FIELD OF THE INVENTION:
[0001] The present invention relates to a method for preventing or treating a pancreatic
ductal adenocarcinoma (PDAC) comprising administering an anti-βig-h3 neutralizing
antibody which directly bind to βig-h3 and restores CD8+ T cell activation. The present
invention also relates to a method for assessing a subject's risk of having pancreatic
carcinoma, said method comprising the step of measuring the level of βig-h3 protein
in a blood sample obtained from said subject wherein the level of βig-h3 is positively
correlated with the risk of said subject of having a pancreatic ductal adenocarcinoma.
BACKGROUND OF THE INVENTION:
[0002] Pancreatic Ductal Adenocarcinoma (PDAC) is one of the most lethal human malignancies
and a major health problem. PDAC causes about 10,000 deaths per year in France and
230,000 in the worldwide (Jemal et al, 2003). The ratio of incidence/death is almost
one indicating that virtually all patients presenting a PDAC will be killed by their
disease. This is due to their short survival median that is about 6 months, the shortest
of all tumors, because the treatments are relatively inefficient and because the disease
was diagnosed at an advanced state. Despite considerable research efforts in the past
decades, conventional treatment approaches, including surgery, radiation, chemotherapy,
or combinations of these, had very limited impact. The prognosis is dismal with only
20% of patients alive one year after diagnosis (Jemal et al, 2003). Given this scenario,
the search for new treatments that will counter PDAC progression and thereby increase
patient life expectancy and quality of life has been given high priority.
[0003] An explanation for the low-efficiency, or high-resistance, to systemic therapies
is that PDAC tumors are hypovascularised and very rich in stroma, representing from
15 to 90% of the tumor mass, which may form a barrier for drug delivery to the transformed
cells.
[0004] The characteristics of PDAC are: (i) Incurable, as all patients will eventually relapse,
underscoring a resistance of the disease to current treatment options. (ii) Very heterogeneous
disease in terms of response to the - yet non-optimal - existing treatments. (iii)
Drug resistance remains a major cause of treatment failure in PDAC and its inevitable
fate due to the prolonged natural course of the disease and the repeated treatments,
creating a relevant social and health problem. (iv) Robust and specific markers predictive
of response to treatment are still lacking, though urgently needed in order to implement
risk-adapted, personalized treatment and maximize clinical benefit while minimizing
costs.
[0005] Gene profiling of whole PDAC tumors has been largely reported in the prior Art (see
Abdollahi et al, 2007; Abiatari et al, 2009; Buchholz et al, 2005a; Buchholz et al,
2005b; Cavard et al, 2009; Cmogorac-Jurcevic et al, 2002; Gress et al, 1997; Ishikawa
et al, 2005; Marcotte et al, 2012; Verma et al, 2012; Wang et al, 2013). However,
the low reproducibility of those studies had discouraged the authors to go on exploring
this direction.
[0006] The reasons for the failure of those approaches may be due to inappropriate tools,
tools of insufficient quality, poor quality of the samples, or they may also be inherent
to the pathology itself since PDAC tumors can contain from 15 to 90% of stroma tissue
associated with variable areas of inflammation and necrosis.
[0007] Thus, and to inventor's knowledge, there are no available diagnostic blood biomarkers,
for predicting the risk of individual subject to have/develop a pancreatic ductal
adenocarcinoma (PDAC). In particular, a need remains for in vitro or ex vivo methods
to diagnose the early stage of tumor onset of individual having PDAC.
[0008] A need also remains for methods and/or kits and/or solid supports, which are suitable
for determining the diagnosis of an individual having PDAC, easily without invasive
intratumor biopsy.
[0009] Therefore, there is a need for new biological markers of PDAC. In particular, biomarkers
that would allow reliable diagnosis and monitoring of the early stages of the disease
are highly desirable.
[0010] The purpose of the present invention is therefore to address this need by providing:
i) a new reliable method for predicting whether a subject is affected by PDAC at an
early stage of the disease onset and ii) a new therapeutical target for treating PDAC.
[0011] Inventors have recently shown that βig-h3 protein (Transforming growth factor betainduced
protein or TGFBIp), a secreted protein of the stroma, capable of binding to both extracellular
matrix and cells, plays an important role to maintain islet tolerance and integrity
against islet insult T cell cytotoxic attack in type 1 diabetes (Patry et al., 2015).
[0012] TGFBIp is an extracellular matrix protein expressed by human endothelial cells and
platelets that induces sepsis through interaction with integrin αvβ5. Bae
et al. shown that neutralizing anti-TGFBIp antibody inhibited the specific interactions
between TGFBIp and integrin αvβ5, one of TGFBIp cognate receptors, (Bae et al., 2014).
They demonstrated that treatments based on the use of a TGFBIp-neutralizing antibody
can ameliorate the deleterious effects of sepsis. Furthermore, elevated expression
of TGFBIp was previously described in several cancer cell lines and tumour biopsies,
such as colon cancer cell lines and high grade advanced colon tumors (Ma et al., 2008)
but also and pancreatic tissue (Turtoi et al., 2011). This expression was detected
in tumour tissue (not at serum level) and it was associated with poor prognostic in
well-advanced tumour (high grade advanced colon cancer in Ma et al 2008). The patent
WO2006/092729 corresponding to Turtoi et al, 2011, discloses the identification of βig-h3 among several biomarkers in the supernatant
of tumor cell lines, and in particular of PDAC. Contrariwise, another study (Han et
al. 2015) while the serum concentration of TGFBIp was assessed in patients suffering
with various cancers, no significant association was ever observed in patients suffering
of pancreatic cancer. Another study demonstrated that the use of siRNA against βig-h3
lead to the inhibition of migration of pancreas carcinoma cells but the impact of
βig-h3 on anti-tumor immunity and thus on the viability and the growth of tumor was
not explored (
WO2012/079977). TGFBI inhibitor is mentioned in a list of active agents which can be used in combination
with a RUNX3 inhibitors for treating pancreatic cancer (
WO2014/113406). Finally, none of these studies have explored the potential therapeutical targeting
of TGFBIp in PDAC and especially as an immunological target in human.
SUMMARY OF THE INVENTION:
[0013] A first object of the invention relates to a method for assessing a subject's risk
of having or developing pancreatic ductal adenocarcinoma, said method comprising the
step of measuring the level of βig-h3 protein in a blood sample obtained from said
subject wherein the level of βig-h3 is positively correlated with the risk of said
subject of having a pancreatic ductal adenocarcinoma.
[0014] A high level of βig-h3 is predictive of a high risk of having or developing a pancreatic
ductal adenocarcinoma.
[0015] A low level of βig-h3 is predictive of a low risk of having a/or developing pancreatic
ductal adenocarcinoma.
[0016] A second object of the invention relates to a method for monitoring the effect of
a therapy for treating pancreatic ductal adenocarcinoma in a subject comprising the
step of measuring the level of βig-h3 in a first blood sample obtained from said subject
at t1 and measuring the level of βig-h3 in a second blood sample obtained from said
subject at t2 wherein when t1 is prior to therapy, t2 is during or following therapy,
and when t1 is during therapy, t2 is later during therapy or following therapy, and
wherein a decrease in the level of βig-h3 in the second sample as compared to the
level of βig-h3 in the first sample is indicative of a positive effect of the therapy
on pancreatic ductal adenocarcinoma in the treated subject.
[0017] A third object of the invention also relates to a βig-h3 antagonist for use in the
prevention or treatment of a patient affected with a pancreatic ductal adenocarcinoma
wherein said antagonist is an anti-βig-h3 neutralizing antibody which directly binds
to βig-h3 and restores CD8+ T cell activation.
[0018] A fourth object of the invention refers to a pharmaceutical composition for use in
the prevention or treatment of pancreatic ductal adenocarcinoma comprising a βig-h3
antagonist according to the invention and a pharmaceutically acceptable carrier
DETAILED DESCRIPTION OF THE INVENTION:
[0019] Here the inventors investigated the correlation between βig-h3 serum levels and biological
findings from PDAC patients. They found that surprisingly: 1) βig-h3 protein is highly
produced by cancer associated fibroblasts (CAFs) in the tumor stroma in pancreatic
neoplasia both in mice and in humans; 2) βig-h3 is expressed very early in tumorigenesis
in pancreatic neoplastic lesions (PanIN1, PanIN2 and PanIN3 Stages) in a mouse model
of PDAC predisposition as well as in PDAC patients 3) βig-h3 is secreted and can be
detected in the serum of the mouse which developed pancreatic neoplastic lesions 4)
βig-h3 acts directly on CD8
+ T cells by reducing their activation and cytotoxic properties 5) βig-h3 interacts
with CD61 at the surface of CD8+ T cells 6) the use of neutralizing βig-h3 antibodies
in PDAC mouse model, reduced tumor growth by enhancing CD8
+ T cell anti-tumoral response and 7) CD8+ T cells are mandatory for βig-h3 neutralization
effect in vivo. These results show that βig-h3 contributes to the anti-tumoral CD8
+T cell response blockade. Neutralizing βig-h3 which acts as a novel immunological
check-point target in PDAC therefore allows to restore beneficial anti-tumor immunity
in pancreatic cancer.
Diagnostic methods according to the invention:
[0020] A first aspect of the invention consists of a method for assessing a subject's risk
of having or developing ductal pancreatic adenocarcinoma (PDAC), said method comprising
the step of measuring the level of βig-h3 protein in a blood sample obtained from
said subject wherein the level of βig-h3 is positively correlated with the risk of
said subject of having a pancreatic ductal adenocarcinoma.
[0021] A high level of βig-h3 is predictive of a high risk of having or developing a pancreatic
ductal adenocarcinoma.
[0022] A low level of βig-h3 is predictive of a low risk of having or developing a pancreatic
ductal adenocarcinoma.
[0023] Indeed, the inventors have surprisingly demonstrated that βig-h3, known until now
to be an extracellular matrix protein expressed by human endothelial cells or various
tumour cells, is a circulating protein present in blood.
[0024] In one embodiment, the blood sample to be used in the methods according to the invention
is a whole blood sample, a serum sample, or a plasma sample. In a preferred embodiment,
the blood sample is a serum sample.
[0025] In a particular embodiment, methods of the invention are suitable for assessing a
subject's risk of having or developing pancreatic carcinoma (PDAC) at an early stage:
for instance when occur pancreatic neoplastic lesions (IPMNs (Intra-Pancreatic Mucinous
Neoplasia), MCNs (Mucinous Cystics Neoplasia), PanIN1, PanIN2 and PanIN3 Stages).
