[0001] The present invention relates to the sector of medicine, more specifically the sector
of oncology.
[0002] Retinoblastoma is the most common malignant intraocular tumour in children, with
an incidence of 1/17,000 newborns. It develops in the retina, usually growing therebelow
towards the vitreous cavity, from cells that have variants predisposed to cancer in
both copies of the Rb1 gene, whether by inherited or acquired mutation. It is a disease
that normally occurs before the age of five years and can be sporadic or hereditary,
if there is a germ line mutation of the Rb1 gene.
[0003] Depending on its presentation, retinoblastoma can be unifocal or multifocal and unilateral
(representing 65% of cases) or bilateral (representing the remaining 35% - with germ
line mutation of the Rb1 gene). Unilateral retinoblastoma only occurs in one of the
patient's eyes, and the average age at the time of diagnosis is 24 months, whereas
bilateral retinoblastoma affects both eyes, with an average age at the time of diagnosis
of 15 months.
[0004] Current treatment of retinoblastoma is aimed primarily at the patient's survival
and secondly at preservation of sight. The optimum treatment is usually complex and
involves experts from multiple disciplines of medicine, such as ophthalmologists,
paediatric oncologists and radiation oncologists, amongst others. There are various
therapeutic options, including especially: systemic or local ocular chemotherapy,
radiotherapy, cryotherapy, laser therapy and surgery (enucleation of the affected
eye). The choice of therapeutic regimen depends on many factors, such as the stage
of tumour development, whether the tumour is unifocal or multifocal and unilateral
or bilateral, the site and size of the tumour, amongst others. Because of the impact
on the eye and its functions, the preferred therapy or treatment of choice is normally
chemotherapy. There is, however, the problem that high-dose chemotherapy is highly
toxic and in a percentage of cases the tumour develops resistance to said treatment.
In these cases, the only therapeutically viable option to preserve the patient's life
is currently enucleation.
[0005] In addition, although retinoblastoma as such is a very curable disease, there is
a fundamental risk of the development of metastases, secondary malignancies or trilateral
retinoblastoma. In these cases, the prognosis is less favourable because there are
no clear and effective therapeutic options for treatment.
[0006] Gene therapy and virotherapy use viruses for therapeutic purposes against cancer.
In gene therapy the virus is modified so as to prevent it from replicating and to
serve as a vehicle or vector for therapeutic genetic material. In contrast, virotherapy
uses viruses that replicate and propagate selectively in the tumour cells. In virotherapy
the tumour cell dies through the cytopathic effect caused by the replication of the
virus inside it rather than through the effect of a therapeutic gene. The preferential
replication in a tumour cell is called oncotropism and tumour lysis is called oncolysis.
Strictly speaking, viruses that replicate selectively in tumours are called oncolytic,
although in a wider meaning the word oncolytic can be applied to any replicating virus
that is able to lyse tumour cells, even non-selectively. In this description the term
oncolytic is used with both meanings.
[0007] Cancer virotherapy far predates gene therapy. The first observations of tumours being
cured with viruses date back to the beginning of the last century. As early as 1912
De Pace achieved tumour regression after inoculating the rabies virus into cervical
carcinomas. Since then, many types of virus have been injected into tumours to treat
them. There are viruses that have natural oncotropism, such as the autonomous parvovirus,
the vesicular stomatitis virus and the reovirus. Other viruses can be genetically
manipulated so that they replicate selectively in tumours. For example, the herpes
simplex virus (HSV) has been made oncotropic by eliminating the ribonucleotide reductase
gene, a dispensable enzymatic activity in actively proliferating cells such as tumour
cells. Adenovirus, however, has been the virus most frequently used in both virotherapy
and gene therapy for cancer because of its low pathogenicity and high ability to infect
tumour cells.
[0008] Fifty-one serotypes of human adenoviruses have been identified, classified into six
groups, differentiated from A to F.
[0009] Human adenovirus serotype 5 (Ad5), which belongs to group C, is a virus formed by
an icosahedral protein capsid containing a 36-kilobase linear deoxyribonucleic acid
(DNA). In adults, Ad5 infection is usually asymptomatic and in children it causes
common cold and conjunctivitis. Ad5 generally infects epithelial cells - the cells
of the bronchial epithelium during a natural infection. It enters the cell by means
of the interaction of the fibre, a viral protein that extends like an antenna from
the twelve vertices of the capsid, with a cell protein involved in intercellular adhesion,
called the Coxsackie-Adenovirus Receptor (CAR). When viral DNA reaches the interior
of the nucleus it starts systematically transcribing the early genes (E1 to E4) of
the virus. The first viral genes to be expressed correspond to early region genes
1A (E1A). E1A binds to the cell protein of the retinoblastoma to release E2F and thus
activate the transcription of other viral genes such as E2, E3 and E4 and the cellular
genes that activate the cell cycle. E1B, for its part, binds to the p53 protein, to
activate the cell cycle and prevent apoptosis of the infected cell. E2 encodes for
virus replication proteins; E3 encodes proteins that inhibit the antiviral immune
response; E4 encodes for proteins that transport viral RNA. Expression of the early
genes leads to replication of the viral DNA, and once this is replicated, the major
late promoter is activated, leading to expression of a messenger ribonucleic acid
(RNA) transcript which, by cutting and differential splicing, generates all the RNAs
that encode for the structural proteins that form the capsid.
[0010] There are two important aspects to be considered in relation to the design of oncolytic
adenoviruses: selectivity and potency. To achieve selectivity towards the tumour cell,
three strategies were used: elimination of viral functions necessary for replication
in normal cells but dispensable in tumour cells; control of the viral genes that initiate
replication by tumour-selective promoters; and modification of the viral capsid proteins
involved in infection of the host cell. By means of these genetic modifications, a
considerable level of selectivity has been achieved, with a tumour-cell replicative
capacity some 10,000 times greater than the replicative capacity in the normal cell.
In relation to oncolytic potency, various genetic modifications for increasing this
have also been described. These modifications include: a) increased viral release,
for example by deletion of E1B19K, overexpression of E3-11.6K (ADP), or relocation
of the protein E3/19K in the plasma membrane; and b) the insertion of a therapeutic
gene into the oncolytic adenovirus genome to generate an "armed oncolytic adenovirus".
In this case, the therapeutic gene would have to mediate the death of the uninfected
carcinogenic cells by activating a prodrug having a bystander effect (in other words,
it kills the uninfected neighbouring cells), activating the immune system against
the tumour, inducing apoptosis, inhibiting angiogenesis, or removing the extracellular
matrix, among other things. In these cases, the form and time of therapeutic gene
expression will be critical for the end result of the therapeutic approach.
[0011] However, the major obstacles encountered by adenoviral therapy in its clinical application
are the immune response, whether pre-existing or generated by the first or subsequent
injections of adenovirus, and the difficulty of adenoviruses being efficiently distributed
throughout the tumour mass, i.e. not infecting solely the surface cells of the tumour
but also reaching those located inside it. This latter difficulty has also been described
for other anti-cancer drugs such as doxorubicin, Taxol [paclitaxel], vincristine and
methotrexate and is thought to be related to the extracellular matrix of the tumour
(involved in the resistance of tumour cells to chemotherapy drugs,
BP Toole et al., "Hyaluronan: a constitutive regulator of chemoresistance and malignancy
in cancer cells", Seminars in Cancer Biology 2008, vol. 18, pp. 244-50). Tumour cells and stromal cells in the tumour produce and assemble a matrix of collagens,
proteoglycans and other molecules that hinder the transport of macromolecules within
the tumour. Hyaluronic acid is one of the main components of said extracellular matrix
involved in the resistance of tumour cells to therapeutic drugs. Hyaluronic acid is
overexpressed in a wide variety of malignant tissues, and in many cases the levels
of said acid are a prognostic factor for tumour progression. The interaction of hyaluronic
acid with the receptors CD44 and RHAMM increases tumour survival and invasion. Moreover,
hyaluronic acid can promote tumour metastases by inducing cell migration and adhesion,
and protecting against the immune system.
