CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to
U.S. Provisional Application No. 61/831,481, filed June 5, 2013,
U.S. Provisional Application No. 61/839,127, filed June 25, 2013,
U.S. Provisional Application No. 61/904,911, filed November 15, 2013,
U.S. Provisional Application No. 61/967,466, filed March 19, 2014, and
U.S. Provisional Application No. 61/981,575, filed April 18, 2014.
STATEMENT OF GOVERNMENT INTEREST
[0002] This invention was made with government support under federal grant numbers DP2-OD008586
and R01DA036865 awarded by NIH and CBET-1151035 awarded by the National Science Foundation.
The U.S. Government has certain rights to this invention.
TECHNICAL FIELD
[0003] The present disclosure relates to the field of gene expression alteration, genome
engineering and genomic alteration of genes using Clustered Regularly Interspaced
Short Palindromic Repeats (CRISPR)/CRISPR-associatcd (Cas) 9-based systems and viral
delivery systems. The present disclosure also relates to the field of genome engineering
and genomic alteration of genes in muscle, such as skeletal muscle and cardiac muscle.
BACKGROUND
[0004] Synthetic transcription factors have been engineered to control gene expression for
many different medical and scientific applications in mammalian systems, including
stimulating tissue regeneration, drug screening, compensating for genetic defects,
activating silenced tumor suppressors, controlling stem cell differentiation, performing
genetic screens, and creating synthetic gene circuits. These transcription factors
can target promoters or enhancers of endogenous genes, or be purposefully designed
to recognize sequences orthogonal to mammalian genomes for transgene regulation. The
most common strategies for engineering novel transcription factors targeted to user-defined
sequences have been based on the programmable DNA-binding domains of zinc finger proteins
and transcription-activator like effectors (TALEs). Both of these approaches involve
applying the principles of protein-DNA interactions of these domains to engineer new
proteins with unique DNA-binding specificity. Although these methods have been widely
successful for many applications, the protein engineering necessary for manipulating
protein-DNA interactions can be laborious and require specialized expertise.
[0005] Additionally, these new proteins are not always effective. The reasons for this are
not yet known but may be related to the effects of epigenetic modifications and chromatin
state on protein binding to the genomic target site. In addition, there are challenges
in ensuring that these new proteins, as well as other components, are delivered to
each cell. Existing methods for delivering these new proteins and their multiple components
include delivery to cells on separate plasmids or vectors which leads to highly variable
expression levels in each cell due to differences in copy number. Additionally, gene
activation following transfection is transient due to dilution of plasmid DNA, and
temporary gene expression may not be sufficient for inducing therapeutic effects.
Furthermore, this approach is not amenable to cell types that are not easily transfected.
Thus another limitation of these new proteins is the potency of transcriptional activation.
[0006] Site-specific nucleases can be used to introduce site-specific double strand breaks
at targeted genomic loci. This DNA cleavage stimulates the natural DNA-repair machinery,
leading to one of two possible repair pathways. In the absence of a donor template,
the break will be repaired by non-homologous end joining (NHEJ), an error-prone repair
pathway that leads to small insertions or deletions of DNA. This method can be used
to intentionally disrupt, delete, or alter the reading frame of targeted gene sequences.
However, if a donor template is provided along with the nucleases, then the cellular
machinery will repair the break by homologous recombination, which is enhanced several
orders of magnitude in the presence of DNA cleavage. This method can be used to introduce
specific changes in the DNA sequence at target sites. Engineered nucleases have been
used for gene editing in a variety of human stem cells and cell lines, and for gene
editing in the mouse liver. However, the major hurdle for implementation of these
technologies is delivery to particular tissues
in vivo in a way that is effective, efficient, and facilitates successful genome modification.
[0007] Hereditary genetic diseases have devastating effects on children in the United States.
These diseases currently have no cure and can only be managed by attempts to alleviate
the symptoms. For decades, the field of gene therapy has promised a cure to these
diseases. However technical hurdles regarding the safe and efficient delivery of therapeutic
genes to cells and patients have limited this approach. Duchenne Muscular Dystrophy
(DMD) is the most common hereditary monogenic disease and occurs in 1 in 3500 males.
DMD is the result of inherited or spontaneous mutations in the dystrophin gene. Dystrophin
is a key component of a protein complex that is responsible for regulating muscle
cell integrity and function. DMD patients typically lose the ability to physically
support themselves during childhood, become progressively weaker during the teenage
years, and die in their twenties. Current experimental gene therapy strategies for
DMD require repeated administration of transient gene delivery vehicles or rely on
permanent integration of foreign genetic material into the genomic DNA. Both of these
methods have serious safety concerns. Furthermore, these strategies have been limited
by an inability to deliver the large and complex dystrophin gene sequence.
SUMMARY
[0008] The present invention is defined by the appended claims. In particular, the present
invention provides:
- [1]. A DNA targeting system that binds to a human gamma globin gene, the DNA targeting
system comprising a Cas fusion protein and at least one guide RNA (gRNA) that targets
a polynucleotide sequence with SEQ ID NO: 33, 34, 35, or 36, wherein the gamma globin
gene is HBG1 and/or HBG2.
- [2]. The DNA targeting system of [1], wherein the Cas fusion protein comprises two
heterologous polypeptide domains, wherein the first polypeptide domain comprises a
Clustered Regularly Interspaced Short Palindromic Repeats associated (Cas) protein
and the second polypeptide domain has an activity selected from the group consisting
of transcription activation activity, transcription repression activity, transcription
release factor activity, histone modification activity, nuclease activity, nucleic
acid association activity, methylase activity, and demethylase activity.
- [3]. A DNA targeting system that binds to a human gamma globin gene, the DNA targeting
system comprising at least one guide RNA (gRNA) and a fusion protein comprising two
heterologous polypeptide domains,
wherein the first polypeptide domain comprises a Clustered Regularly Interspaced Short
Palindromic Repeats associated (Cas) protein and the second polypeptide domain has
an activity selected from the group consisting of transcription activation activity,
transcription repression activity, transcription release factor activity, histone
modification activity, nuclease activity, nucleic acid association activity, methylase
activity, and demethylase activity,
wherein the at least one guide RNA (gRNA) targets a polynucleotide sequence with SEQ
ID NO: 33, 34, 35, or 36, and
wherein the gamma globin gene is HBG1 and/or HBG2.
- [4]. The DNA targeting system of [1] or [3], wherein the at least one gRNA targets
a polynucleotide sequence with:
- a) a complement of SEQ ID NO: 33, 34, 35, or 36;
- b) a nucleic acid that is substantially identical to SEQ ID NO: 33, 34, 35, or 36,
or complement thereof; or
- c) a nucleic acid that hybridizes under stringent conditions to SEQ ID NO: 33, 34,
35, or 36, complement thereof, or a sequence substantially identical thereto.
- [5]. The DNA targeting system of [2] or [3], wherein the Cas protein comprises a Cas9,
wherein the Cas9 comprises at least one amino acid mutation which knocks out nuclease
activity of Cas9.
- [6]. The DNA targeting system of [5], wherein the at least one amino acid mutation
is at least one of D10A and H840A.
- [7]. The DNA targeting system of [6], wherein the Cas protein comprises iCas9 (amino
acids 36-1403 of SEQ ID NO: 1).
- [8]. The DNA targeting system of [2] or [3], wherein the second polypeptide domain
of the fusion protein comprises at least one VP16 transcription activation domain
repeat or a KRAB domain.
- [9]. The DNA targeting system of [8], wherein the second polypeptide domain of the
fusion protein comprises a VP16 tetramer ("VP64") or a p65 activation domain.
- [10]. The DNA targeting system of [2] or [3], wherein the fusion protein further comprises
a linker connecting the first polypeptide domain to the second polypeptide domain.
- [11]. The DNA targeting system of [1] or [3], wherein the at least one gRNA targets
a promoter region of HBG1 and/or HBG2.
- [12]. An isolated polynucleotide encoding the DNA targeting system of [1] or [3],
- [13]. A vector comprising the isolated polynucleotide of [12].
- [14]. A cell comprising the isolated polynucleotide of [12].
- [15]. A method of modulating mammalian gene expression in a cell, the method comprising
contacting the cell with the DNA targeting system of [1] or [3],
- [16]. A composition for inducing gene expression in a subject, the composition comprising
the DNA targeting system of [1] or [3],
- [17]. A modified lentiviral vector comprising an isolated polynucleotide encoding
the DNA targeting system of [2] or [3], the isolated polynucleotide comprising a first
polynucleotide sequence encoding the fusion protein and a second polynucleotide sequence
encoding the at least one gRNA.
- [18]. The modified lentiviral vector of [17] for use in a method of activating endogenous
gene expression in a subject.
- [19]. The modified lentiviral vector of [18] for the use of [18], wherein the subject
is suffering from sickle cell disease or thalassaemia.
[0009] Furthermore, disclosed herein is a fusion protein comprising two heterologous polypeptide
domains. The first polypeptide domain comprises a Clustered Regularly Interspaced
Short Palindromic Repeats associated (Cas) protein and the second polypeptide domain
has an activity selected from the group consisting of transcription activation activity,
transcription repression activity, transcription release factor activity, histone
modification activity, nuclease activity, nucleic acid association activity, methylase
activity, and demethylase activity. The Cas protein may comprise Cas9. The Cas9 may
comprise at least one amino acid mutation which knocks out nuclease activity of Cas9.
The at least one amino acid mutation may be at least one of D10A and H840A. The Cas
protein may comprise iCas9 (amino acids 36-1403 of SEQ ID NO: 1). The second polypeptide
domain may have transcription activation activity. The second polypeptide domain may
comprise at least one VP16 transcription activation domain repeat. The second polypeptide
domain may comprise a VP16 tetramer ("VP64") or a p65 activation domain. The fusion
protein may further comprise a linker connecting the first polypeptide domain to the
second polypeptide domain. The fusion protein may comprise iCas9-VP64.
[0010] Also disclosed herein is a DNA targeting system comprising said fusion protein and
at least one guide RNA (gRNA). The at least one gRNA may comprise a 12-22 base pair
complementary polynucleotide sequence of the target DNA sequence followed by a protospacer-adjacent
motif. The at least one gRNA may target a promoter region of a gene, an enhancer region
of a gene, or a transcribed region of a gene. The at least one gRNA may target an
intron of a gene. The at least one gRNA may target an exon of a gene. The at least
one gRNA may target a the promoter region of a gene selected from the group consisting
of
ASCL1, BRN2, MYT1L, NANOG, VEGFA, TERT, IL1B, IL1R2, IL1RN, HBG1, HBG2, and
MYOD1. The at least one gRNA may comprise at least one of SEQ ID NOs: 5-40, 65-144, 492-515,
540-563, and 585-625.
[0011] Also disclosed herein is a DNA targeting system that binds to a dystrophin gene comprising
Cas9 and at least one guide RNA (gRNA). The at least one gRNA may target an intron
of the dystrophin gene. The at least one gRNA may target an exon of the dystrophin
gene. The at least one guide RNA may comprise at least one of SEQ ID NOs: 5-40, 65-144,
492-515, 540-563, and 585-625. The DNA targeting system may comprise between one and
ten different gRNAs.
[0012] The present disclosure relates to an isolated polynucleotide encoding said fusion
protein or said DNA targeting system.
[0013] The present disclosure relates to a vector comprising said isolated polynucleotide.
[0014] The present disclosure relates to a cell comprising said isolated polynucleotide
or said vector.
[0015] The present disclosure relates to a method of modulating mammalian gene expression
in a cell. The method comprises contacting the cell with said fusion protein, said
DNA targeting system, said isolated polynucleotide, or said vector. The gene expression
may be induced.
[0016] The present disclosure relates to a method of transdifferentiating or inducing differentiation
of a cell. The method comprises contacting the cell with said fusion protein, said
DNA targeting system, said isolated polynucleotide, or said vector. The cell may be
a fibroblast cell or an induced pluripotent stem cells. The fibroblast cell may be
trandifferentiated into a neuronal cell or a myogenic cell. The DNA targeting system
may be contacted with the cell and at least one gRNA targets a promoter region of
at least one gene selected from the group consisting of
ASCL1,
BRN2, MYOD1, and
MYT1L. The DNA targeting system may comprise at least one gRNA that targets the promoter
region of the
ASCL1 gene and at least one gRNA that targets the promoter region of the
BRN2 gene. The DNA targeting system may comprise between one and twenty different gRNAs.
The DNA targeting system may comprise 8 or 16 different gRNAs. The DNA targeting system
may comprise dCas9-VP64. The DNA targeting system may be delivered to the cell virally
or non-virally.
[0017] The present disclosure relates to correcting a mutant gene in a cell. The method
comprises administering to a cell containing said DNA targeting system, said isolated
polynucleotide, or said vector. The correction of the mutant gene may comprise homology-directed
repair. The method may further comprise administering to the cell a donor DNA. The
mutant gene may comprise a frameshift mutation which causes a premature stop codon
and a truncated gene product. The correction of the mutant gene may comprise nuclease
mediated non-homologous end joining. The correction of the mutant gene may comprise
a deletion of a premature stop codon, a disruption of a splice acceptor site, a deletion
of one or more exons, or disruption of a splice donor sequence. The deletion of one
or more exons may result in the correction of the reading frame.
[0018] The present disclosure is for use in treating a subject in need thereof having a
mutant dystrophin gene. The use comprises administering to the subject said DNA targeting
system, said isolated polynucleotide, or said vector. The subject may be suffering
from Duchenne muscular dystrophy.
[0019] The present disclosure relates to correcting a mutant dystrophin gene in a cell.
