences comprising nucleotides,
ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides and
nucleotides comprising backbone modifications, branchpoints and nonnucleotide residues,
groups or bridges.
[0148] In some embodiments, the linker can be a linker molecule. Examples of linker molecules
can include, but are not limited to, a polymer, sugar, nucleic acid, peptide, protein,
hydrocarbon, lipid, polyethelyne glycol, crosslinker, or combination thereof.
[0149] Non-limiting examples of crosslinkers that can be used as linker molecules can include,
but are not limited to, amine-to-amine crosslinkers (e.g., but are not limited to
the ones based on NHS-ester and/or imidoester reactive groups), amine-to-sulfhydryl
crosslinkers, carboxyl-to-amine crosslinkers (e.g., but are not limited to, carbodiimide
crosslinking agents such as DCC, and/or EDC (EDAC); and/or N-hydroxysuccinimide (NHS)),
photoreactive crosslinkers (e.g., but not limited to, aryl azide, diazirine and any
art-recognized photo-reactive (light-activated) chemical crosslinking reagents), sulfhydryl-to-carbohydrate
crosslinkers (e.g., but are not limited to the ones based on malemide and/or hydrazide
reactive groups), sulfhydryl-to hydroxyl crosslinkers (e.g., but are not limited to
the ones based on maleimide and/or isocyanate reactive groups), sulfhydryl-to-sulfhydryl
crosslinkers (e.g., but are not limited to, maleimide and/or pyridyldithiol reactive
groups), sulfo-SMCC crosslinkers, sulfo-SBED biotin label transfer reagents, sulfhydryl-based
biotin label transfer reagents, photoreactive amino acids (e.g., but are not limited
to diazirine analogs of leucine and/or methionine), NHS-azide Staudinger ligation
reagents (e.g., but are not limited to, activated azido compounds), NHSphosphine Staudinger
ligation reagents (e.g., but are not limited to, activated phosphine compounds), and
any combinations thereof.
[0150] In some embodiments, any commercially available crosslinkers (e.g., but not limited
to the ones from Thermo Scientific or Piercenet, Rockford, IL) can be used as a linker
molecule herein.
[0151] In some embodiments, the term "linker" as used herein can be a physical substrate.
In some embodiments, the physical substrate is a particle. The particle can be of
any shape, e.g., spheres; rods; shells; beads, tubes, wires, and prisms; and these
particles can be part of a network.
[0152] The particles can be made of any materials. In some embodiments, the particle can
comprise a material selected from the group consisting of metal (e.g., gold, or iron),
metal oxides (e.g., iron oxide), plastic, glass, polymer (e.g., polystyrene), and
any combinations thereof.
[0153] For in vivo purposes, e.g., disease and/or pathogen diagnosis and/or targeted drug
delivery, the polymer can be biocompatible and/or biodegradable. The term "biocompatible
polymer" refers to polymers which, in the amounts employed, are non-toxic and substantially
non-immunogenic when used internally in the patient and which are substantially insoluble
in the body fluid of the mammal. Examples of non-biodegradable biocompatible polymers
include, by way of example, cellulose acetates (including cellulose diacetate), ethylene
vinyl alcohol copolymers, hydrogels (e.g., acrylics), polyacrylonitrile, polyvinylacetate,
cellulose acetate butyrate, nitrocellulose, copolymers of urethane/carbonate, copolymers
of styrene/maleic acid, and any combinations thereof. Biodegradable polymers are known
in the art, e.g., without limitations, linear-chain polymers such as polylactides,
polyglycolides, polycaprolactones, polyanhydrides, polyamides, polyurethanes, polyesteramides,
polyorthoesters, polydioxanones, polyacetals, polyketals, polycarbonates, polyorthocarbonates,
polyphosphazenes, polyhydroxybutyrates, polyhydroxyvalerates, polyalkylene oxalates,
polyalkylene succinates, poly(malic acid), poly(amino acids), polyvinylpyrrolidone,
polyethylene glycol, polyhydroxy cellulose, chitin, chitosa, and copolymers, terpolymers
and any combinations thereof. Other biodegradable polymers include, for example, fibrin,
gelatin, collagen, and any combinations thereof.
[0154] The particles can be of any size, provided that the particle size does not significantly
affect the diffusion property of the detection reagent. For example, the particle
size can range from 5 nm to 1 mm, from about 10 nm to about 500 µm, or from about
50 nm to about 250 µm. In some embodiments, a particle described herein is a nanoparticle
or a microparticle. As used herein, the term "nanoparticle" refers to particles that
are on the order of 10
-9 or one billionth of a meter and below 10
-6 or 1 millionth of a meter in size. The term "microparticle" as used herein refers
to particles that are on the order of 10
-6 or one millionth of a meter and below 10
-3 or 1 thousandth of a meter in size. In some embodiments, the particle can be selected
from a group consisting of a gold nanoparticle or microparticle, a paramagnetic nanoparticle
or microparticle, a magnetic nanoparticle or microparticle, a polystyrene nanoparticle
or microparticle, a nanotube or a microtube, a nanowire or a microwire, and any combinations
thereof.
[0155] The particles can be adapted to possess at least one additional property, depending
on various applications. In some embodiments, the particles can be adapted to be magnetic
responsive or paramagnetic-responsive, e.g., magnetic or paramagnetic particles. In
some embodiments, the particles can be adapted to be a delivery vehicle. For example,
in some embodiments, the particles can be encapsulated with a therapeutic agent, e.g.,
for targeted drug delivery to treat a disease or disorder.
[0156] In some embodiments, the particles can be modified. For example, the particles can
be conjugated with proteins, peptides, nucleic acids, or any combinations thereof.
In one embodiment, the particles can be surface-conjugated or coated with one member
of the binding pair as described above (e.g., for biotin-streptavidin interaction,
streptavidin-coated particles can be used). In some embodiments, the particles can
be surface-activated with functional groups (e.g., but not limited to, amine, carboxylic
acid, epoxy, tosyl, silane, and any combinations thereof), e.g., to provide binding
sites for probe reagents and/or nucleic acid labels. Methods for surface modifications
of particles, such as nanoparticles or microparticles, are well known in the art.
One of skill in the art can readily modify or activate the surface of particles using
any art-recognized reactions, e.g., covalently through crosslinkers, or through protein
interaction.
[0157] The particles described herein can be used in conjunction with the organic linker
described above, to form a conjugate linker, or the particles can be used alone as
a linker. Both the nucleic acid labels and the probe reagents can be coupled to the
particles using a multitude of methods. These include, but are not limited to, direct
covalent attachment such as using chemical crosslinkers based on chemistries such
as NHS, maleimide, tosyl, isocyanide, etc.; chemical linkage such as using EDC chemistry,
thiol adsorption to gold, vinyl/acrylate radical reaction, acrylate-based addition
(of e.g., thiols); and protein mediated couplings based on proteins such as streptavidin
(and its relatives such as avidin, neutravidin, etc.), protein A, and secondary antibodies,
and any combinations thereof.
[0158] The particles can act as hubs that facilitate a conjugation of multiple nucleic acid
labels to single or multiple probes. Depending on applications and/or properties of
nucleic acid labels and/or probe reagents, particles can be used as hubs for multi-conjugation.
For example, in some embodiments, by acting as a hub, the particles can allow multiple
nucleic acid labels to be present at each location (e.g., location of a target molecule
or analyte) where the probe binds. Accordingly, the signal generated from the detection
reagent can be amplified and thus greater than if only a single label was present.
This is especially desirable where antigens/targets or analytes are sparse in a sample.
[0159] In some embodiments, the particles can allow multiple probes to be arranged in proximity
to each other. Thus, the particles can allow several weaker binding events to combine
into strong binding. This "avidity action" can transform probe reagents with individually
weak affinities into effective sensors.
[0160] In some embodiments, by acting as a hub, the particles can allow each probe reagent
to conjugate to multiple nucleic acid labels. This capability can eliminate the need
for other amplification methods (e.g., rolling circle amplification) as multiple nucleic
acid labels corresponding to a probe reagent can be used as a form of signal amplification.
In some embodiments, this capability can also be used to separate the detection reagents
with one nucleic acid label from the ones with different nucleic acid labels, which
can, in turn, enable, for example, sequencing by single-base extension. Furthermore,
different nucleic acid labels can be conjugated to the particles at controlled ratios,
and the ratios can encode additional information. By way of example only, to capture
in situ information of one or more enzymes' behavior (e.g., relative enzyme concentration)
in the presence of an analyte, two or more different nucleic acid labels can be conjugated
to the particles, wherein a subpopulation of the nucleic acid labels corresponding
to the probe reagent is not cleavable, while other subpopulations of the nucleic acid
labels are each adapted to be cleavable in the presence of their respective enzymes.
In such embodiments, the cleavable nucleic acid labels can be conjugated to the particles
by cleavable peptide bonds specific for corresponding enzymes. By comparing the ratios
of signals generated from the various nucleic acid labels, one would be able to determine
the relative enzyme concentrations in the presence of an analyte.
[0161] The arrangement of the probe reagent(s) and/or nucleic acid label(s) on the particles
can vary with a number of factors, e.g., applications, properties of probe reagents
and/or nucleic acid labels, sample properties, and/or analytes of interests. In some
embodiments, the probe reagents and nucleic acid labels can be conjugated to the particle
directly (see, e.g.,
Fig. 4A). In some embodiments, one component can be linked to the particle through the other.
In such embodiments, the probe reagents can be conjugated or linked to the particle
through the nucleic acid labels (see, e.g.,
Fig. 4B), e.g., to allow the probe reagents being more accessible by the corresponding analytes
in a sample.
[0162] In some embodiments, the detection reagents can further comprise at least one substrate
linker conjugated to the particle. In such embodiment, the substrate linker can allow
the detection reagents to be immobilized to a solid support or substrate.
Detectable molecules or detectable labels
[0163] A detectable molecule or detectable label can be covalently attached to a decoder
probe or complementary nucleobase before or after the decoder probe or the complementary
nucleobase is attached to the pre-determined subsequences or hybridization sites of
a nucleic acid label. For example, in attaching a detectable label to a decoder probe,
the label can be covalently attached by incorporation of a nucleotide containing a
detectable label into the nucleic acid during its synthesis, but before it is hybridized
the pre-determined subsequence of the nucleic acid label. Alternatively, during the
synthesis of a decoder probe sequence, a nucleotide containing a detectable label
acceptor group can be included, and the detectable label can be added to the decoder
probe after its synthesis, either before or after it is hybridized to the predetermined
subsequences of the nucleic acid label. Alternatively, the detectable label can be
indirectly attached to the decoder probe, for example, by incorporating a nucleotide
containing a ligand-binding molecule (e.g., biotin) into the decoder probe during
synthesis, and by adding a ligand (e.g., streptavidin) that is covalently attached
to the detectable molecule, or vice versa.