[0012] On the other hand, the inhibition of interactions between hyaluronic acid and the
tumour cells, reversing resistance to a large number of drugs, has been described.
Various works have indicated that hyaluronidases, enzymes responsible for the degradation
of hyaluronic acid, increase the activity of various types of chemotherapy in patients
with melanoma, Kaposi's sarcoma, head and neck cancer and hepatic metastases from
the colon. The mechanism of action of hyaluronidases is as yet unknown, but is generally
attributed to a decrease in cell adhesion barriers, reduced interstitial pressure
and improved penetration of the anticancer drug into the tumour, rather than its inhibitory
effects on the signalling pathways related to cell survival.
[0013] Hyaluronidase enzymes are a family of enzymes responsible for degrading hyaluronic
acid. In the human species six genes that encode for hyaluronidase enzymes, having
different properties and locations, have been located to date. The isoforms Hyal1
and Hyal2 are found in most tissues, Hyal1 being the predominant form in human plasma.
Hyal3 is located in the bone marrow and testicles, but its function is not well characterised.
The hyaluronidase enzyme PH20 is highly expressed in the testicles and is involved
in the process by which the oocyte is fertilised by the spermatozoon. The hyaluronidase
enzyme PH20 is anchored to the plasma membrane and the inner acrosomal membrane of
the spermatozoa and gives the spermatozoon the ability to penetrate the extracellular
matrix of the cumulus cells (which are rich in hyaluronic acid) and reach the zona
pellucida of the oocyte. During the acrosome reaction, some of the hyaluronidase enzymes
anchored in the spermatozoon membrane are processed enzymatically to give rise to
a soluble form of the protein, which is released from the acrosomal membrane. The
membrane protein PH20 is the only enzyme in the mammalian hyaluronidase family with
activity at neutral pH.
[0014] In view of the above, there is a need to have alternative therapies, more effective
than the current ones, to treat retinoblastoma. In addition, said alternative treatments
are particularly necessary when the tumour develops resistance to chemotherapy at
the maximum permitted doses and/or the doses to be used show excessively high levels
of toxicity, to avoid enucleating one or both eyes (for cases when the various alternative
treatments with chemotherapy do not have positive effects). New therapeutic alternatives
are also required to allow the risk of the patient developing metastases, secondary
malignancies or trilateral retinoblastoma to be eliminated or reduced.
[0015] After extensive and exhaustive experiments, the inventors of the present invention
have discovered, surprisingly, that it is possible to use genetically modified oncolytic
adenoviruses to treat retinoblastoma and that said oncolytic adenoviruses allow the
risk of metastases, secondary malignancies and/or trilateral retinoblastoma to be
eliminated or reduced. The results obtained by the inventors of the present invention
prove surprising for various reasons, including the fact that the aforementioned modified
oncolytic adenovirus is not effective in infecting cell lines derived from some tumours
yet is so for cell lines derived from retinoblastoma; and, furthermore, in in-vivo
treatments, even though the adenovirus is injected into a theoretically semi-closed
or isolated system (the vitreous cavity), the adenovirus manages to reduce the ability
of the tumour cells to form metastases in comparison with the effect observed when
using conventional chemotherapy. In other words, an effect is observed outside the
eye which is totally unexpected and superior to that observed in conventional therapies
of the prior art.
[0016] As used in the present document, "oncolytic adenovirus" and its plural refer to adenoviruses
capable of replicating themselves or being replication-competent in the tumour cell.
Said oncolytic adenoviruses are differentiated from non-replicating adenoviruses because
the latter are unable to replicate themselves in the target cell.
[0017] According to a first aspect, the present invention discloses a composition comprising
an oncolytic adenovirus for use for treating retinoblastoma, wherein the aforementioned
oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0018] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Intraocular or intravitreal injections
have the advantage that they are performed into an organ, the eye, which provides
an immunoprivileged environment, facilitating a lower immune response, or no response,
to the oncolytic adenovirus comprised in the composition. This situation makes it
possible to ensure, to a large extent, that the action of the oncolytic adenovirus
will remain confined to the eye, since if the adenovirus should ever leave said organ
it could be neutralised by the immune system. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0019] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0020] In a preferred embodiment, the treatment of retinoblastoma takes place in a mammal,
preferably a human, more preferably a paediatric human patient.
[0021] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0022] The oncolytic adenovirus used in the present invention is an oncolytic adenovirus
with replication machinery and a capsid that allows infection and replication in human
cancer cells. In a preferred embodiment, said oncolytic adenovirus is preferably generated
from adenoviruses that infect humans, for example from an adenovirus of serotype 1
to 51, or combinations thereof (hybrid recombinant of two or more different serotypes
of adenovirus) of human adenoviruses. In the most preferred embodiment, the oncolytic
adenovirus used in the present invention is generated from a human adenovirus serotype
5.
[0023] It should be noted that the hyaluronidase enzyme contributes to ensuring greater
or easier dispersion and penetration of the oncolytic adenovirus, thus ensuring that
said adenovirus can reach and infect a larger number of retinoblastoma cells.
[0024] Furthermore, in one embodiment the hyaluronidase enzyme is a mammalian testicular
hyaluronidase enzyme, more preferably a human one (GenBank Gene ID: 6677), also known
as SPAM1 or spermatozoon adhesion molecule 1 or PH20. In one embodiment, the sequence
of said enzyme has the sequence corresponding to the membrane-binding carboxy-terminal
domain deleted from it, in order for the enzyme to be soluble. When this carboxy-terminal
domain is deleted, the resulting enzyme is secreted into the extracellular environment.
[0025] In a preferred embodiment, the sequence encoding a hyaluronidase enzyme inserted
into the oncolytic adenovirus genome is SEQ ID NO: 1, from which nucleotides 1471
to 1527, corresponding to the carboxy-terminal domain, have been deleted.
[0026] It is envisaged that the hyaluronidase enzyme sequence is inserted at any point in
the oncolytic adenovirus genome as long as it allows said adenovirus to replicate
selectively in tumour or cancer cells and as long as the hyaluronidase enzyme is expressed
and produced effectively and functionally in the required quantities. Preferably,
the hyaluronidase enzyme sequence is inserted into the genome of the oncolytic adenovirus
after the nucleotide sequence of the adenovirus fibre.
[0027] Clearly, the expression of the hyaluronidase enzyme is controlled by a promoter operational
in the retinoblastoma cells to be treated. Preferably, the expression of said enzyme
is controlled by a promoter operational in animal cells. Preferably, the promoter
is selected from the group consisting of the cytomegalovirus promoter, the adenovirus
major late promoter, the SV40 promoter, the herpes simplex virus thymidine kinase
promoter, the RSV promoter, the EF1-α promoter, the beta-actin promoter, the human
IL-2 promoter, the human IL-4 promoter, the IFN promoter, the E2F promoter, the human
GM-CSF promoter or combinations thereof. The promoter that regulates the expression
of the enzyme can be present naturally in the adenovirus, as is the case with the
adenovirus major late promoter. The promoter can also be inserted together with the
sequence encoding the enzyme. In a preferred embodiment, the promoter is the adenovirus
major late promoter and this is already located in the oncolytic adenovirus genome.