The method comprises administering to a cell containing a mutant dystrophin gene said
DNA targeting system, said isolated polynucleotide, said vector, or said cell. The
mutant dystrophin gene may comprise a premature stop codon, disrupted reading frame
via gene deletion, an aberrant splice acceptor site, or an aberrant splice donor site,
and wherein the target region is upstream or downstream of the premature stop codon,
disrupted reading frame, aberrant splice acceptor site, or the aberrant splice donor
site. The correction of the mutant dystrophin gene may comprise homology-directed
repair. The method may further comprise administering to the cell a donor DNA. The
mutant dystrophin gene may comprise a frameshift mutation which causes a premature
stop codon and a truncated gene product. The correction of the mutant dystrophin gene
may comprise nuclease mediated non-homologous end joining. The correction of the mutant
dystrophin gene may comprise a deletion of a premature stop codon, correction of a
disrupted reading frame, or modulation of splicing by disruption of a splice acceptor
site or disruption of a splice donor sequence. The correction of the mutant dystrophin
gene may comprise a deletion of exons 45-55 or exon 51.
[0020] The present disclosure relates to a kit comprising said fusion protein, said DNA
targeting system, said isolated polynucleotide, said vector, or said cell.
[0021] The present disclosure relates to a method of modulating mammalian gene expression
in a cell. The method comprises contacting the cell with a polynucleotide encoding
a DNA targeting system. The DNA targeting system comprises said fusion protein and
at least one guide RNA (gRNA). The DNA targeting system may comprise between one and
ten different gRNAs. The different gRNAs may bind to different target regions within
the target gene. The target regions may be separated by at least one nucleotide. The
target regions may be separated by about 15 to about 700 base pairs. Each of the different
gRNAs may bind to at least one different target genes. The different target genes
may be located on same chromosome. The different target genes may be located on different
chromosomes. The at least one target region may be within a non-open chromatin region,
an open chromatin region, a promoter region of the target gene, an enhancer region
of the target gene, a transcribed region of the target gene, or a region upstream
of a transcription start site of the target gene. The at least one target region may
be located between about 1 to about 1000 base pairs upstream of a transcription start
site of a target gene. The at least one target region may be located between about
1 to about 600 base pairs upstream of a transcription start site of a target gene.
The gene expression may be induced. The DNA targeting system may comprise two different
gRNAs, three different gRNAs, four different gRNAs, five different gRNAs, six different
gRNAs, seven different gRNAs, eight different gRNAs, nine different gRNAs, or ten
different gRNAs. The at least one guide RNA may target a promoter region of a gene
selected from the group consisting of
ASCL1, BRN2, MYT1L, NANOG, VEGFA, TERT, IL1B, IL1R2, IL1RN, HBG1, HBG2, and
MYOD1. The at least one guide RNA may comprise at least one of SEQ ID NOs: 5-40, 65-144,
492-515, 540-563, and 585-625. The at least one target region may be within an intron
or an exon of a target gene.
[0022] The present disclosure relates to a composition for inducing mammalian gene expression
in a cell. The composition comprises said fusion protein and at least one guide RNA
(gRNA).
[0023] The present disclosure relates to a composition for inducing mammalian gene expression
in a cell. The composition comprises an isolated polynucleotide sequence encoding
said fusion protein and at least one guide RNA (gRNA). The at least one guide RNA
may target a promoter region of a gene selected from the group consisting of
ASCL1, BRN2, MYT1L, NANOG, VEGFA, TERT, IL1B, IL1R2, IL1RN, HBG1, HBG2, and
MYOD1. The at least one guide RNA may comprise at least one of SEQ ID NOs5-40, 65-144, 492-515,
540-563, and 585-625.
[0024] The present disclosure relates to a cell comprising said composition for inducing
mammalian gene expression in a cell.
[0025] The present disclosure relates to a kit comprising said composition for inducing
mammalian gene expression in a cell or said cell comprising said composition for inducing
mammalian gene expression in a cell.
[0026] The present disclosure relates to a kit for inducing mammalian gene expression in
a cell. The kit comprises said composition for inducing mammalian gene expression
in a cell or said cell comprising said composition for inducing mammalian gene expression
in a cell.
[0027] The present disclosure relates to a composition for genome editing in a muscle of
a subject. The composition comprises a modified adeno-associated virus (AAV) vector
and a nucleotide sequence encoding a site-specific nuclease. The muscle is skeletal
muscle or cardiac muscle. The modified AAV vector may have enhanced cardiac and skeletal
muscle tissue tropism. The site-specific nuclease may comprise a zinc finger nuclease,
a TAL effector nuclease, or a CRISPR/Cas9 system. The site-specific nuclease may bind
a gene or locus in the cell of the muscle. The gene or locus may be dystrophin gene.
The composition may further comprise a donor DNA or transgene.
[0028] The present disclosure relates to a kit comprising said composition for genome editing
in a muscle of a subject.
[0029] The present disclosure is for use in genome editing in a muscle of a subject. The
use comprises administering to the muscle said composition for genome editing in a
muscle of a subject, wherein the muscle is skeletal muscle or cardiac muscle. The
genome editing may comprise correcting a mutant gene or inserting a transgene. Correcting
a mutant gene may comprise deleting, rearranging, or replacing the mutant gene. Correcting
the mutant gene may comprise nuclease-mediated non-homologous end joining or homology-directed
repair.
[0030] The present disclosure is for use in treating a subject. The use comprises administering
said composition for genome editing in a muscle of a subject to a muscle of the subject,
wherein the muscle is skeletal muscle or cardiac muscle. The subject may be suffering
from a skeletal muscle condition or a genetic disease. The subject may be suffering
from Duchenne muscular dystrophy.
[0031] The present disclosure relates to correcting a mutant gene in a subject, the use
comprises administering said composition for genome editing in a muscle of a subject.
The muscle is skeletal muscle or cardiac muscle. The composition may be injected into
the skeletal muscle of the subject. The composition may be injected systemically to
the subject. The skeletal muscle may be tibialis anterior muscle.
[0032] The present disclosure relates to a modified lentiviral vector for genome editing
in a subject comprising a first polynucleotide sequence encoding said fusion protein
and a second polynucleotide sequence encoding at least one sgRNA. The first polynucleotide
sequence may be operably linked to a first promoter. The first promoter may be a constitutive
promoter, an inducible promoter, a repressible promoter, or a regulatable promoter.
The second polynucleotide sequence may encode between one and ten different sgRNAs.
The second polynucleotide sequence may encode two different sgRNAs, three different
sgRNAs, four different sgRNAs, five different sgRNAs, six different sgRNAs, seven
different sgRNAs, eight different sgRNAs, nine different sgRNAs, or ten different
sgRNAs. Each of the polynucleotide sequences encoding the different sgRNAs may be
operably linked to a promoter. Each of the promoters operably linked to the different
sgRNAs may be the same promoter. Each of the promoters operably linked to the different
sgRNAs may be different promoters. The promoter may be a constitutive promoter, an
inducible promoter, a repressible promoter, or a regulatable promoter. The sgRNA may
bind to a target gene. Each of the sgRNA may bind to a different target region within
one target loci. Each of the sgRNA may bind to a different target region within different
gene loci. The fusion protein may comprise Cas9 protein or iCas9-VP64 protein. The
fusion protein may comprise a VP64 domain, a p300 domain, or a KRAB domain. The two
or more endogenous genes may be transcriptionally activated. The two or more endogenous
genes may be repressed.
[0033] The present disclosure relates to a method of activating an endogenous gene in a
cell. The method comprises contacting a cell with said modified lentiviral vector.
The endogenous gene may be transiently activated. The endogenous gene may be stably
activated. The endogenous gene may be transiently repressed. The endogenous gene may
be stably repressed. The fusion protein may be expressed at similar levels to the
sgRNAs. The fusion protein may be expressed at different levels to the sgRNAs. The
cell may be a primary human cell.
[0034] The present disclosure relates to a method of multiplex gene editing in a cell. The
method comprises contacting a cell with said modified lentiviral vector. The multiplex
gene editing may comprise correcting at least one mutant gene or inserting a transgene.
Correcting a mutant gene may comprise deleting, rearranging, or replacing the at least
one mutant gene. Correcting the at least one mutant gene may comprise nuclease-mediated
non-homologous end joining or homology-directed repair. The multiplex gene editing
may comprise deleting at least one gene, wherein the gene is an endogenous normal
gene or a mutant gene. The multiplex gene editing may comprise deleting at least two
genes. The multiplex gene editing may comprise deleting between two and ten genes.
[0035] The present disclosure relates to a method of modulating gene expression of at least
one target gene in a cell. The method comprises contacting a cell with said modified
lentiviral vector. The gene expression of at least two genes may be modulated. The
gene expression of between two genes and ten genes may be modulated. The gene expression
of the at least one target gene may be modulated when gene expression levels of the
at least one target gene are increased or decreased compared to normal gene expression
levels for the at least one target gene.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036]
Fig. 1 shows RNA-guided activation of the human IL1RN gene by iCas9-VP64. (a,b) An
RNA-guided transcriptional activator was created by fusing the inactivated Cas9 (iCas9,
D10A/H840A) to the VP64 transactivation domain. iCas9-VP64 recognizes genomic target
sites through the hybridization of a guide RNA (gRNA) to a 20 bp target sequence.
(c) Expression plasmids for four gRNAs or crRNA/tracrRNAs targeted to sequences in
the IL1RN promoter were co-transfected with the iCas9-VP64 expression plasmid into HEK293T
cells. Activation of IL1RN expression was assessed by qRT-PCR. (d) The four gRNA expression plasmids were cotransfected
with iCas9-VP64 individually or in combination. Robust gene activation was observed
by qRT-PCR only in response to the combination of gRNAs. (e) Activation of IL1RN expression was confirmed by assessing secretion of the IL-lra gene product into the
media by ELISA. IL-1ra was only detected in three of the six samples treated with
the combination of gRNAs. For (c-e), data are shown as the mean ± s.e.m. (n = 3 independent
experiments). Treatment with the combination of gRNAs was statistically different
than all other treatments (*P ≤ 0.02) by Tukey's test. (f) RNA-seq was performed on
samples treated with empty expression vector (n = 2) or co-transfected with the expression
plasmids for iCas9-VP64 and the four gRNAs targeting IL1RN (n = 2). The only statistically significant changes in gene expression between these
treatments were an increase in the four IL1RN isoforms (false discovery rate ≤ 3 x 10-4) and a decrease in IL32 (false discovery rate = 0.03).
Fig. 2 shows RNA-guided activation of human genes relevant to cell and gene therapy,
genetic reprogramming, and regenerative medicine. HEK293T cells were transfected with
the iCas9-VP64 expression plasmid and four gRNAs individually or in combination. Target
gene expression was measured by qRT-PCR and normalized to GAPDH mRNA levels. Data are shown as the mean ± s.e.m. (n = 3 independent experiments).
Treatment with the combination of gRNAs was statistically different than all other
treatments (*P < 0.05) by Tukey's test.
Fig. 3 shows expression of iCas9-VP64. Expression of iCas9-VP64 in transfected HEK293
cells was confirmed by western blot for the N-terminal Flag epitope tag. The wt Cas9
expression plasmid does not contain the epitope tag.
Fig. 4 shows positions of gRNA target sites and DNAse hypersensitivity of human target
genes. The four gRNA target sites for each locus are designated as custom tracks above
each gene and DNase-seq data indicating DNAse-hypersensitive open chromatin regions
is shown below each gene. DNase-seq was performed in HEK293T cells to identify DNase
hypersensitive regions, as previously described (Song et al., Cold Spring Harbor protocols 2010, pdb prot5384 (2010); Song et al. Genome Res 21, 1757-1767 (2011)). The results show that open chromatin was not a requirement for gene activation
by combinations of gRNAs with iCas9-VP64.
Fig. 5 shows the absence of nuclease activity by iCas9-VP64. Wild-type Cas9 or inactivated
(D10A, H840A) iCas9-VP64 expression plasmids were co-transfected with expression plasmids
for four different guide RNAs targeting the IL1RN promoter. Nuclease activity was determined by the Surveyor assay (Guschin et al., Methods Mol Biol 649, 247-256 (2010)). The lower molecular weight bands indicative of nuclease activity and DNA repair
by non-homologous end joining are only present following treatment with wild-type
Cas9, supporting abrogation of nuclease activity by iCas9-VP64.
Fig. 6 shows RNA-seq for samples treated with gRNAs targeting HBG1 and HBG2. RNA-seq was performed on samples treated with a control empty expression vector (n
= 3) or cotransfected with the expression plasmids for iCas9-VP64 and the four gRNAs
targeting HBG1 (n = 2). Three of these gRNAs also target HBG2. Increases in both HBG1 and HBG2 relative to control were observed but were not statistically significant due to low
expression levels. The only statistically significant changes in gene expression between
these treatments were decreases in IL32 (false discovery rate = 0.0007) and TNFRS9 (false discovery rate = 0.002).
Fig. 7 shows upregulation of Ascl1 and γ-globin by iCas9-VP64. HEK293T cells were
transfected with iCas9-VP64 and four gRNAs targeting the ASCL1 or HBG1 promoter. Levels of corresponding Ascll and γ-globin protein production were assessed
by western blot. Low levels of these proteins were detectable in HEK293T cells and
increases in expression were detectable following iCas9-VP64 treatment in two independent
experiments.
Fig. 8 shows activation of downstream targets of Ascl1 in iCas9-VP64-treated murine
embryonic fibroblasts. Mouse embryonic fibroblasts (MEFs) were transfected with a
control GFP expression plasmid or the iCas9-VP64 expression plasmid and a combination
of four gRNA expression plasmids targeting ASCL1 at a ratio of 50:50 or 75:25. (a)
The gRNA target sites in the human ASCL1 promoter (SEQ ID NO: 3) are conserved in the mouse ASCL1 promoter (SEQ ID NO: 4). Target sites arc indicated by solid lines and the transcribed
region is indicated by dashed line. (b) ASCL1 expression in MEFs increased at two days after iCas9-VP64/gRNA treatment as determined
by qRT-PCR. (c-h) After 10 days in neural induction media, cells were stained for
Ascl1 and Tuj1, an early marker of neuronal differentiation (c-d), or for Tuj1 and
MAP2, a marker of more mature neuronal differentiation (d-f). Some Tuj1-positive cells
adopted neuronal morphologies (f-g) and a single cell was found to be positive for
Tuj1 and MAP2 (g). (h) Tuj1-positive cells were readily identified in the iCas9-VP64/gRNA-treated
cultures (~0.05%) but were absent in controls. n = 3 independent samples and data
are represented as mean ± standard error of the mean. gRNA 75/25 is significantly
different than gRNA 50/50 and control (*P < 0.01, Tukey's test).