[0026] As defined herein the term "βig-h3" or (βig-h3) also known as "Transforming growth
factor β-induced protein" or "TGFBIp" or "TGFBi" is an extracellular matrix protein
expressed by human endothelial cells and platelets that in humans is encoded by the
TGFBI gene. This gene encodes an RGD-containing protein that binds to type I, II and IV
collagens. The RGD motif is found in many extracellular matrix proteins modulating
cell adhesion and serves as a ligand recognition sequence for several integrins. This
protein plays a role in cell-collagen interactions and may be involved in endochondrial
bone formation in cartilage. The protein is induced by transforming growth factor-beta
and acts to inhibit cell adhesion. Mutations of the gene cause several forms of corneal
dystrophies (Munier et al 1997). One example of wild-type βig-h3 human amino acid
sequence is provided in SEQ ID NO:1 (NCBI Reference Sequence: NP_000349). One example
of nucleotide sequence encoding wild-type βig-h3 amino acid sequence of SEQ ID NO:1
is provided in SEQ ID NO:2 (NCBI Reference Sequence: NM_000358).
[0027] In one embodiment of the methods defined above, one or more biological markers are
quantified together with βig-h3.
[0028] As used herein, a "biological marker" encompasses any detectable product that is
synthesized upon the expression of a specific gene, and thus includes gene-specific
mRNA, cDNA and protein.
[0029] The various biological markers names specified herein correspond to their internationally
recognized acronyms that are usable to get access to their complete amino acid and
nucleic acid sequences, including their complementary DNA (cDNA) and genomic DNA sequences.
Illustratively, the corresponding amino acid and nucleic acid sequences of each of
the biological markers specified herein may be retrieved, on the basis of their acronym
names, that are also termed herein "gene symbols", in the GenBank or EMBL sequence
databases. All gene symbols listed in the present specification correspond to the
GenBank nomenclature. Their DNA (cDNA and gDNA) sequences, as well as their amino
acid sequences are thus fully available to the one skilled in the art from the GenBank
database, notably at the following Website address: "http://www.ncbi.nlm.nih.gov/".
[0030] Of course variant sequences of the biological markers may be employed in the context
of the present invention, those including but not limited to functional homologues,
paralogues or orthologues of such sequences.
[0031] As used herein, the term "subject" denotes a mammal, such as a rodent, a feline,
a canine, and a primate. Preferably, a subject according to the invention is a human.
[0032] The term "pancreatic ductal adenocarcinoma" refers to or describes the pathological
condition in mammals that is typically characterized by unregulated pancreas cell
growth. More precisely, Pancreatic ductal adenocarcinoma (PDAC) is a malignant tumor
characterized by rapid progression that affects the exocrine compartment. PDAC is
associated with an abundant stromal reaction, which accounts for up to 90% of the
tumor volume. Since few years, the contribution of this massive stroma has emerged
as a novel actor and contributor of pancreatic tumor initiation and progression.
[0033] The level of the βig-h3 may be determined by using standard electrophoretic and immunodiagnostic
techniques, including immunoassays such as competition, direct reaction such as immunohistochemistry,
or sandwich type assays. Such assays include, but are not limited to, Western blots;
agglutination tests; enzyme-labelled and mediated immunoassays, such as ELISAs; biotin/avidin
type assays; radioimmunoassays; immunoelectrophoresis; immunoprecipitation, etc. The
reactions generally include revealing labels such as fluorescent, chemiluminescent,
radioactive, enzymatic labels or dye molecules, or other methods for detecting the
formation of a complex between the antigen and the antibody or antibodies reacted
therewith.
[0034] For example, determination of the βig-h3 level can be performed by a variety of techniques
and method any well known method in the art: RIA kits (DiaSorin; IDS, Diasource) Elisa
kits (Thermo Fisher, EHTGFBI, R&D DY2935, IDS (manual) IDS (adapted on open analyzers)
Immunochemiluminescent automated methods (DiaSorin Liaison, Roche Elecsys family,
IDS iSYS) (Janssen et al., 2012).
[0035] In a particular embodiment, the methods of the invention comprise contacting the
blood sample with a binding partner.
[0036] As used therein, binding partner refers to a molecule capable of selectively interacting
with βig-h3.
[0037] The binding partner may be generally an antibody that may be polyclonal or monoclonal,
preferably monoclonal. Polyclonal antibodies directed against βig-h3 can be raised
according to known methods by administering the appropriate antigen or epitope to
a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and
mice, among others. Various adjuvants known in the art can be used to enhance antibody
production. Although antibodies useful in practicing the invention can be polyclonal,
monoclonal antibodies are preferred. Monoclonal antibodies against βig-h3 can be prepared
and isolated using any technique that provides for the production of antibody molecules
by continuous cell lines in culture. Techniques for production and isolation include
but are not limited to the hybridoma technique originally described by
Kohler et al. Nature. 1975; 256(5517):495-7 ; the human B-cell hybridoma technique (
Cote et al Proc Natl Acad Sci USA. 1983;80(7):2026-30); and the EBV-hybridoma technique (
Cole et al., 1985, in "Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc.
pp. 77-96). Alternatively, techniques described for the production of single chain antibodies
(see e.g.
U.S. Pat. No. 4,946,778) can be adapted to produce anti- βig-h3, single chain antibodies. Antibodies useful
in practicing the present invention also include anti- βig-h3 including but not limited
to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody
molecule, and Fab fragments, which can be generated by reducing the disulfide bridges
of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can
be constructed to allow rapid identification of fragments having the desired specificity
to βig-h3. For example, phage display of antibodies may be used. In such a method,
single-chain Fv (scFv) or Fab fragments are expressed on the surface of a suitable
bacteriophage, e. g., M13. Briefly, spleen cells of a suitable host, e. g., mouse,
that has been immunized with a protein are removed. The coding regions of the VL and
VH chains are obtained from those cells that are producing the desired antibody against
the protein. These coding regions are then fused to a terminus of a phage sequence.
Once the phage is inserted into a suitable carrier, e. g., bacteria, the phage displays
the antibody fragment. Phage display of antibodies may also be provided by combinatorial
methods known to those skilled in the art. Antibody fragments displayed by a phage
may then be used as part of an immunoassay.
[0038] In another embodiment, the binding partner may be an aptamer. Aptamers are a class
of molecule that represents an alternative to antibodies in term of molecular recognition.
Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize
virtually any class of target molecules with high affinity and specificity. Such ligands
may be isolated through Systematic Evolution of Ligands by EXponential enrichment
(SELEX) of a random sequence library, as described in
Tuerk et al. (1990) Science, 249, 505-510. The random sequence library is obtainable by combinatorial chemical synthesis of
DNA. In this library, each member is a linear oligomer, eventually chemically modified,
of a unique sequence. Possible modifications, uses and advantages of this class of
molecules have been reviewed in Jayasena 1999. Peptide aptamers consist of conformationally
constrained antibody variable regions displayed by a platform protein, such as E.
coli Thioredoxin A, that are selected from combinatorial libraries by two hybrid methods
(
Colas et al. (1996) Nature, 380, 548-50).
[0039] The binding partners of the invention such as antibodies or aptamers, may be labeled
with a detectable molecule or substance, such as a fluorescent molecule, a radioactive
molecule or any others labels known in the art. Labels are known in the art that generally
provide (either directly or indirectly) a signal.
[0040] As used herein, the term "labeled", with regard to the binding partner, is intended
to encompass direct labeling of the antibody or aptamer by coupling (i.e., physically
linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g.
fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)) to the
antibody or aptamer, as well as indirect labeling of the probe or antibody by reactivity
with a detectable substance. An antibody or aptamer of the invention may be labeled
with a radioactive molecule by any method known in the art. For example radioactive
molecules include but are not limited radioactive atom for scintigraphic studies such
as 1123, 1124, In111, Re186, Re188.
[0041] The aforementioned assays generally involve the bounding of the binding partner (ie.
antibody or aptamer) in a solid support. Solid supports which can be used in the practice
of the invention include substrates such as nitrocellulose (e. g., in membrane or
microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene
latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper;
nylon membranes; activated beads, magnetically responsive beads, and the like. More
particularly, an ELISA method can be used, wherein the wells of a microtiter plate
are coated with a set of antibodies against βig-h3. A body fluid sample containing
or suspected of containing βig-h3 is then added to the coated wells. After a period
of incubation sufficient to allow the formation of binding partner-βig-h3 complexes,
the plate(s) can be washed to remove unbound material and a labeled secondary binding
molecule added. The secondary binding molecule is allowed to react with any captured
sample marker protein, the plate washed and the presence of the secondary binding
molecule detected using methods well known in the art.
[0042] As the binding partner, the secondary binding molecule may be labeled.
[0043] Different immunoassays, such as radioimmunoassay or ELISA, have been described in
the art.
[0044] Measuring the level of βig-h3 with or without immunoassay-based methods may also
include separation of the proteins: centrifugation based on the protein's molecular
weight; electrophoresis based on mass and charge; HPLC based on hydrophobicity; size
exclusion chromatography based on size; and solid-phase affinity based on the protein's
affinity for the particular solid-phase that is use. Once separated, βig-h3 may be
identified based on the known "separation profile" e. g., retention time, for that
protein and measured using standard techniques. Alternatively, the separated proteins
may be detected and measured by, for example, a mass spectrometer.
[0045] In a preferred embodiment, the method for measuring the level of βig-h3 comprises
the step of contacting the blood sample with a binding partner capable of selectively
interacting with βig-h3to allow formation of a binding partner- βig-h3 complex.
[0046] In more preferred embodiment, the method according to the invention comprises further
the steps of separating any unbound material of the blood sample from the binding
partner- βig-h3 complex, contacting the binding partner- βig-h3 complex with a labelled
secondary binding molecule, separating any unbound secondary binding molecule from
secondary binding molecule- βig-h3 complexes and measuring the level of the secondary
binding molecule of the secondary binding molecule- βig-h3 complexes.
[0047] Typically, a high or a low level of βig-h3 is intended by comparison to a control
reference value.
[0048] Said reference control values may be determined in regard to the level of βig-h3
present in blood samples taken from one or more healthy subject or to the βig-h3 distribution
in a control population.
[0049] In one embodiment, the method according to the present invention comprises the step
of comparing said level of βig-h3 to a control reference value wherein a high level
of βig-h3 compared to said control reference value is predictive of a high risk of
having a pancreatic ductal adenocarcinoma and a low level of βig-h3 compared to said
control reference value is predictive of a low risk of having a pancreatic ductal
adenocarcinoma.
[0050] The control reference value may depend on various parameters such as the method used
to measure the level of βig-h3 or the gender of the subject.