In this last embodiment it is not necessary to introduce the promoter together with
the hyaluronidase enzyme sequence, but rather the latter is introduced into the oncolytic
adenovirus genome in such a way that it remains under the control of said promoter.
[0028] It is envisaged that the oncolytic adenovirus comprises additional sequences that
allow promotion or optimisation of the protein translation of the sequence encoding
the hyaluronidase enzyme. Said sequences can be inside or outside the hyaluronidase
enzyme gene. For example, said additional sequences are selected from the group consisting
of a sequence of cutting and splicing that allows RNA to be processed, IRES (internal
ribosome entry site) sequences, the picornavirus sequence 2A or combinations thereof.
[0029] The tumour cell-specific replication machinery comprised by the oncolytic virus used
in the present invention is machinery that, as explained above, causes the oncolytic
adenovirus to replicate itself in a specific form in tumour cells and not in healthy
or normal cells. Said machinery can take different forms if, as a result, it provides
oncolytic adenoviruses with a replicative capacity solely in the retinoblastoma (tumour)
cells - in other words, adenoviruses with selective replication in which their replication
machinery requires the virus to enter the cancer or tumour cells in order for the
virus to replicate itself. In this respect, the oncolytic adenovirus used can have
modifications in its genome sequence that give it selective replication in tumour
cells.
[0030] In one embodiment this is achieved with the incorporation of a specific tissue promoter
or a specific tumour promoter, where said promoter controls the expression of one
or more genes in the group E1a, E1b, E2 and E4. In particular, the promoter is selected
from the group consisting of the E2F promoter, the telomerase hTERT promoter, the
tyrosinase promoter, the prostate-specific antigen (PSA) promoter, the alpha-fetoprotein
promoter, the COX-2 promoter, as well as artificial promoters formed by various transcription
factor binding sites such as binding sites for hypoxia-inducible factor (HIF-1), the
ETS transcription factor, the tumour cytotoxic factor (TCF), the E2F transcription
factor or the Sp1 transcription factor. Preferably, the promoter controls the expression
of E1a.
[0031] In a preferred embodiment, the specific replication machinery for tumour cells is
defective replication machinery that can be complemented in tumour cells with both
defective copies of the Rb1 gene. In other words, this is replication machinery that
is mutated or modified such that when it enters healthy (non-tumour) cells it is not
expressed or is expressed in such a way that it does not lead to viral replication.
Instead, when the oncolytic adenovirus enters a tumour cell with the characteristics
mentioned above, the replication machinery acquires sufficient complementation (the
tumour cell performs the functions lacking in the virus) for the virus to be able
to be replicated (complete its cycle, producing viruses and leading to lysis of the
tumour cell). In this embodiment, one option for achieving said selective replication
in tumour cells with both defective copies of the Rb1 gene is the elimination of early
functions of E1A that block the retinoblastoma (RB) pathway. Other viral genes that
interact directly with the retinoblastoma protein, such as E4 and E4orf6/7 respectively,
are candidates for deletion or truncation in order to achieve selective replication
in tumour cells with both defective copies of the Rb1 gene. In the most preferred
embodiment, the oncolytic adenovirus used in the present invention is characterised
by the deletion Δ24, which affects the interaction of E1a with the retinoblastoma
protein, and the insertion of four sites binding to E2F-1 and one site binding to
Sp1 into the endogenous E1a promoter to control the expression of E1a. Said DNA sequence
corresponds to SEQ ID NO: 2 in the attached list of sequences.
[0032] Other modifications that comply with the above, i.e. allow specific replication of
oncolytic adenoviruses in retinoblastoma tumour cells, are also provided for and included
in the present invention.
[0033] The two strategies explained for achieving selective replication in retinoblastoma
are not mutually exclusive.
[0034] Furthermore, it is envisaged that the oncolytic adenovirus used in the present invention
comprises one or more modifications in the capsid allowing increased affinity of said
oncolytic adenovirus for the cancer or tumour cells (modifications in its capsid to
increase its infectivity with regard to the cancer or tumour cells or to direct it
to a receptor present in said cancer or tumour cells). In this way, the proportion
of oncolytic adenoviruses infecting cancer or tumour cells is increased compared with
those infecting healthy cells, and the latter adenoviruses can even reach a negligible
amount compared with the former.
[0035] In one embodiment, the oncolytic adenovirus used in the present invention has been
modified genetically so as to include, in the adenovirus capsid proteins, ligands
that increase infectivity or direct the virus to a receptor in the cancer or tumour
cell. Directing the adenovirus to the tumour can also be achieved with bifunctional
ligands that bind to the virus on one side and to the tumour receptor on the other.
In a preferred embodiment, the oncolytic adenovirus used in the present invention
has the capsid modified to increase its infectivity or to direct it better to the
target tumour cell, such that the binding domain KKTK of the heparan sulfates present
in the adenovirus fibre has been replaced by the domain RGDK. Said modification relates
to positions 91 to 94 of the adenovirus fibre, taking the standard sequence of the
adenovirus serotype 5 fibre as the reference. The sequence SEQ ID NO: 9 shows the
complete sequence of the adenovirus type 5 fibre protein with the modified version
in its heparan sulfate binding domain (modification RGDK).
[0036] Furthermore, it is also possible to modify the capsid of the viruses for other purposes,
for example to increase the persistence of the oncolytic adenovirus in blood and thus
increase the possibilities of said adenovirus reaching tumour nodules (particularly
if said nodules or tumour foci are disseminated). For example, the capsid can be covered
with polymers such as polyethylene glycol.
[0037] Therefore, in the most preferred embodiment, the oncolytic adenovirus used in the
present invention is generated from a human adenovirus serotype 5 and comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome, more preferably
the human testicular hyaluronidase enzyme sequence (PH20, SEQ ID NO: 1) from which
the sequence corresponding to the membrane-binding carboxy-terminal domain has been
deleted in order for the enzyme to be soluble.
- deficient replication machinery that can be complemented in tumour cells by both defective
copies of the Rb1 gene; more preferably said machinery comprises the deletion Δ24,
which affects the interaction of E1a with the Rb protein, and the insertion of four
binding sites to E2F-1 and one binding site to Sp1 into the endogenous E1a promoter
to control the expression of E1a;
- modification of the adenovirus capsid to increase the infectivity of said virus or
to direct said adenovirus better to the target tumour cell; more preferably the binding
domain KKTK of the heparan sulfates present in the adenovirus fibre has been replaced
by the domain RGDK.
[0038] Preferably, the oncolytic virus sequence of the present invention corresponds to
SEQ ID NO: 3.
[0039] The oncolytic adenovirus used in the present invention can have inserted into its
genome other genes in common use in the field of gene therapy for cancer to increase
the cytotoxicity of oncolytic adenoviruses on tumour cells, for example the thymidine
kinase gene, the cytosine deaminase gene, proapoptotic genes, immunostimulants, tumour
suppressors or prodrug activators.
[0040] To construct the oncolytic adenovirus to be used in the present invention (i.e. as
explained above), use is made of any of the methods of construction of genetically
modified adenovirus known in the field of gene therapy and virotherapy using adenoviruses.