[0164] In some embodiments, the ratios of a detectable label to a decoder probe can range
from about 1:1 to about 100:1, from 1:1 to about 50:1, from about 1:1 to about 25:1,
from about 1:1 to about 10:1, or from about 1:1 to about 5:1. When a decoder probe
comprises more than one detectable label, each detectable label can be attached to
a nucleotide of the decoder probe.
[0165] A detectable label or a detectable molecule can be attached to any nucleotide including
both natural and non-natural nucleotides. A nucleotide contains three parts, a phosphate
group, a pentose five-carbon sugar molecule, and an organic base. In RNA, the pentose
is ribose and in DNA it is deoxyribose and so nucleotides for incorporation into RNA
are called ribonucleotides and nucleotides for incorporation into DNA are called deoxyribonucleotides.
Three bases adenine, guanine, and cytosine are found in both DNA and RNA while thymine
is normally found only in DNA and uracil is normally found only in RNA. Nucleotides
can have one, two or three attached phosphate groups and are sometimes referred to
as nucleoside phosphates. Nucleotides can contain modified nucleosides having modified
bases (e.g., 5-methyl cytosine) and modified sugar groups (e.g., 2'O-methyl ribosyl,
2'O-methoxyethyl ribosyl, 2'fluoro ribosyl, 2'amino ribosyl, and the like). An example
of non-natural bases that are used in the art are isocytidine and isoguanine.
[0166] A detectable label or a detectable molecule as used herein is intended to mean an
individual measurable moiety, such as a radioisotope, fluorochrome, dye, enzyme (including
its effect on a substrate), nanoparticle, chemiluminescent marker, biotin, or other
moiety known in the art that is measurable by analytical methods. A detectable label
or a detectable molecule can be attached to a nucleotide using methods well known
in the art and exemplified herein.
[0167] Without limitations, examples of a detectable label or a detectable molecule that
can be utilized can include optical reporters or optical labels. Suitable optical
reporters or optical labels include, but are not limited to, fluorescent reporters
and chemiluminescent groups. A wide variety of fluorescent reporter dyes are known
in the art. Typically, the fluorophore is an aromatic or heteroaromatic compound and
can be a pyrene, anthracene, naphthalene, acridine, stilbene, indole, benzindole,
oxazole, thiazole, benzothiazole, cyanine, carbocyanine, salicylate, anthranilate,
coumarin, fluorescein, rhodamine or other like compound. Suitable fluorescent reporters
include xanthene dyes, such as fluorescein or rhodamine dyes, including, but not limited
to, Alexa Fluor
® dyes (InvitrogenCorp.; Carlsbad, Calif), fluorescein, fluorescein isothiocyanate
(FITC), Oregon GreenTM, rhodamine, Texas red, tetrarhodamine isothiocynate (TRITC),
5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE),
tetrachlorofluorescein (TET), 6-carboxyrhodamine (R6G), N,N,N,N'-tetramefhyl-6-carboxyrhodamine
(TAMRA), 6-carboxy-X-rhodamine (ROX). Suitable fluorescent reporters also include
the naphthylamine dyes that have an amino group in the alpha or beta position. For
example, naphthylamino compounds include 1-dimethylamino-naphthyl-5-sulfonate, 1-anilino-8-naphthalene
sulfonate, 2-p-toluidinyl-6-naphthalene sulfonate, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic
acid (EDANS). Other fluorescent reporter dyes include coumarins, such as 3-phenyl-7-isocyanatocoumarin;
acridines, such as 9-isothiocyanatoacridine and acridine orange; N-(p(2-benzoxazolyl)phenyl)maleimide;
cyanines, such as Cy2, indodicarbocyanine 3 (Cy3), indodicarbocyanine 5 (Cy5), indodicarbocyanine
5.5 (Cy5.5), 3-(-carboxy-pentyl)-3'ethyl-5,5'-dimethyloxacarbocyanine (CyA); 1H,5H,11H,
15H-Xantheno[2,3,4-ij:5,6,7-i'j']diquinolizin-18-ium, 9-[2(or 4)-[[[6-[2,5-dioxo-1-pyrrolidinyl)oxy]-6-oxohexyl]
amino]sulfonyl]-4(or 2)-sulfophenyl]-2,3,6,7,12,13,16,17octahydro-inner salt (TR or
Texas Red); BODIPYTM dyes; benzoxadiazoles; stilbenes; pyrenes; and the like. Many
suitable forms of these fluorescent compounds are available and can be used.
[0168] Examples of fluorescent proteins suitable for use as imaging agents include, but
are not limited to, green fluorescent protein, red fluorescent protein (e.g., DsRed),
yellow fluorescent protein, cyan fluorescent protein, blue fluorescent protein, and
variants thereof (see, e.g.,
U.S. Pat. Nos. 6,403, 374,
6,800,733, and
7,157,566). Specific examples of GFP variants include, but are not limited to, enhanced GFP
(EGFP), destabilized EGFP, the GFP variants described in
Doan et al, Mol. Microbiol, 55:1767-1781 (2005), the GFP variant described in
Crameri et al, Nat. Biotechnol., 14:315319 (1996), the cerulean fluorescent proteins described in
Rizzo et al, Nat. Biotechnol, 22:445 (2004) and
Tsien, Annu. Rev. Biochem., 67:509 (1998), and the yellow fluorescent protein described in
Nagal et al, Nat. Biotechnol., 20:87-90 (2002). DsRed variants are described in, e.g.,
Shaner et al, Nat. Biotechnol., 22:1567-1572 (2004), and include mStrawberry, mCherry, morange, mBanana, mHoneydew, and mTangerine.
Additional DsRed variants are described in, e.g.,
Wang et al, Proc. Natl. Acad. Sci. U.S.A., 101: 16745-16749 (2004) and include mRaspberry and mPlum. Further examples of DsRed variants include mRFPmars
described in
Fischer et al, FEBS Lett., 577:227-232 (2004) and mRFPruby described in
Fischer et al, FEBS Lett, 580:2495-2502 (2006).
[0169] Amine-reactive and thiol-reactive fluorophores are available and generally used for
labeling nucleotides and biomolecules. In some embodiments, nucleotides are fluorescently
labeled during chemical synthesis, for example, incorporation of amines or thiols
during nucleotide synthesis permit addition of fluorophores. Fluorescently labeled
nucleotides are commercially available. For example, uridine and deoxyuridine triphosphates
are available that are conjugated to ten different fluorophores that cover the spectrum.
[0170] In some embodiments, radioisotopes can be utilized as detectable molecules or detectable
molecules for labeling nucleotides including, for example,
32P,
33P,
35S,
3H, and
125I. These radioisotopes have different half-lives, types of decay, and levels of energy
which can be tailored to match the needs of a particular experiment. For example,
3H is a low energy emitter which results in low background levels, however this low
energy also results in long time periods for autoradiography. Radioactively labeled
ribonucleotides and deoxyribonucleotides are commercially available. Nucleotides are
available that are radioactively labeled at the first, or α, phosphate group, or the
third, or γ, phosphate group. For example, both [α-
32P]dATP and [y-
32P]dATP are commercially available. In addition, different specific activities for
radioactively labeled nucleotides are also available commercially and can be tailored
for different experiments.
[0171] Suitable non-metallic isotopes include, but are not limited to,
11C,
14C,
13N,
18F,
123I,
124I, and
125I. Suitable radioisotopes include, but are not limited to,
99mTc,
95Tc,
111In,
62Cu,
64Cu, Ga,
68Ga, and
153Gd. Suitable paramagnetic metal ions include, but are not limited to, Gd(III), Dy(III),
Fe(III), and Mn(II). Suitable X-ray absorbers include, but are not limited to, Re,
Sm, Ho, Lu, Pm, Y, Bi, Pd, Gd, La, Au, Au, Yb, Dy, Cu, Rh, Ag, and Ir. In some embodiments,
the radionuclide is bound to a chelating agent or chelating agent-linker attached
to the aggregate. Suitable radionuclides for direct conjugation include, without limitation,
18F,
124I,
125I,
131I, and mixtures thereof. Suitable radionuclides for use with a chelating agent include,
without limitation,
47Sc,
64Cu,
67Cu,
89Sr,
86Y,
87Y,
90Y,
105Rh,
111Ag,
111In,
117mSn,
149Pm,
153Sm,
166Ho,
177Lu,
186Re,
188Re,
211At,
212Bi, and mixtures thereof. Suitable chelating agents include, but are not limited to,
DOTA, BAD, TETA, DTPA, EDTA, NTA, HDTA, their phosphonate analogs, and mixtures thereof.
One of skill in the art will be familiar with methods for attaching radionuclides,
chelating agents, and chelating agent-linkers to the particles.
[0172] Non-radioactive and non-fluorescent label monomers are also available. For example,
biotin can be attached directly to nucleotides and detected by specific and high affinity
binding to avidin or streptavidin which has been chemically coupled to an enzyme catalyzing
a colorimetric reaction (such as phosphatase, luciferase, or peroxidase). Digoxigenin
labeled nucleotides can also similarly be used for non-isotopic detection of nucleic
acids. Biotinylated and digoxigenin-labeled nucleotides are commercially available.
[0173] In some embodiments, enzymatic reaction on a substrate can be utilized a detection
method. In such embodiments, enzymes (e.g., horseradish peroxidase or alkaline phosphatase)
can be linked to a nucleotide of a nucleic acid label and/or decoder probe. During
detection, a substrate on which the particular enzyme reacts can be added to induce
a colorimetric reaction. Any enzyme-substrate reactions known in the art can be used
herein.
[0174] Very small particles, termed nanoparticles, also can be used as detectable labels
or detectable molecules to label decoder probes or any nucleic acids. These particles
range from 1-1000 nm in size and include diverse chemical structures such as gold
and silver particles and quantum dots.