[0051] Typically, for a level of βig-h3 in a serum sample measured using a competitive immunoassay
with a polyclonal antibody raised against human βig-h3, a level of βig-h3 superior
to 5 µg/ml, is predictive of a high risk of having a pancreatic ductal adenocarcinoma
and a level of βig-h3 lower than 5 µg/ml is predictive of a low risk of having a pancreatic
ductal adenocarcinoma.
[0052] Control reference values are easily determinable by the one skilled in the art, by
using the same techniques as for determining the level of βig-h3 in blood samples
previously collected from the patient under testing.
[0053] A "control reference value" can be a "threshold value" or a "cut-off value". Typically,
a "threshold value" or "cut-off value" can be determined experimentally, empirically,
or theoretically. A threshold value can also be arbitrarily selected based upon the
existing experimental and/or clinical conditions, as would be recognized by a person
of ordinary skilled in the art. The threshold value has to be determined in order
to obtain the optimal sensitivity and specificity according to the function of the
test and the benefit/risk balance (clinical consequences of false positive and false
negative). Typically, the optimal sensitivity and specificity (and so the threshold
value) can be determined using a Receiver Operating Characteristic (ROC) curve based
on experimental data. Preferably, the person skilled in the art may compare the βig-h3
levels (obtained according to the method of the invention) with a defined threshold
value. In one embodiment of the present invention, the threshold value is derived
from the βig-h3 level (or ratio, or score) determined in a blood sample derived from
one or more subjects who are responders to pancreatic ductal adenocarcinoma treatment.
In one embodiment of the present invention, the threshold value may also be derived
from βig-h3 level (or ratio, or score) determined in a blood sample derived from one
or more subjects who are not affected with pancreatic ductal adenocarcinoma. Furthermore,
retrospective measurement of the βig-h3 levels (or ratio, or scores) in properly banked
historical subject samples may be used in establishing these threshold values.
[0054] "Risk" in the context of the present invention, relates to the probability that an
event will occur over a specific time period, as in the conversion to pancreatic ductal
adenocarcinoma (PDAC), and can mean a subject's "absolute" risk or "relative" risk.
Absolute risk can be measured with reference to either actual observation post-measurement
for the relevant time cohort, or with reference to index values developed from statistically
valid historical cohorts that have been followed for the relevant time period. Relative
risk refers to the ratio of absolute risks of a subject compared either to the absolute
risks of low risk cohorts or an average population risk, which can vary by how clinical
risk factors are assessed. Odds ratios, the proportion of positive events to negative
events for a given test result, are also commonly used (odds are according to the
formula p/(1-p) where p is the probability of event and (1- p) is the probability
of no event) to no conversion. Alternative continuous measures, which may be assessed
in the context of the present invention, include time to AMC and/or congenital peripheral
neuropathy disease conversion and therapeutic AMC and/or congenital peripheral neuropathy
disease conversion risk reduction ratios.
[0055] "Risk evaluation," or "evaluation of risk" in the context of the present invention
encompasses making a prediction of the probability, odds, or likelihood that an event
or disease state may occur, the rate of occurrence of the event or conversion from
one disease state to another, i.e., from a normal condition to a PDAC condition or
to one at risk of developing a PDAC. Risk evaluation can also comprise prediction
of future clinical parameters, traditional laboratory risk factor values, or other
indices of PDAC, such as cellular population determination in peripheral tissues,
in serum or other fluid, either in absolute or relative terms in reference to a previously
measured population. The methods of the present invention may be used to make continuous
or categorical measurements of the risk of conversion to PDAC, thus diagnosing and
defining the risk spectrum of a category of subjects defined as being at risk for
a PDAC. In the categorical scenario, the invention can be used to discriminate between
normal and other subject cohorts at higher risk for PADC. In other embodiments, the
present invention may be used so as to help to discriminate those having PDAC from
normal.
[0056] The invention also relates to the use of βig-h3 as a blood biomarker of PDAC, especially
at early stage. According to the present invention, early stage of PDAC means for
instance when occurs pancreatic neoplastic lesions (PanIN1, PanIN2 and PanIN3 Stages).
Monitoring anti-pancreatic cancer treatments
[0057] Monitoring the influence of agents (e.g., drug compounds) on the level of expression
of one or more tissue-specific biological markers of the invention can be applied
for monitoring the malignant potency of the treated pancreatic ductal adenocarcinoma
of the patient with time. For example, the effectiveness of an agent to affect βig-h3
expression can be monitored during treatments of subjects receiving anti-cancer, and
especially chemotherapy treatments.
[0058] Accordingly, a second object of the invention also relates to method for monitoring
the effect of a therapy for treating pancreatic ductal adenocarcinoma in a subject
comprising the step of measuring the level of βig-h3 in a first blood sample obtained
from said subject at t1 and measuring the level of βig-h3 in a second blood sample
obtained from said subject at t2 wherein when t1 is prior to therapy, t2 is during
or following therapy, and when t1 is during therapy, t2 is later during therapy or
following therapy, and wherein a decrease in the level of βig-h3 in the second sample
as compared to the level of βig-h3 in the first sample is indicative of a positive
effect of the therapy on pancreatic ductal adenocarcinoma in the treated subject.
[0059] In another embodiment, the present invention provides a method for monitoring the
effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist,
peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate)
comprising the steps of (i) obtaining a pre- administration blood sample from a subject
prior to administration of the agent; (ii) detecting the βig-h3 blood level; (iii)
obtaining one or more post- administration samples from the subject; (iv) detecting
βig-h3 blood level in the post-administration samples; (v) comparing βig-h3 level
in the pre-administration sample with the level of expression in the post-administration
sample or samples; and (vi) altering the administration of the agent to the subject
accordingly. For example, increased βig-h3 blood level during the course of treatment
may indicate ineffective dosage and the desirability of increasing the dosage, or
indicative to the necessity to change the treatment. Conversely, decreased βig-h3
blood may indicate efficacious treatment and no need to change dosage.
[0060] In a specific embodiment, the therapy for treating pancreatic ductal adenocarcinoma
is selected from the group consisting of chemotherapy treatment and/or a βig-h3 antagonist.
[0061] Because repeated collection of biological samples from the cancer-bearing patient
are needed for performing the monitoring method described above, then preferred biological
samples is blood samples susceptible to contain (i) cells originating from the patient's
pancreatic ductal adenocarcinoma tissue, or (ii) specific marker expression products
synthesized by cells originating from the patients pancreatic ductal adenocarcinoma
tissue, including nucleic acids and proteins.
Therapeutic methods and uses:
[0062] The present disclosure provides methods and compositions (such as pharmaceutical
compositions) for preventing or treating a pancreatic ductal adenocarcinoma. The present
disclosure also provides methods and compositions for inhibiting or preventing pancreatic
ductal adenocarcinoma.
[0063] In the context of the invention, the term "treatment or prevention" means reversing,
alleviating, inhibiting the progress of, or preventing the disorder or condition to
which such term applies, or one or more symptoms of such disorder or condition. In
particular, the treatment of the disorder may consist in reducing the number of malignant
cells. Most preferably, such treatment leads to the complete depletion of the malignant
cells.
[0064] Preferably, the individual to be treated is a human or non-human mammal (such as
a rodent (mouse, rat), a feline, a canine, or a primate) affected or likely to be
affected with cancer. Preferably, the individual is a human.
[0065] The present disclosure relates to a βig-h3 antagonist for use in the prevention or
the treatment of a patient affected with a pancreatic ductal adenocarcinoma.
[0066] An "βig-h3 antagonist" refers to a molecule (natural or synthetic) capable of neutralizing,
blocking, inhibiting, abrogating, reducing or interfering with the activities of βig-h3
including, for example, reduction or blocking the interaction between βig-h3 and αVβ3
integrin. βig-h3 antagonists include antibodies and antigen-binding fragments thereof,
proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides,
nucleic acids, bioorganic molecules, peptidomimetics, pharmacological agents and their
metabolites, transcriptional and translation control sequences, and the like. Antagonists
also include, antagonist variants of the protein, siRNA molecules directed to a protein,
antisense molecules directed to a protein, aptamers, and ribozymes against a protein.
For instance, the βig-h3 antagonist may be a molecule that binds to βig-h3 and neutralizes,
blocks, inhibits, abrogates, reduces or interferes with the biological activity of
βig-h3 (such as inducing tumor cell growth). More particularly, the βig-h3 antagonist
according to the disclosure is an anti-βig-h3 antibody.
[0067] By "biological activity" of a βig-h3 is meant inducing tumor cell growth and inhibiting
CD8
+ T cell activation (blocking the anti-tumoral response).
[0068] Tests for determining the capacity of a compound to be βig-h3 antagonist are well
known to the person skilled in the art. In a preferred embodiment, the antagonist
specifically binds to βig-h3 in a sufficient manner to inhibit the biological activity
of βig-h3. Binding to βig-h3 and inhibition of the biological activity of βig-h3 may
be determined by any competing assays well known in the art. For example, the assay
may consist in determining the ability of the agent to be tested as βig-h3 antagonist
to bind to βig-h3. The binding ability is reflected by the Kd measurement. The term
"KD", as used herein, is intended to refer to the dissociation constant, which is
obtained from the ratio of Kd to Ka (i.e. Kd/Ka) and is expressed as a molar concentration
(M). KD values for binding biomolecules can be determined using methods well established
in the art. In specific embodiments, an antagonist that "specifically binds to βig-h3"
is intended to refer to an inhibitor that binds to human βig-h3 polypeptide with a
KD of 1µM or less, 100nM or less, 10nM or less, or 3nM or less. Then a competitive
assay may be settled to determine the ability of the agent to inhibit biological activity
of βig-h3. The functional assays may be envisaged such evaluating the ability to inhibit
a) induction of tumor cell growth and/or b) inhibition of CD8
+ T cell activation (see example with blocking βig-h3 antibody and Figures 2 and 3).
[0069] The skilled in the art can easily determine whether a βig-h3 antagonist neutralizes,
blocks, inhibits, abrogates, reduces or interferes with a biological activity of βig-h3.
To check whether the βig-h3 antagonist bind to βig-h3 and/or is able to inhibit tumor
cell growth and/or blocking the inhibiting CD8
+ T cell activation in the same way than the initially characterized blocking βig-h3
antibody and/or binding assay and/or a cell proliferation assay and/or or a inhibiting
CD8+ T cell activation assay may be performed with each antagonist. For instance inhibiting
CD8
+ T cell activation can be assessed by detecting cells expressing activation markers
with antibody anti-CD69 and anti-CD44 (CD8
+ T cells) as described in the Examples section (figure 2) and cell proliferation assay
can be measured by CFSE-proliferation assay.