The most commonly used method is based on first constructing the desired genetic modification
in a plasmid containing the adenoviral region to be modified, and then carrying out
homologous recombination in bacteria with a plasmid containing the rest of the viral
genome.
[0041] The oncolytic adenovirus used in the present invention is propagated and amplified
in cell lines normally used in the field of gene therapy and virotherapy such as the
lines HEK-293 (Reference number: ATCC CRL-1573) and A549 (Reference number: ATCC CCL185).
A preferred method of propagation of said adenovirus is by infection of a cell line
permitting the replication of the adenovirus. The lung adenocarcinoma line A549 is
an example of a line with such characteristics. Propagation takes place, for example,
as follows: the A549 cells are grown on plastic cell culture plates and are infected
using 100 virus particles per cell. Two days later, the cytopathic effect reflecting
virus production can be observed as a clustering of the cells. The cells are collected
and stored in tubes. After centrifuging at 1000 g for 5 minutes, the cell pellet is
frozen and thawed three times, to lyse the cells. The resulting cell extract is centrifuged
at 1000 g for 5 minutes and the supernatant, in which the viruses are located, is
loaded over a caesium chloride gradient and centrifuged for 1 hour at 35,000 g. The
virus band obtained from the gradient is loaded again over another caesium chloride
gradient and centrifuged for 16 hours at 35,000 g. The virus band is collected and
dialysed opposite PBS-10% glycerol. The virus dialysate is aliquoted and stored at
-80 ºC. The number of plaque-forming units and particles is quantified following standard
protocols known in the prior art. Phosphate-buffered saline (PBS) with 5% glycerol
is a standard formulation for storing adenoviruses. However, new formulations improving
virus stability have been described. The methods for purifying the adenovirus containing
the hyaluronidase gene for use in cancer treatment are the same as those described
for other adenoviruses and adenoviral vectors used in the prior art in virotherapy
and gene therapy for cancer.
[0042] It will be understood that the composition used in the present invention is used
in a pharmaceutically acceptable presentation. This means that said composition may
additionally comprise pharmaceutically acceptable excipients.
[0043] The dose of oncolytic adenovirus required can be determined by the person skilled
in the art, taking various parameters into account, for example the volume of the
vitreous cavity, the volume of the retinoblastoma to be treated or the age and weight
of the patient to be treated. It will be understood that the dose must be a therapeutically
effective quantity of oncolytic adenovirus in order to produce a positive therapeutic
effect on the retinoblastoma, "positive therapeutic effect" meaning the maintenance
or reduction of retinoblastoma volume.
[0044] Obviously, the person skilled in the art will adapt the composition depending on
the particular method of administration, taking particular account of the route of
administration to be used.
[0045] The composition can also be administered in a therapeutic regimen that includes the
administration of one or more other anti-tumour agents (such as one or more chemotherapy
drugs) and/or one or more of the other aforementioned therapies conventionally used
for treating retinoblastoma. The composition used in the present invention in relation
to these other therapeutic agents and or therapies can be administered prior to, at
the same time as or after the same. When the composition used in the present invention
is administered at the same time as one or more other anti-tumour agents, said one
or more other anti-tumour agents can be included in the composition used in the present
invention or can be administered as separate compositions.
[0046] Alternatively, the composition used in the present invention, comprising the oncolytic
adenovirus as explained above, can be used alone in a therapeutic regimen for treating
retinoblastoma, i.e. without using other anti-tumour agents and/or other conventional
therapies.
[0047] According to a second aspect, the present invention discloses a composition comprising
an oncolytic adenovirus for use for preventing, removing or reducing metastases, secondary
malignancies and or trilateral retinoblastoma associated with retinoblastoma, wherein
the aforementioned oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0048] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0049] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0050] In a preferred embodiment, the prevention, removal or reduction of metastases, secondary
malignancies and/or trilateral retinoblastoma associated with retinoblastoma takes
place in a mammal, preferably a human, more preferably a paediatric human patient.
[0051] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0052] The oncolytic adenovirus used is the same as has been explained previously.
[0053] The composition and the form in which said composition is used or can be administered
is also the same as has been explained previously.
[0054] According to a third aspect, the present invention relates to a composition comprising
an oncolytic adenovirus for use thereof in the treatment of retinoblastoma, wherein
the aforementioned oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0055] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0056] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0057] In a preferred embodiment, the treatment of retinoblastoma takes place in a mammal,
preferably a human, more preferably a paediatric human patient.
[0058] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0059] The oncolytic adenovirus used is the same as has been explained previously.
[0060] The composition and the form in which said composition is used or can be administered
is also the same as has been explained previously.
[0061] According to a fourth aspect, the present invention relates to a composition comprising
an oncolytic adenovirus for use thereof in the prevention, removal or reduction of
metastases, secondary malignancies and/or trilateral retinoblastoma associated with
retinoblastoma, wherein the aforementioned oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0062] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0063] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0064] In a preferred embodiment, the prevention, removal or reduction of metastases, secondary
malignancies and/or trilateral retinoblastoma associated with retinoblastoma takes
place in a mammal, preferably a human, more preferably a paediatric human patient.
[0065] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0066] The oncolytic adenovirus used is the same as has been explained previously.
[0067] The composition and the form in which said composition is used or can be administered
is also the same as has been explained previously.
[0068] According to a fifth aspect, the present disclosure relates to a method for treating
retinoblastoma in a patient requiring the same, comprising the administration of a
therapeutically effective amount of a composition comprising an oncolytic adenovirus,
wherein the aforementioned oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0069] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0070] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0071] In a preferred embodiment, the patient requiring treatment of retinoblastoma is a
mammal, preferably a human, more preferably a paediatric human patient.
[0072] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0073] The oncolytic adenovirus used is the same as has been explained previously.
[0074] The composition and the form in which said composition is used or can be administered
is also the same as has been explained previously.
[0075] According to a final aspect, the present disclosure relates to a method for preventing,
removing or reducing metastases, secondary malignancies and/or trilateral retinoblastoma
associated with retinoblastoma in a patient requiring the same, comprising the administration
of a therapeutically effective amount of a composition comprising an oncolytic adenovirus,
wherein the aforementioned oncolytic adenovirus comprises:
- a sequence encoding a hyaluronidase enzyme inserted into its genome; and
- replication machinery specific for tumour cells.
[0076] Said composition is injected by any route ensuring that the necessary amount of the
adenovirus reaches the interior of the eyeball, preferably by intraocular injection,
even more preferably intravitreal injection. Therefore, in a preferred embodiment,
the aforementioned composition takes an appropriate form for intravitreal or intraocular
administration or injection.
[0077] Another possible route of administration for the composition provided for in the
present invention is intratumoral injection.
[0078] In a preferred embodiment, the patient requiring prevention, removal or reduction
of metastases, secondary malignancies and/or trilateral retinoblastoma associated
with retinoblastoma is a mammal, preferably a human, more preferably a paediatric
human patient.
[0079] In another preferred embodiment, the retinoblastoma treated is a retinoblastoma resistant
to conventional chemotherapy and/or radiotherapy treatment; even more preferably said
retinoblastoma is refractory or the result of a relapse and is resistant to conventional
chemotherapy and/or radiotherapy treatment.
[0080] The oncolytic adenovirus used is the same as has been explained previously.
[0081] The composition and the form in which said composition is used or can be administered
is also the same as has been explained previously.