[0175] When irradiated with angled incident white light, silver or gold nanoparticles ranging
from 40-120 nm will scatter monochromatic light with high intensity. The wavelength
of the scattered light is dependent on the size of the particle. Four to five different
particles in close proximity will each scatter monochromatic light which when superimposed
will give a specific, unique color. Alternatively, the gold nanoparticles can be detected
or "developed" using a silver-based developer such that the tiny nanoparticle can
be detected easily, even with naked eyes. The particles are being manufactured by
companies such as Genicon Sciences. Derivatized silver or gold particles can be generally
attached to a broad array of molecular molecules including, proteins, antibodies,
small molecules, receptor ligands, and nucleic acids. For example, the surface of
the particle can be chemically derivatized to allow attachment to a nucleotide, which
can then be incorporated into a decoder probe.
[0176] Another type of nanoparticle that can be used as a detectable molecule or detectable
label are quantum dots. Quantum dots are fluorescing crystals 1-5 nm in diameter that
are excitable by a large range of wavelengths of light. These crystals emit light,
such as monochromatic light, with a wavelength dependent on their chemical composition
and size. Quantum dots such as CdSe, ZnSe, InP, or InAs possess unique optical properties.
[0177] Due to their very small size the quantum dots can be generally coupled into oligonucleotides
directly without affecting the solubility or use of the oligonucleotide. Thus, quantum
dots can be coupled to decoder probes as described herein. To synthesize a decoder
probe-quantum dot complex by conventional batch chemistry, both the decoder probe
and the quantum dot require at least a reactive group of different kinds that can
be reacted with each other. For example, if a decoder probe has an amino group and
a quantum dot has an aldehyde group, these groups can react to form a Schiff base.
A decoder probe can be derivatized to attach a single amino or other functional group
using chemistry well known in the art. When a quantum dot is derivatized, the quantum
dot can be covered with a chemical reagent which results in coating the entire surface
of the nanoparticle with several functional groups.
[0178] A detectable molecule or detectable label can be attached to a nucleotide of a decoder
probe or nucleic acid using a variety of methods well known in the art and described
herein. For example, the detectable molecule or detectable label can be directly attached
to the nucleotide in a 1:1 correspondence by incorporation of a radioactive phosphate
into the phosphate backbone of the nucleotide. Also, for example, a general method
for labeling phosphates with a fluorescent label that employs an imidazole derivative
prepared from a BODIPY FL hydrazide has been reported (
Wang and Giese, Anal. Chem. 65: 3518 (1993).
[0179] Depending on the labeling moiety used, it can be desirable to derivatize or chemically
modify a nucleotide in order to bind the label monomer. These methods and chemistries
are known in the art. In addition, a linker can be used to attach a detectable molecule
or detectable label to a nucleotide in a 1:1 correspondence. For example, a fluorescently
labeled nucleotide such as fluorescein-12-dUTP can have a fluorophore monomer attached
via a four-atom aminoalkynyl group to the dUTP molecule.
[0180] These nucleotides attached to detectable molecules or detectable labels can be incorporated
into a decoder probe or nucleic acid using several methods for labeling nucleic acids
well known in the art. For example, enzymes such as DNA or RNA polymerases, Taq polymerases,
terminal deoxynucleotidyl transferases, or reverse transcriptases can be used to incorporate
labeled nucleotides into decoder probes or nucleic acids.
[0181] Labeled nucleotides can be incorporated into decoder probe sequences or nucleic acids,
for example, by nick translation. In this procedure DNAse I is used to create single-strand
nicks in double stranded DNA and then the 5' to 3' exonuclease and 5' to 3' polymerase
actions of E. coli DNA polymerase I are used to remove stretches of single stranded
DNA starting at the nicks and replace them with new strands made by incorporation
of labeled nucleotides. Nick translation can utilize any labeled nucleotide including
radioactively labeled nucleotides and biotinylated or digoxigenin labeled nucleotides.
In a similar way T4 DNA polymerase can be used to incorporate labeled nucleotides.
In addition, labeled nucleotides can be incorporated into nucleic acids using the
polymerase chain reaction (PCR) and Taq polymerases. The degree of labeling can be
controlled by including one, or up to all four labeled nucleotides. In addition, the
degree of labeling can be controlled by increasing or decreasing the concentration
of the labeled nucleotide(s).
[0182] Other methods for labeling decoder probes or nucleic acids include generating single-stranded
cDNA from RNA by using a reverse transcriptase in the presence of labeled nucleotides.
In addition, DNA can be cloned into a vector with SP6 or T7 polymerase sites. Transcription
in the presence of SP6 or T7 RNA polymerase and labeled nucleotides results in a labeled
RNA transcript. The transcript can be labeled to different degrees by including one
or more labeled nucleotides. In addition, several nucleotides within a nucleic acid
can be labeled, for example, by cloning DNA into a bacteriophage M13 based vector.
Then the Klenow fragment of DNA polymerase I and the M13 universal probe primer can
be used to synthesize the complementary stand with incorporation of labeled nucleotides.
[0183] Several methods are described above for incorporation of labeled nucleotides into
newly synthesized decoder probes or nucleic acids. Existing nucleic acids can also
be labeled using several methods known in the art. For example, RNA or DNA can be
end-labeled with [y-32P]ATP and T4 polynucleotide kinase. This kinase can be used
to transfer the radioactive phosphate of ATP to a free 5' OH group in either DNA or
RNA. The enzyme also has a phosphatase activity and so two reactions are possible.
In the forward reaction, the enzyme catalyzes phosphorylation following removal of
5' terminal phosphates with alkaline phosphatase (or other phosphatase). In the exchange
reaction, the kinase catalyzes the exchange of an existing 5' phosphate with the third
or y phosphate of ATP. The latter reaction is carried out in the presence of excess
ATP and ADP for efficient phosphorylation. Using this method the radioactive phosphate
of ATP is transferred to the end of the nucleic acid molecule.
[0184] Decoder probes or nucleic acids can also be labeled with terminal deoxynucleotidyl
transferase which adds labeled nucleotides onto the 3' end of DNA fragments. Both
single and double-stranded DNAs are substrates for this enzyme. The large (Klenow)
fragment of E. coli DNA polymerase I can also be used to label the ends of decoder
probes or nucleic acids. Since this enzyme has a 5' to 3' polymerase activity it can
be used to "fill in" the 3' ends of nucleic acid (e.g., DNA) fragments opposite of
5' extensions or overhangs with labeled nucleotides. End-labeling of decoder probes
or nucleic acids using polynucleotide kinase or terminal deoxynucleotidyl transferase
results in the incorporation of one detectable label or detectable molecule per nucleic
acid. The "fill in" reaction can be used to label the decoder probe or nucleic acid
at one nucleotide per nucleic acid or at more than one nucleotide per nucleic acid.
[0185] In addition, decoder probes or nucleic acids can be labeled by modification of nucleotides
within the nucleic acid sequences. For example, cytidine residues in DNA and RNA can
be modified by reaction with sodium bisulfite to form sulfonate intermediates that
can then be directly coupled to hydrazides or aliphatic amines. Virtually any of the
fluorescent, biotin or other hydrazides or aliphatic amines can be used in this reaction.
The bisulfite-activated cytidylic acid can also be coupled to aliphatic diamines such
as ethylenediamine. The amine-modified nucleic acids (e.g., DNA or RNA) can then be
modified with any of the amine-reactive dyes. In addition, phosphate groups can be
targeted in nucleic acids for labeling. Although phosphate groups of nucleotides are
not very reactive in aqueous solution, their terminal phosphate groups can react with
carbodiimides and similar reagents in combination with nucleophiles to yield labeled
phsophodiesters, phosphoramidates and phosphorothioates. For example, nucleic acids
(e.g., DNA) can be reacted quantitatively with carbonyl diimidazole and a diamine
such as ethylenediamine to yield a phosphoramidate that has a free primary amine and
that this amine can then be modified with amino-reactive reagents. Fluorescent or
biotinylated amines have been coupled to the 5' phosphate of tRNA using dithiodipyridine
and triphenylphosphine.
[0186] The bond between detectable molecules or detectable labels and decoder probes or
nucleic acids can be covalent bonds or non-covalent bonds that are stable to hybridization.
The detectable molecules or detectable labels can be bound to a decoder probe or a
nucleic acid in a sequence specific manner, for example by the incorporation of a
labeled nucleotide into a sequence that has been digested by a restriction enzyme.
Alternatively the detectable molecules or detectable labels can be bound to a decoder
probe or a nucleic acid in a non-sequence specific manner, for example by the incorporation
of a label onto the terminal phosphate of a nucleic acid using [γ-
32P]ATP and T4 polynucleotide kinase.
Synthesis of nucleic acids (e.g., for at least part of the nucleic acid label such
as pre-determined subsequences and/or decoder probe sequences
[0187] The nucleic acids described herein can be chemically synthesized using naturally
occurring nucleotides or variously modified nucleotides designed to increase the biological
stability of the molecules or to increase the physical stability of the duplex formed
between the label attachment region and the annealed complementary polynucleotide
sequences or segments, e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be used. Examples of modified nucleotides which can be used to generate
the synthetic nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine,
N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic
acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N2-carboxypropyl)uracil,
(acp3)w, and 2,6-diaminopurine.
[0188] Alternatively, the synthetic nucleic acid can be produced biologically using a vector
into which a nucleic acid has been subcloned. As one example, a linear single-stranded
DNA backbone can be made from a double stranded plasmid DNA using a four step protocol
that includes (i) linearization of the dsDNA with a restriction enzyme, (ii) dephosphorylation
with a thermolabile phosphatase, (iii) digestion with a second restriction enzyme
to separate the cloning vector from the backbone sequence, and (iv) digestion with
a strand-specific lambda exonuclease digestion, leaving only one strand of the backbone
fragment intact.
[0189] In various embodiments, the nucleic acids can be modified at the base moiety, sugar
moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility
of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids
can be modified to generate peptide nucleic acids (see
Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 40:5-23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid
mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced
by a pseudopeptide backbone and only the four natural nucleobases are retained. The
neutral backbone of PNAs has been shown to allow for specific hybridization to DNA
and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can
be performed using standard solid phase peptide synthesis protocols as described in
Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 4(1): 5-23;
Perry-O'Keefe et al., 1996, Proc. Natl. Acad. Sci. USA 93: 14670-675.