[0070] Accordingly to the present disclosure, the βig-h3 antagonist may be a molecule that
binds to βig-h3 selected from the group consisting of antibodies, aptamers, and polypeptides.
[0071] The skilled in the art can easily determine whether a βig-h3 antagonist neutralizes,
blocks, inhibits, abrogates, reduces or interferes with a biological activity of βig-h3:
(i) binding to βig-h3 and/or (ii) inducing tumor cell growth and/or (iii) inhibiting
CD8+ T cell activation.
[0072] Accordingly, in a specific embodiment of the invention, the βig-h3 antagonist directly
binding to βig-h3 and inhibits the inhibition of CD8+ T cell activation (or restore
CD8+ T cell activation).
[0073] Thus, the present invention relates to a βig-h3 antagonist for use in the prevention
or the treatment of a patient affected with a pancreatic ductal adenocarcinoma wherein
said antagonist is an anti-βig-h3 neutralizing antibody which directly binds to βig-h3
and restores CD8+ T cell activation.
[0074] The present disclosure also relates to a βig-h3 antagonist for use in a method to
activate the anti-tumoral CD8+T cell response of a patient affected with a cancer.
[0075] The terms "cancer" and "tumors" refer to or describe the pathological condition in
mammals that is typically characterized by unregulated cell growth. More precisely,
in the use of the invention, diseases, namely tumors that express/secrete βig-h3 are
most likely to respond to the βig-h3 antagonist after the restoration of CD8+ T cell
activation. In particular, the cancer may be associated with a solid tumor or lymphoma/leukemia
(from hematopoietic cell). Examples of cancers that are associated with solid tumor
formation include breast cancer, uterine/cervical cancer, oesophageal cancer, pancreatic
cancer, colon cancer, colorectal cancer, kidney cancer, ovarian cancer, prostate cancer,
head and neck cancer, non-small cell lung cancer stomach cancer, tumors of mesenchymal
origin (i.e; fibrosarcoma and rhabdomyoscarcoma) tumors of the central and peripheral
nervous system (i.e; including astrocytoma, neuroblastoma, glioma, glioblatoma) thyroid
cancer.
[0076] Preferably the solid tumor is selected from the group consisting of pancreatic cancer
eosophage squamous cell carcinoma (Ozawa et al, 2014), gastric and hepatic carcinoma
(Han et al, 2015), colon cancer (Ma et al, 2008), melanoma (Lauden et al, 2014).
[0077] More preferably the pancreatic cancer is pancreatic ductal adenocarcinoma.
[0078] The terms "anti-tumoral CD8+T cell response" means the natural ability of the CD8+T
cell to lyse cancer cells (Robbins and Kawakami, 1996, Romero, 1996)
• Antibody
[0079] In another embodiment, the βig-h3 antagonist is an antibody (the term including antibody
fragment or portion) that can block the interaction of βig-h3 with αVβ3 integrin.
[0080] In preferred embodiment, the βig-h3 antagonist may consist in an antibody directed
against the βig-h3, in such a way that said antibody impairs the binding of a βig-h3
to αVβ3 integrin ("neutralizing antibody").
[0081] For this invention, neutralizing antibody of βig-h3 are selected as above described
for their capacity to (i) bind to βig-h3 and/or (ii) inhibiting tumor cell growth
and/or (iii) blocking the inhibiting CD8
+ T cell activation.
[0082] In one embodiment of the antibodies or portions thereof described herein, the antibody
is a monoclonal antibody. In one embodiment of the antibodies or portions thereof
described herein, the antibody is a polyclonal antibody. In one embodiment of the
antibodies or portions thereof described herein, the antibody is a humanized antibody.
In one embodiment of the antibodies or portions thereof described herein, the antibody
is a chimeric antibody. In one embodiment of the antibodies or portions thereof described
herein, the portion of the antibody comprises a light chain of the antibody. In one
embodiment of the antibodies or portions thereof described herein, the portion of
the antibody comprises a heavy chain of the antibody. In one embodiment of the antibodies
or portions thereof described herein, the portion of the antibody comprises a Fab
portion of the antibody. In one embodiment of the antibodies or portions thereof described
herein, the portion of the antibody comprises a F(ab')2 portion of the antibody. In
one embodiment of the antibodies or portions thereof described herein, the portion
of the antibody comprises a Fc portion of the antibody. In one embodiment of the antibodies
or portions thereof described herein, the portion of the antibody comprises a Fv portion
of the antibody. In one embodiment of the antibodies or portions thereof described
herein, the portion of the antibody comprises a variable domain of the antibody. In
one embodiment of the antibodies or portions thereof described herein, the portion
of the antibody comprises one or more CDR domains of the antibody.
[0083] As used herein, "antibody" includes both naturally occurring and non-naturally occurring
antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies,
and monovalent and divalent fragments thereof. Furthermore, "antibody" includes chimeric
antibodies, wholly synthetic antibodies, single chain antibodies, and fragments thereof.
The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized
by recombinant methods to reduce its immunogenicity in man.
[0084] Antibodies are prepared according to conventional methodology. Monoclonal antibodies
may be generated using the method of
Kohler and Milstein (Nature, 256:495, 1975). To prepare monoclonal antibodies useful in the invention, a mouse or other appropriate
host animal is immunized at suitable intervals (e.g., twice-weekly, weekly, twice-monthly
or monthly) with antigenic forms of βig-h3. The animal may be administered a final
"boost" of antigen within one week of sacrifice. It is often desirable to use an immunologic
adjuvant during immunization. Suitable immunologic adjuvants include Freund's complete
adjuvant, Freund's incomplete adjuvant, alum, Ribi adjuvant, Hunter's Titermax, saponin
adjuvants such as QS21 or Quil A, or CpG-containing immunostimulatory oligonucleotides.
Other suitable adjuvants are well-known in the field. The animals may be immunized
by subcutaneous, intraperitoneal, intramuscular, intravenous, intranasal or other
routes. A given animal may be immunized with multiple forms of the antigen by multiple
routes.
[0085] Briefly, the recombinant βig-h3 may be provided by expression with recombinant cell
lines. Recombinant form of βig-h3 may be provided using any previously described method.
Following the immunization regimen, lymphocytes are isolated from the spleen, lymph
node or other organ of the animal and fused with a suitable myeloma cell line using
an agent such as polyethylene glycol to form a hydridoma. Following fusion, cells
are placed in media permissive for growth of hybridomas but not the fusion partners
using standard methods, as described (
Coding, Monoclonal Antibodies: Principles and Practice: Production and Application
of Monoclonal Antibodies in Cell Biology, Biochemistry and Immunology, 3rd edition,
Academic Press, New York, 1996). Following culture of the hybridomas, cell supernatants are analyzed for the presence
of antibodies of the desired specificity, i.e., that selectively bind the antigen.
Suitable analytical techniques include ELISA, flow cytometry, immunoprecipitation,
and western blotting. Other screening techniques are well-known in the field. Preferred
techniques are those that confirm binding of antibodies to conformationally intact,
natively folded antigen, such as non-denaturing ELISA, flow cytometry, and immunoprecipitation.
[0086] Significantly, as is well-known in the art, only a small portion of an antibody molecule,
the paratope, is involved in the binding of the antibody to its epitope (see, in general,
Clark, W. R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons,
Inc., New York;
Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications,
Oxford). The Fc' and Fc regions, for example, are effectors of the complement cascade but
are not involved in antigen binding. An antibody from which the pFc' region has been
enzymatically cleaved, or which has been produced without the pFc' region, designated
an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody.
Similarly, an antibody from which the Fc region has been enzymatically cleaved, or
which has been produced without the Fc region, designated an Fab fragment, retains
one of the antigen binding sites of an intact antibody molecule. Proceeding further,
Fab fragments consist of a covalently bound antibody light chain and a portion of
the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of
antibody specificity (a single Fd fragment may be associated with up to ten different
light chains without altering antibody specificity) and Fd fragments retain epitope-binding
ability in isolation.
[0087] Within the antigen-binding portion of an antibody, as is well-known in the art, there
are complementarity determining regions (CDRs), which directly interact with the epitope
of the antigen, and framework regions (FRs), which maintain the tertiary structure
of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain
Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions
(FR1 through FR4) separated respectively by three complementarity determining regions
(CDR1 through CDRS). The CDRs, and in particular the CDRS regions, and more particularly
the heavy chain CDRS, are largely responsible for antibody specificity.
[0088] It is now well-established in the art that the non CDR regions of a mammalian antibody
may be replaced with similar regions of conspecific or heterospecific antibodies while
retaining the epitopic specificity of the original antibody. This is most clearly
manifested in the development and use of "humanized" antibodies in which non-human
CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional
antibody.
[0089] This invention provides in certain embodiments compositions and methods that include
humanized forms of antibodies. As used herein, "humanized" describes antibodies wherein
some, most or all of the amino acids outside the CDR regions are replaced with corresponding
amino acids derived from human immunoglobulin molecules. Methods of humanization include,
but are not limited to, those described in
U.S. Pat. Nos. 4,816,567,
5,225,539,
5,585,089,
5,693,761,
5,693,762 and
5,859,205, which are hereby incorporated by reference. The above
U.S. Pat. Nos. 5,585,089 and
5,693,761, and
WO 90/07861 also propose four possible criteria which may used in designing the humanized antibodies.
The first proposal was that for an acceptor, use a framework from a particular human
immunoglobulin that is unusually homologous to the donor immunoglobulin to be humanized,
or use a consensus framework from many human antibodies. The second proposal was that
if an amino acid in the framework of the human immunoglobulin is unusual and the donor
amino acid at that position is typical for human sequences, then the donor amino acid
rather than the acceptor may be selected. The third proposal was that in the positions
immediately adjacent to the 3 CDRs in the humanized immunoglobulin chain, the donor
amino acid rather than the acceptor amino acid may be selected. The fourth proposal
was to use the donor amino acid reside at the framework positions at which the amino
acid is predicted to have a side chain atom within 3A of the CDRs in a three dimensional
model of the antibody and is predicted to be capable of interacting with the CDRs.
The above methods are merely illustrative of some of the methods that one skilled
in the art could employ to make humanized antibodies. One of ordinary skill in the
art will be familiar with other methods for antibody humanization.