[0082] The inventors of the present invention have therefore managed to resolve the problems
present in the prior art, since they have been able to ascertain that the use of oncolytic
adenoviruses having the characteristics mentioned above makes it possible to provide
an alternative therapeutic method to those currently available that allows enucleation
of the eye to be avoided, and to provide a method that prevents, reduces or avoids
the development of metastases, secondary malignancies or trilateral retinoblastoma
associated with retinoblastoma.
[0083] For better understanding, the present invention is described in greater detail below
with reference to the attached figures, which are presented by way of example, and
with reference to illustrative but nonlimiting examples. Said examples are carried
out in cell cultures (in vitro) and in animal models (mouse and rabbit), both recognised
and accepted as reliable models representative of retinoblastoma in the scientific
world, on the basis of which a person skilled in the art will recognise the direct
application of the methods and treatments of the present invention in humans.
Fig. 1 shows the results of the Western blot mentioned in example 2. In said Western
blot the expression of the protein E1A is analysed in the various cell lines analysed.
Retinal explants were used as a general control and, as a control of expression, the
presence of tubulin was measured. In this figure, row 1 shows the expression of E1A
and row 2 the expression of tubulin. With regard to the various columns, column A
relates to the primary cell line HSJD-RBT1; column B relates to the primary cell line
HSJD-RBVS1; column C relates to the primary cell line HSJD-RBT2; column D relates
to the primary cell line HSJD-RBVS2, column E relates to the primary cell line HSJD-RBVS3;
column F relates to the primary cell line HSJD-RBT5; column G relates to the primary
cell line HSJD-RBT7; column H relates to the primary cell line HSJD-RBT8; column I
relates to the primary cell line HSJD-RBVS8; column J relates to the cell line Y79;
and column K relates to retinal explants.
Fig. 2 shows in graph form the survival of treated eyes and control eyes according
to the Kaplan-Meier method for the study described in example 3. Fig. 2A relates to
the results obtained by generating orthotopic tumours in mice using the cell line
Y79; Fig. 2B relates to the results obtained by generating orthotopic tumours in mice
using the primary cell line HSJD-RBT2; Fig. 2C relates to the results obtained by
generating orthotopic tumours in mice using the primary cell line HSJD-RBT5; Fig.
2D relates to the results obtained by generating orthotopic tumours in mice using
the primary cell line HSJD-RBVS1; Fig. 2E relates to the results obtained by generating
orthotopic tumours in mice using the primary cell line HSJD-RBT7; and Fig. 2F relates
to the results obtained by generating orthotopic tumours in mice using the primary
cell line HSJD-RBVS8.
Fig. 3 shows in graph form the survival of treated eyes and control eyes according
to the Kaplan-Meier method for the study described in example 4. Fig. 3A relates to
the results obtained by generating orthotopic tumours in mice using the cell line
Y79; Fig. 3B relates to the results obtained by generating orthotopic tumours in mice
using the primary cell line HSJD-RBT-002; and Fig. 3C relates to the results obtained
by generating orthotopic tumours in mice using the primary cell line HSJD-RBT-005.
Fig. 4 shows in graph form the survival of treated eyes and control eyes according
to the Kaplan-Meier method for the study described in example 5.
Fig. 5 shows in graph form the survival of treated eyes and control eyes according
to the Kaplan-Meier method for the study described in example 6.
Example 1. Generation of the oncolytic adenovirus VCN-01
[0084] The cDNA of hyaluronidase PH20 was obtained by PCR amplification (polymerase chain
reaction amplification technique) of the various exons of the protein from the genome
of the cell line A549 and subsequent binding of these exons with specific oligonucleotides
that contain the target of the restriction enzyme Mfel. The resulting fragment was
digested with Mfel and cloned by ligation in the shuttle plasmid, pNKFiberRGD (containing
the sequence of the adenovirus fibre modified with RGD), to generate the plasmid pNKFiberPH20.
The cDNA corresponding to the PH20 protein cloned in the plasmid pNKFiberPH20 is shown
in SEQ ID NO: 1. SEQ ID NO: 1 shows the nucleotides coding for the PH20 protein from
the start of its transcription (ATG) to position 1470. The nucleotide sequence of
region 1471 to 1527 encodes for the hydrophobic tail of the protein, which is responsible
for anchoring it to the membrane. Said sequence was deleted. After the position 1470
the translation stop codon TAA was added.
[0085] To generate the plasmid pAdwtRGD-PH20, the adenovirus fibre gene of the plasmid pVK50cau
(which contains the complete Ad5 sequence with a Swal target in the fibre) was replaced
by homologous recombination in yeast, according to procedures known in the prior art,
by the fibre gene followed by the hyaluronidase PH20 gene of the plasmid pNKFiberPH20
digested with Notl/Kpnl.
[0086] The adenoviral plasmid pICOVIR17 was used to generate the adenovirus ICOVIR17 (SEQ
ID NO: 17). To generate this plasmid, the adenovirus fibre gene of the plasmid pICOVIR15
was replaced by homologous recombination in yeast by the fibre gene followed by the
hyaluronidase PH20 gene of the plasmid pAdwtRGD-PH20 digested with Spel/Pacl.
[0087] The adenovirus ICOVIR15 (SEQ ID NO: 4) comes from the adenovirus AdΔ24RGD, characterised
by containing the deletion Δ24 in the sequence coding for the protein E1a. This deletion
affects the interaction of E1a with the retinoblastoma protein. AdΔ24RGD also has
the insertion of the RGD peptide in the adenovirus fibre, to increase the infectivity
of the virus. These two modifications were described in
K. Suzuki et al., "A conditionally replicative adenovirus with enhanced infectivity
shows improved oncolytic potency", Clin Cancer Res 2001, vol. 7, pp. 120-6. Starting from AdΔ24RGD, four binding sites to E2F-1 and one binding site to Sp1
were inserted into the endogenous E1a promoter to control the expression of E1a. In
this way ICOVIR15 was obtained. This insertion was carried out by replacing the sequence
419-422 of the genome by the sequence with the four binding sites to E2F-1 and one
binding site to Sp1, such that the final sequence is that shown in SEQ ID NO: 4. To
do this, a single cleavage site BsiWI was created by mutagenesis directed to the E1A
promoter of pEndK/Spe (
J. E. Carette et al., "Conditionally replicating adenoviruses expressing short hairpin
RNAs silence the expression of a target gene in cancer cells", Cancer Res 2004, vol.
64, pp. 2663-7). The binding site to Sp1 was introduced into the pEndK/Spe plasmid with the site
BsiWI by ligation of said plasmid digested with BsiWI with the oligonucleotides Sp1F
(SEQ ID NO: 5 - 5'-GTACGTCGACCACAAACCCCGCCCAGCGTCTTGTCATTGGCGTCGACGCT-3') and Sp1R
(SEQ ID NO: 6 - 5'-GTACAGCGTCGACGCCAATGACAAGACGCTGGGCGGGGTTTGTGG TCGAC-3') paired
together. The binding sites to E2F were introduced by means of binding the oligonucleotides
E2FF2 (SEQ ID NO: 7 - 5'-GTACGTCGGCGGCTCGTGGC TCTTTCGCGGCAAAAAGGATTTGGCGCGTAAAAGTGGTTCGAA-3')
and E2FR2 (SEQ ID NO: 8 - 5'-GTACTTCGAACCACTTTTACGCGCCAAATCCTTTTTGCCGCGAAAGAGCCAC
GAGCCGCCGAC-3') paired together, to create the plasmid pEndK415Sp1 E2F2. Next, the
CAU sequence, which contains the elements required for plasmid replication in yeast
- a centromere, the autonomous recombination sequence ARS and the selection marker
URS3 - was introduced by homologous recombination in yeast, to create the plasmid
pEndK415Sp1 E2F2CAU. Finally, homologous recombination in yeast of the plasmid pEndK415Sp1
E2F2CAU, digested with Kpnl, with the adenoviral genome of the adenovirus AdΔ24RGD,
was carried out to construct pICOVIR15cau. ICOVIR15 was obtained by transfection of
Pacl digestion of pICOVIR15cau to HEK293 cells (ATCC reference number CRL-1573).