Fig. 9 shows (a) the iCas9-VP64 protein sequence (SEQ ID NO: 1) and (b) the sequence
of the gRNA expression cassette with U6 promoter (SEQ ID NO: 2).
Fig. 10 shows the standard curves for qRT-PCR. For each gene, the experimental sample
with the highest expression level was diluted to create a standard curve that was
assayed by qRT-PCR to ensure efficient amplification over an appropriate dynamic range.
The efficiencies of all amplification reactions were within 90-115%.
Figs. 11(a)-11(b) show the validation of RNA-guided repair. Fig. 11(a) shows the Surveyor
assay results of genomic DNA harvested from HEK 293T cells two days after Cas9 was
co-transfected into the cells with empty vector (negative control) or gRNA. Fig. 11(b)
shows the location of the gRNA target. Fig. 11(c) shows the expected cleavage sizes
for each gRNA.
Fig. 12 shows RNA-guided repair in DMD 8036 (del48-50) cells as shown by Surveyor
assay.
Fig. 13 shows RNA-guided repair in DMD 8036 (del48-50) cells as shown by PCR across
the entire locus. The PCR of a wild-type dystrophin gene generates a fragment of 1447
bp in size, whereas PCR of the mutant gene in the DMD 8036 cell line shows a deletion
of approximately 817 bp. The deletion band after introduction of the CRISPR/Cas9-based
system was approximately 630 bp.
Fig. 14 shows RNA-guided repair in DMD 8036 (del48-50) cells as shown by Western blot
with MANDYS8 (anti-dystrophin antibody) and GAPDH antibody (positive control).
Fig. 15 shows ChIP sequencing data illustrating the specific binding of iCas9-VP64
targeting the IL1RN promoter. HEK 293T cells were transfected with iCas9-VP64 targeting
the IL1RN promoter.
Fig. 16 shows CRISPR/Cas9 targeting of the dystrophin gene. (A) sgRNA sequences were
designed to bind sequences in the exon 45-55 mutational hotspot region of the dystrophin
gene, such that gene editing could restore dystrophin expression from a wide variety
of patient-specific mutations. Arrows within introns indicate sgRNA targets designed
to delete entire exons from the genome. Arrows within exons indicate sgRNA targets
designed to create targeted frameshifts in the dystrophin gene. (B) Example of frame
correction following introduction of small insertions or deletions by NHEJ DNA repair
in exon 51 using the CR3 sgRNA. (C) Schematic of multiplex sgRNA targets designed
to delete exon 51 and restore the dystrophin reading frame in a patient mutation with
the deletion of exons 48-50. (D) Schematic of multiplex sgRNA targets designed to
delete the entire exon 45-55 region to address a variety of DMD patient mutations.
Fig. 17 shows images of TBE-PAGE gels used to quantify Surveyor assay results to measure
day 3 gene modification in Table 7. Asterisks mark expected sizes of bands indicative
of nuclease activity.
Fig. 18 shows images of TBE-PAGE gels used to quantify Surveyor assay results to measure
day 10 gene modification in Table 7. Asterisks mark expected sizes of bands indicative
of nuclease activity.
Fig. 19 shows fluorescence-activated flow sorting to enrich genetically modified DMD
myoblasts. (A) A plasmid expressing a human-codon optimized SpCas9 protein linked
to a GFP marker using a T2A ribosomal skipping peptide sequence was co-electroporated
into human DMD myoblasts with one or two plasmids carrying sgRNA expression cassettes.
(B) The indicated sgRNA expression cassettes were independently co-transfected into
HEK293Ts with a separate plasmid expressing SpCas9 with (bottom) or without (top)
a GFP marker linked to SpCas9 by a T2A ribosomal skipping peptide sequence. Gene modification
frequencies were assessed at 3 days post-transfection by the Surveyor assay. (C) DMD
myoblasts with deletions of exons 48-50 in the dystrophin gene were treated with sgRNAs
that correct the dystrophin reading frame in these patient cells. Gene modification
was assessed at 20 days postelectroporation in unsorted (bulk) or GFP+ sorted cells.
(D) GFP expression in DMD myoblasts 3 days after electroporation with indicated expression
plasmids. Transfection efficiencies and sorted cell populations are indicated by the
gated region.
Fig. 20 shows targeted frameshifts to restore the dystrophin reading frame using CRISPR/Cas9.
(A) The 5' region of exon 51 was targeted using a sgRNA, CR3, that binds immediately
upstream of the first out-of-frame stop codon. PAM: protospacer-adjacent motif. (B)
The exon 51 locus was PCR amplified from HEK293T cells treated with SpCas9 and CR3
expression cassettes. Sequences of individual clones were determined by Sanger sequencing.
The top sequence (bolded, exon in red) is the native, unmodified sequence. The number
of clones for each sequence is indicated in parentheses. (C) Summary of total gene
editing efficiency and reading frame conversions resulting from gene modification
shown in (B). (D) Western blot for dystrophin expression in human DMD myoblasts treated
with SpCas9 and the CR3 sgRNA expression cassette (Fig. 19C) to create targeted frameshifts
to restore the dystrophin reading frame. Dystrophin expression was probed using an
antibody against the roddomain of the dystrophin protein after 6 days of differentiation.
Fig. 21 shows deletion of exon 51 from the human genome using multiplex CRISPR/Cas9
gene editing. (A) End-point genomic PCR across the exon 51 locus in human DMD myoblasts
with a deletion of exons 48-50. The top arrow indicates the expected position of full-length
PCR amplicons and the two lower arrows indicate the expected position of PCR amplicons
with deletions caused by the indicated sgRNA combinations. (B) PCR products from (A)
were cloned and individual clones were sequenced to determine insertions and deletions
present at the targeted locus. The top row shows the wild-type unmodified sequence
and the triangles indicate SpCas9 cleavage sites. At the right are representative
chromatograms showing the sequences of the expected deletion junctions. (C) End-point
RT-PCR analysis of dystrophin mRNA transcripts in CRISPR/Cas9-modified human Δ48-50
DMD myoblasts treated with the indicated sgRNAs. A representative chromatogram of
the expected deletion PCR product is shown at the right. Asterisk: band resulting
from hybridization of the deletion product strand to the unmodified strand. (D) Rescue
of dystrophin protein expression by CRISPR/Cas9 genome editing was assessed by western
blot for the dystrophin protein with GAPDH as a loading control. The arrow indicates
the expected restored dystrophin protein band.
Fig. 22 shows deletion of the entire exon 45-55 region in human DMD myoblasts by multiplex
CRISPR/Cas9 gene editing. (A) End-point genomic PCR of genomic DNA to detect deletion
of the region between intron 44 and intron 55 after treating HEK293Ts or DMD myoblasts
with the indicated sgRNAs. (B) Individual clones of PCR products of the expected size
for the deletions from DMD myoblasts in (A) were analyzed by Sanger sequencing to
determine the sequences of genomic deletions present at the targeted locus. Below
is a representative chromatograms showing the sequence of the expected deletion junctions.
(C) End-point RT-PCR analysis of dystrophin mRNA transcripts in CRISPR/Cas9-modified
human Δ48-50 DMD myoblasts treated with the indicated sgRNAs. A representative chromatogram
of the expected deletion PCR product is shown at the right. (D) Analysis of restored
dystrophin protein expression by western blot following electroporation of DMD myoblasts
with sgRNAs targeted to intron 44 and/or intron 55.
Fig. 23 shows verification of flow cytometry-based enrichment of gene-modified DMD
myoblasts used for in vivo cell transplantation experiment. DMD myoblasts were treated with Cas9 with or without
sgRNA expression vectors for CR1 and CR5 and sorted for GFP+ cells by flow cytometry.
Deletions at the exon 51 locus were detected by end-point PCR using primers flanking
the locus. Neg ctrl: DMD myoblasts treated with Cas9 only and sorted for GFP+ cells.
Fig. 24 shows expression of restored human dystrophin in vivo following transplantation
of CRISPR/Cas9-treated human DMD myoblasts into immunodeficient mice. Human Δ48-50
DMD myoblasts were treated with SpCas9, CR1, and CR5 to delete exon 51 and sorted
for GFP expression as shown in Fig. 19. These sorted cells and untreated control cells
were injected into the hind limbs of immunodeficient mice and assessed for human-specific
protein expression in muscle fibers after 4 weeks post-transplantation. Cryosections
were stained with anti-human spectrin, which is expressed by both uncorrected and
corrected myoblasts that have fused into mouse myofibers, or anti-human dystrophin
antibodies as indicated. White arrows indicate muscle fibers positive for human dystrophin.
Fig. 25 shows additional immunofluorescence images probing human dystrophin expression.
Serial sections from regions stained with anti-human spectrin are shown inset in top
left. (A-C) Sections from muscles injected with untreated human DMD myoblasts. (D-F)
Sections from muscles injected with CR1/5 treated human DMD myoblasts enriched by
flow cytometry. White arrows indicate dystrophin positive fibers.
Fig. 26 shows evaluation of CRISPR/Cas9 toxicity and off-target effects for CR1/CR5-mediated
deletion of exon 51 in human cells. (A) Results of a cytotoxicity assay in HEK293T
cells treated with human-optimized SpCas9 and the indicated sgRNA constructs. Cytotoxicity
is based on survival of GFP-positive cells that are co-transfected with the indicated
nuclease. I-SceI is a well-characterized non-toxic meganuclease and GZF3 is a known
toxic zinc finger nuclease. (B) Surveyor analysis at off-target sites in sorted hDMD cells treated with expression
cassettes encoding Cas9 the indicated sgRNAs. These three off-target sites tested
in hDMD cells were identified from a panel of 50 predicted sites tested in HEK293T
cells (Fig. 27 and Table 4). TGT: on-target locus for indicated sgRNA. OT:off-target
locus. (C, D) End-point nested PCR to detect chromosomal translocations in (C) HEK293T
cells treated with Cas9 and CR1 or (D) sorted hDMD cells treated with Cas9, CR1, and
CR5. The schematic depicts the relative location of nested primer pairs customized
for each translocation event. The expected size of each band was estimated based on
the primer size and the location of the predicted sgRNA cut site at each locus. Asterisks
indicate bands detected at the expected size. The identities of the bands in (C) were
verified by Sanger sequencing from each end (Fig. 30). A representative chromatogram
for the P2/P5 translocation in HEK293T cells is shown.
Fig. 27 shows images of TBE-PAGE gels used to quantify Surveyor assay results to measure
on-target and off-target gene modification in Table 4. Asterisks mark expected sizes
of bands indicative of nuclease activity.
Fig. 28 shows end-point nested PCR to detect chromosomal translocations caused by
CRISPR/Cas9 off-target activity for CR3 and CR6/CR36 in human cells. Nested end-point
PCR analysis was used to detect translocations in (A) HEK293T or sorted hDMD cells
treated with Cas9 and CR3 as indicated, (B) HEK293T cells treated with Cas9 and CR36
alone, or (C) sorted hDMD cells treated with Cas9, CR6, and CR36 expression cassettes.
The second nested PCR reaction for translocation was amplified using custom primers
for each predicted translocation locus to maximize specificity (See Table 4). The
schematic depicts the relative location of nested primer pairs used to probe for the
presence of translocations. Each possible translocation event was first amplified
from genomic DNA isolated from cells treated with or without the indicated sgRNA(s).
A second nested PCR reaction was performed using primers within the predicted PCR
amplicons that would result from translocations. Expected size was estimated based
on the indicated primer binding site and the predicted sgRNA cut site at each locus.
*indicates bands detected at the expected size and verified by Sanger sequencing from
each end. #indicates amplicons in which Sanger sequencing showed sequences other than
the predicted translocation, likely a result of mispriming during the nested PCR.
Fig. 29 shows Sanger sequencing chromatograms for bands detected in Fig. 28 resulting
from translocations between CR3 and CR3-OT1, on chromosomes X and 1, respectively,
in HEK293T cells treated with Cas9 and CR3 gene cassettes. Arrows show regions of
homology to the indicated chromosome nearby the expected break points caused by the
appropriate sgRNAs. Note that sequencing reads become out of phase near the break
point due to the error-prone nature of DNA repair by non-homologous end-joining.
Fig. 30 shows Sanger sequencing chromatograms for bands detected in Fig. 26C resulting
from translocations between CR1 and CR1-OT1, on chromosomes X and 16, respectively,
in HEK293T cells treated with Cas9 and CR1 gene cassettes. Arrows show regions of
homology to the indicated chromosome nearby the expected break points caused by the
appropriate sgRNAs. Note that sequencing reads become out of phase near the break
point due to the error-prone nature of DNA repair by non-homologous end-joining.
Fig. 31 shows an overview of in vivo AAV injections and tissue harvest.
Fig. 32 shows Surveyor analysis of Rosa26 ZFN activities in skeletal muscle in vitro
and in vivo following delivery of AA V -SASTG-ROSA. Arrows indicate expected bands
resulting from Surveyor cleavage. n.d.: not detected. (a) Proliferating C2C12s were
transduced with the indicated amount of virus and harvested at 4 days post-infection.
Arrows indicate expected bands sizes resulting from Surveyor cleavage. (b) C2C12s
were incubated in differentiation medium for 5 days and then transduced with the indicated
amount of AAV-SASTG-ROSA virus in 24 well plates. Samples were collected at 10 days
post-transduction. (c) The indicated amount ofAAV-SASTG-ROSA was injected directly
into the tibialis anterior of C57BL/6J mice and muscles were harvested 4 weeks post-infection.
The harvested TA muscles were partitioned into 8 separate pieces for genomic DNA analysis,
each shown in a separate lane.
Fig. 33 shows Rosa T2A opt DNA sequence (SEQ ID NO: 434) and Rosa T2A opt protein
sequence (SEQ ID NO: 435).
Fig. 34 shows SASTG capsid DNA sequence (SEQ ID NO:436) and SASTG capsid peptide sequence
(SEQ ID NO: 437).