[0190] In an exemplary embodiment, the selected novel nucleic acid sequence (e.g., DNA sequence)
can be constructed synthetically as double-stranded nucleic acid by a commercial gene
synthesis company and cloned in an oriented fashion into a "phagemid", a plasmid vector
containing an M13 or f1 phage intergenic (IG) region which contains the cis-acting
sequences necessary for nucleic acid (e.g., DNA) replication and phage encapsidation,
such as pUC119. The appropriate orientation of the cloned insert relative to the phage
origin of replication allows for the generation of a single-stranded DNA backbone
which is the reverse complement of the RNA molecules generated by in vitro transcription
for each label attachment region.
[0191] In order to generate the single-stranded nucleic acid (e.g., DNA) backbone (e.g.,
of at least part of the nucleic acid label and/or decoder probes), the phagemid is
transformed into an E. coli strain containing an F' episome. Subsequent infection
of the transformed bacteria with a helper phage such as the M113 mutant K07 results
in the secretion of the phagemid carrying the single-stranded nucleic acid sequence,
packaged phage from which the circular, single-stranded nucleic acid is prepared using
a standard protocol. This nucleic acid is linearized and the vector portion is excised
by annealing short, complementary oligonucleotides to either end of the single-strander
nucleic acid sequence to generate double-stranded restriction sites, followed by treatment
with the appropriate restriction enzymes.
Analytes or target molecules
[0192] The terms "analyte," "target analyte," and "target molecule", as used interchangeably
herein, refer to the molecule detected, identified or measured by binding of a detection
reagent described herein whose probe reagent(s) recognize (i.e., are specific binding
partners) thereto. In some embodiments, a target molecule or an analyte can be, but
is not limited to, any of the following or any combinations of the following: nucleic
acid, peptide, a polypeptide/protein (e.g., a bacterial or viral protein or an antibody),
a lipid, a carbohydrate, a glycoprotein, a glycolipid, a small molecule, an organic
monomer, sugar, peptidoglycan, a cell, a virus or a drug. Nucleic acids that can be
analyzed by the methods herein include: double-stranded DNA, single-stranded DNA,
single-stranded DNA hairpins, DNA/RNA hybrids, RNA (e.g. mRNA or miRNA) and RNA hairpins.
Generally, a target molecule can be a naturally occurring molecule or a cDNA of a
naturally occurring molecule or the complement of said cDNA. In other embodiments,
a target molecule can be modified, e.g., by mutation or chemical reaction. In some
embodiments, a target molecule can be synthetic or recombinant.
[0193] In some embodiments, an analyte can be an analyte comprising at least one post-translational
modification, e.g., phosphorylations and/or glycosylations.
[0194] A target molecule or an analyte can be part of a sample that contains other components
or can be the sole or major component of the sample. A target molecule or an analyte
can be a component of a whole cell, tissue or body fluid, a cell or tissue extract,
a fractionated lysate thereof or a substantially purified molecule. The target molecule
can be present in solution or attached to a solid substrate, including, for example,
to a solid surface such as a chip, microarray, bead or a blotting membrane. Also the
target molecule or analyte can have either a known or unknown structure or sequence.
Sample
[0195] The methods, detection reagents and kits described herein can be used to analyze
a sample from any sources, e.g., but not limited to biological samples (e.g., collected
from organisms, animals or subjects), environmental samples, food, food byproduct,
soil, archaeological samples, extraterrestrial samples, or any combinations thereof.
[0196] In some embodiments, the term "sample" refers to a biological sample. The term "biological
sample" as used herein denotes a sample taken or isolated from a biological organism,
e.g., tissue cell culture supernatant, cell lysate, a tissue sample (e.g., biopsy),
a homogenate of a tissue sample from a subject or a fluid sample from a subject. Exemplary
biological samples include, but are not limited to, blood, sputum, urine, cerebrospinal
fluid, urine, sweat, mucus, nasal discharge, vaginal fluids, spinal fluid, pleural
fluid, nipple aspirates, lymph fluid, the external sections of the skin, respiratory,
intestinal, and genitourinary tracts, tears, saliva, milk, feces, sperm, cells or
cell cultures, serum, leukocyte fractions, smears, tissue samples of all kinds, plants
and parts of plants, microorganisms (such as bacteria), viruses (such as cytomegalo
virus, HIV, hepatitis B, hepatitis C, hepatitis δ virus), yeasts, embryos, fungi,
cell-free sample material, etc. The term also includes both a mixture of the above-mentioned
samples such as fungus-infected plants or whole human blood containing mycobacteria
as well as food samples that contain free or bound nucleic acids, or proteins, or
cells containing nucleic acids or proteins, environmental samples which contain free
or bound nucleic acids, or proteins, or cells containing nucleic acids or proteins.
The term "biological sample" also includes untreated or pretreated (or pre-processed)
biological samples.
[0197] A "biological sample" can contain cells from subject, but the term can also refer
to non-cellular biological material, such as non-cellular fractions of blood, saliva,
or urine, that can be used to measure gene expression levels. In some embodiments,
the sample is from a resection, bronchoscopic biopsy, or core needle biopsy of a primary
or metastatic tumor, or a cell block from pleural fluid. In addition, fine needle
aspirate samples can be used. Samples can be either paraffin-embedded or frozen tissue.
In some embodiments, a biological sample can comprise a biopsy, a surgically removed
tissue, a swap, or any combinations thereof.
[0198] The sample can be obtained by removing a sample of cells from a subject, but can
also be accomplished by using previously isolated cells (e.g. isolated by another
person). In addition, the biological sample can be freshly collected or a previously
collected sample. Furthermore, the biological sample can be utilized for the detection
of the presence and/or quantitative level of a biomolecule of interest. Representative
target analytes include, but are not limited to nucleic acids, proteins, and derivatives
and fragments thereof.
[0199] In some embodiments, the biological sample is an untreated biological sample. As
used herein, the phrase "untreated biological sample" refers to a biological sample
that has not had any prior sample pre-treatment except for dilution and/or suspension
in a solution. Exemplary methods for treating a biological sample include, but are
not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing
and thawing, and any combinations thereof.
[0200] In accordance with some embodiments, a biological sample can be pre-processed, as
described earlier, before employing the detection reagents and the methods described
herein. In some embodiments, the biological sample can be filtered before isolating
a cellular material according to the methods, apparatus and kits described herein.
[0201] In some embodiments, the biological sample can be treated with a chemical and/or
biological reagent. Chemical and/or biological reagents can be employed to protect
and/or maintain the stability of the sample or target analytes during processing.
In addition, or alternatively, chemical and/or biological reagents can be employed
to release or expose target analytes from other components of the sample. One exemplary
reagent is a protease inhibitor, which is generally used to protect or maintain the
stability of the target analytes during processing.
[0202] In some embodiments, the term "sample" as used herein can refer to an environmental
sample (including, but not limited to, air, agricultural (e.g., but not limited to
hydrofarms or hydroponic samples), pond, water, wastewater, and soil samples); biological
warfare agent samples; research samples including extracellular fluids. In some embodiments,
an environmental sample can comprise a sample collected from a working surface of
an equipment or machine (e.g., but not limited to, food or pharmaceutical product
processing equipment or machine), a device (e.g., but not limited to, biomedical devices,
implantation devices, fluid delivery devices such as a tubing, and/or a catheter),
and/or a building or dwellings (e.g., but not limited to, food processing plants,
pharmaceutical manufacturing plants, hospitals, and/or clinics).
[0203] In some embodiments, a sample can comprise food (e.g., solid and/or fluid food as
well as processed food) and/or food byproduct. For example, the methods, detection
reagents and kits described herein can be used to detect an analyte, e.g., a particular
nutrient, in food and/or food byproduct, e.g., but not limited to, meat, milk, yoghurt,
bread, starch-based products, vegetables, and any combinations thereof. In some embodiments,
the methods, detection reagents and kits described herein can be used to detect a
contaminant, e.g., bacteria, fungus, spores, molds, and/or viruses, in food and/or
food byproduct.
[0204] In some embodiments, a sample can comprise a pharmaceutical product (e.g., but not
limited to pills, tablets, gel capsules, syrups, vaccines, liquids, sprays, and any
combinations thereof). For example, the methods, detection reagents and kits described
herein can be used to detect the presence and/or measure the level of a particular
active agent present in a pharmaceutical product. In some embodiments, the methods,
detection reagents and kits described herein can be used to detect a contaminant,
e.g., bacteria, fungus, spores, molds, and/or viruses, in a pharmaceutical product.
[0205] In some embodiments, a sample can comprise an archaeological sample. In some embodiments,
an archaeological sample can be obtained or collected from artifacts, architecture,
biofacts (or ecofact, e.g., an object found at an archaeological site), cultural landscapes,
and any combinations thereof.
[0206] In some embodiments, a sample can comprise an extraterrestrial sample. For example,
an extraterrestrial sample can be any object or specimen (e.g., rock, meteorite, and/or
environmental samples) obtained or collected from outer space or universe, and/or
planets beyond the planet Earth, e.g., the moon, other planets (e.g., but not limited
to, Mars, and/or Jupiter) and/or non-stellar objects.
Applications of the detection reagents
[0207] The detection reagents, compositions, methods and kits described herein can be used
for diagnostic, prognostic therapeutic and screening purposes. They provide the advantage
that many different target analytes can be analyzed at one time from a single sample
using the methods described herein. This allows, for example, for several diagnostic
tests to be performed on one sample.
[0208] When the probe reagent is a nucleic acid, the methods described herein can discriminate
between nucleotide sequences. The difference between the target nucleotide sequences
can be, for example, a single nucleic acid base difference, a nucleic acid deletion,
a nucleic acid insertion, or rearrangement. Such sequence differences involving more
than one base can also be detected. In some embodiments, the oligonucleotide probe
sets have substantially the same length so that they hybridize to target nucleotide
sequences at substantially similar hybridization conditions. As a result, the process
described herein is able to detect various kinds of diseases or disorders, e.g., but
not limited to, infectious diseases, genetic diseases, and cancer.
[0209] Without wishing to be bound, the detection reagents, compositions, methods and kits
described herein can also be used for environmental monitoring, forensics, and food
science. Examples of genetic analyses that can be performed on nucleic acids include
e.g., SNP detection, STR detection, RNA expression analysis, promoter methylation,
gene expression, virus detection, viral subtyping and drug resistance.
[0210] In the area of environmental monitoring, some embodiments can be used for detection,
identification, and monitoring of pathogenic and indigenous microorganisms in natural
and engineered ecosystems and microcosms such as in municipal waste water purification
systems and water reservoirs or in polluted areas undergoing bioremediation. It can
also be used to detect plasmids containing genes that can metabolize xenobiotics,
to monitor specific target microorganisms in population dynamic studies, or either
to detect, identify, or monitor genetically modified microorganisms in the environment
and in industrial plants.