[0088] The adenovirus ICOVIR17, which contains the same modifications as ICOVIR15, plus
the insertion of the hyaluronidase gene after the adenovirus fibre gene, was generated
by digestion with Pacl of the pICOVIR17 plasmid and transfection into HEK293 cells.
[0090] The sequence SEQ ID NO: 9 shows the complete sequence of the adenovirus serotype
5 fibre protein with the modified version in its heparan sulfate binding domain (modification
RGDK). The adenovirus ICOVIR17 contains a version of the adenovirus fibre gene into
which the peptide RGD-4C has been inserted (Cys-Asp-Cys-Arg-Gly-Asp-Cys-Phe-Cys; CDCRGDCFC;
SEQ ID NO: 10) into the HI region of the knob domain of the protein (hypervariable
loop of the adenovirus capsid, evolutionarily non-conserved and highly exposed). VCN-01
is completely analogous to ICOVIR17 apart from the fibre gene, since in this case
the VCN-01 fibre differs only from the native form of human adenovirus serotype 5
in that the amino acids
91KKTK
94 have been replaced by the peptide with a high affinity for integrins
91RGDK
94, in the shaft domain of the protein.
Example 2. Cytotoxicity in primary cultures of retinoblastoma refractory to conventional treatment
with chemotherapy and/or radiotherapy.
[0091] First, IC50 was studied in various primary cultures obtained from retinoblastomas
showing resistance to conventional chemotherapy and/or radiotherapy treatment. The
cell line Y79 (ATCC reference number HTB-18) was also analysed.
[0092] To obtain the various primary cultures, tumour samples were first taken from enucleated
eyes of patients with retinoblastoma at the Sant Joan de Deu Hospital (HSJD, Barcelona),
under a protocol approved by the corresponding Ethics Committee and with an Informed
Consent. The specimens were collected from two possible sources: solid tumour tissue
in the retina (retinoblastoma tumour; RBT) or from the tumour seeds in the vitreous
body (retinoblastoma vitreous seedings; RBVS). To obtain cell suspensions of the RBT
specimens, these were disaggregated using a mixture of collagenase (5 mg/mL) and DNAse
(40 Kunitz units/mL) (Sigma, St Louis, MO) at 37°C for 5 min; cells from RBVS samples
were collected by centrifugation. After two washes with PBS, the tumour cells were
cultured as tumour-spheres floating in a serum-free neural stem cell medium.
[0093] To determine the IC
50 values of VCN-01, tests were carried out with each line on 96-well plates seeded
with 5000 cells per well. After being cultured for 24 hours, the cells were exposed
to increasing doses of VCN-01 for 11-14 days in triplicate. At this point the metabolic
activity of each well was determined using the reagent MTS (Promega, Fitchburg, WI,
USA) and according to procedures known in the prior art. Based on these values and
using Graphpad Prism 5 software (La Jolla, CA, USA), the concentration of VCN-01 that
was causing a 50% decrease in cell proliferation (IC
50 value) was calculated.
Table 1. IC
50 results obtained in primary cultures of retinoblastoma refractory to conventional
chemotherapy and/or radiotherapy treatment; and in the cell line Y79.
| Cell model |
IC50 (TU/cell) (95% confidence interval) |
| HSJD-RBT-1 |
5.47 (4.81-6.21) |
| HSJD-RBVS-1 |
>100 (not sensitive) |
| HSJD-RBT-2 |
8.01 (5.69-11.29) |
| HSJD-RBVS-3 |
2.97 (1.60-5.50) |
| HSJD-RBT-5 |
0.0825 (0.0489-0.139) |
| HSJD-RBT-7 |
8.82 (4.29-18.14) |
| HSJD-RBT-8 |
27.29 (21.73-34.03) |
| Y79 |
0.0809 (0.0662-0.0988) |
[0094] As can be seen in Table 1, VCN-01 demonstrated great cytotoxicity in all the cell
lines tested except for one (HSJD-RBVS1), from which it can be deduced that not only
can said oncolytic adenovirus correctly infect a large number of primary cell lines
derived from retinoblastoma but that it also has high cytotoxic activity in them.
[0095] Furthermore, expression of the adenoviral protein E1A was analysed 24 hours from
infection of the cell lines by Western blotting (said expression indicated that the
defective replication machinery of VCN-01 was correctly complemented by the machinery
of the corresponding tumour cell). As can be seen in Fig. 1, expression of the protein
E1A was observed in all the cell lines mentioned above apart from the cell line HSJD-RBVS1,
which agrees or correlates with the IC
50 results obtained and shown in Table 1.
Example 3. Anti-tumour activity in various orthotopic models of human retinoblastoma in mice
treated with an injection of VCN-01 or vehicle.
[0096] Female athymic mice (Hsd:Athymic Nude-Foxn1nu) aged 6 weeks were injected with 200,000
cells of the corresponding primary cell line or the cell line Y79 in 2 µL Matrigel,
into the vitreous cavity of both eyes. On the eighth day, an intravitreal injection
of the 100x dose of VCN-01 (2 µL with a total content of 3x10
9 virus particles per eye) was applied to the right eyes of each animal. The contralateral
(left) eyes were injected by the intravitreal route with the vehicle in which VCN-01
(20 mM Tris pH 8.0 25 mM NaCl, 2.5% glycerol) had been diluted.
[0097] The distribution of mice in each of the experimental groups was as indicated in Table
2.
Table 2. Experimental groups and number of mice per study group in example 3.
| Group (cell line with which the orthotopic tumour is generated in the eyes of the
mice) |
Number of mice in the treated group |
| Cell line Y79 |
17 |
| HSJD-RBT2 |
6 |
| HSJD-RBT5 |
6 |
| HSJD-RBVS1 |
6 |
| HSJD-RBT7 |
6 |
| HSJD-RBVS8 |
5 |
[0098] In this case, what was studied was the survival of the treated and control eyes,
i.e. the number of days until the size of the retinoblastoma required enucleation
of said eye.
[0099] As can be seen in Fig. 2, eyes treated with the adenovirus VCN-01 survive in greater
numbers and for a longer time in all the groups analysed (that is to say, irrespective
of the cell line used for implanting the orthotopic tumour in the mouse eye, a significant
improvement was observed when applying treatment with the adenovirus VCN-01).
Example 4. Anti-tumour activity in various orthotopic models of human retinoblastoma in mice
treated with two injections of VCN-01 or vehicle.