[0090] In one embodiment of the humanized forms of the antibodies, some, most or all of
the amino acids outside the CDR regions have been replaced with amino acids from human
immunoglobulin molecules but where some, most or all amino acids within one or more
CDR regions are unchanged. Small additions, deletions, insertions, substitutions or
modifications of amino acids are permissible as long as they would not abrogate the
ability of the antibody to bind a given antigen. Suitable human immunoglobulin molecules
would include IgG1, IgG2, IgG3, IgG4, IgA and IgM molecules. A "humanized" antibody
retains a similar antigenic specificity as the original antibody. However, using certain
methods of humanization, the affinity and/or specificity of binding of the antibody
may be increased using methods of "directed evolution", as described by
Wu et al., /. Mol. Biol. 294:151, 1999, the contents of which are incorporated herein by reference.
[0091] Fully human monoclonal antibodies also can be prepared by immunizing mice transgenic
for large portions of human immunoglobulin heavy and light chain loci. See, e.g.,
U.S. Pat. Nos. 5,591,669,
5,598,369,
5,545,806,
5,545,807,
6,150,584, and references cited therein, the contents of which are incorporated herein by reference.
These animals have been genetically modified such that there is a functional deletion
in the production of endogenous (e.g., murine) antibodies. The animals are further
modified to contain all or a portion of the human germ-line immunoglobulin gene locus
such that immunization of these animals will result in the production of fully human
antibodies to the antigen of interest. Following immunization of these mice (e.g.,
XenoMouse (Abgenix), HuMAb mice (Medarex/GenPharm)), monoclonal antibodies can be
prepared according to standard hybridoma technology. These monoclonal antibodies will
have human immunoglobulin amino acid sequences and therefore will not provoke human
anti-mouse antibody (KAMA) responses when administered to humans.
[0093] Thus, as will be apparent to one of ordinary skill in the art, the present invention
also provides for F(ab') 2 Fab, Fv and Fd fragments; chimeric antibodies in which
the Fc and/or FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been
replaced by homologous human or non-human sequences; chimeric F(ab')2 fragment antibodies
in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been
replaced by homologous human or non-human sequences; chimeric Fab fragment antibodies
in which the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been
replaced by homologous human or non-human sequences; and chimeric Fd fragment antibodies
in which the FR and/or CDR1 and/or CDR2 regions have been replaced by homologous human
or non-human sequences. The present invention also includes so-called single chain
antibodies.
[0094] The various antibody molecules and fragments may derive from any of the commonly
known immunoglobulin classes, including but not limited to IgA, secretory IgA, IgE,
IgG and IgM. IgG subclasses are also well known to those in the art and include but
are not limited to human IgG1, IgG2, IgG3 and IgG4.
[0095] In another embodiment, the antibody according to the invention is a single domain
antibody. The term "single domain antibody" (sdAb) or "VHH" refers to the single heavy
chain variable domain of antibodies of the type that can be found in Camelid mammals
which are naturally devoid of light chains. Such VHH are also called "nanobody
®". According to the invention, sdAb can particularly be llama sdAb.
[0096] Example of neutralizing anti- βig-h3 antibody is disclosed, for example, in
Bae JS et al Acta Physiol 2014, 212, 306-315. The skilled artisan can use routine technologies to use the antigen-binding sequences
of these antibodies (e.g., the CDRs) and generate humanized antibodies for treatment
of PDAC as disclosed herein.
• Aptamer
[0097] In particular, the βig-h3 antagonist is an aptamer directed against βig-h3. Aptamers
are a class of molecule that represents an alternative to antibodies in term of molecular
recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity
to recognize virtually any class of target molecules with high affinity and specificity.
Such ligands may be isolated through Systematic Evolution of Ligands by EXponential
enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold
L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis
of DNA. In this library, each member is a linear oligomer, eventually chemically modified,
of a unique sequence. Possible modifications, uses and advantages of this class of
molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of
a conformationally constrained antibody variable region displayed by a platform protein,
such as E. coli Thioredoxin A that are selected from combinatorial libraries by two
hybrid methods (Colas et al., 1996).
[0098] Then, in particular, neutralizing aptamers of βig-h3 are selected as above described
for their capacity to (i) bind to βig-h3 and/or (ii) inhibit tumor cell growth and/or
(iii) blocking the inhibiting CD8+ T cell activation.
• Inhibitor of βig-h3 gene expression
[0099] In examples which are not claimed, the βig-h3 antagonist is an inhibitor of βig-h3
gene expression. An "inhibitor of expression" refers to a natural or synthetic compound
that has a biological effect to inhibit the expression of a gene. Therefore, an "inhibitor
of βig-h3 gene expression" denotes a natural or synthetic compound that has a biological
effect to inhibit the expression of βig-h3 gene.
[0100] In particular, said inhibitor of βig-h3 gene expression is a siRNA, an antisense
oligonucleotide, a nuclease or a ribozyme.
[0101] Inhibitors of βig-h3 gene expression for use in the present disclosure may be based
on antisense oligonucleotide constructs. Anti-sense oligonucleotides, including anti-sense
RNA molecules and anti-sense DNA molecules, would act to directly block the translation
of βig-h3 mRNA by binding thereto and thus preventing protein translation or increasing
mRNA degradation, thus decreasing the level of βig-h3, and thus activity, in a cell.
For example, antisense oligonucleotides of at least about 15 bases and complementary
to unique regions of the mRNA transcript sequence encoding βig-h3 can be synthesized,
e.g., by conventional phosphodiester techniques and administered by e.g., intravenous
injection or infusion. Methods for using antisense techniques for specifically inhibiting
gene expression of genes whose sequence is known are well known in the art (e.g. see
U.S. Pat. Nos. 6,566,135;
6,566,131;
6,365,354;
6,410,323;
6,107,091;
6,046,321; and
5,981,732).
[0102] Small inhibitory RNAs (siRNAs) can also function as inhibitors of βig-h3 gene expression
for use in the present disclosure. βig-h3 gene expression can be reduced by using
small double stranded RNA (dsRNA), or a vector or construct causing the production
of a small double stranded RNA, such that βig-h3 gene expression is specifically inhibited
(i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding
vector are well known in the art for genes whose sequence is known (e.g. see Tuschi,
T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT.
et al. (2002); Brummelkamp, TR. et al. (2002);
U.S. Pat. Nos. 6,573,099 and
6,506,559; and International Patent Publication Nos.
WO 01/36646,
WO 99/32619, and
WO 01/68836).
[0104] Ribozymes can also function as inhibitors of βig-h3 gene expression for use in the
present disclosure. Ribozymes are enzymatic RNA molecules capable of catalyzing the
specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific
hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic
cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically
and efficiently catalyze endonucleolytic cleavage of βig-h3 mRNA sequences are thereby
useful within the scope of the present disclosure. Specific ribozyme cleavage sites
within any potential RNA target are initially identified by scanning the target molecule
for ribozyme cleavage sites, which typically include the following sequences, GUA,
GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides
corresponding to the region of the target gene containing the cleavage site can be
evaluated for predicted structural features, such as secondary structure, that can
render the oligonucleotide sequence unsuitable. The suitability of candidate targets
can also be evaluated by testing their accessibility to hybridization with complementary
oligonucleotides, using, e.g., ribonuclease protection assays.
[0105] Antisense oligonucleotides, siRNAs and ribozymes useful as inhibitors of βig-h3 gene
expression can be prepared by known methods. These include techniques for chemical
synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively,
anti-sense RNA molecules can be generated by
in vitro or
in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can
be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase
promoters such as the T7 or SP6 polymerase promoters. Various modifications to the
oligonucleotides of the disclosure can be introduced as a means of increasing intracellular
stability and half-life. Possible modifications include but are not limited to the
addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5'
and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather
than phosphodiesterase linkages within the oligonucleotide backbone.
[0106] Antisense oligonucleotides, siRNAs and ribozymes may be delivered
in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle
capable of facilitating the transfer of the antisense oligonucleotide, siRNA or ribozyme
nucleic acid to the cells and preferably cells expressing βig-h3. Preferably, the
vector transports the nucleic acid to cells with reduced degradation relative to the
extent of degradation that would result in the absence of the vector. In general,
the vectors useful in the disclosure include, but are not limited to, plasmids, phagemids,
viruses, other vehicles derived from viral or bacterial sources that have been manipulated
by the insertion or incorporation of the antisense oligonucleotide, siRNA or ribozyme
nucleic acid sequences. Viral vectors are a preferred type of vector and include,
but are not limited to nucleic acid sequences from the following viruses: retrovirus,
such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary
tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type
viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia
virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other
vectors not named but known to the art.
[0107] Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential
genes have been replaced with the gene of interest. Non-cytopathic viruses include
retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription
of genomic viral RNA into DNA with subsequent proviral integration into host cellular
DNA. Retroviruses have been approved for human gene therapy trials. Most useful are
those retroviruses that are replication-deficient (i.e., capable of directing synthesis
of the desired proteins, but incapable of manufacturing an infectious particle). Such
genetically altered retroviral expression vectors have general utility for the high-efficiency
transduction of genes
in vivo. Standard protocols for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a plasmid, transfection
of a packaging cell lined with plasmid, production of recombinant retroviruses by
the packaging cell line, collection of viral particles from tissue culture media,
and infection of the target cells with viral particles) are provided in
KRIEGLER (A Laboratory Manual," W.H. Freeman C.O., New York, 1990) and in
MURRY ("Methods in Molecular Biology," vol.7, Humana Press, Inc., Cliffton, N.J.,
1991).
[0108] Preferred viruses for certain applications are the adeno-viruses and adeno-associated
viruses, which are double-stranded DNA viruses that have already been approved for
human use in gene therapy. The adeno-associated virus can be engineered to be replication
deficient and is capable of infecting a wide range of cell types and species. It further
has advantages such as, heat and lipid solvent stability; high transduction frequencies
in cells of diverse lineages, including hemopoietic cells; and lack of superinfection
inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated
virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing
the possibility of insertional mutagenesis and variability of inserted gene expression
characteristic of retroviral infection. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than 100 passages in the
absence of selective pressure, implying that the adeno-associated virus genomic integration
is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal
fashion.
[0109] Other vectors include plasmid vectors. Plasmid vectors have been extensively described
in the art and are well known to those of skill in the art. See e.g.,
SANBROOK et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring
Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering
antigen-encoding genes to cells
in vivo. They are particularly advantageous for this because they do not have the same safety
concerns as with many of the viral vectors. These plasmids, however, having a promoter
compatible with the host cell, can express a peptide from a gene operatively encoded
within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV,
SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in
the art. Additionally, plasmids may be custom designed using restriction enzymes and
ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered
by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid
can be injected by intramuscular, intradermal, subcutaneous, or other routes. It may
also be administered by intranasal sprays or drops, rectal suppository and orally.
It may also be administered into the epidermis or a mucosal surface using a gene-gun.