Fig. 35 shows DZF16 ZFN target site sequence (SEQ ID NO: 442), DZF16-L6 left full
amino acid sequence (SEQ ID NO: 443) and DZF16-R6 right full amino acid sequence (SEQ
ID NO: 444).
Fig. 36 shows E51C3 ZFN target site sequence (SEQ ID NO: 445), E51C3-3L left full
amino acid sequence (SEQ ID NO: 446) and E51C3-3R right full amino acid sequence (SEQ
ID NO: 447).
Fig. 37 shows DZF15 ZFN target site sequence (SEQ ID NO: 448), DZF15-L6 left full
amino acid sequence (SEQ ID NO: 449), DZF15-R6 right full amino acid sequence (SEQ
ID NO: 450), DZF15-L5 left full amino acid sequence (SEQ ID NO: 451), DZF15-R5 right
full amino acid sequence (SEQ ID NO: 452).
Fig. 38 shows E51C4 ZFN target site sequence (SEQ ID NO: 453), E51C4-4L left full
amino acid sequence (SEQ ID NO: 454) and E51C4-4R right full amino acid sequence (SEQ
ID NO: 455).
Fig. 39 shows schematic diagrams of a "Single vector, multiplex CRISPR system," Dual
vector, multiplex CRISPR system," and "Single vector, single gRNA system."
Fig. 40 shows the nucleotide sequences of SaCas9-NLS (with the NLS underlined) (SEQ
ID NO: 64) and SaCas9 gRNA (SEQ ID NO: 116).
Fig. 41 shows the nucleotide sequences of NmCas9 (with the NLS 1 underlined, the NLS
2 underlined and bolded, and the HA tag bolded), NmCas9 short hairpin from Thomson
PNAS 2013 (SEQ ID NO: 118), and NmCas9 long hairpin from Church Nature Biotech 2013
(SEQ ID NO: 119).
Fig. 42 shows validation of sgRNA and lentiviral Cas9 expression constructs. (a) Constructs
encoding unique Pol III promoters expressing sgRNAs targeting the AAVS1 locus or a
construct containing the hU6 promoter immediately followed by poly-thymidine to terminate
expression ("PolyT") were transfected into HEK293T cells. End-point RT-PCR was used
to probe for expression of each indicated promoter/sgRNA construct two days post-transfection.
- RT: no reverse transcriptase control. (b) HEK293Ts were transfected with expression
vectors encoding the AAVS1 zinc-finger nuclease or Cas9-T2A-GFP and the indicated
promoter/sgRNA expression cassettes and assessed for gene modification levels 3 days
post-transfection using the Surveyor assay. (c) HEK293T cells were transduced with
lentiviral constructs encoding the indicated Cas9-T2A-GFP constructs without sgRNAs
and assessed for Cas9 expression by western blot 7 days post-transduction by probing
for a FLAG epitope tag on the N-terminus of the Cas9 protein.
Fig. 43 shows Golden Gate assembly of single lentiviral CRISPR/Cas9 expression cassettes.
Fig. 44 shows single lentiviral delivery of a multiplex CRISPR/Cas9 system. (a) Four
sgRNAs targeting distinct genomic loci were cloned into a lentiviral vector expressing
the active Cas9 nuclease. (b) HEK293Ts and primary human dermal fibroblasts were transduced
with lentivirus expressing the indicated sgRNAs and assayed for cleavage events using
the Surveyor assay. HEK293Ts were assayed 7 days post transduction. The human fibroblasts
were assayed 10 days post transduction.
Fig. 45 shows transient gene activation in HEK293Ts stably expressing dCas9-VP64.
HEK293Ts were transduced with lentivirus to stably express dCas9-VP64 and were subsequently
transfected with plasmid expressing the indicated sgRNA combinations. By varying the
number of sgRNAs delivered, tunable endogenous gene activation of the endogenous IL1RN
(a) and HBG1 (b) loci was achieved 3 days post transfection. Peak levels of endogenous
IL1RN (c) and HBG1 (d) were observed 3-6 days post transfection and the level of activation
returned to background levels between days 15-20. Importantly, the cell lines were
able to reactive following a second transfection on day 20 albeit at a lower level
than previously observed.
Fig. 46 shows stable gene activation in HEK293Ts using a single lentiviral multiplex
dCas9-VP64 vector. HEK293Ts were transduced with lentivirus to stably express dCas9-VP64
and the indicated combinations of gRNAs. By varying the number of sgRNAs delivered,
tunable endogenous gene activation of the endogenous IL1RN (a) and HBG1 (b) loci was
achieved 7 days post transduction. Peak levels of endogenous IL1RN (c) and HBG1 (d)
were observed 6 days post transduction and the level of activation was sustained out
to day 21.
Fig. 47 shows IL1RN mRNA expression levels.
Fig. 48 shows a schematic representing the direct conversion of fibroblasts to neurons
through ectopic expression of the BAM neuronal transcription factors.
Fig. 49 shows (A) Schematic of the dCas9-VP64 construct. dCas9-VP64 is a catalytically
inactive form of the Cas9 protein fused to a tetramer of the VP16 transcriptional
activation domain. (B) Schematic showing the mechanism of RNA-guided recruitment of
dCas9-VP64 to a genomic target. (C) Schematic of the experimental protocol to generate
iNs with CRISPR/Cas9 transcription factors.
Fig. 50 shows endogenous ASCL1 expression at day 3 determined by (A) qRT-PCR or total ASCL1 protein detected by (B) immunofluorescence in MEFs transduced with dCas9-VP64 and
transfected with either gRNAs targeted to the ASCL1 promoter, ASCL1 cDNA, or luciferase. Asterisk (*) indicates significant (p<0.05) increase in ASCL1 expression with the co-delivery of 8 gRNAs compared to 4 gRNAs. Ectopic expression
of ASCL1 produced more protein than induced by dCas9-VP64 and 8 gRNAs targeted to the Ascl1
promoter, but did not activate the endogenous locus by day 3 in culture.
Fig. 51 shows (A) TUJ1 and MAP2-postive cells generated by ectopic BAM factors or by dCas9-VP64 and gRNAs targeted
to the BRN2 and ASCL1 promoters (B) Cells with neuronal morphology expressing a hSyn-RFP reporter at day
11 in N3 medium.
Fig. 52 shows (A) A cell with neuronal morphology positive for the GCaMP5 calcium
indicator in the presence (bottom) or absence (top) of KCl in the culture medium.
(B) A trace of normalized fluorescent intensity over time showing depolarization of
the cell in response to KCl addition.
Fig. 52 shows activation of downstream targets of Ascl1 and Brn2, i.e., master regulatory
genes, in iCas9-VP64-treated murine embryonic fibroblasts using dCas9-VP64 transcription
factors to convert the fibroblasts to neurons. Mouse embryonic fibroblasts (MEFs)
were transfected with a control GFP expression plasmid or the iCas9-VP64 expression
plasmid and a combination of eight gRNA expression plasmids targeting ASCL1 and BRN2.
The dCas9 transcription factors were delivered virally. After 10 days in neural induction
media, cells were stained for Tuj1, an early marker of neuronal differentiation and
MAP2, a marker of more mature neuronal differentiation. The conversion to neurons
was efficient.
Fig. 53 shows the CRISPR/Cas9 platform for control of mammalian gene regulation. A.
Cas9-based effectors bind genomic sequences in the presence of a chimeric gRNA molecule
consisting of a constant region that complexes with Cas9 preceded by an exchangeable
20bp protospacer that confers target site specificity. B. Cas9-based synthetic transcription
factors repress transcription of a target gene by interfering with RNA polymerase
activity or by binding within the promoter and blocking the binding sites of endogenous
transcription factors. C. Targeting regulatory elements such as enhancers could also
potentially block the expression of multiple distal genes.
Fig. 54 shows targeting the HS2 enhancer using CRISPR/dCas9-KRAB. The HS2 region is
a potent enhancer that distally regulates the expression of globin genes >10kb downstream.
A panel of single gRNAs was designed to target sites along the enhancer region.
Fig. 55 shows that single gRNAs targeting the HS2 enhancer effect potent transcriptional
repression of globin genes. A. dCas9 and dCas9-KRAB repressors were delivered on a
lentiviral vector. Single gRNAs were transiently transfected for screening. When assayed
by quantitative RT-PCR at 3 days post-transfection, K562s expressing dCas9-KRAB achieve
up to 80% repression of B. γ-globin, C. ε-globin, and D. β-globin genes, as compared
to control cells that received no gRNA treatment. D. Protein expression in cells expressing
dCas9 or dCas9-KRAB and treated with Cr4 or Cr8 show mild repression of γ-globin expression
at day 3, compared to β-actin controls.
Fig. 56 shows expression of globin locus genes with varying doses of gRNA plasmid
delivered to cells treated with A. no lentivirus, B. dCas9 lentivirus, or C. dCas9-KRAB
lentivirus. Increasing the dose of Cr4 gRNA plasmid delivered enhanced repression
in dCas9-KRAB treated cells, indicating that both the dCas9-KRAB effector and targeted
gRNA play a role in achieving repression.
Fig. 57 shows that stably delivering single gRNAs with dCas9-KRAB silences expression
of the globin genes. A. dCas9 and dCas9-KRAB repressors were co-expressed on a lentiviral
vector with single gRNAs. When assayed by quantitative RT-PCR at 7 days post-transduction,
K562s expressing dCas9-KRAB achieve up to 95% repression of B. γ-globin, C. ε-globin,
and D. β-globin genes, as compared to control cells that received no lentiviral treatment.
Fig. 58 shows that isolating the p300 HAT "Core" for targeted epigenetic modification
of histones only via dCas9 fusion.
Fig. 59 shows a simplified schematic of S. pyogenes dCas9-VP64 fusion (top) and dCas9-p300 core fusion (bottom). The Protospacer Adjacent
Motifs (PAM) are shown with arrows at target gene loci and synthetic guide RNA (gRNA)
is shown with hatched arrows.
Fig. 60A-60C show representative data at three human loci demonstrating the efficacy
of activation using dCas9-p300 in relation to dCas9-VP64 and dCas9 without any fused
effector domain in the human 293T cell culture line.
Fig. 61A-61C show the amino acid sequences of the dCas9 constructs. The legend for
all Figs. 61A-61C is shown in Fig. 61A.
Fig. 62 shows that HAT-dCase9-p300 fusion proteins fail to activate gene expression.
Fig. 63 shows that gRNA's also act synergistically with dCas9-p300 Core.
Fig. 64 shows TALEN mediated integration of minidystrophin at the 5'UTR of the Dp427m
skeletal muscle isoform of dystrophin in skeletal myoblast cell lines derived from
human DMD patients carrying different deletions in the dystrophin gene. DMD patient
cells were electroporated with constructs encoding a TALEN pair active at the 5'UTR
locus and a donor template carrying the minidystrophin gene. (a) Schematic showing
how minidystrophin is integrated into the 5'UTR. (b) Hygromycin-resistant clonal cell
lines were isolated and screened by PCR for successful site-specific integrations
at the 5'UTR using the primers shown in (a). Asterisks indicate clones selected for
further analysis in (c). (c) Clonally isolated DMD myoblasts with detected integration
events were differentiated for 6 days and assessed for expression of an HA tag fused
to the C terminus of minidystrophin.
DETAILED DESCRIPTION
[0037] As described herein, certain methods and engineered CRISPR/CRISPR-associated (Cas)
9-based system compositions have been discovered to be useful for altering the expression
of genes, genome engineering, and correcting or reducing the effects of mutations
in genes involved in genetic diseases. The CRISPR/Cas9-bascd system involves a Cas9
protein and at least one guide RNA, which provide the DNA targeting specificity for
the system. In particular, the present disclosure describes a Cas9 fusion protein
that combines the DNA sequence targeting function of the CRISPR/Cas9-based system
with an additional activity, thus allowing changes in gene expression and/or epigenetic
status. The system may also be used in genome engineering and correcting or reducing
the effects of gene mutations.
[0038] The present disclosure also provides certain compositions and methods for delivering
CRISPR/CRISPR-associated (Cas) 9-based system and multiple gRNAs to target one or
more endogenous genes. Co-transfection of multiple sgRNAs targeted to a single promoter
allow for synergistic activation, however, co-transfection of multiple plasmids leads
to variable expression levels in each cell due to differences in copy number. Additionally,
gene activation following transfection is transient due to dilution of plasmid DNA
over time. Moreover, many cell types are not easily transfected and transient gene
expression may not be sufficient for inducing a therapeutic effect. To address these
limitations, a single lentiviral system was developed to express Cas9 and up to four
sgRNAs from independent promoters. A platform is disclosed that expresses Cas9 or
dCas9 fusion proteins and up to four gRNAs from a single lentiviral vector. The lentiviral
vector expresses a constitutive or inducible Cas9 or dCas9-VP64 in addition to one,
two, three, or four gRNAs expressed from independent promoters. This system enables
control of both the magnitude and timing of CRISPR/Cas9-based gene regulation. Furthermore,
the lentiviral platform provides the potent and sustained levels of gene expression
that will facilitate therapeutic applications of the CRISPR/Cas9 system in primary
cells. Finally, this system may be used for editing multiple genes simultaneously,
such as the concurrent knockout of several oncogenes.
[0039] The present disclosure also provides certain compositions and methods for delivering
site-specific nucleases to skeletal muscle and cardiac muscle using modified adeno-associated
virus (AAV) vectors. The site-specific nucleases, which may be engineered, are useful
for altering the expression of genes, genome engineering, correcting or reducing the
effects of mutations in genes involved in genetic diseases, or manipulating genes
involved in other conditions affecting skeletal muscle or cardiac muscle or muscle
regeneration. The engineered site-specific nucleases may include a zinc finger nuclease
(ZFN), a TAL effector nuclease (TALEN), and/or a CRISPR/Cas9 system for genome editing.
As described herein, genes in skeletal muscle tissue were successfully edited
in vivo using this unique delivery system. Disclosed herein is a means to rewrite the human
genome for therapeutic applications and target model species for basic science applications.