[0100] Female athymic mice (Hsd:Athymic Nude-Foxn1nu) aged 6 weeks were injected with 200,000
cells of the corresponding primary cell line or the cell line Y79 in 2 µL Matrigel,
into the vitreous cavity of each eye. On the eighth day, an intravitreal injection
of the 100x dose of VCN-01 (2 µL with a total content of 3x10
9 virus particles) was applied to both eyes of the mice in the treated group, and the
mice of the other group (control group) were given an intravitreal injection of vehicle
(20 mM Tris pH 8.0, 25 mM NaCl, 2.5% glycerol) into each eye. On the twenty-second
day, the therapeutic procedure was repeated, i.e. an intravitreal injection of the
100x dose of VCN-01 (2 µL with a total content of 3x10
9 virus particles) was applied to both eyes of the mice in the treated group, and the
mice of the other group (control group) were given an intravitreal injection of the
same vehicle also into both eyes.
[0101] The distribution of mice in each of the experimental groups was as indicated in Table
3.
Table 3. Experimental groups and number of mice per study group in example 4.
| Group (cell line with which the orthotopic tumour is generated in the eyes of the
mice) |
Number of mice in the control group |
Number of mice in the treated group |
| Cell line Y79 |
6 |
6 |
| HSJD-RBT2 |
6 |
6 |
| HSJD-RBT5 |
6 |
6 |
[0102] In this case too, the survival of the treated and control eyes was studied, i.e.
the number of days until the size of the retinoblastoma required enucleation of said
eye.
[0103] As can be seen in Fig. 3, eyes treated with the adenovirus VCN-01 survive in greater
numbers and for a longer time in all the groups analysed (that is to say, irrespective
of the cell line used for implanting the orthotopic tumour in the mouse eye, a significant
improvement was observed when applying treatment with the adenovirus VCN-01).
Example 5. Dose escalation study of VCN-01 in mice.
[0104] Female athymic mice (Hsd:Athymic Nude-Foxn1nu) aged 6 weeks were injected with 200,000
cells of the primary cell line HSJD-RBT2 (day 0) in 2 µL Matrigel. Next, said mice
were treated according to the following groups and the following regimen:
Table 4. Groups and treatment days in the study in example 5. The days are indicated
by taking day 0 to be the day when the cells of the primary line of retinoblastoma
are injected or implanted to generate the orthotopic tumours.
| Group (treatment applied) |
Number of mice in the group |
Injection days (for VCN-01 and vehicle) / Chemotherapy days |
| Vehicle (control group; 20 mM Tris pH 8.0 25 mM NaCl, 2.5% glycerol) |
7 |
8 and 22 |
| Systemic chemotherapy (Carboplatin/Etoposide) (6 mg/kg etoposide and 34 mg/kg carboplatin) |
7 |
8, 29 and 50 |
| VCN-01 dose 100x (3x109 virus particles per eye) |
6 |
8 and 22 |
| VCN-01 dose 10x (3x108 virus particles per eye) |
7 |
8 and 22 |
| VCN-01 dose 3x (1x108 virus particles per eye) |
7 |
8 and 22 |
| VCN-01 dose 1x (3x107 virus particles per eye) |
7 |
8 and 22 |
[0105] The parameter analysed was the survival of the treated and control eyes, i.e. the
number of days until the size of the retinoblastoma required enucleation of said eye.
[0106] The results obtained are summarised in Fig. 4. As can be seen in said figure, all
the tested doses of VCN-01 gave significantly better results for eye survival than
the control or chemotherapy treatment groups. In addition, it was possible to ascertain,
surprisingly, that the dose that offered greatest survival of the eye for a longer
time was 10x.
Example 6. Dose escalation study of VCN-01 in mice.
[0107] Female athymic mice (Hsd:Athymic Nude-Foxn1nu) aged 6 weeks were injected with 200,000
cells of the primary cell line HSJD-RBT2 (day 0) in 2 µL Matrigel. Next, said mice
were treated according to the following groups and the following regimen:
Table 5. Groups and treatment days in the study in example 5. The days are indicated
by taking day 0 to be the day when the cells of the primary line of retinoblastoma
are injected or implanted to generate the orthotopic tumours.
| Group (treatment applied) |
Number of mice in the group |
Injection days (for VCN-01 and vehicle) / Chemotherapy days |
| Vehicle (control group; 20 mM Tris pH 8.0 25 mM NaCl, 2.5% glycerol) |
8 |
8 and 22 |
| Intravitreal chemotherapy (Melphalan; 0.033 µg in 2 µL per eye) |
5 |
8 and 22 |
| VCN-01 HIGH dose (3x108 virus particles per eye) (10x VCN-01) |
7 |
8 and 22 |
| VCN-01 LOW dose (3x107 virus particles per eye) (1x VCN-01) |
8 |
8 and 22 |
| VCN-01 VERY LOW dose (3x108 virus particles per eye) (1x/10 VCN-01) |
8 |
8 and 22 |
| VCN-01 ULTRA LOW dose (3x105 virus particles per eye) (1x/100 VCN-01) |
8 |
8 and 22 |
[0108] The parameter analysed was the survival of the treated and control eyes, i.e. the
number of days until the size of the retinoblastoma required enucleation of said eye.
[0109] The results obtained are summarised in Fig. 5. As can be seen in said figure, all
the doses revealed a superior result compared with the control group. Furthermore,
the HIGH and LOW doses also demonstrated a superior effect at the end of treatment
than the group treated with intravitreal chemotherapy.
[0110] Although the invention has been described in relation to preferred embodiments, these
should not be considered to limit the invention, which is to be defined by the broadest
interpretation of the following claims.
Example 7. Analysis of the influence of VCN-01 on brain metastases in retinoblastoma in mice.
[0111] Extraocular extension of retinoblastoma to the central nervous system (CNS) is fatal
for patients.
[0112] To carry out this study an orthotopic model of retinoblastoma was used. Use was made
of brains from the mice in Examples 5 and 6, female athymic nude mice (Hsd:Athymic
Nude-Foxn1
nu strain - Harlan Laboratories, Gannat, France), aged 6 weeks, which received an injection
into the posterior segment of each eye, of 2x10
5 cells HSJD-RBT2 (primary culture of cells mentioned above and obtained from the eye
of a retinoblastoma patient resistant to chemotherapy).
Table 6. Brains analysed in the study in Example 7, with details of the treatment
applied to each of the mice from which the brains were extracted.
| Group |
Treatment |
Dose |
Route of administration |
Number of brains |
| 1 |
Vehicle (negative control) |
2 µL per eye |
Intravitreal |
14 |
| 2 |
Systemic chemotherapy (positive control) |
6 mg/kg etoposide and 34 mg/kg carboplatin |
Intraperitoneal |
5 |
| 3 |
Reference dose of VCN-01 (100x VCN-01) |
3x109 virus particles in 2 µL per eye (5.7x108 TU) |
Intravitreal |
6 |
| 4 |
High dose of VCN-01 (10x VCN-01) |
3x108 virus particles in 2 µL per eye (5.7x107 TU) |
Intravitreal |
11 |
| 5 |
Intermediate dose of VCN-01 (3x VCN-01) |
1x108 virus particles in 2 µL per eye (1.9x107 TU) |
Intravitreal |
7 |
| 6 |
Low dose of VCN-01 (1x VCN-01) |
3x107 virus particles in 2 µL per eye (5.7x1 06 TU) |
Intravitreal |
14 |
| 7 |
Very low dose of VCN-01 (1x/10 VCN-01) |
3x108 virus particles in 2 µL per eye (5.7x105 TU) |
Intravitreal |
6 |
| 8 |
Ultra-low dose of VCN-01 (1x/100 VCN-01) |
3x108 virus particles in 2 µL per eye (5.7x104 TU) |
Intravitreal |
5 |
[0113] The therapeutic regimen applied to each of the groups mentioned in Table 6 (by way
of reference, the cell injection day was -7) was:
- Group 1 (Vehicle): injection on days 1 and 15.