The plasmids may be given in an aqueous solution, dried onto gold particles or in
association with another DNA delivery system including but not limited to liposomes,
dendrimers, cochleate and microencapsulation.
Method of preventing or treating pancreas cancer
[0110] The present disclosure further contemplates, but does not claim, a method of preventing
or treating pancreatic ductal adenocarcinoma in a subject comprising administering
to the subject a therapeutically effective amount of a βig-h3 antagonist.
[0111] In particular, the present disclosure, but does not claim, a method of inhibiting
pancreatic tumor growth in a subject comprising administering a therapeutically effective
amount of a βig-h3 antagonist.
[0112] By a "therapeutically effective amount" of a βig-h3 antagonist as above described
is meant a sufficient amount of the antagonist to prevent or treat a pancreatic ductal
adenocarcinoma. It will be understood, however, that the total daily usage of the
compounds and compositions of the present invention will be decided by the attending
physician within the scope of sound medical judgment. The specific therapeutically
effective dose level for any particular subject will depend upon a variety of factors
including the disorder being treated and the severity of the disorder; activity of
the specific compound employed; the specific composition employed, the age, body weight,
general health, sex and diet of the subject; the time of administration, route of
administration, and rate of excretion of the specific compound employed; the duration
of the treatment; drugs used in combination or coincidential with the specific polypeptide
employed; and like factors well known in the medical arts. For example, it is well
within the skill of the art to start doses of the compound at levels lower than those
required to achieve the desired therapeutic effect and to gradually increase the dosage
until the desired effect is achieved. However, the daily dosage of the products may
be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the
compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0,
100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the
dosage to the subject to be treated. A medicament typically contains from about 0.01
mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg
of the active ingredient. An effective amount of the drug is ordinarily supplied at
a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially
from about 0.001 mg/kg to 7 mg/kg of body weight per day.
[0113] The disclosure also relates to a method for treating a PDAC in a subject having a
high level of βig-h3 in blood with a βig-h3 antagonist (not claimed).
[0114] The disclosure also relates to βig-h3 antagonist for use in the treatment of a PDAC
in a subject having a high level of βig-h3 in blood (not claimed).
[0115] The above method and use of the invention comprise the step of measuring the level
of βig-h3 protein in a blood sample obtained from said subject wherein and compared
to a reference control value.
[0116] A high level of βig-h3 is predictive of a high risk of having or developing a pancreatic
ductal adenocarcinoma and means that βig-h3antagonist must be used.
[0117] Typically, a body fluid sample is obtained from the subject and the level of βig-h3
is measured in this sample. Indeed, statistical analyses revealed that decreasing
βig-h3 levels would be particularly beneficial in those patients displaying high levels
of βig-h3.
Pharmaceutical compositions of the invention:
[0118] The βig-h3 antagonist as described above may be combined with pharmaceutically acceptable
excipients, and optionally sustained-release matrices, such as biodegradable polymers,
to form therapeutic compositions.
[0119] Accordingly, the present disclosure relates to a pharmaceutical composition comprising
a βig-h3 antagonist according to the disclosure and a pharmaceutically acceptable
carrier.
[0120] The present invention relates to a pharmaceutical composition for use in the prevention
or treatment of pancreatic ductal adenocarcinoma comprising a βig-h3 antagonist according
to the invention and a pharmaceutically acceptable carrier.
[0121] "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities
and compositions that do not produce an adverse, allergic or other untoward reaction
when administered to a mammal, especially a human, as appropriate. A pharmaceutically
acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid
filler, diluent, encapsulating material or formulation auxiliary of any type.
[0122] In therapeutic applications, compositions are administered to a patient already suffering
from a disease, as described, in an amount sufficient to cure or at least partially
stop the symptoms of the disease and its complications. An appropriate dosage of the
pharmaceutical composition is readily determined according to any one of several well-established
protocols. For example, animal studies (for example on mice or rats) are commonly
used to determine the maximal tolerable dose of the bioactive agent per kilogram of
weight. In general, at least one of the animal species tested is mammalian. The results
from the animal studies can be extrapolated to determine doses for use in other species,
such as humans for example. What constitutes an effective dose also depends on the
nature and severity of the disease or condition, and on the general state of the patient's
health.
[0123] In therapeutic treatments, the antagonist contained in the pharmaceutical composition
can be administered in several dosages or as a single dose until a desired response
has been achieved. The treatment is typically monitored and repeated dosages can be
administered as necessary. Compounds of the invention may be administered according
to dosage regimens established whenever inactivation of βig-h3 is required.
[0124] The daily dosage of the products may be varied over a wide range from 0.01 to 1,000
mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0,
2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for
the symptomatic adjustment of the dosage to the patient to be treated. A medicament
typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably
from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug
is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body
weight per day, especially from about 0.001 mg/kg to 10 mg/kg of body weight per day.
It will be understood, however, that the specific dose level and frequency of dosage
for any particular patient may be varied and will depend upon a variety of factors
including the activity of the specific compound employed, the metabolic stability,
and length of action of that compound, the age, the body weight, general health, sex,
diet, mode and time of administration, rate of excretion, drug combination, the severity
of the particular condition, and the host undergoing therapy.
[0125] In the pharmaceutical compositions of the present invention for oral, sublingual,
subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration,
the active principle, alone or in combination with another active principle, can be
administered in a unit administration form, as a mixture with conventional pharmaceutical
supports, to animals and human beings. Suitable unit administration forms comprise
oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions
or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous,
transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal,
intrathecal and intranasal administration forms and rectal administration forms.
[0126] The appropriate unit forms of administration include forms for oral administration,
such as tablets, gelatine capsules, powders, granules and solutions or suspensions
to be taken orally, forms for sublingual and buccal administration, aerosols, implants,
forms for subcutaneous, intramuscular, intravenous, intranasal or intraocular administration
and forms for rectal administration.
[0127] In the pharmaceutical compositions of the present invention, the active principle
is generally formulated as dosage units containing from 0.5 to 1000 mg, preferably
from 1 to 500 mg, more preferably from 2 to 200 mg of said active principle per dosage
unit for daily administrations.
[0128] When preparing a solid composition in the form of tablets, a wetting agent such as
sodium laurylsulfate can be added to the active principle optionally micronized, which
is then mixed with a pharmaceutical vehicle such as silica, gelatine, starch, lactose,
magnesium stearate, talc, gum arabic or the like. The tablets can be coated with sucrose,
with various polymers or other appropriate substances or else they can be treated
so as to have a prolonged or delayed activity and so as to release a predetermined
amount of active principle continuously.
[0129] A preparation in the form of gelatin capsules is obtained by mixing the active principle
with a diluent such as a glycol or a glycerol ester and pouring the mixture obtained
into soft or hard gelatine capsules.
[0130] A preparation in the form of a syrup or elixir can contain the active principle together
with a sweetener, which is preferably calorie-free, methyl-paraben and propylparaben
as an antiseptic, a flavoring and an appropriate color.
[0131] The water-dispersible powders or granules can contain the active principle mixed
with dispersants or wetting agents, or suspending agents such as polyvinyl-pyrrolidone,
and also with sweeteners or taste correctors.
[0132] Rectal administration is effected using suppositories prepared with binders which
melt at the rectal temperature, for example cacao butter or polyethylene glycols.
[0133] Parenteral, intranasal or intraocular administration is effected using aqueous suspensions,
isotonic saline solutions or sterile and injectable solutions which contain pharmacologically
compatible dispersants and/or wetting agents, for example propylene glycol, butylene
glycol, or polyethylene glycol.
[0134] Thus a cosolvent, for example an alcohol such as ethanol or a glycol such as polyethylene
glycol or propylene glycol, and a hydrophilic surfactant such as Tween. RTM. 80, can
be used to prepare an aqueous solution injectable by intravenous route. The active
principle can be solubilized by a triglyceride or a glycerol ester to prepare an oily
solution injectable by intramuscular route.
[0135] Transdermal administration is effected using multilaminated patches or reservoirs
into which the active principle is in the form of an alcoholic solution.
[0136] Administration by inhalation is effected using an aerosol containing for example
sorbitan trioleate or oleic acid together with trichlorofluoromethane, dichlorotetrafluoroethane
or any other biologically compatible propellant gas.
[0137] The active principle can also be formulated as microcapsules or microspheres, optionally
with one or more carriers or additives.
[0138] Among the prolonged-release forms which are useful in the case of chronic treatments,
implants can be used. These can be prepared in the form of an oily suspension or in
the form of a suspension of microspheres in an isotonic medium.
[0139] The active principle can also be presented in the form of a complex with a cyclodextrin,
for example .alpha.-, .beta.- or .gamma.-cyclodextrin, 2-hydroxypropyl-.beta.-cyclodextrin
or methyl-.beta.-cyclodextrin.
FIGURES:
[0140]
Figure 1. The main source of βig-h3 in neoplasic lesions is the CAFs.
A. Protocol isolation of ductal cells and CAFs. B. Relative expression of βig-h3 in ductal and CAF isolated compartments (RT-qPCR using
TBP as a house keeping reference gene). C βig-h3 production by CAF in control ex vivo condition of stimulated for 24h with
TGF-β1. ∗∗P <0.01
Figure 2. Soluble βig-h3 production in the microenvironment of the tumor is able to modulate
specific CD8+ T cell responses.
βig-h3 directly modulates CD8+ T cell activation. OT1 T cells were pretreated with rβig-h3 for 24 h and then Ag-specific
activated by adding OVA peptide at 2 different concentrations (10 and 1 ng/ml). Pretreated
conditions are represented in red. Not treated conditions are represented in gray.
A) Quantification of the divided CFSElow OT1 cell after 98h of in vitro cell culture B) Quantification of the total number of OT1 cells after 98h of in vitro cell culture, B) Quantification of the activated CD69+OT1 cells after 98h of in vitro cell culture C) Quantification of the activated CD44+ OT1 cells after 98h of in vitro cell culture. D) Quantification of the total number of CD69+OT1 cells after 98h of in vitro cell culture, E) Quantification of the number of OT1
in presence/absence of CAF cells and anti-βig-h3 neutralizing Ab or control Ab cells
after 98h of in vitro cell culture F) Quantification of the number of OT1 cells in presence/absence of
CAF supernatant and with anti-βig-h3 neutralizing Ab or control Ab cells after 98h
of in vitro cell culture. G) Quantification of anti-tumoral CD8+ T cells from draining lymph nodes (DLN) of p48;Kras mice after 5 days in culture
with tumoral cell line (KC). Representative of 3 independent experiments. ∗P < 0.05. ∗∗P < 0.01
Figure 3. βig-h3 depletion enhances T cell responses in vivo.