[0211] Some embodiments can also be used in a variety of forensic areas, including for human
identification for military personnel and criminal investigation, paternity testing
and family relation analysis, HLA compatibility typing, and screening blood, sperm,
or transplantation organs for contamination.
[0212] In the food and feed industry, some embodiments have a wide variety of applications.
For example, it can be used for identification and characterization of production
organisms such as yeast for production of beer, wine, cheese, yogurt, bread, etc.
Another area of use is related to the quality control and certification of products
and processes (e.g., livestock, pasteurization, and meat processing) for contaminants.
Other uses include the characterization of plants, bulbs, and seeds for breeding purposes,
identification of the presence of plant-specific pathogens, and detection and identification
of veterinary infections.
[0213] In some embodiments, the methods, detection reagents and kits described herein can
be used to detect the presence and/or measure the level of a particular active agent
present in a pharmaceutical product. In some embodiments, the methods, detection reagents
and kits described herein can be used to detect a contaminant, e.g., bacteria, fungus,
spores, molds, and/or viruses, in a pharmaceutical product.
[0214] In some embodiments, the methods, detection reagents and kits described herein can
be used to detect the presence and/or measure the level of an analyte of interest
present in an archaeological sample, e.g., obtained or collected from artifacts, architecture,
biofacts (or ecofact, e.g., an object found at an archaeological site), cultural landscapes,
and any combinations thereof.
[0215] In some embodiments, the methods, detection reagents and kits described herein can
be used to detect the presence and/or measure the level of an analyte of interest
present in an extraterrestrial sample, e.g., any object or specimen (e.g., rock, meteorite,
and/or environmental samples) obtained or collected from outer space or universe,
and/or planets beyond the planet Earth, e.g., the moon, other planets (e.g., but not
limited to, Mars, and/or Jupiter) and/or non-stellar objects. For example, the methods,
detection reagents, and kits described herein can be used to analyze the composition
of an extratrerresterial sample or specimen, e.g., a rock specimen, a water sample,
and/or an air sample.
[0216] In some embodiments, the detection reagents and methods described herein can be used
to detect and/or identify analytes comprising a post-translation modification, e.g.,
phosphorylation or glycosylation. As such, in some embodiments, the detection reagents
and methods described herein can differentiate between multiple different glycosylation
forms of recombinant therapeutic proteins
[0217] Immunohistochemistry: Some embodiments can be used to perform antibody-based staining of cell or tissues
for microscopic evaluation. This can involve either unfixed or unpermeabilized samples
examined for surface or extracellular antigens, or permeabilized samples wherein intracellular
antigens are also probed. While very common, immunohistochemistry is typically limited
to probing with a small set of antibodies at a time (due to the limitation of available
optical colors), and multiple staining cycles are generally avoided, since the stripping
of the preceding cycle's antibodies can damage the sample. Some embodiments of the
detection reagents comprising antibodies as probe reagents and nucleic acid labels
can allow for many antibodies to be used concurrently, which saves time and sample
material, extract more data, and demand less prior knowledge of the sample. In some
embodiments, without wishing to be bound by theory, when a subset of the probed antigens
can overlap spatially, the detection reagents with a plurality of contiguous pre-determined
subsequences (e.g., each pre-determined subsequences contain one nucleotide, as shown
in
Fig. 1) can be used.
[0218] In-situ hybridization: Fluorescence in-situ hybridization (FISH) is a technique for detecting (and/or quantifying)
the presence of certain cellular DNA or RNA (often ribosomal RNA). As with other fluorescence-based
techniques, FISH is limited to the number of colors available to the microscopy. Using
some embodiments of the detection reagents and/or methods described herein, the cells
can be probed for many sequences simultaneously, thus allowing the user to save time
and sample material, extract more data, and demand less prior knowledge of the sample.
[0219] Expression profiling: Nucleic-acid probe reagents of the detection reagents can target messenger RNA or
micro RNA and provide information on the RNA-level expression state of the cell. Using
some embodiments of the detection reagents and/or methods described herein, the assay
can capture and probe numerous mRNA and/or miRNA at once, reducing and/or eliminating
potentially harmful stripping steps.
[0220] Western blots: Western blots are protein assays wherein proteins are separated electrophoretically,
transferred to a membrane and stained. In many cases, the staining is done using one
or a few antibodies in order to detect the corresponding antigens in the blot. By
using some embodiments of the detection reagents and/or methods described herein,
the blot can be simultaneously probed using a large number of antibodies without antibody-stripping
steps. This can allow one blot to provide significantly more information than the
conventional Western blots where one antibody is usually probed at a time and can
require antibody stripping for the next antibody probing, thereby saving sample material
and time.
[0221] Diagnostic/Prognostic Methods: The present methods can be applied to the analysis of biological samples obtained
or derived from a patient so as to determine whether a diseased cell type is present
in the sample and/or to stage the disease.
[0222] In some embodiments, the methods described herein are used in the diagnosis of a
condition. As used herein the term "diagnose" or "diagnosis" of a condition includes
predicting or diagnosing the condition, determining predisposition to the condition,
monitoring treatment of the condition, diagnosing a therapeutic response of the disease,
and prognosis of the condition, condition progression, and response to particular
treatment of the condition. For example, a blood sample can be assayed according to
any of the methods described herein to determine the presence and/or quantity of markers
of a cancerous cell type in the sample, thereby diagnosing or staging the cancer.
[0223] In some embodiments, the detection reagents and methods described herein can be directly
used as contrast agents for in vivo or in situ diagnosis, in which detection reagents
are administered to a subject, either by oral administration or local injection. The
probe reagents of the detection reagents can bind to the target analytes, e.g., biomarkers
for specific diseases or disorders, and detection of the nucleic acid labels using
the methods described herein can then locate the target analytes. In some embodiments,
the detection reagents and methods described herein can be used to locate microscopic
tumors in a subject, where other conventional methods are not sensitive enough to
detect such microscopic tumors.
[0224] Cancers which can be detected by some embodiments of the process described herein
generally involve oncogenes, tumor suppressor genes, or genes involved in DNA amplification,
replication, recombination, or repair. Examples of these include: BRCA1 gene, p53
gene, APC gene, Her2/Neu amplification, Bcr/Ab1, K-ras gene, and human papillomavirus
Types 16 and 18. Some embodiments can be used to identify amplifications, large deletions
as well as point mutations and small deletions/insertions of the above genes in the
following common human cancers: leukemia, colon cancer, breast cancer, lung cancer,
prostate cancer, brain tumors, central nervous system tumors, bladder tumors, melanomas,
liver cancer, osteosarcoma and other bone cancers, testicular and ovarian carcinomas,
head and neck tumors, and cervical neoplasms.
[0225] Genetic diseases can also be detected by some embodiments of the process described
herein. This can be carried out by prenatal or post-natal screening for chromosomal
and genetic aberrations or for genetic diseases. Examples of detectable genetic diseases
include: 21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome, Turner Syndrome,
Duchenne Muscular Dystrophy, Down Syndrome or other trisomies, heart disease, single
gene diseases, HLA typing, phenylketonuria, sickle cell anemia, Tay-Sachs Disease,
thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune diseases, lipidosis,
obesity defects, hemophilia, inborn errors of metabolism, and diabetes.
[0226] Alternatively, the methods described herein can be used to diagnose pathogen infections,
for example infections by intracellular bacteria and viruses, by determining the presence
and/or quantity of markers of bacterium or virus, respectively, in the sample.
[0227] A wide variety of infectious diseases can be detected by some embodiments of the
process described herein. Typically, these are caused by bacterial, viral, parasite,
and fungal infectious agents. The resistance of various infectious agents to drugs
can also be determined using some embodiments described herein.
[0228] Bacterial infectious agents which can be detected by some embodiments can include
Escherichia coli, Salmonella, Shigella, Klebsiella, Pseudomonas, Listeria monocytogenes,
Mycobacterium tuberculosis, Mycobacterium aviumintracellulare, Yersinia, Francisella,
Pasteurella, Brucella, Clostridia, Bordetella pertussis, Bacteroides, Staphylococcus
aureus, Streptococcus pneumonia, B-Hemolytic strep., Corynebacteria, Legionella, Mycoplasma,
Ureaplasma, Chlamydia, Neisseria gonorrhea, Neisseria meningitides, Hemophilus influenza,
Enterococcus faecalis, Proteus vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema
palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial pathogens, Nocardia,
and Acitnomycetes.
[0229] Fungal infectious agents which can be detected by some embodiments can include Cryptococcus
neoformans, Blastomyces dermatitidis, Histoplasma capsulatum, Coccidioides immitis,
Paracoccidioides brasiliensis, Candida albicans, Aspergillus fumigautus, Phycomycetes
(Rhizopus), Sporothrix schenckii, Chromomycosis, and Maduromycosis.
[0230] Viral infectious agents which can be detected by some embodiments can include human
immunodeficiency virus, human T-cell lymphocytotrophic virus, hepatitis viruses (e.g.,
Hepatitis B Virus and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human
papillomaviruses, orthomyxo viruses, paramyxo viruses, adenoviruses, corona viruses,
rhabdo viruses, polio viruses, toga viruses, bunya viruses, arena viruses, rubella
viruses, and reo viruses.
[0231] Parasitic agents which can be detected by some embodiments can include Plasmodium
falciparum, Plasmodium malaria, Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus,
Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba histolytica, Cryptosporidum,
Giardia spp., Trichimonas spp., Balatidium coli, Wuchereria bancrofti, Toxoplasma
spp., Enterobius vermicularis, Ascaris lumbricoides, Trichuris trichiura, Dracunculus
medinesis, trematodes, Diphyllobothrium latum, Taenia spp., Pneumocystis carinii,
and Necator americanis.
[0232] In some embodiments, contacting a biological sample with the detection reagents described
herein immune-staining, in-situ hybridization or a combination, can be used for the
purpose of detecting and identifying pathogens in biological samples. In such embodiments,
for example, surface or intracellular antigens, DNA, ribosomal RNA and/or messenger
RNA can be detected with some embodiments of the detection reagents and methods described
herein. Detection reagents and methods described herein can be especially useful in
this context since a) which pathogen may be in the sample is not known in advance,
and b) each pathogen cell should respond to one or few of the probes, facilitating
the detection reagent and nucleic acid label design.