[0040] Gene editing is highly dependent on cell cycle and complex DNA repair pathways that
vary from tissue to tissue. Skeletal muscle is a very complex environment, consisting
of large myofibers with more than 100 nuclei per cell. Gene therapy and biologics
in general have been limited for decades by
in vivo delivery hurdles. These challenges include stability of the carrier
in vivo, targeting the right tissue, getting sufficient gene expression and active gene product,
and avoiding toxicity that might overcome activity, which is common with gene editing
tools. Other delivery vehicles, such as direct injection of plasmid DNA, work to express
genes in skeletal muscle and cardiac muscle in other contexts, but do not work well
with these site-specific nucleases for achieving detectable levels of genome editing.
[0041] While many gene sequences are unstable in AAV vectors and therefore undeliverable,
these site-specific nucleases are surprisingly stable in the AAV vectors. When these
site-specific nucleases are delivered and expressed, they remained active in the skeletal
muscle tissue. The protein stability and activity of the site-specific nucleases are
highly tissue type- and cell type-dependent. These active and stable nucleases are
able to modify gene sequences in the complex environment of skeletal muscle. The current
disclosure describes a way to deliver active forms of this class of therapeutics to
skeletal muscle or cardiac muscle that is effective, efficient and facilitates successful
genome modification.
[0042] The present disclosure also provides certain fusion epigenetic effector molecules,
a dCas9-p300 fusion protein, which provides a robust and potentially more widely applicable
tool for synthetic transcriptional modulation compared to the dCas9-VP64 fusion. The
activated target genes to a substantially greater extent than the dCas9-VP64 fusion
protein at all loci tested. In addition, the p300 has intrinsic endogenous activity
at enhancers within the human genome. The dCas9-p300 fusion protein may be able to
activate endogenous target gene promoters and enhancer regions.
[0043] The dCas9-p300 fusion protein can be used in human tissue culture cell lines to activate
gene expression. This fusion protein may be used to direct the epigenetic state of
target loci within human cells with precision and predictability in order to control
differentiation, modulate cellular regulation, and apply innovative potential therapies.
Current technologies are limited in the strength of activation and the extent and
sustainability of epigenetic modulation; obstacles which may be obviated via utilization
of this new fusion protein.
[0044] Section headings as used in this section and the entire disclosure herein are merely
for organizational purposes and are not intended to be limiting.
1. Definitions
[0045] Unless otherwise defined, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the art. In case of
conflict, the present document, including definitions, will control. Preferred methods
and materials are described below, although methods and materials similar or equivalent
to those described herein can be used in practice or testing of the present disclosure.
[0046] The terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and
variants thereof, as used herein, are intended to be open-ended transitional phrases,
terms, or words that do not preclude the possibility of additional acts or structures.
The singular forms "a," "and" and "the" include plural references unless the context
clearly dictates otherwise. The present disclosure also contemplates other embodiments
"comprising," "consisting of" and "consisting essentially of," the embodiments or
elements presented herein, whether explicitly set forth or not.
[0047] For the recitation of numeric ranges herein, each intervening number there between
with the same degree of precision is explicitly contemplated. For example, for the
range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for
the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and
7.0 are explicitly contemplated.
[0048] "Adeno-associated virus" or "AAV" as used interchangeably herein refers to a small
virus belonging to the genus Dependovirus of the Parvoviridae family that infects
humans and some other primate species. AAV is not currently known to cause disease
and consequently the virus causes a very mild immune response.
[0049] "Binding region" as used herein refers to the region within a nuclease target region
that is recognized and bound by the nuclease.
[0050] "Cardiac muscle" or "heart muscle" as used interchangeably herein means a type of
involuntary striated muscle found in the walls and histological foundation of the
heart, the myocardium. Cardiac muscle is made of cardiomyocytes or myocardiocytes.
Myocardiocytes show striations similar to those on skeletal muscle cells but contain
only one, unique nucleus, unlike the multinucleated skeletal cells.
[0051] "Cardiac muscle condition" as used herein refers to a condition related to the cardiac
muscle, such as cardiomyopathy, heart failure, arrhythmia, and inflammatory heart
disease.
[0052] "Coding sequence" or "encoding nucleic acid" as used herein means the nucleic acids
(RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein.
The coding sequence can further include initiation and termination signals operably
linked to regulatory elements including a promoter and polyadenylation signal capable
of directing expression in the cells of an individual or mammal to which the nucleic
acid is administered. The coding sequence may be codon optimize.
[0053] "Complement" or "complementary" as used herein means a nucleic acid can mean Watson-Crick
(e.g., A-TIU and C-G) or Hoogsteen base pairing between nucleotides or nucleotide
analogs of nucleic acid molecules. "Complementarity" refers to a property shared between
two nucleic acid sequences, such that when they are aligned antiparallel to each other,
the nucleotide bases at each position will be complementary.
[0054] "Correcting", "genome editing" and "restoring" as used herein refers to changing
a mutant gene that encodes a truncated protein or no protein at all, such that a full-length
functional or partially full-length functional protein expression is obtained. Correcting
or restoring a mutant gene may include replacing the region of the gene that has the
mutation or replacing the entire mutant gene with a copy of the gene that does not
have the mutation with a repair mechanism such as homology-directed repair (HDR).
Correcting or restoring a mutant gene may also include repairing a frameshift mutation
that causes a premature stop codon, an aberrant splice acceptor site or an aberrant
splice donor site, by generating a double stranded break in the gene that is then
repaired using non-homologous end joining (NHEJ). NHEJ may add or delete at least
one base pair during repair which may restore the proper reading frame and eliminate
the premature stop codon. Correcting or restoring a mutant gene may also include disrupting
an aberrant splice acceptor site or splice donor sequence. Correcting or restoring
a mutant gene may also include deleting a non-essential gene segment by the simultaneous
action of two nucleases on the same DNA strand in order to restore the proper reading
frame by removing the DNA between the two nuclease target sites and repairing the
DNA break by NHEJ.
[0055] "Donor DNA", "donor template" and "repair template" as used interchangeably herein
refers to a double-stranded DNA fragment or molecule that includes at least a portion
of the gene of interest. The donor DNA may encode a full-functional protein or a partially-functional
protein.
[0056] "Duchenne Muscular Dystrophy" or "DMD" as used interchangeably herein refers to a
recessive, fatal, X-linked disorder that results in muscle degeneration and eventual
death. DMD is a common hereditary monogenic disease and occurs in 1 in 3500 males.
DMD is the result of inherited or spontaneous mutations that cause nonsense or frame
shift mutations in the dystrophin gene. The majority of dystrophin mutations that
cause DMD are deletions of exons that disrupt the reading frame and cause premature
translation termination in the dystrophin gene. DMD patients typically lose the ability
to physically support themselves during childhood, become progressively weaker during
the teenage years, and die in their twenties.
[0057] "Dystrophin" as used herein refers to a rod-shaped cytoplasmic protein which is a
part of a protein complex that connects the cytoskeleton of a muscle fiber to the
surrounding extracellular matrix through the cell membrane. Dystrophin provides structural
stability to the dystroglycan complex of the cell membrane that is responsible for
regulating muscle cell integrity and function. The dystrophin gene or "DMD gene" as
used interchangeably herein is 2.2 megabases at locus Xp21. The primary transcription
measures about 2,400 kb with the mature mRNA being about 14 kb. 79 exons code for
the protein which is over 3500 amino acids.
[0058] "Exon 51" as used herein refers to the 51
st exon of the dystrophin gene. Exon 51 is frequently adjacent to frame-disrupting deletions
in DMD patients and has been targeted in clinical trials for oligonucleotide-based
exon skipping. A clinical trial for the exon 51 skipping compound eteplirsen recently
reported a significant functional benefit across 48 weeks, with an average of 47%
dystrophin positive fibers compared to baseline. Mutations in exon 51 are ideally
suited for permanent correction by NHEJ-based genome editing.
[0059] "Frameshift" or "frameshift mutation" as used interchangeably herein refers to a
type of gene mutation wherein the addition or deletion of one or more nucleotides
causes a shift in the reading frame of the codons in the mRNA. The shift in reading
frame may lead to the alteration in the amino acid sequence at protein translation,
such as a missense mutation or a premature stop codon.
[0060] "Functional" and "full-functional" as used herein describes protein that has biological
activity. A "functional gene" refers to a gene transcribed to mRNA, which is translated
to a functional protein.
[0061] "Fusion protein" as used herein refers to a chimeric protein created through the
joining of two or more genes that originally coded for separate proteins. The translation
of the fusion gene results in a single polypeptide with functional properties derived
from each of the original proteins.
[0062] "Genetic construct" as used herein refers to the DNA or RNA molecules that comprise
a nucleotide sequence that encodes a protein. The coding sequence includes initiation
and termination signals operably linked to regulatory elements including a promoter
and polyadenylation signal capable of directing expression in the cells of the individual
to whom the nucleic acid molecule is administered. As used herein, the term "expressible
form" refers to gene constructs that contain the necessary regulatory elements operable
linked to a coding sequence that encodes a protein such that when present in the cell
of the individual, the coding sequence will be expressed.
[0063] "Genetic disease" as used herein refers to a disease, partially or completely, directly
or indirectly, caused by one or more abnormalities in the genome, especially a condition
that is present from birth. The abnormality may be a mutation, an insertion or a deletion.
The abnormality may affect the coding sequence of the gene or its regulatory sequence.
The genetic disease may be, but not limited to DMD, hemophilia, cystic fibrosis, Huntington's
chorea, familial hypercholesterolemia (LDL receptor defect), hepatoblastoma, Wilson's
disease, congenital hepatic porphyria, inherited disorders of hepatic metabolism,
Lesch Nyhan syndrome, sickle cell anemia, thalassaemias, xeroderma pigmentosum, Fanconi's
anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma,
and Tay-Sachs disease.
[0064] "Homology-directed repair" or "HDR" as used interchangeably herein refers to a mechanism
in cells to repair double strand DNA lesions when a homologous piece of DNA is present
in the nucleus, mostly in G2 and S phase of the cell cycle. HDR uses a donor DNA template
to guide repair and may be used to create specific sequence changes to the genome,
including the targeted addition of whole genes. If a donor template is provided along
with the site specific nuclease, such as with a CRISPR/Cas9-based systems, then the
cellular machinery will repair the break by homologous recombination, which is enhanced
several orders of magnitude in the presence of DNA cleavage. When the homologous DNA
piece is absent, non-homologous end joining may take place instead.
[0065] "Genome editing" as used herein refers to changing a gene. Genome editing may include
correcting or restoring a mutant gene. Genome editing may include knocking out a gene,
such as a mutant gene or a normal gene. Genome editing may be used to treat disease
or enhance muscle repair by changing the gene of interest.
[0066] "Identical" or "identity" as used herein in the context of two or more nucleic acids
or polypeptide sequences means that the sequences have a specified percentage of residues
that are the same over a specified region. The percentage may be calculated by optimally
aligning the two sequences, comparing the two sequences over the specified region,
determining the number of positions at which the identical residue occurs in both
sequences to yield the number of matched positions, dividing the number of matched
positions by the total number of positions in the specified region, and multiplying
the result by 100 to yield the percentage of sequence identity. In cases where the
two sequences are of different lengths or the alignment produces one or more staggered
ends and the specified region of comparison includes only a single sequence, the residues
of single sequence are included in the denominator but not the numerator of the calculation.
When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent.
Identity may be performed manually or by using a computer sequence algorithm such
as BLAST or BLAST 2.0.
[0067] "Mutant gene" or "mutated gene" as used interchangeably herein refers to a gene that
has undergone a detectable mutation. A mutant gene has undergone a change, such as
the loss, gain, or exchange of genetic material, which affects the normal transmission
and expression of the gene. A "disrupted gene" as used herein refers to a mutant gene
that has a mutation that causes a premature stop codon. The disrupted gene product
is truncated relative to a full-length undisrupted gene product.
[0068] "Non-homologous end joining (NHEJ) pathway" as used herein refers to a pathway that
repairs double-strand breaks in DNA by directly ligating the break ends without the
need for a homologous template. The template-independent re-ligation of DNA ends by
NHEJ is a stochastic, error-prone repair process that introduces random micro-insertions
and microdeletions (indcls) at the DNA breakpoint. This method may be used to intentionally
disrupt, delete, or alter the reading frame of targeted gene sequences. NHEJ typically
uses short homologous DNA sequences called microhomologies to guide repair. These
microhomologies are often present in single-stranded overhangs on the end of double-strand
breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break
accurately, yet imprecise repair leading to loss of nucleotides may also occur, but
is much more common when the overhangs are not compatible.
[0069] "Normal gene" as used herein refers to a gene that has not undergone a change, such
as a loss, gain, or exchange of genetic material. The normal gene undergoes normal
gene transmission and gene expression.
[0070] "Nuclease mediated NHEJ" as used herein refers to NHEJ that is initiated after a
nuclease, such as a cas9, cuts double stranded DNA.
[0071] "Nucleic acid" or "oligonucleotide" or "polynucleotide" as used herein means at least
two nucleotides covalently linked together. The depiction of a single strand also
defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses
the complementary strand of a depicted single strand. Many variants of a nucleic acid
may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also
encompasses substantially identical nucleic acids and complements thereof. A single
strand provides a probe that may hybridize to a target sequence under stringent hybridization
conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent
hybridization conditions.
[0072] Nucleic acids may be single stranded or double stranded, or may contain portions
of both double stranded and single stranded sequence. The nucleic acid may be DNA,
both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations
of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine,
thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine.
Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.
[0073] "Operably linked" as used herein means that expression of a gene is under the control
of a promoter with which it is spatially connected. A promoter may be positioned 5'
(upstream) or 3' (downstream) of a gene under its control. The distance between the
promoter and a gene may be approximately the same as the distance between that promoter
and the gene it controls in the gene from which the promoter is derived. As is known
in the art, variation in this distance may be accommodated without loss of promoter
function.
[0074] "Partially-functional" as used herein describes a protein that is encoded by a mutant
gene and has less biological activity than a functional protein but more than a non-functional
protein.