Quantification of intra-pancreatic CD8+ T cells (A), EPCAM (ductal tumoral compartment) (B) and αSMA(CAF compartment) (C).
Representative of 3 independent experiments ∗P < 0.05. ∗∗P < 0.01
Figure 4. βig-h3 can be used as a marker of early neoplasic development
A. ELISA determination of the amount of βig-h3 in WT and KC mice at the age of 2 months.
B) ELISA determination of the amount of βig-h3 in the sera of 20 healthy volunteers
and 20 PDAC patients. ∗P < 0.05, ∗∗∗<0.001.
Fig. 5. βig-h3 signals through CD61 on the surface of T cells. (A) Mean fluorescence intensity (MFI) of CD61 expression on CD8+ T cells in spleen and in tumor. (B) MFI of CD61 expression in CD8+ T cells βig-h3-treated or not treated (0) for 24 h. (C) Confocal colocalisation of
CD61 with pLck Y505 was calculated using Zen sofware according to Manders method.
At least 20 images were analyzed for each molecule. The results are representative
of 3 independent experiments. ∗∗∗∗P < 0.0001.
Fig. 6. CD8+ T cells are instrumental for the βig-h3 neutralization effect on tumor growth. (A) Experimental setting. FACS analysis of the percentage of CD45 (B), percentage
of CD8+ T cells among CD45+ cells (C) percentage of EPCAM- among CD45-cells (D). (E)
Experimental setting. (F) FACS analysis of the percentage of EPCAM- among CD45- cells.
The results are representative of 2 independent experiments. ∗P < 0.05.
Fig. 7 Additional cohort of sera of 49 healthy volunteers from blood bank and 104 patients
with PDAC for the presence of soluble βig-h3 as a potential diagnosis marker. ELISA determination of the amount of βig-h3 in the sera ∗∗∗ P <0.001.
EXAMPLE 1:
Material & Methods
Mouse models
[0141] p48-Cre;Kras
G12D were bred and housed in specific pathogen-free conditions and used as a model of
development of PANINs. These mice develop PANIN lesions starting from 1.5 months.
In order to determine the role of βig-h3 molecule in the regulation of specific immune
response OT1/Rag2 KO transgenic mice expressing unique OT1 T cell receptor (CD8
+ T cells) were used. Furthermore, a neutralizing antibody against βigh3 was used in
order to assess the impact of the molecule in the early stages of PANIN development.
[0142] Mouse pancreas of p48-Cre;Kras
G12D or WT animals were isolated by collagen disruption. Ducts were isolated using DBA-lectin-FITC
and subsequent anti-FITC magnetic beads and CAFs by using anti-PDGFRa-PE and anti-PE
magnetic beads and MACS Miltenyi technology. Alternatively, for increase purity we
FACS sort them. The purified populations were injected in Matrigel in recipient mice
(immunocompetant WT C57B16 mice). Antibody i.p injection with anti-TGFBIp neutralizing
monoclonal antibody (provided by In-San Kim, Korea Institute of Science and Technology
Seoul, Korea) or control monoclonal antibody (BioXCell, USA) at a concentration of
300 µg/kg was done in
p48-Cre;Kras
G12D once per week for 4 weeks. Altenatively,
p48-Cre;Kras
G12D cell line (2 different cell lines generated as described previously by Agbunag et
al., 2006 from pancreata of
p48-Cre;Kras
G12D 2.5 month old mice), infused with anti-TGFBIp neutralizing monoclonal antibody or
control Ab were sc injected in matrigel in immunocompetant WT C57B16 mice.
[0143] The impact of T cell population on the tumor tumorigenesis after s.c. transplantation
can be assessed by antibody depletion with anti-CD8 (CD8
+ T cells), anti-CD4 (CD4
+ T cells) or anti-Grl (for monocytes/macrophages) all from BioXCell, USA.
Biological resources:
[0144] Pancreas slides from patients with PANINs, IPMN or PDAC were collected from Bucarest,
Romanian National Institute for Diabetes, Marseille Hopital La Timone and Lyon, Hopital
Edouard Herriot. 6-µm sections from paraffin embedded pancreas were stained for immunhistochemistry
and immunofluoresce. All experimental procedures were approved by Romanian National
Ethics Committee and French National Ethics Committee. Sera were recovered from CRB
(Centre de Ressources Biologiques Centre Leon Berard, Lyon France) BB-0033-00050.
Cell culture
[0145] Cells extracted from draining lymph nodes, pancreas (by collagenase distruption as
previously described Agbunag et al., 2006), spleen were cultured in 96-U-shaped-well
plates (300 000 cells/well) in presence of neutralizing anti-βigh3 Ab or control Ab
(BioXCell, USA) at a final concentration of 6 µg/ml for 24 hours.
Flow cytometry analysis
[0146] For extracellular staining, draining lymph nodes cells or perfused pancreata were
stained with CD8 V450 rat antibody (BD Bioscience), mouse CD4 V500 rat antibody (BD
Bioscience), mouse CD44 A700 rat antibody (BD Bioscience), CD69 FITC (ImmunoTools).
For intracellular staining, draining lymph nodes cells were activated with PMA and
ionomycin (1µg/ml) for 4 hrs at 37°C in 5% CO
2 in RPMI 1640 medium (Invitrogen) supplemented with 10% FCS (Biowest), 10 mM HEPES,
100U/ml penicillin G, 100µg/ml streptomycin, 2mM L-glutamine (Invitrogen) in the presence
of Golgi plug (BD Pharmingen). After activation, cells were stained with CD8 V450
rat antibody (BD Bioscience), mouse CD4 V500 rat antibody (BD Bioscience), permeabilized
using Cytofix-Cytoperm (BD Pharmingen) and further stained with anti-IFNy (clone XMG1.2,
BD Pharmingen), anti-Granzyme B (clone GB12, Invitrogen) and. Flow cytometry analyses
was carried out with BD Fortessa Flow Cytometer (BD Biosciences) and analyzed with
either BD FACS Diva software v5.0.1 (BD) or FlowJo (Tree Star, Inc.).
Reverse transcription and qPCR
[0147] RNAs were extracted by Qiagen kit from pelleted islets according to the manufacturer.
RNA concentrations were measured at Nanodrop. Reverse transcription (RT) was made
on equivalent quantity of extracted RNAs (superior to 300 ng). From cDNA, quantitative
Polymerase Chain Reaction (qPCR) was made with Power SYBR
® Master Mix (Life technologies) with following primers, TBP Forward 5'-TGGTGTGCACAGGAGCCAAG-3'(SEQ
ID N°3), TBP Reverse 5'-TTCACATCACAGCTCCCCAC-3'(SEQ ID N°4) and βig-h3 All-in-oneTM
qPCR (cat no MQP028379) primers from GeneCopoeia.
Immunofluorescence and confocal microscopy
[0148] Slides with 5 µm sections of mouse pancreas included in paraffin were deparaffined.
Sections were unmasked by unmasking solution (Vector H 3300) then saturated with antibody
diluent (Dako) during 30 minutes and incubated with primary antibody diluted in antibody
diluent over night at 4°C (βig-h3 rabbit antibody from Sigma, αSMA from Genetex, CK19
CK19 Troma III from DSHB). For cultured cells, cells were cytospined on slides and
fixed in 0.4% paraformaldehide for 10 min and then permeabilized in 0.1% TritonX-100
for 10 min. Cells were washed in PBS 0.05% Tween and the blocked with antibody diluent
(Dako) 15 min before staining o.n. at 4°C with, βig-h3 rabbit antibody from Sigma,
CD61 from Ebioscience, pErk from Cell Signalling. Slides were incubated with species
specific anti-Fab'2-Alexa 647 and Alexa 555 (Molecular Probes) and mount with Vectashield
Mounting medium with DAPI. Representative images of the localization of each molecule
are shown. All confocal analysis were multiple repeats, and at least 20 images were
analyzed for each molecule. The method use for colocalization quantifications was
previously described (10). Data were rendered and analyzed using Zen software (Zeiss).
Statistical analysis
[0149] P values were calculated with Student's t test, (GraphPad Prism) as specified in
figure legends.
∗P < 0.05;
∗∗P < 0.01;
∗∗∗P < 0.001.
∗∗∗∗P < 0.0001
Results
βig-h3 is expressed early in tumorigenesis in pancreatic neoplasia.
[0150] We have previously shown that in WT pancreas in C57B16 βig-h3 protein is expressed
at low levels in islets of Langerhans (Patry et al., 2015). No expression of the protein
was detected in the exocrine compartment. In contrast, in p48Cre;Kras
G12D (KC) mice developing neoplasia starting from 1.5 months (Hingorani et al., 2003),
we found a significant expression of the protein around the neoplastic lesions. This
expression was maintained, but heterogeneous, at later stages of the neoplastic development
(ie 4.5 and 7 months). Furthermore, we have identified by immunofluorescence staining
that βig-h3 expression was localized around neoplastic ductal cells (PANINs) expressing
ductal marker cytokeratin 19 (CK19) and that is was mostly colocalized with the stromal
marker αSMA as soon as 1.5 months of PANIN development. In order to check for the
relevance of the expression protein pattern in patients with pancreatic cancer, we
have performed immunohistochemistry staining on pancreas adenocarcinoma (PDAC). 15
patients with PDAC have been analyzed and all of them showed the protein expressed
in the extracellular compartment in the stroma around neoplastic ducts but also in
the diffuse carcinoma. Altogether, these results demonstrate for the first time that
βig-h3, a TGF-β/Activins superfamily target, is expressed early during neoplasia in
mice and that this expression was found with the same pattern of staining in human
PDAC.
βig-h3 is restricted to the microenvironment compartment in pancreatic neoplasia.
[0151] Since the pattern of βig-h3 expression showed colocalization with αSMA, we next investigated
which types of cells were producing the protein. Therefore we have isolated from 2.5
months pancreas, the ductal cells and the cancer associated fibroblasts (CAFs) by
magnetic beads sorting (Fig. 1A) (described in mat&methods). After mRNA extraction
we have performed qRT-PCR for βig-h3 transcript. We found that the expression of βig-h3
protein was restricted to the CAF compartment (Figure 1B). We have confirmed these
data at the level of protein since three different CAF cell lines (isolated from KC
mice) were cultivated
in vitro for 24h in complete media or stimulated with TGF-β1 (20 ng/ml). We found that CAFs
produce βig-h3 protein
ex vivo and that this production was further potentiated by TGF-β treatment (Fig. 1C).