[0233] Some embodiments can also be used for detection of drug resistance by infectious
agents. For example, vancomycin-resistant Enterococcus faecium, methicillin-resistant
Staphylococcus aureus, penicillin-resistant Streptococcus pneumoniae, multi-drug resistant
Mycobacterium tuberculosis, and AZT-resistant human immunodeficiency virus can all
be identified with some embodiments described herein.
[0234] Thus, the target molecules detected using the compositions and methods described
herein can be either patient markers (such as a cancer marker) or markers of infection
with a foreign agent, such as bacterial or viral markers.
[0235] Because of the quantitative nature of detection reagents, the compositions and methods
described herein can be used to quantitate target molecules whose abundance is indicative
of a biological state or disease condition, for example, blood markers that are upregulated
or downregulated as a result of a disease state.
[0236] In addition, the compositions and methods described herein can be used to provide
prognostic information that assists in determining a course of treatment for a patient.
For example, the amount of a particular marker for a tumor can be accurately quantified
from even a small sample from a patient. For certain diseases like breast cancer,
overexpression of certain genes, such as Her2-neu, indicate a more aggressive course
of treatment will be needed.
[0237] In some embodiments, the compositions and methods described herein can be administered
to a subject for in vivo diagnosis and/or monitoring of a disease or disorder. Specific
devices or methods known in the art for the in vivo detection of fluorescence, e.g.,
from fluorophores or fluorescent proteins, include, but are not limited to, in vivo
near-infrared fluorescence (see, e.g.,
Frangioni, Curr. Opin. Chem. Biol, 7:626-634 (2003)), the MaestroTM in vivo fluorescence imaging system (Cambridge Research & Instrumentation,
Inc.; Woburn, Mass.), in vivo fluorescence imaging using a flying-spot scanner (see,
e.g.,
Ramanujam et al, IEEE Transactions on Biomedical Engineering, 48:1034-1041 (2001), and the like. Other methods or devices for detecting an optical response include,
without limitation, visual inspection, CCD cameras, video cameras, photographic film,
laser-scanning devices, fluorometers, photodiodes, quantum counters, epifluorescence
microscopes, scanning microscopes, flow cytometers, fluorescence microplate readers,
or signal amplification using photomultiplier tubes.
[0238] Any device or method known in the art for detecting the radioactive emissions of
radionuclides in a subject is suitable for use as described herein. For example, methods
such as Single Photon Emission Computerized Tomography (SPECT), which detects the
radiation from a single photon gamma-emitting radionuclide using a rotating gamma
camera, and radionuclide scintigraphy, which obtains an image or series of sequential
images of the distribution of a radionuclide in tissues, organs, or body systems using
a scintillation gamma camera, may be used for detecting the radiation emitted from
a radiolabeled aggregate. Positron emission tomography (PET) is another suitable technique
for detecting radiation in a subject.
[0239] Analysis of Pathology Samples: RNA extracted from formaldehyde- or paraformaldehyde-fixed paraffin-embedded tissue
samples is typically poor in quality (fragmented) and low in yield. This makes gene
expression analysis of low-expressing genes in histology samples or archival pathology
tissues extremely difficult and often completely infeasible. The detection reagents
and methods described herein can fill this unmet need by allowing the analysis of
very small quantities of low-quality total RNA.
[0240] To use detection reagents in such an application, total RNA can be extracted from
formaldehyde- or paraformaldehyde-fixed paraffin-embedded tissue samples (or similar)
using commercially available kits such as RecoverAll Total Nucleic Acid Isolation
Kit (Ambion) following manufacturer's protocols. RNA in such samples is frequently
degraded to small fragments (200 to 500 nucleotides in length), and many paraffin-embedded
histology samples only yield tens of nanograms of total RNA. Small amounts (5 to 100
ng) of this fragmented total RNA can be used directly as target analyte upon contact
with the detection reagents described herein, using the methods described herein described
herein.
[0241] Screening Methods: The methods described herein can be used, among other things, for determining the
effect of a perturbation, including chemical compounds, mutations, temperature changes,
growth hormones, growth factors, disease, or a change in culture conditions, on various
target molecules, thereby identifying target molecules whose presence, absence or
levels are indicative of particular biological states. In one embodiment, some examples
described herein can be used to elucidate and discover components and pathways of
disease states. For example, the comparison of quantities of target molecules present
in a disease tissue with "normal" tissue allows the elucidation of important target
molecules involved in the disease, thereby identifying targets for the discovery/screening
of new drug candidates that can be used to treat disease.
[0242] Targeted Delivery Vehicles: In some embodiments, the therapeutic and/or diagnostic agent can be encapsulated
within the particles that provide conjugation sites for the probe reagents and nucleic
acid labels. In such embodiments, the detection reagents and methods described herein
can be used to deliver a therapeutic and/or diagnostic agent to cells where the probe
reagents of the detection reagents bind. Nucleic acid labels of the detection reagents
can be detected to monitor the location of drug administration.
[0243] Cell Lineage Tracking: In some embodiments, the detection reagents described herein can be used to track
cell lineage, e.g., in culture or in vivo. For example, the probe reagents of the
detection reagents can bind to live cells of interest, allowing labeling and/or tracking
of individual cell differentiation. Examples of such application include, but are
not limited to, lineage tracking in stem cell differentiation, and lineage determination
of dendritic cells and/or white blood cells. In some embodiments, these cells after
lineage determination can be further used accordingly.
Kits comprising detection reagents
[0244] Kits for various assays are disclosed herein, but not part of the invention. In some
embodiments, a kit can comprise: (a) a plurality of nucleic acid labels of the detection
reagents described herein; and (b) at least one coupling reagent required to conjugate
the nucleic acid labels to probe reagents of interest. In such embodiments, users
can attach the provided nucleic acid labels to their probe reagents of interest to
form their own detection reagents described herein. Examples of the coupling reagent
required for nucleic acid label-probe reagent conjugation can include any reagents
that are generally used to perform any of the conjugation methods described herein,
e.g., biotin and avidin-like molecules such as streptavidin or neutravidin. However,
in alternative embodiments, the kit can comprise a plurality of the detection reagents
described herein that are ready for use and thus no nucleic acid label-probe reagent
conjugation steps are required to be performed by users prior to use.
[0245] In some embodiments, the kit can further comprise at least one reagent, e.g., used
in a readout method described herein. For example, if the readout method is sequencing-based,
the kit can further comprise at least one agent used in sequencing-based readout.
Alternatively, if the readout method is hybridization-based, the kit can further comprise
at least one set of decoder probes complementary to at least a portion of subsequences
of the detection reagents, wherein each subpopulation of the decoder probes comprises
a different detectable label, each different detectable label producing a different
signal signature.
[0246] Accordingly, in some embodiments, a kit for hybridization-based readout can comprise:
(a) a plurality of nucleic acid labels of the detection reagents described herein;
(b) at least one reagent required to conjugate the nucleic acid labels to probe reagents
of interest; and (c) at least one set of decoder probes complementary to at least
a portion of subsequences of the detection reagents, wherein each subpopulation of
the decoder probes comprises a different detectable label, each different detectable
label producing a different signal signature. In some embodiments, the kit can further
comprise at least one reagent, e.g., used in the readout method.
[0247] In alternative embodiments, a kit for hybridization-based readout can comprise: (a)
a plurality of the detection reagents described herein; (b) at least one set of decoder
probes complementary to at least a portion of subsequences of the detection reagents,
wherein each subpopulation of the decoder probes comprises a different detectable
label, each different detectable label producing a different signal signature; and
(c) at least one reagent.
[0248] In any embodiments of the kit described herein, the plurality of the detection reagents
can include one or more different kinds of the detection reagents. In some embodiments,
it is desirable to provide different kinds of the detection reagents (e.g., different
types of probe reagents, target binding domains, and/or target analytes) in separate
containers. The number of different kinds of the detection reagents provided in the
kit can be tailored for each application described herein. In some embodiments, the
kit can comprise at least 2, at least 3, at least 4, at least 5, at least 6 at least
7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40, at
least 50, at least 60, at least 70, at least 80, at least 90, at least 100 or more
different kinds of the detection reagents.
[0249] In any embodiments of the kit described herein , the kit can comprise a plurality
of sets of decoder probes, e.g., e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more sets of
decoder probes, wherein each set of decoder probes can target a different pre-determined
sequence of the nucleic acid label. In each set of the decoder probes, there can be
about 2, 3, 4, 5, 6, 7, 8, 9, 10 or more distinct populations of decoder probes. The
decoder probes can be pre-labeled with at least one detectable label or unlabeled.
In some embodiments where the decoder probes are not pre-labeled, the kit can further
comprise one or more distinct detectable labels provided in separate containers for
labeling the decoder probes. In some embodiments, the detectable label can be an optical
label described herein.
[0250] Examples of a reagent, e.g., used in a readout method, can include, but are not limited
to, a readout reagent, a wash buffer, a signal removal buffer, buffers for performing
hybridization reactions, restriction endonucleases, nucleic acid ligases, and any
combinations thereof.
[0251] In some embodiments, the detection reagents can be provided in a solution phase.
In other embodiments, the detection reagents can be immobilized in a solid support
or substrate.
[0252] By "substrate" or "solid support" or other grammatical equivalents herein is meant
any material that can be modified to contain discrete individual sites appropriate
for the attachment or association of beads and is amenable to at least one detection
method. As will be appreciated by those in the art, the number of possible substrates
is very large. Possible substrates include, but are not limited to, glass and modified
or functionalized glass, plastics (including acrylics, polystyrene and copolymers
of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes,
Teflon, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based
materials including silicon and modified silicon, carbon, metals, inorganic glasses,
plastics, optical fiber bundles, and a variety of other polymers. In general, the
substrates allow optical detection and do not themselves appreciably fluoresce.
[0253] Generally the substrate is flat (planar), although as will be appreciated by those
in the art, other configurations of substrates may be used as well; for example, three
dimensional configurations can be used, for example by embedding the detection reagents
in a porous block of plastic that allows sample access to the detection reagents and
using a confocal microscope for detection. In some embodiments, the detection reagents
can be placed on the inside surface of a tube, for flow-through sample analysis to
minimize sample volume. Preferred substrates include optical fiber bundles, and flat
planar substrates such as glass, polystyrene and other plastics and acrylics. In some
embodiment, the solid support or substrate can be a multi-well plate.