[0075] "Premature stop codon" or "out-of-frame stop codon" as used interchangeably herein
refers to nonsense mutation in a sequence of DNA, which results in a stop codon at
location not normally found in the wild-type gene. A premature stop codon may cause
a protein to be truncated or shorter compared to the full-length version of the protein.
[0076] "Promoter" as used herein means a synthetic or naturally-derived molecule which is
capable of conferring, activating or enhancing expression of a nucleic acid in a cell.
A promoter may comprise one or more specific transcriptional regulatory sequences
to further enhance expression and/or to alter the spatial expression and/or temporal
expression of same. A promoter may also comprise distal enhancer or repressor elements,
which may be located as much as several thousand base pairs from the start site of
transcription. A promoter may be derived from sources including viral, bacterial,
fungal, plants, insects, and animals. A promoter may regulate the expression of a
gene component constitutively, or differentially with respect to cell, the tissue
or organ in which expression occurs or, with respect to the developmental stage at
which expression occurs, or in response to external stimuli such as physiological
stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters
include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac
operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR
promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and the CMV IE
promoter.
[0077] "Repeat variable diresidue" or "RVD" as used interchangeably herein refers to a pair
of adjacent amino acid residues within a DNA recognition motif (also known as "RVD
module"), which includes 33-35 amino acids, of a TALE DNA-binding domain. The RVD
determines the nucleotide specificity of the RVD module. RVD modules may be combined
to produce an RVD array. The "RVD array length" as used herein refers to the number
of RVD modules that corresponds to the length of the nucleotide sequence within the
TALEN target region that is recognized by a TALEN,
i.e., the binding region.
[0078] "Site-specific nuclease" as used herein refers to an enzyme capable of specifically
recognizing and cleaving DNA sequences. The site-specific nuclease may be engineered.
Examples of engineered site-specific nucleases include zinc finger nucleases (ZFNs),
TAL effector nucleases (TALENs), and CRISPR/Cas9-based systems.
[0079] "Skeletal muscle" as used herein refers to a type of striated muscle, which is under
the control of the somatic nervous system and attached to bones by bundles of collagen
fibers known as tendons. Skeletal muscle is made up of individual components known
as myocytes, or "muscle cells", sometimes colloquially called "muscle fibers." Myocytes
are formed from the fusion of developmental myoblasts (a type of embryonic progenitor
cell that gives rise to a muscle cell) in a process known as myogenesis. These long,
cylindrical, multinucleated cells are also called myofibers.
[0080] "Skeletal muscle condition" as used herein refers to a condition related to the skeletal
muscle, such as muscular dystrophies, aging, muscle degeneration, wound healing, and
muscle weakness or atrophy.
[0081] "Spacers" and "spacer region" as used interchangeably herein refers to the region
within a TALEN or ZFN target region that is between, but not a part of, the binding
regions for two TALENs or ZFNs.
[0082] "Subject" and "patient" as used herein interchangeably refers to any vertebrate,
including, but not limited to, a mammal (
e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat,
dog, rat, and mouse, a non-human primate (for example, a monkey, such as a cynomolgous
or rhesus monkey, chimpanzee, etc.) and a human). In some embodiments, the subject
may be a human or a non-human. The subject or patient may be undergoing other forms
of treatment.
[0083] "Target gene" as used herein refers to any nucleotide sequence encoding a known or
putative gene product. The target gene may be a mutated gene involved in a genetic
disease.
[0084] "Target region" as used herein refers to the region of the target gene to which the
site-specific nuclease is designed to bind and cleave.
[0085] "Transcription activator-like effector" or "TALE" as used herein refers to a protein
structure that recognizes and binds to a particular DNA sequence. The "TALE DNA-binding
domain" refers to a DNA-binding domain that includes an array of tandem 33-35 amino
acid repeats, also known as RVD modules, each of which specifically recognizes a single
base pair of DNA. RVD modules may be arranged in any order to assemble an array that
recognizes a defined sequence.
[0086] A binding specificity of a TALE DNA-binding domain is determined by the RVD array
followed by a single truncated repeat of 20 amino acids. A TALE DNA-binding domain
may have 12 to 27 RVD modules, each of which contains an RVD and recognizes a single
base pair of DNA. Specific RVDs have been identified that recognize each of the four
possible DNA nucleotides (A, T, C, and G). Because the TALE DNA-binding domains are
modular, repeats that recognize the four different DNA nucleotides may be linked together
to recognize any particular DNA sequence. These targeted DNA-binding domains may then
be combined with catalytic domains to create functional enzymes, including artificial
transcription factors, methyltransferases, integrases, nucleases, and recombinases.
[0087] "Transcription activator-like effector nucleases" or "TALENs" as used interchangeably
herein refers to engineered fusion proteins of the catalytic domain of a nuclease,
such as endonuclease
FokI, and a designed TALE DNA-binding domain that may be targeted to a custom DNA sequence.
A "TALEN monomer" refers to an engineered fusion protein with a catalytic nuclease
domain and a designed TALE DNA-binding domain. Two TALEN monomers may be designed
to target and cleave a TALEN target region.
[0088] "Transgene" as used herein refers to a gene or genetic material containing a gene
sequence that has been isolated from one organism and is introduced into a different
organism. This non-native segment of DNA may retain the ability to produce RNA or
protein in the transgenic organism, or it may alter the normal function of the transgenic
organism's genetic code. The introduction of a transgene has the potential to change
the phenotype of an organism.
[0089] "Variant" used herein with respect to a nucleic acid means (i) a portion or fragment
of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide
sequence or portion thereof; (iii) a nucleic acid that is substantially identical
to a referenced nucleic acid or the complement thereof; or (iv) a nucleic acid that
hybridizes under stringent conditions to the referenced nucleic acid, complement thereof,
or a sequences substantially identical thereto.
[0090] "Variant" with respect to a peptide or polypeptide that differs in amino acid sequence
by the insertion, deletion, or conservative substitution of amino acids, but retain
at least one biological activity. Variant may also mean a protein with an amino acid
sequence that is substantially identical to a referenced protein with an amino acid
sequence that retains at least one biological activity. A conservative substitution
of an amino acid,
i.e., replacing an amino acid with a different amino acid of similar properties (
e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the
art as typically involving a minor change. These minor changes may be identified,
in part, by considering the hydropathic index of amino acids, as understood in the
art.
Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity
and charge. It is known in the art that amino acids of similar hydropathic indexes
may be substituted and still retain protein function. In one aspect, amino acids having
hydropathic indexes of ±2 are substituted. The hydrophilicity of amino acids may also
be used to reveal substitutions that would result in proteins retaining biological
function. A consideration of the hydrophilicity of amino acids in the context of a
peptide permits calculation of the greatest local average hydrophilicity of that peptide.
Substitutions may be performed with amino acids having hydrophilicity values within
±2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino
acids are influenced by the particular side chain of that amino acid. Consistent with
that observation, amino acid substitutions that are compatible with biological function
are understood to depend on the relative similarity of the amino acids, and particularly
the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity,
charge, size, and other properties.
[0091] "Vector" as used herein means a nucleic acid sequence containing an origin of replication.
A vector may be a viral vector, bacteriophage, bacterial artificial chromosome or
yeast artificial chromosome. A vector may be a DNA or RNA vector. A vector may be
a selfreplicating extrachromosomal vector, and preferably, is a DNA plasmid. For example,
the vector may encode an iCas9-VP64 fusion protein comprising the amino acid sequence
of SEQ ID NO: 1 or at least one gRNA nucleotide sequence of any one of SEQ ID NOs:
5-40, 65-144, 492-515, 540-563, and 585-625. Alternatively, the vector may encode
Cas9 and at least one gRNA nucleotide sequence of any one of SEQ ID NOs: 5-40, 65-144,
492-515, 540-563, and 585-625.
[0092] "Zinc finger" as used herein refers to a protein structure that recognizes and binds
to DNA sequences. The zinc finger domain is the most common DNA-binding motif in the
human proteome. A single zinc finger contains approximately 30 amino acids and the
domain typically functions by binding 3 consecutive base pairs of DNA via interactions
of a single amino acid side chain per base pair.
[0093] "Zinc finger nuclease" or "ZFN" as used interchangeably herein refers to a chimeric
protein molecule comprising at least one zinc finger DNA binding domain effectively
linked to at least one nuclease or part of a nuclease capable of cleaving DNA when
fully assembled.
[0094] Unless otherwise defined herein, scientific and technical terms used in connection
with the present disclosure shall have the meanings that are commonly understood by
those of ordinary skill in the art. For example, any nomenclatures used in connection
with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology,
genetics and protein and nucleic acid chemistry and hybridization described herein
are those that are well known and commonly used in the art. The meaning and scope
of the terms should be clear; in the event however of any latent ambiguity, definitions
provided herein take precedent over any dictionary or extrinsic definition. Further,
unless otherwise required by context, singular terms shall include pluralities and
plural terms shall include the singular.
2. Compositions for Genome Editing
[0095] The present disclosure is directed to compositions for genome editing, genomic alteration
or altering gene expression of a target gene. The compositions may include a may include
viral vector and fusion protein such as a site-specific nuclease or CRISPR/Cas9-system
with at least one gRNA.
a. Compositions for Genome Editing in Muscle
[0096] The present disclosure is directed to a composition for genome editing a target gene
in skeletal muscle or cardiac muscle of a subject. The composition includes a modified
AAV vector and a nucleotide sequence encoding a site-specific nuclease. The composition
delivers active forms of site-specific nucleases to skeletal muscle or cardiac muscle.
The composition may further comprise a donor DNA or a transgene. These compositions
may be used in genome editing, genome engineering, and correcting or reducing the
effects of mutations in genes involved in genetic diseases and/or other skeletal or
cardiac muscle conditions.
[0097] The target gene may be involved in differentiation of a cell or any other process
in which activation, repression, or disruption of a gene may be desired, or may have
a mutation such as a deletion, frameshift mutation, or a nonsense mutation. If the
target gene has a mutation that causes a premature stop codon, an aberrant splice
acceptor site or an aberrant splice donor site, the site-specific nucleases may be
designed to recognize and bind a nucleotide sequence upstream or downstream from the
premature stop codon, the aberrant splice acceptor site or the aberrant splice donor
site. The site-specific nucleases may also be used to disrupt normal gene splicing
by targeting splice acceptors and donors to induce skipping of premature stop codons
or restore a disrupted reading frame. The site-specific nucleases may or may not mediate
off-target changes to protein-coding regions of the genome.
3. CRISPR system
[0098] "Clustered Regularly Interspaced Short Palindromic Repeats" and "CRISPRs", as used
interchangeably herein refers to loci containing multiple short direct repeats that
are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced
archaea. The CRISPR system is a microbial nuclease system involved in defense against
invading phages and plasmids that provides a form of acquired immunity. The CRISPR
loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as
well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated
nucleic acid cleavage. Short segments of foreign DNA, called spacers, are incorporated
into the genome between CRISPR repeats, and serve as a 'memory' of past exposures.
Cas9 forms a complex with the 3' end of the sgRNA, and the protein-RNA pair recognizes
its genomic target by complementary base pairing between the 5' end of the sgRNA sequence
and a predefined 20 bp DNA sequence, known as the protospacer. This complex is directed
to homologous loci of pathogen DNA via regions encoded within the crRNA, i.e., the
protospacers, and protospacer-adjacent motifs (PAMs) within the pathogen genome. The
non-coding CRISPR array is transcribed and cleaved within direct repeats into short
crRNAs containing individual spacer sequences, which direct Cas nucleases to the target
site (protospacer). By simply exchanging the 20 bp recognition sequence of the expressed
sgRNA, the Cas9 nuclease can be directed to new genomic targets. CRISPR spacers are
used to recognize and silence exogenous genetic elements in a manner analogous to
RNAi in eukaryotic organisms.
[0099] Three classes of CRISPR systems (Types I, II and III effector systems) are known.
The Type II effector system carries out targeted DNA double-strand break in four sequential
steps, using a single effector enzyme, Cas9, to cleave dsDNA. Compared to the Type
I and Type III effector systems, which require multiple distinct effectors acting
as a complex, the Type II effector system may function in alternative contexts such
as eukaryotic cells. The Type 11 effector system consists of a long pre-crRNA, which
is transcribed from the spacer-containing CRISPR locus, the Cas9 protein, and a tracrRNA,
which is involved in pre-crRNA processing. The tracrRNAs hybridize to the repeat regions
separating the spacers of the pre-crRNA, thus initiating dsRNA cleavage by endogenous
RNase III. This cleavage is followed by a second cleavage event within each spacer
by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9,
forming a Cas9:crRNA-tracrRNA complex.
[0100] The Cas9:crRNA-tracrRNA complex unwinds the DNA duplex and searches for sequences
matching the crRNA to cleave. Target recognition occurs upon detection of complementarity
between a "protospacer" sequence in the target DNA and the remaining spacer sequence
in the crRNA. Cas9 mediates cleavage of target DNA if a correct protospacer-adjacent
motif (PAM) is also present at the 3' end of the protospacer. For protospacer targeting,
the sequence must be immediately followed by the protospacer-adjacent motif (PAM),
a short sequence recognized by the Cas9 nuclease that is required for DNA cleavage.
Different Type II systems have differing PAM requirements. The
S. pyogenes CRISPR system may have the PAM sequence for this Cas9 (SpCas9) as 5'-NRG-3', where
R is either A or G, and characterized the specificity of this system in human cells.
A unique capability of the CRISPR/Cas9 system is the straightforward ability to simultaneously
target multiple distinct genomic loci by co-expressing a single Cas9 protein with
two or more sgRNAs. For example, the
Streptococcus pyogenes Type II system naturally prefers to use an "NGG" sequence, where "N" can be any nucleotide,
but also accepts other PAM sequences, such as "NAG" in engineered systems (
Hsu et al., Nature Biotechnology (2013) doi:10.1038/nbt.2647). Similarly, the Cas9 derived from
Neisseria meningitidis (NmCas9) normally has a native PAM of NNNNGATT, but has activity across a variety
of PAMs, including a highly degenerate NNNNGNNN PAM (
Esvelt et al. Nature Methods (2013) doi:10.1038/nmeth.2681).