Secreted βig-h3 dampens CD8+ T cell Ag-specific responses
[0152] We have previously shown that βig-h3 was able to inhibit diabetogenic T cells to
kill islet beta cells by directly blocking Lck kinase in inactive conformation (Patry
et al., 2015). In order to determine if βig-h3 was able to modulate CD8
+ T cell Ag-specific responses. We treatead OT1 CD8+ T cell with recombinant βig-h3
and further treat the cells with specific OVA SIINFEKL cognate peptide (at 2 different
concentrations). We demonstrate that βig-h3 pretreatment was able to significantly
decrease Ag-specific responses as measured by the number of total (Fig. 2B) and dividing
OT1 (Fig. 2A) cells expressing activation marker CD69 (Fig. 2D) and CD44 (Fig. 2C).
We have further used a neutralizing Ab against βig-h3 in co-culture experiments of
CD8
+ T cells with CAFs. As shown in figure 2E, adding of the neutralizing Ab was not able
to abolish the immune-suppressive of CAFs but was able to block the secreted protein
in the CAF supernatant (Fig. 2F). Furthermore, we have confirmed these results by
using T cells from draining lymph of KC mice stimulated with irradiated pancreas KC
cell line (Fig. 2G). Altogether, these results show for the first time that βig-h3
was able to modulate specific anti-tumoral CD8
+ T cell responses
in vitro.
βig-h3 neutralization in vivo enhances local CD8+ T cell response
[0153] In order to test the impact
in vivo we have treated KC mice with a neutralizing βig-h3 Ab or isotype control antibody
starting starting from the age of 21 days (immediately after weaning). We treated
the mice for once per week for 4 weeks and then evaluated the neoplasia in the pancreas
by FACS staining, immunohistochemistry and immunofluorescence. Treated mice displayed
reduced CK19 staining compared to littermate control Ab treated mice. Furthermore,
this response was associated with increased number of CD8
+ T cells in neoplastic pancreas as detected by immunofluorescence and FACS analysis
(Fig. 3A). We confirmed by FACS that the ductal neoplastic compartment expressing
EPCAM was reduced (Fig. 3B). The number of CAFs as detected by αSMA staining was not
reduced, suggesting that βig-h3 neutralization enhances CD8
+ anti-tumoral responses that kill the neoplastic cell without reducing the number
of CAFs (only by modifying their function).
[0154] In order to test if only the local pancreatic anti-tumoral was sufficient to drive
the elimination of neoplastic cells, we have performed injection of KC cell line into
immunocompetent B6 mice. KC cell line treated with anti-bigh3 neutralizing Ab or control
Ab were injected sc in B6 (in Matrigel) and sacrificed 10 days later. The use of βig-h3
neutralizing Ab leads to significant decrease in tumor size and weight. More importantly
this results were correlated with decreased EPCAM staining and as well as CAF number
(Fig.3A, 3B) as detected by FACS staining. Furthermore, the tumor itself displayed
less cancer initiating cells (as defined in the literature as CD45
-CD44
+CD24
low. Altogether these results show for the first time that βig-h3 neutralization leads
to tumor elimination by enhancing the CD8 anti-tumoral response
in vivo.
βig-h3 can be used as a marker of early neoplasic development
[0155] Since βig-h3 expression occurs early in pancreatic neoplasia we hypothesized that
βig-h3 could be detected in the sera and use as a "predictive marker". We have use
ELISA to detect the amount of βig-h3 in the sera of WT of KC mice. We have detected
significant increase in the amount of bigh3 in the sera of KC mice (69.32 ± 35.70
N=6) compared to WT mice the detection was below the threshold of the ELISA test (Fig
4A).
[0156] As a proof of concept in human PDAC we have tested the sera of 20 healthy volunteers
from blood bank and 20 patients with PDAC for the presence of soluble βig-h3 as a
potential diagnosis marker. As shown in figure 4B there is a significant difference
between healthy volunteers and PDAC patients indicated that this molecule have potential
interest as a biomarker.
EXAMPLE 2
βig-h3 interacts with CD61 on T cell surface
[0157] βig-h3 has been reported to signal through binding to αvβ3 integrins (
Tumbarello DA, et al. Mol Cancer 2012;11:36). Therefore, we searched for the expression of β3 (CD61) at the surface of CD8+ T
cells. We found that both CD8+ T cell present in lymph nodes and in tumors express
CD61 and further noticed that the expression of CD61 was significantly higher in tumor
CD8+ T cells compared to peripheral CD8+ T cells (Fig. 5A). We next confirmed that
βig-h3 was able to signal through CD61 since treatment of CD8+ T cells with recombinant
βig-h3 protein (rβig-h3) led to CD61 internalization (Fig. 5B). As reported before
in diabetis (
Patry M, Diabetes 2015;64:4212-9), treatment of CD8+ T cells with rβig-h3 resulted in the phosphorylation of Lck on
Y505 and its colocalization with CD61 (Fig. 5C). These results show that βig-h3 interacts
with CD61 at the surface of CD8+ T cells leading to the phosphorylation of Lck on
Y505 (
Davis SJ,. Trends Immunol 2011;32:1-5) and subsequently the blocking of this early kinase of the TCR signaling pathway.
CD8+ T cells are mandatory for βig-h3 neutralization effect in vivo
[0158] Since βig-h3 neutralization leads to local accumulation of CD8+ T cells, we thought
to investigate the direct contribution of CD8+ T cells to the process. To test this
hypothesis, we injected KC cell line treated with βig-h3 neutralizing or control Ab
in Rag2KO mice. The mice were further injected i.v with CD8+ T cells isolated from
pancreatic-draining lymph nodes of KC mice (Fig. 6A). We found that while the mice
injected with KC cell line treated with βig-h3 neutralizing Ab displayed a similar
recruitment of CD45+ cells, they were showing an increased accumulation of CD8+ T
cells compared to control-condition treated animals (Fig. 6B and 6C). Moreover, concomitant
to the CD8 T cell enhanced number, we detected a reduced proportion of neoplastic
ductal CD45-/EPCAM+ cells (Fig. 6D). These results suggest that in absence of βig-h3,
the accumulation of CD8+ T cells might be responsible for the diminished proportion
of EPCAM+ cells. A prediction would be that the observed reduction of EPCAM+ population
in the tumor would be rescued by CD8+ T cell depletion. To test this hypothesis, we
performed sub-cutaneous implantation of KC derived cell line treated with βig-h3 neutralizing
or control Ab and subsequently depleted for CD8+ T cells by 2 consecutive iv injections
at day 7 and 8 post tumor-cell-injection (Fig. 6E). These treatments resulted in a
depletion of more than 90% of the CD8+ T cell population without altering the CD4+
T cell or the F4/80 populations. In contrast, the neutralization of CD8 cells was
sufficient to permit the establishment of the same number of EPCAM+ cell in both βig-h3
neutralized or control conditions (Fig. 6F). Altogether, these results indicate that
CD8+ T cells are mandatory for the βig-h3 neutralizing effect on tumor growth in vivo.
βig-h3 can be used as a marker of PDAC
[0159] As a proof of concept in human PDAC we have tested an additional cohort of sera of
49 healthy volunteers from blood bank and 104 patients with PDAC for the presence
of soluble βig-h3 as a potential diagnosis marker. As shown in figure 7 there is a
significant difference between healthy volunteers and PDAC patients indicated that
this molecule have potential interest as a biomarker.
Table 1: Useful nucleotide and amino acid sequences for practicing the invention
| SEQ ID NO |
Nucleotide or amino acid sequence |
| 1 |
MALFVRLLAL |
ALALALGPAA |
TLAGPAKSPY |
QLVLQHSRLR |
| (βig-h3 AA sequence) |
GRQHGPNVCA |
VQKVIGTNRK |
YFTNCKQWYQ |
RKICGKSTVI |
| SYECCPGYEK |
VPGEKGCPAA |
LPLSNLYETL |
GVVGSTTTQL |
| YTDRTEKLRP |
EMEGPGSFTI |
FAPSNEAWAS |
LPAEVLDSLV |
| SNVNIELLNA |
LRYHMVGRRV |
LTDELKHGMT |
LTSMYQNSNI |
| QIHHYPNGIV |
TVNCARLLKA |
DHHATNGVVH |
LIDKVISTIT |
| NNIQQIIEIE |
DTFETLRAAV |
AASGLNTMLE |
GNGQYTLLAP |
| TNEAFEKIPS |
ETLNRILGDP |
EALRDLLNNH |
ILKSAMCAEA |
| IVAGLSVETL |
EGTTLEVGCS |
GDMLTINGKA |
IISNKDILAT |
| NGVIHYIDEL |
LIPDSAKTLF |
ELAAESDVST |
AIDLFRQAGL |
| GNHLSGSERL |
TLLAPLNSVF |
KDGTPPIDAH |
TRNLLRNHII |
| KDQLASKYLY |
HGQTLETLGG |
KKLRVFVYRN |
SLCIENSCIA |
| AHDKRGRYGT |
LFTMDRVLTP |
PMGTVMDVLK |
GDNRFSMLVA |
| AIQSAGLTET |
LNREGVYTVF |
APTNEAFRAL |
PPRERSRLLG |
| DAKELANILK |
YHIGDEILVS |
GGIGALVRLK |
SLQGDKLEVS |
| LKNNVVSVNK |
EPVAEPDIMA |
TNGVVHVITN |
VLQPPANRPQ |
| ERGDELADSA |
LEIFKQASAF |
SRASQRSVRL APVYQKLLER |
MKH |
| 2 |
 |
| (βig-h3 nucleic acid sequence) |
| |
 |
|
|
|
| 3 |
TGGTGTGCACAGGAGCCAAG |
| (TBPi Forward primer) |
| 3 |
TTCACATCACAGCTCCCCAC |
| (TBPi Reverse primer) |
REFERENCES:
[0160] Throughout this application, various references describe the state of the art to
which this invention pertains.
SEQUENCE LISTING
[0161]
<110> INSERM
<120> EARLY AND NON INVASIVE METHOD FOR ASSESSING A SUBJECT'S RISK OF HAVING PANCREATIC
DUCTAL ADENOCARCINOMA AND METHODS OF TREATEMENT OF SUCH DISEASE
<130> BIO16072HENNINO/AF
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 683
<212> PRT
<213> Homo sapiens
<400> 1




<210> 2
<211> 2805
<212> DNA
<213> Homo sapiens
<400> 2


<210> 3
<211> 20
<212> DNA
<213> Artificial
<220>
<223> TBPi Forward primer
<400> 3
tggtgtgcac aggagccaag 20
<210> 4
<211> 20
<212> DNA
<213> Artificial
<220>
<223> TBPi Reverse primer
<400> 4
ttcacatcac agctccccac 20