[0254] In addition to the above mentioned components, the kit can include informational
material. The informational material can be descriptive, instructional, marketing
or other material that relates to the methods described herein and/or the use of the
aggregates for the methods described herein. For example, the informational material
describes methods for administering the detection reagents to a subject, and/or includes
instructions to label decoder probes with detectable labels provided therein and/or
instructions to conjugate at least one nucleic acid label to a probe reagent. The
kit can also include a delivery device.
[0255] In some embodiments, the informational material can include instructions to administer
the formulation in a suitable manner, e.g., in a suitable dose, dosage form, or mode
of administration (e.g., a dose, dosage form, or mode of administration described
herein). In another embodiment, the informational material can include instructions
for identifying a suitable subject, e.g., a human, e.g., an adult human. The informational
material of the kits is not limited in its form. In many cases, the informational
material, e.g., instructions, is provided in printed matter, e.g., a printed text,
drawing, and/or photograph, e.g., a label or printed sheet. However, the informational
material can also be provided in other formats, such as Braille, computer readable
material, video recording, or audio recording. In another embodiment, the informational
material of the kit is a link or contact information, e.g., a physical address, email
address, hyperlink, website, or telephone number, where a user of the kit can obtain
substantive information about the formulation and/or its use in the methods described
herein. Of course, the informational material can also be provided in any combination
of formats.
[0256] In some embodiments, the kit contains separate containers, dividers or compartments
for each component and informational material. For example, each different component
can be contained in a bottle, vial, or syringe, and the informational material can
be contained in a plastic sleeve or packet. In other embodiments, the separate elements
of the kit are contained within a single, undivided container. For example, the formulation
is contained in a bottle, vial or syringe that has attached thereto the informational
material in the form of a label.
[0257] In some embodiments, the kit includes a plurality, e.g., a pack, of individual containers,
each containing one or more unit dosage forms of the composition comprising the detection
reagents. For example, the kit includes a plurality of syringes, ampules, foil packets,
or blister packs, each containing a single unit dose of the formulation. The containers
of the kits can be air tight and/or waterproof.
Some selected definitions
[0258] Unless stated otherwise, or implicit from context, the following terms and phrases
include the meanings provided below. Unless explicitly stated otherwise, or apparent
from context, the terms and phrases below do not exclude the meaning that the term
or phrase has acquired in the art to which it pertains. The definitions are provided
to aid in describing particular embodiments of the aspects described herein, and are
not intended to limit the claimed invention, because the scope of the invention is
limited only by the claims. Further, unless otherwise required by context, singular
terms shall include pluralities and plural terms shall include the singular.
[0259] As used herein the term "comprising" or "comprises" is used in reference to compositions,
methods, and respective component(s) thereof, that are essential to the invention,
yet open to the inclusion of unspecified elements, whether essential or not. Additionally,
the term "comprising" or "comprises" includes "consisting essentially of' and "consisting
of."
[0260] As used herein the term "consisting essentially of' refers to those elements required
for a given embodiment. The term permits the presence of additional elements that
do not materially affect the basic and novel or functional characteristic(s) of that
embodiment of the invention.
[0261] The term "consisting of" refers to compositions, methods, and respective components
thereof as described herein, which are exclusive of any element not recited in that
description of the embodiment.
[0262] Other than in the operating examples, or where otherwise indicated, all numbers expressing
quantities of ingredients or reaction conditions used herein should be understood
as modified in all instances by the term "about." The term "about" when used in connection
with percentages can mean ±1%.
[0263] The singular terms "a," "an," and "the" include plural referents unless context clearly
indicates otherwise. Similarly, the word "or" is intended to include "and" unless
the context clearly indicates otherwise.
[0264] Methods and materials described herein can be used in the practice or testing of
this disclosure. The term "comprises" means "includes." The abbreviation, "e.g." is
derived from the Latin exempli gratia, and is used herein to indicate a non-limiting
example. Thus, the abbreviation "e.g." is synonymous with the term "for example."
[0265] As used herein, the term "identifier" generally refers to a unique expression to
distinguish variations from one to another among a class of substances, items, or
objects. In particular embodiments, the term "identifier" as used herein refers to
association of a unique pre-determined subsequence to a specific probe reagent, thus
conferring the presence and identity of the probe reagent when the pre-determined
subsequence is detected.
[0266] The term "statistically significant" or "significantly" refers to statistical significance
and generally means a two standard deviation (2SD) above or below a reference level.
The term refers to statistical evidence that there is a difference. It is defined
as the probability of making a decision to reject the null hypothesis when the null
hypothesis is actually true. The decision is often made using the p-value.
[0267] As used herein, the term "substantially" means a proportion of at least about 60%,
or preferably at least about 70% or at least about 80%, or at least about 90%, at
least about 95%, at least about 97% or at least about 99% or more, or any integer
between 70% and 100%. In some embodiments, the term "substantially" means a proportion
of at least about 90%, at least about 95%, at least about 98%, at least about 99%
or more, or any integer between 90% and 100%. In some embodiments, the term "substantially"
can include 100%.
[0268] The term "sphere" means a particle having an aspect ratio of at most 3:1. The term
"aspect ratio" means the ratio of the longest axis of an object to the shortest axis
of the object, where the axes are not necessarily perpendicular.
[0269] The term "rod" means a particle having a longest dimension of at most 5000 nm, and
having an aspect ratio of from 3:1 to 20:1.
[0270] The term "prism" means a particle having at least two non-parallel faces connected
by a common edge.
[0271] As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically-acceptable
material, composition or vehicle for administration of the detection reagents. Pharmaceutically
acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial
and antifungal agents, isotonic and absorption delaying agents, and the like which
are compatible with the activity of the detection reagents and are physiologically
acceptable to the subject. Some examples of materials which can serve as pharmaceutically-acceptable
carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches,
such as corn starch and potato starch; (3) cellulose, and its derivatives, such as
sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline
cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7)
lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8)
excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil,
cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10)
glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol
and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate;
(13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide;
(15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution;
(19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or
polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum
component, such as serum albumin, HDL and LDL; (22) C2-C12 alchols, such as ethanol;
and (23) other non-toxic compatible substances employed in pharmaceutical formulations.
Wetting agents, coloring agents, release agents, coating agents, sweetening agents,
flavoring agents, perfuming agents, preservative and antioxidants can also be present
in the formulation. The terms such as "excipient", "carrier", "pharmaceutically acceptable
carrier" are used interchangeably herein.
[0272] As used here, the term "pharmaceutically acceptable" refers to those compounds, materials,
compositions, and/or dosage forms which are, within the scope of sound medical judgment,
suitable for use in contact with the tissues of human beings and animals without excessive
toxicity, irritation, allergic response, or other problem or complication, commensurate
with a reasonable benefit/risk ratio.
[0273] As used herein, the term "therapeutic agent" refers to a biological or chemical agent
used for treatment, curing, mitigating, or preventing deleterious conditions in a
subject. The term "therapeutic agent" also includes substances and agents for combating
a disease, condition, or disorder of a subject, and includes drugs, diagnostics, and
instrumentation. "Therapeutic agent" also includes anything used in medical diagnosis,
or in restoring, correcting, or modifying physiological functions. The terms "therapeutic
agent" and "pharmaceutically active agent" are used interchangeably herein.
[0274] A therapeutic agent can be selected according to the treatment objective and biological
action desired. Thus, a therapeutic agent can be selected from any class suitable
for the therapeutic objective. Further, the therapeutic agent may be selected or arranged
to provide therapeutic activity over a period of time.
[0275] Exemplary pharmaceutically active compound include, but are not limited to, those
found in
Harrison's Principles of Internal Medicine, 13th Edition, Eds. T.R. Harrison McGraw-Hill
N.Y., NY;
Physicians Desk Reference, 50th Edition, 1997, Oradell New Jersey, Medical Economics
Co.;
Pharmacological Basis of Therapeutics, 8th Edition, Goodman and Gilman, 1990;
United States Pharmacopeia, The National Formulary, USP XII NF XVII, 1990; current edition of Goodman and Oilman's The Pharmacological Basis of Therapeutics;
and current edition of The Merck Index.
[0276] Exemplary pharmaceutically active agents include, but are not limited to, steroids
and nonsteroidal anti-inflammatory agents, antirestenotic drugs, antimicrobial agents,
angiogenic factors, calcium channel blockers, thrombolytic agents, antihypertensive
agents, anti-coagulants, antiarrhythmic agents, cardiac glycosides, and the like.
[0277] In some embodiments, the therapeutic agent is selected from the group consisting
of salicylic acid and derivatives (aspirin), para-aminophenol and derivatives (acetaminophen),
arylpropionic acids (ibuprofen), corticosteroids, histamine receptor antagonists and
bradykinin receptor antagonists, leukotriene receptor antagonists, prostaglandin receptor
antagonists, platelet activating factor receptor antagonists, sulfonamides, trimethoprim-sulfamethoxazole,
quinolones, penicillins, cephalosporin, basic fibroblast growth factor (FGF), acidic
fibroblast growth factor, vascular endothelial growth factor, angiogenic transforming
growth factor alpha and beta, tumor necrosis factor, angiopoietin, platelet-derived
growth factor, dihydropyridines (e.g., nifedipine, benzothiazepines such as dilitazem,
and phenylalkylamines such as verapamil), urokinase plasminogen activator, urokinase,
streptokinase, angiotensin converting enzyme (ACE) inhibitors, spironolactone, tissue
plasminogen activator (tPA), diuretics, thiazides, antiadrenergic agents, clonidine,
propanolol, angiotensin-converting enzyme inhibitors, captopril, angiotensin receptor
antagonists, losartan, calcium channel antagonists, nifedine, heparin, warfarin, hirudin,
tick anti-coagulant peptide, and low molecular weight heparins such as enoxaparin,
lidocaine, procainamide, encainide, flecanide, beta adrenergic blockers, propranolol,
amiodarone, verpamil, diltiazem, nickel chloride, cardiac glycosides, angiotensin
converting enzyme inhibitors, angiotensin receptor antagonists, nitrovasodilators,
hypolipidemic agents (e.g., nicotinic acid, probucol, etc.), bile acid-binding resins
(e.g., cholestyramine, and fibric acid derivatives e.g., clofibrate), HMG CoA reductase
inhibitors, HMG CoA synthase inhibitors, squalene synthase inhibitors, squalene epoxidase
inhibitors, statins (e.g., lovastatin, cerivastatin, fluvastatin, pravastatin, simvaststin,
etc.), anti-psychotics, SSRIs, antiseizure medication, contraceptives, systemic and
local analgesics (chronic pain, bone growth/remodeling factors (osteoblast/osteoclast
recruiting and stimulating factors), neurotransmitters (L-DOPA, Dopamine, neuropeptides),
emphysema drugs, TGF-beta), rapamycin, naloxone, paclitaxel, amphotericin, Dexamethasone,
flutamide, vancomycin, phenobarbital, cimetidine, atenolol, aminoglycosides, hormones
(e.g., thyrotropin-releasing hormone, p-nitrophenyl beta-cellopentaosideand luteinizing
hormone-releasing hormone), vincristine, amiloride, digoxin, morphine, procainamide,
quinidine, quinine, ranitidine, triamterene, trimethoprim, vancomycin, aminoglycosides,
and penicillin, and pharmaceutically acceptable salts thereof.