4. CRISPR/Cas9-based system
[0101] An engineered form of the Type II effector system of
Streptococcus pyogenes was shown to function in human cells for genome engineering. In this system, the
Cas9 protein was directed to genomic target sites by a synthetically reconstituted
"guide RNA" ("gRNA", also used interchangeably herein as a chimeric single guide RNA
("sgRNA")), which is a crRNA-tracrRNA fusion that obviates the need for RNase III
and crRNA processing in general (see Fig. 53A). Provided herein are CRISPR/Cas9-based
engineered systems for use in genome editing and treating genetic diseases. The CRISPR/Cas9-based
engineered systems may be designed to target any gene, including genes involved in
a genetic disease, aging, tissue regeneration, or wound healing. The CRISPR/Cas9-based
systems may include a Cas9 protein or Cas9 fusion protein and at least one gRNA. The
Cas9 fusion protein may, for example, include a domain that has a different activity
that what is endogenous to Cas9, such as a transactivation domain.
[0102] The target gene may be involved in differentiation of a cell or any other process
in which activation of a gene may be desired, or may have a mutation such as a frameshift
mutation or a nonsense mutation. If the target gene has a mutation that causes a premature
stop codon, an aberrant splice acceptor site or an aberrant splice donor site, the
CRISPR/Cas9-based system may be designed to recognize and bind a nucleotide sequence
upstream or downstream from the premature stop codon, the aberrant splice acceptor
site or the aberrant splice donor site. The CRISPR-Cas9-based system may also be used
to disrupt normal gene splicing by targeting splice acceptors and donors to induce
skipping of premature stop codons or restore a disrupted reading frame. The CRISPR/Cas9-based
system may or may not mediate off-target changes to protein-coding regions of the
genome.
a. Cas9
[0103] The CRISPR/Cas9-based system may include a Cas9 protein or a Cas9 fusion protein.
Cas9 protein is an endonuclease that cleaves nucleic acid and is encoded by the CRISPR
loci and is involved in the Type II CRISPR system. The Cas9 protein may be from any
bacterial or archaea species, such as
Streptococcus pyogenes. The Cas9 protein may be mutated so that the nuclease activity is inactivated. An
inactivated Cas9 protein from
Streptococcus pyogenes (iCas9, also referred to as "dCas9") with no endonuclease activity has been recently
targeted to genes in bacteria, yeast, and human cells by gRNAs to silence gene expression
through steric hindrance. As used herein, "iCas9" and "dCas9" both refer to a Cas9
protein that has the amino acid substitutions D10A and H840A and has its nuclease
activity inactivated. For example, the CRISPR/Cas9-based system may include a Cas9
of SEQ ID NO: 459 or 461.
b. Cas9 fusion protein
[0104] The CRISPR/Cas9-based system may include a fusion protein. The fusion protein may
comprise two heterologous polypeptide domains, wherein the first polypeptide domain
comprises a Cas protein and the second polypeptide domain has an activity such as
transcription activation activity, transcription repression activity, transcription
release factor activity, histone modification activity, nuclease activity, nucleic
acid association activity, methylase activity, or demethylase activity. The fusion
protein may include a Cas9 protein or a mutated Cas9 protein, as described above,
fused to a second polypeptide domain that has an activity such as transcription activation
activity, transcription repression activity, transcription release factor activity,
histone modification activity, nuclease activity, nucleic acid association activity,
methylase activity, or demethylase activity.
(1) Transcription Activation Activity
[0105] The second polypeptide domain may have transcription activation activity,
i.e., a transactivation domain. For example, gene expression of endogenous mammalian genes,
such as human genes, may be achieved by targeting a fusion protein of iCas9 and a
transactivation domain to mammalian promoters via combinations of gRNAs. The transactivation
domain may include a VP16 protein, multiple VP16 proteins, such as a VP48 domain or
VP64 domain, or p65 domain of NF kappa B transcription activator activity. For example,
the fusion protein may be iCas9-VP64.
(2) Transcription Repression Activity
[0106] The second polypeptide domain may have transcription repression activity. The second
polypeptide domain may have a Kruppel associated box activity, such as a KRAB domain,
ERF repressor domain activity, Mxi1 repressor domain activity, SID4X repressor domain
activity, Mad-SID repressor domain activity or TATA box binding protein activity.
For example, the fusion protein may be dCas9-KRAB.
(3) Transcription Release Factor Activity
[0107] The second polypeptide domain may have transcription release factor activity. The
second polypeptide domain may have eukaryotic release factor 1 (ERF1) activity or
eukaryotic release factor 3 (ERF3) activity.
(4) Histone Modification Activity
[0108] The second polypeptide domain may have histone modification activity. The second
polypeptide domain may have histone deacetylase, histone acetyltransferase, histone
demethylase, or histone methyltransferase activity. The histone acetyltransferase
may be p300 or CREB-binding protein (CBP) protein, or fragments thereof. For example,
the fusion protein may be dCas9-p300.
(5) Nuclease Activity
[0109] The second polypeptide domain may have nuclease activity that is different from the
nuclease activity of the Cas9 protein. A nuclease, or a protein having nuclease activity,
is an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits
of nucleic acids. Nucleases are usually further divided into endonucleases and exonucleases,
although some of the enzymes may fall in both categories. Well known nucleases are
deoxyribonuclease and ribonuclease.
(6) Nucleic Acid Association Activity
[0110] The second polypeptide domain may have nucleic acid association activity or nucleic
acid binding protein- DNA-binding domain (DBD) is an independently folded protein
domain that contains at least one motif that recognizes double- or single-stranded
DNA. A DBD can recognize a specific DNA sequence (a recognition sequence) or have
a general affinity to DNA. nucleic acid association region selected from the group
consisting of hclix-tum-hclix region, leucine zipper region, winged helix region,
winged helix-turn-helix region, helix-loop-helix region, immunoglobulin fold, B3 domain,
Zinc finger, HMG-box, Wor3 domain, TAL effector DNA-binding domain.
(7) Methylase Activity
[0111] The second polypeptide domain may have methylase activity, which involves transferring
a methyl group to DNA, RNA, protein, small molecule, cytosine or adenine. The second
polypeptide domain may include a DNA methyltransferase.
(8) Demethylase Activity
[0112] The second polypeptide domain may have demethylase activity. The second polypeptide
domain may include an enzyme that remove methyl (CH3-) groups from nucleic acids,
proteins (in particular histones), and other molecules. Alternatively, the second
polypeptide may covert the methyl group to hydroxymethylcytosine in a mechanism for
demethylating DNA. The second polypeptide may catalyze this reaction. For example,
the second polypeptide that catalyzes this reaction may be Tet1.
c. gRNA
[0113] The gRNA provides the targeting of the CRISPR/Cas9-based system. The gRNA is a fusion
of two noncoding RNAs: a crRNA and a tracrRNA. The sgRNA may target any desired DNA
sequence by exchanging the sequence encoding a 20 bp protospacer which confers targeting
specificity through complementary base pairing with the desired DNA target. gRNA mimics
the naturally occurring crRNA:tracrRNA duplex involved in the Type II Effector system.
This duplex, which may include, for example, a 42-nucleotide crRNA and a 75-nucleotide
tracrRNA, acts as a guide for the Cas9 to cleave the target nucleic acid. The "target
region", "target sequence" or "protospacer" as used interchangeably herein refers
to the region of the target gene to which the CRISPR/Cas9-based system targets. The
CRISPR/Cas9-based system may include at least one gRNA, wherein the gRNAs target different
DNA sequences. The target DNA sequences may be overlapping. The target sequence or
protospacer is followed by a PAM sequence at the 3' end of the protospacer. Different
Type II systems have differing PAM requirements. For example, the
Streptococcus pyogenes Type II system uses an "NGG" sequence, where "N" can be any nucleotide.
[0114] The number of gRNA administered to the cell may be at least 1 gRNA, at least 2 different
gRNA, at least 3 different gRNA at least 4 different gRNA, at least 5 different gRNA,
at least 6 different gRNA, at least 7 different gRNA, at least 8 different gRNA, at
least 9 different gRNA, at least 10 different gRNAs, at least 11 different gRNAs,
at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs,
at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs,
at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs,
at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs,
at least 40 different gRNAs, at least 45 different gRNAs, or at least 50 different
gRNAs. The number of gRNA administered to the cell may be between at least 1 gRNA
to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at
least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different
gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least
25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA
to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at
least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different
gRNAs, at least 4 gRNAs to at least 50 different gRNAs, at least 4 different gRNAs
to at least 45 different gRNAs, at least 4 different gRNAs to at least 40 different
gRNAs, at least 4 different gRNAs to at least 35 different gRNAs, at least 4 different
gRNAs to at least 30 different gRNAs, at least 4 different gRNAs to at least 25 different
gRNAs, at least 4 different gRNAs to at least 20 different gRNAs, at least 4 different
gRNAs to at least 16 different gRNAs, at least 4 different gRNAs to at least 12 different
gRNAs, at least 4 different gRNAs to at least 8 different gRNAs, at least 8 different
gRNAs to at least 50 different gRNAs, at least 8 different gRNAs to at least 45 different
gRNAs, at least 8 different gRNAs to at least 40 different gRNAs, at least 8 different
gRNAs to at least 35 different gRNAs, 8 different gRNAs to at least 30 different gRNAs,
at least 8 different gRNAs to at least 25 different gRNAs, 8 different gRNAs to at
least 20 different gRNAs, at least 8 different gRNAs to at least 16 different gRNAs,
or 8 different gRNAs to at least 12 different gRNAs.
[0115] The gRNA may comprise a complementary polynucleotide sequence of the target DNA sequence
followed by a PAM sequence. The gRNA may comprise a "G" at the 5' end of the complementary
polynucleotide sequence. The gRNA may comprise at least a 10 base pair, at least a
11 base pair, at least a 12 base pair, at least a 13 base pair, at least a 14 base
pair, at least a 15 base pair, at least a 16 base pair, at least a 17 base pair, at
least a 18 base pair, at least a 19 base pair, at least a 20 base pair, at least a
21 base pair, at least a 22 base pair, at least a 23 base pair, at least a 24 base
pair, at least a 25 base pair, at least a 30 base pair, or at least a 35 base pair
complementary polynucleotide sequence of the target DNA sequence followed by a PAM
sequence. The PAM sequence may be "NGG", where "N" can be any nucleotide. The gRNA
may target at least one of the promoter region, the enhancer region or the transcribed
region of the target gene. The gRNA may include a nucleic acid sequence of at least
one of SEQ ID NOs: 5-40, 65-144, 492-515, 540-563, 585-625, 462 (Fig. 40), 464 (Fig.
41), and 465 (Fig. 41).
[0116] The gRNA may target any nucleic acid sequence. The nucleic acid sequence target may
be DNA. The DNA may be any gene. For example, the gRNA may target a gene, such as
BRN2, MYT1L, ASCL1, NANOG, VEGFA, TERT, IL1B, IL1R2, IL1RN, HBG1, HBG2, MYOD1, OCT4, and
DMD.
(1) Dystrophin
[0117] Dystrophin is a rod-shaped cytoplasmic protein which is a part of a protein complex
that connects the cytoskeleton of a muscle fiber to the surrounding extracellular
matrix through the cell membrane. Dystrophin provides structural stability to the
dystroglycan complex of the cell membrane. The dystrophin gene is 2.2 megabases at
locus Xp21. The primary transcription measures about 2,400 kb with the mature mRNA
being about 14 kb. 79 exons code for the protein which is over 3500 amino acids. Normal
skeleton muscle tissue contains only small amounts of dystrophin but its absence of
abnormal expression leads to the development of severe and incurable symptoms. Some
mutations in the dystrophin gene lead to the production of defective dystrophin and
severe dystrophic phenotype in affected patients. Some mutations in the dystrophin
gene lead to partially-functional dystrophin protein and a much milder dystrophic
phenotype in affected patients.
[0118] DMD is the result of inherited or spontaneous mutations that cause nonsense or frame
shift mutations in the dystrophin gene. Naturally occurring mutations and their consequences
are relatively well understood for DMD. It is known that in-frame deletions that occur
in the exon 45-55 region contained within the rod domain can produce highly functional
dystrophin proteins, and many carriers are asymptomatic or display mild symptoms.
Furthermore, more than 60% of patients may theoretically be treated by targeting exons
in this region of the dystrophin gene. Efforts have been made to restore the disrupted
dystrophin reading frame in DMD patients by skipping non-essential exons during mRNA
splicing to produce internally deleted but functional dystrophin proteins. The deletion
of internal dystrophin exons retain the proper reading frame but cause the less severe
Becker muscular dystrophy.
(2) CRISPR/Cas9-based system for targeting dystrophin
[0119] A CRISPR/Cas9-based system specific for dystrophin gene are disclosed herein. The
CRISPR/Cas9-based system may include Cas9 and at least one gRNA to target the dystrophin
gene. The CRISPR/Cas9-based system may bind and recognize a target region. The target
regions may be chosen immediately upstream of possible out-of-frame stop codons such
that insertions or deletions during the repair process restore the dystrophin reading
frame by frame conversion. Target regions may also be splice acceptor sites or splice
donor sites, such that insertions or deletions during the repair process disrupt splicing
and restore the dystrophin reading frame by splice site disruption and exon exclusion.
Target regions may also be aberrant stop codons such that insertions or deletions
during the repair process restore the dystrophin reading frame by eliminating or disrupting
the stop codon.
[0120] Single or multiplexed sgRNAs may be designed to restore the dystrophin reading frame
by targeting the mutational hotspot at exons 45-55 and introducing either intraexonic
small insertions and deletions, or large deletions of one or more exons. Following
treatment with Cas9 and one or more sgRNAs, dystrophin expression may be restored
in Duchenne patient muscle cells
in vitro. Human dystrophin was detected
in vivo following transplantation of genetically corrected patient cells into immunodeficient
mice. Significantly, the unique multiplex gene editing capabilities of the CRISPR/Cas9
system enable efficiently generating large deletions of this mutational hotspot region
that can correct up to 62% of patient mutations by universal or patient-specific gene
editing approaches.