- Group 2 (Systemic chemotherapy): injection of etoposide on days 1, 2 and 3 and injection
of carboplatin on day 1. The same administration regimen was repeated on days 22,
23 and 24; and 43, 44 and 45.
- Groups 3 to 8 (administration of different doses of VCN-01). Injection on days 1 and
15.
[0114] The presence of human retinoblastoma cells in the brains mentioned in Table 6 was
evaluated. Said evaluation was performed by measuring the amount of CRX messenger
ribonucleic acid (mRNA) by means of real-time polymerase chain reaction. For this,
total ribonucleic acid (RNA) from the brains of the mice was extracted using TRIzol
(Life Technologies, Waltham, MA, USA). Next, complementary deoxyribonucleic acid (cDNA)
was synthesised with the M-MLV reverse transcriptase system (Life Technologies, Waltham,
MA, USA) using 1 µg of the RNA extracted. The amount of CRX mRNA was measured using
the common protocol known in the prior art for the real-time polymerase chain reaction;
specifically, a reaction was prepared with a volume of 10 µL, using the SYBR® Green
PCR Master Mix (Life Technologies, Waltham, MA, USA); the primers and probe shown
in Table 7 were used; and the 7500 Sequence Detection System (Applied Biosytems, Foster
City, CA, USA) was used to detect the signals in the various cycles of the real-time
polymerase chain reaction (first stage of 10 min at 95ºC, followed by 40 cycles of
15 s at 95ºC and 1 min at 60ºC).
[0115] As a control, for normalisation of CRX gene expression, the mRNA of the TATA box
binding protein (TBP) was used. Its expression was measured in accordance with the
protocol indicated above and known in the prior art, and using the primers and probe
indicated in Table 7 for that purpose.
Table 7. Primers and probe used in the real-time polymerase chain reaction to measure
the expression of CRX and TBP.
| Type |
Gene |
Sequence |
SEQ ID NO: |
| Forward primer |
CRX |
5'-AGGTGGCTCTGAAGATCAATCTG-3' |
11 |
| Reverse primer |
CRX |
5'-TTAGCCCTCCGGTTCTTGAA-3' |
12 |
| Probe |
CRX |
5'-FAM-CTGAGTCCAGGGTTC-MGB-3' |
13 |
| Forward primer |
TBP |
5'-GAACATCATGGATCAGAACAACAG-3' |
14 |
| Reverse primer |
TBP |
5'-ATTGGTGTTCTGAATAGGCTGTG-3' |
15 |
| Probe |
TBP |
5'-FAM-CTGCCACCTTACGCTCAGGGCTTGG-TAMRA-3' |
16 |
[0116] The signals obtained were processed by the 2
ΔΔCt method, in order to determine the positive brain samples and the negative brain samples.
The results obtained are summarised in table 8
Table 8. Results obtained in the analysis of retinoblastoma brain metastases for the
various groups of mice analysed in Example 7.
| Group |
Treatment |
Number of available brains analysed |
Number of brains with metastasis |
| 1 |
Vehicle (negative control) |
14 |
6 |
| 2 |
Systemic chemotherapy (positive control) |
5 |
4 |
| 3 |
Reference dose of VCN-01 |
6 |
0 |
| 4 |
High dose of VCN-01 |
11 |
0 |
| 5 |
Intermediate dose of VCN-01 |
7 |
0 |
| 6 |
Low dose of VCN-01 |
14 |
3 |
| 7 |
Very low dose of VCN-01 |
6 |
1 |
| 8 |
Ultra-low dose of VCN-01 |
5 |
0 |
[0117] As can be deduced from Table 8, only four of the 49 mice treated with the various
doses of VCN-01 (8%) showed signs of metastasis in the CNS (i.e. human retinoblastoma
cells could be detected in the brains of said mice), while 43% of the negative controls
and 80% of the mice treated with systemic chemotherapy had metastases in the CNS.
None of the mice treated with an intermediate, high and reference dose of VCN-01 developed
metastases.
[0118] It can therefore be concluded that, in a surprising manner, VCN-01 prevented the
spread of retinoblastoma to the CNS.
SEQUENCE LISTING
[0119]
<110> VCN Biosciences SL
<120> Use of viral vectors in the treatment of retinoblastoma
<130> P 1500081
<160> 17
<170> PatentIn version 3.5
<210> 1
<211> 1530
<212> DNA
<213> Artificial Sequence
<220>
<223> Complete PH20 cDNA sequence comprising the carboxy-terminal domain. (from ATG
until stop codon, both included)
<400> 1


<210> 2
<211> 1406
<212> DNA
<213> Artificial Sequence
<220>
<223> Sequence of the modified endogenous promoter of E1a + encoding Ela-Delta24 region
in VCN-01 (comprising the four binding sites to E2F-1, the binding site to Sp1 and
the encoding region of Ela-Delta24)
<400> 2


<210> 3
<211> 37607
<212> DNA
<213> Artificial Sequence
<220>
<223> Complete sequence of VCN-01 (ICOVIR-17K)
<400> 3





















<210> 4
<211> 36141
<212> DNA
<213> Artificial Sequence
<220>
<223> Complete sequence of ICOVIR15
<400> 4




















<210> 5
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> SplF oligonucleotide
<400> 5
gtacgtcgac cacaaacccc gcccagcgtc ttgtcattgg cgtcgacgct 50
<210> 6
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> SplR oligonucleotide
<400> 6
gtacagcgtc gacgccaatg acaagacgct gggcggggtt tgtggtcgac 50
<210> 7
<211> 63
<212> DNA
<213> Artificial Sequence
<220>
<223> E2FF2 oligonucleotide
<400> 7

<210> 8
<211> 60
<212> DNA
<213> Artificial Sequence
<220>
<223> E2FR2 oligonucleotide
<400> 8
gtacttcgaa ccacttttac gcgccaaatc ctttttgccg cgaaagagcc acgagccgcc 60
<210> 9
<211> 576
<212> PRT
<213> Artificial Sequence
<220>
<223> Amino acid sequence, amino acids 1-582 of the modified version of the fibre
of adenovirus serotype 5 in which RGDK modification has been introduced.
<400> 9



<210> 10
<211> 9
<212> PRT
<213> Artificial Sequence
<220>
<223> RGD-4C peptdie
<400> 10

<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for CRX
<400> 11
aggtggctct gaagatcaat ctg 23
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for CRX
<400> 12
ttagccctcc ggttcttgaa 20
<210> 13
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for CRX
<400> 13
ctgagtccag ggttc 15
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Forward primer for TBP
<400> 14
gaacatcatg gatcagaaca acag 24
<210> 15
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Reverse primer for TBP
<400> 15
attggtgttc tgaataggct gtg 23
<210> 16
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Probe for TBP
<400> 16
ctgccacctt acgctcaggg cttgg 25
<210> 17
<211> 37634
<212> DNA
<213> Artificial Sequence
<220>
<223> Complete sequence of ICOVIR17
<400> 17




