[0278] As used herein, the term "fluorescent color" refers to a color emitted by any fluorophore
(e.g., fluorescent dye, fluorescent particles such as quantum dots, and/or fluorescent
proteins) upon light excitation and/or electromagnetic radiation. Fluorescent dye
as disclosed herein refers to a dye which exhibits energy and is visible under illumination
at a predefined wavelength. Numerous fluorescent molecules are commercially available
and can be adapted for use in the methods, detection reagents and kits as disclosed
herein, and include those from Molecular Probes, Sigma and similar other commercial
sources. In some embodiments, a "fluorescent color" can be produced by phosphorescence.
In some embodiments, a "fluorescent color" can be produced by luminescence (including
bioluminescence).
[0279] To the extent not already indicated, it will be understood by those of ordinary skill
in the art that any one of the various embodiments herein described and illustrated
may be further modified to incorporate features shown in any of the other embodiments
disclosed herein.
[0280] The following examples illustrate some embodiments of the disclosure. The following
examples do not in any way limit the invention.
EXAMPLES
Example 1: Exemplary hybridization-based detection methods of detection reagents
[0281] A solution suspension of streptavidin-coated Dynabeads (of about 1 µm), each conjugated
to one of six nucleic acid labels and a corresponding probe reagent specific for a
target analyte, wherein each of the nucleic acid labels comprised at least one pre-determined
subsequence, e.g., a first (e.g., A1, A2, and A3) and a second (B1, B2, and B3) pre-determined
subsequence, was prepared. The nucleic acid labels can comprise a nucleic acid sequence
of any length. In some embodiments, the nucleic acid labels can comprise at least
15 nucleotides, at least 20 nucleotides, at least 22 nucleotides, or at least 24 nucleotides.
A sample containing multiple target analytes was contacted with the target analyte-specific
Dynabeads, so that the Dynabeads would bind to the respective target analyte on the
sample. Any unbound Dynabeads was then removed, e.g., by washing. In the first readout,
a set of three decoder probes, each with a distinct sequence complementary to the
first pre-determined subsequences (e.g., A1
∗, A2
∗, and A3*) and a corresponding optical label (e.g., selected from red, green or blank),
was added to the sample with bound Dynabeads, and then imaged with fluorescent microscopy
(
Fig. 6A). The fluorescent signal was then removed, e.g., by photobleaching, from the previous
stage before the next readout. In the second readout, a different set of three decoder
probes, each with a distinct complementary sequence to the second pre-determined subsequences
(e.g., B1
∗, B2
∗, B3
∗) and a corresponding optical label (e.g., selected from red, green blank), was added
to the photobleached sample, and then imaged with fluorescent microscopy (
Fig. 6B). The temporal sequence of the optical signatures obtained from each bead can then
be analyzed to determine the identity of the probe and thus the presence of the corresponding
target analyte on the sample. Based on the intensity and/or coverage of the optical
signals, the amount of the target analyte can also be determined.
[0282] By way of example only, a biotinylated anti-
C.
albicans antibody (e.g., an commercially-available antibody from Pierce Antibodies PA1-27145)
was conjugated with a plurality of different biotinylated nucleic acid labels (e.g.,
8 different biotinylated SeqTag label sequences) using any conjugation methods known
in the art. In one embodiment, the biotinylated anti-
C.
albicans antibody was conjugated with a plurality of different biotinylated nucleic acid labels
(e.g., biotinylated SeqTag label sequences) using a streptavidin-like protein (e.g.,
Neutravidin) as a bridge. The SeqTag label sequences are shown in Table 5. The SeqTag
label sequences can comprise at least about 24 nucleotides. In some embodiments, the
SeqTag label sequences can comprise DNA, RNA or a combination thereof. Each conjugate
was incubated with a sample comprising
C.
albicans, washed, and readout using any readout method as described herein, e.g., the displacement-hybridization
method.
Table 5. DNA sequences of exemplary SeqTag labels
| SEQ ID NO: |
SeqTag label |
DNA Sequence |
| 59 |
SeqTag 1 |
5'-Biotin - TTTCGCTTTCTGTAATGGAGTGGA - 3' |
| 60 |
SeqTag 2 |
5'-Biotin - TTTCGCTTTAGCCTAAGTGAAATC - 3' |
| 61 |
SeqTag 3 |
5'-Biotin - TTTCGCTTTTTTGGGGAAAAGACA - 3' |
| 62 |
SeqTag 4 |
5'-Biotin - TTTCGCTTTTAGGCATTAGCATTG - 3' |
| 63 |
SeqTag 5 |
5'-Biotin - TTTCGCTTTGGAAGCACCTATTCC - 3' |
| 64 |
SeqTag 6 |
5'-Biotin - TTTCGCTTTCTGGAGAAAGGGCCA - 3' |
| 65 |
SeqTag 7 |
5'-Biotin - TTTCGCTTTCGGTTCCAAAGACAC - 3' |
| 66 |
SeqTag 8 |
5'-Biotin - TTTCGCTTTGAAGCCGGTTATAGC - 3' |
[0283] During the displacement hybridization method, by way of example only, as shown in
Fig. 7, the yeast was incubated in readout step 1 with a mixture of all three "set 1" decoder
probes, followed by an incubation with a mixture of the "set 2" decoder probes and
the "set 1 displacers" (which are nucleic acid sequences to remove "set 1" fluorescence),
and similarly with appropriate sets of decoder probes and displacers for steps 3 and
4. The decoder probes can comprise a nucleic acid sequence (e.g., DNA, RNA or a combination
thereof) and a detection label, e.g., at its 5' end. The nucleic acid sequence of
the decoder probes can be of any length. In some embodiments, the decoder probes can
comprise at least about 10 nucleotides, at least about 12 nucleotides, at least about
14 nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least
about 20 nucleotides or longer. Detection labels can be any art-recognized label described
herein, e.g., fluorescent detection labels such as FAM, Cy3, and C5, or any labels
described herein. Probe displacers, as described earlier, are nucleic acid sequences
that are used to remove or displace the previous decoder probes hybridized to the
nucleic acid labels (e.g., SeqTag labels) such that a different set of decoder probes
can be added and hybridized to the nucleic acid labels. The probe displacers can have
a nucleic acid sequence of any length. In some embodiments, the nucleic acid sequence
of the probe displacers can be longer than that of the decoder probes. In some embodiments,
the probe displacers can comprise at least about 12 nucleotides, at least about 14
nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least
about 20 nucleotides, at least about 21 nucleotides or longer. Tables 2 and 3 show
DNA sequences of exemplary decoder probes (or readout probes) and probe displacers,
respectively. As seen in
Fig. 7, each biotinylated anti-
C albicans antibody conjugated with a different SeqTag label sequence properly stained the yeast
and fluorescenced only as designated by its SeqTag label with appropriate sets of
decoder probes and probe displacer in each readout step.
Table 6. DNA sequences of exemplary decoder probes
| SEQ ID NO: |
Readout probe |
DNA Sequence |
| 67 |
Set 1 FAM |
5'-FAM - TTTTCCACTCCATTACAG - 3' |
| 68 |
Set 1 Cy3 |
5'-Cy3 - TTTGATTTCACTTAGGCT - 3' |
| 69 |
Set 1 Cy5 |
5'-Cy5 - TTTTGTCTTTTCCCCAAA - 3' |
| 70 |
Set 2 FAM |
5'-FAM - TTTCAATGCTAATGCCTA - 3' |
| 71 |
Set 2 Cy3 |
5'-Cy3 - TTTGGAATAGGTGCTTCC - 3' |
| 72 |
Set 2 Cy5 |
5'-Cy5 - TTTTGGCCCTTTCTCCAG - 3' |
| 73 |
Set 3 FAM |
5'-FAM - TTTGTGTCTTTGGAACCG - 3' |
| 74 |
Set 3 Cy3 |
5'-Cy3 - TTTGCTATAACCGGCTTC - 3' |
Table 7. DNA sequences of exemplary probe displacers
| SEQ ID NO: |
Probe Displacer |
DNA Sequence |
| 75 |
Set 1 FAM-Displacer |
5' - TCCACTCCATTACAGAAAGCG - 3' |
| 76 |
Set 1 Cy3-Displacer |
5' - GATTTCACTTAGGCTAAAGCG - 3' |
| 77 |
Set 1 Cy5-Displacer |
5' - TGTCTTTTCCCCAAAAAAGCG - 3' |
| 78 |
Set 2 FAM-Displacer |
5' - CAATGCTAATGCCTAAAAGCG - 3' |
| 79 |
Set 2 Cy3-Displacer |
5' - GGAATAGGTGCTTCCAAAGCG - 3' |
| 80 |
Set 2Cy5-Displacer |
5' - TGGCCCTTTCTCCAGAAAGCG - 3' |
| 81 |
Set 3 FAM-Displacer |
5' -TGTGTCTTTGGAACCGAAAGCG - 3' |
| 82 |
Set 3 Cy3-Displacer |
5' - GCTATAACCGGCTTCAAAGCG - 3' |
[0284] Content of all patents and other publications identified herein are provided solely
for their disclosure prior to the filing date of the present application. Nothing
in this regard should be construed as an admission that the inventors are not entitled
to antedate such disclosure by virtue of prior invention or for any other reason.
All statements as to the date or representation as to the contents of these documents
is based on the information available to the applicants and does not constitute any
admission as to the correctness of the dates or contents of these documents.