[0121] The CRISPR/Cas9-based system may use gRNA of varying sequences and lengths. Examples
of gRNAs may be found in Table 6. The CRISPR/Cas9-based system may target a nucleic
acid sequence of SEQ ID NOs: 65-144, or a complement thereof. The gRNA may include
a nucleotide sequence selected from the group consisting of SEQ ID NO: 65-144, or
a complement thereof. For example, the disclosed CRISPR/Cas9-based systems were engineered
to mediate highly efficient gene editing at exon 51 of the dystrophin gene. These
CRISPR/Cas9-based systems restored dystrophin protein expression in cells from DMD
patients.
(a) Exons 51 and 45-55
[0122] Exon 51 is frequently adjacent to frame-disrupting deletions in DMD. Elimination
of exon 51 from the dystrophin transcript by exon skipping can be used to treat approximately
15% of all DMD patients. This class of DMD mutations is ideally suited for permanent
correction by NHEJ-based genome editing and HDR. The CRISPR/Cas9-based systems described
herein have been developed for targeted modification of exon 51 in the human dystrophin
gene. These CRISPR/Cas9-based systems were transfected into human DMD cells and mediated
efficient gene modification and conversion to the correct reading frame. Protein restoration
was concomitant with frame restoration and detected in a bulk population of CRISPR/Cas9-based
system -treated cells. Similarly, the elimination of exons 45-55 of the dystrophin
transcript can be used to treat approximately 62% of all DMD patients.
(3) AAV/CRISPR Constructs
[0123] AAV may be used to deliver CRISPRs using various construct configurations (see Fig.
39). For example, AAV may deliver Cas9 and gRNA expression cassettes on separate vectors.
Alternatively, if the small Cas9 proteins, derived from species such as
Staphylococcus aureus or
Neisseria meningitidis, are used then both the Cas9 and up to two gRNA expression cassettes may be combined
in a single AAV vector within the 4.7 kb packaging limit (see Fig. 39).
5. Multiplex CRISPR/Cas9-Based System
[0124] The present disclosure is directed to a multiplex CRISPR/Cas9-Based System which
includes a CRISPR/CRISPR-associated (Cas) 9-based system, such as Cas9 or dCas9, and
multiple gRNAs to target one or more endogenous genes. This platform utilizes a convenient
Golden Gate cloning method to rapidly incorporate up to four independent sgRNA expression
cassettes into a single lentiviral vector. Each sgRNA was efficiently expressed and
could mediate multiplex gene editing at diverse loci in immortalized and primary human
cell lines. Transient transcriptional activation in cell lines stably expressing dCas9-VP64
was demonstrated to be tunable by synergistic activation with one to four sgRNAs.
Furthermore, the single lentiviral vector can induce sustained and long-term endogenous
gene expression in immortalized and primary human cells. This system allows for rapid
assembly of a single lentiviral vector that enables efficient multiplex gene editing
or activation in model and primary cell lines.
[0125] The multiplex CRISPR/Cas9-Based System provides potency of transcriptional activation
and tunable induction of transcriptional activation. Readily generated by Golden Gate
assembly, the final vector expresses a constitutive Cas9 or dCas9-VP64 in addition
to one, two, three, or four sgRNAs expressed from independent promoters. Each promoter
is capable of efficiently expressing sgRNAs that direct similar levels of Cas9 nuclease
activity. Furthermore, lentiviral delivery of a single vector expressing Cas9 and
four sgRNAs targeting independent loci resulted in simultaneous multiplex gene editing
of all four loci. Tunable transcriptional activation at two endogenous genes in both
transient and stable contexts was achieved using lentiviral delivery of Cas9 with
or without sgRNAs. Highly efficient and long-term gene activation in primary human
cells is accomplished. This system is therefore an attractive and efficient method
to generate multiplex gene editing and long-term transcriptional activation in human
cells.
[0126] The multiplex CRISPR/Cas9-Based System allows efficient multiplex gene editing for
simultaneously inactivating multiple genes. The CRISPR/Cas9 system can simultaneously
target multiple distinct genomic loci by co-expressing a single Cas9 protein with
two or more sgRNAs, making this system uniquely suited for multiplex gene editing
or synergistic activation applications. The CRISPR/Cas9 system greatly expedites the
process of molecular targeting to new sites by simply modifying the expressed sgRNA
molecule. The single lentiviral vector may be combined with methods for achieving
inducible control of these components, either by chemical or optogenetic regulation,
to facilitate investigation of the dynamics of gene regulation in both time and space.
[0127] The multiplex CRISPR/Cas9-based systems may transcriptionally activate two or more
endogenous genes. The multiplex CRISPR/Cas9-based systems may transcriptionally repress
two or more endogenous genes. For example, at least two endogenous genes, at least
three endogenous genes, at least four endogenous genes, at least five endogenous genes,
or at least ten endogenous genes may be activated or repressed by the multiplex CRISPR/Cas9-based
system. Between two and fifteen genes, between two and ten genes, between two and
five genes, between five and fifteen genes, or between five and ten genes may be activated
or repressed by the multiplex CRISPR/Cas9-based system.
(1) Modified Lentiviral Vector
[0128] The multiplex CRISPR/Cas9-based system includes a modified lentiviral vector. The
modified lentiviral vector includes a first polynucleotide sequence encoding a fusion
protein and a second polynucleotide sequence encoding at least one sgRNA. The fusion
protein may be the fusion protein of the CRISPR/Cas9-based system, as described above.
The first polynucleotide sequence may be operably linked to a promoter. The promoter
may be a constitutive promoter, an inducible promoter, a repressible promoter, or
a regulatable promoter.
[0129] The second polynucleotide sequence encodes at least 1 sgRNA. For example, the second
polynucleotide sequence may encode at least 1 sgRNA, at least 2 sgRNAs, at least 3
sgRNAs, at least 4 sgRNAs, at least 5 sgRNAs, at least 6 sgRNAs, at least 7 sgRNAs,
at least 8 sgRNAs, at least 9 sgRNAs, at least 10 sgRNAs, at least 11 sgRNA, at least
12 sgRNAs, at least 13 sgRNAs, at least 14 sgRNAs, at least 15 sgRNAs, at least 16
sgRNAs, at least 17 sgRNAs, at least 18 sgRNAs, at least 19 sgRNAs, at least 20 sgRNAs,
at least 25 sgRNA, at least 30 sgRNAs, at least 35 sgRNAs, at least 40 sgRNAs, at
least 45 sgRNAs, or at least 50 sgRNAs. The second polynucleotide sequence may encode
between 1 sgRNA and 50 sgRNAs, between 1 sgRNA and 45 sgRNAs, between 1 sgRNA and
40 sgRNAs, between 1 sgRNA and 35 sgRNAs, between 1 sgRNA and 30 sgRNAs, between 1
sgRNA and 25 different sgRNAs, between 1 sgRNA and 20 sgRNAs, between 1 sgRNA and
16 sgRNAs, between 1 sgRNA and 8 different sgRNAs, between 4 different sgRNAs and
50 different sgRNAs, between 4 different sgRNAs and 45 different sgRNAs, between 4
different sgRNAs and 40 different sgRNAs, between 4 different sgRNAs and 35 different
sgRNAs, between 4 different sgRNAs and 30 different sgRNAs, between 4 different sgRNAs
and 25 different sgRNAs, between 4 different sgRNAs and 20 different sgRNAs, between
4 different sgRNAs and 16 different sgRNAs, between 4 different sgRNAs and 8 different
sgRNAs, between 8 different sgRNAs and 50 different sgRNAs, between 8 different sgRNAs
and 45 different sgRNAs, between 8 different sgRNAs and 40 different sgRNAs, between
8 different sgRNAs and 35 different sgRNAs, between 8 different sgRNAs and 30 different
sgRNAs, between 8 different sgRNAs and 25 different sgRNAs, between 8 different sgRNAs
and 20 different sgRNAs, between 8 different sgRNAs and 16 different sgRNAs, between
16 different sgRNAs and 50 different sgRNAs, between 16 different sgRNAs and 45 different
sgRNAs, between 16 different sgRNAs and 40 different sgRNAs, between 16 different
sgRNAs and 35 different sgRNAs, between 16 different sgRNAs and 30 different sgRNAs,
between 16 different sgRNAs and 25 different sgRNAs, or between 16 different sgRNAs
and 20 different sgRNAs. Each of the polynucleotide sequences encoding the different
sgRNAs may be operably linked to a promoter. The promoters that are operably linked
to the different sgRNAs may be the same promoter. The promoters that are operably
linked to the different sgRNAs may be different promoters. The promoter may be a constitutive
promoter, an inducible promoter, a repressible promoter, or a regulatable promoter.
[0130] The at least one sgRNA may bind to a target gene or loci. If more than one sgRNA
is included, each of the sgRNAs binds to a different target region within one target
loci or each of the sgRNA binds to a different target region within different gene
loci. The fusion protein may include Cas9 protein or iCas9-VP64 protein. The fusion
protein may include a VP64 domain, a p300 domain, or a KRAB domain.
6. Site-Specific Nucleases
[0131] The composition, as described above, includes a nucleotide sequence encoding a site-specific
nuclease that binds and cleaves a target region. The site-specific nuclease may be
engineered. For example, an engineered site-specific nuclease may be a CRISPR/Cas9-based
system, a ZFN, or a TALEN. The site-specific nuclease may bind and cleave a gene or
locus in the genome of a cell in the skeletal muscle or cardiac muscle. For example,
the gene or locus may be the Rosa26 locus or the dystrophin gene.
a. CRISPR/Cas9-based system
[0132] The CRISPR/Cas9-based system, as described above, may be used to introduce site-specific
double strand breaks at targeted genomic loci.
b. Zinc Finger Nucleases (ZFN)
[0133] The site-specific nuclease may be a ZFN. A single zinc finger contains approximately
30 amino acids and the domain functions by binding 3 consecutive base pairs of DNA
via interactions of a single amino acid side chain per base pair. The modular structure
of the zinc finger motif permits the conjunction of several domains in series, allowing
for the recognition and targeting of extended sequences in multiples of 3 nucleotides.
These targeted DNA-binding domains can be combined with a nuclease domain, such as
FokI, to generate a site-specific nuclease, called a "zinc finger nuclease" (ZFNs) that
can be used to introduce site-specific double strand breaks at targeted genomic loci.
This DNA cleavage stimulates the natural DNA-repair machinery, leading to one of two
possible repair pathways, NHEJ and HDR. For example, the ZFN may target the Rosa26
locus (
Perez-Pinera et al. Nucleic Acids Research (2012) 40:3741-3752) or a dystrophin gene. Examples of ZFNs are shown in Table 1 and Figs. 35-38. In
Table 1, the DNA recognition helices are underlined and "Fok ELD-S" and "Fok KKR-S"
refers to the FokI nuclease domain that is fused to the zinc finger protein DNA-binding
domains. In Figs. 35-38, the target DNA sequence in the target sites (i.e., in SEQ
ID NOs: 442, 445, 448, and 453) and the DNA recognition helices in the ZFN amino acid
sequences (i.e., in SEQ ID NOs: 443, 444, 446, 447, 449-452, 454, and 455) are underlined,
respectively.
c. TAL effector Nucleases (TALENs)
[0134] TALENs may be used to introduce site-specific double strand breaks at targeted genomic
loci. Site-specific double-strand breaks are created when two independent TALENs bind
to nearby DNA sequences, thereby permitting dimerization of Fold and cleavage of the
target DNA. TALENs have advanced genome editing due to their high rate of successful
and efficient genetic modification. This DNA cleavage may stimulate the natural DNA-repair
machinery, leading to one of two possible repair pathways: homology-directed repair
(HDR) or the non-homologous end joining (NHEJ) pathway. The TALENs may be designed
to target any gene involved in a genetic disease.
[0135] The TALENs may include a nuclease and a TALE DNA-binding domain that binds to the
target gene in a TALEN target region. The target gene may have a mutation such as
a frameshift mutation or a nonsense mutation. If the target gene has a mutation that
causes a premature stop codon, the TALEN may be designed to recognize and bind a nucleotide
sequence upstream or downstream from the premature stop codon. A "TALEN target region"
includes the binding regions for two TALENs and the spacer region, which occurs between
the binding regions. The two TALENs bind to different binding regions within the TALEN
target region, after which the TALEN target region is cleaved. Examples of TALENs
are described in International Patent Application No.
PCT/US2013/038536.
7. Transcriptional Activators
[0136] The composition, as described above, includes a nucleotide sequence encoding a transcriptional
activator that activates a target gene. The transcriptional activator may be engineered.
For example, an engineered transcriptional activator may be a CRISPR/Cas9-based system,
a zinc finger fusion protein, or a TALE fusion protein.
a. CRISPR/Cas9-based system
[0137] The CRISPR/Cas9-based system, as described above, may be used to activate transcription
of a target gene with RNA. The CRISPR/Cas9-based system may include a fusion protein,
as described above, wherein the second polypeptide domain has transcription activation
activity or histone modification activity. For example, the second polypeptide domain
may include VP64 or p300.
b. Zinc Finger Fusion Proteins
[0138] The transcriptional activator may be a zinc finger fusion protein. The zinc finger
targeted DNA-binding domains, as described above, can be combined with a domain that
has transcription activation activity or histone modification activity. For example,
the domain may include VP64 or p300.
c. TALE fusion proteins
[0139] TALE fusion proteins may be used to activate transcription of a target gene. The
TALE fusion protein may include a TALE DNA-binding domain and a domain that has transcription
activation activity or histone modification activity. For example, the domain may
include VP64 or p300.
8. Compositions
[0140] The present disclosure is directed to a composition for altering gene expression
and engineering or altering genomic DNA in a cell or subject. The composition may
also include a viral delivery system.
a. Compositions for Genome Editing in Muscle
[0141] The present disclosure is directed to a composition for genome editing a target gene
in skeletal muscle or cardiac muscle of a subject. The composition includes a modified
AAV vector and a nucleotide sequence encoding a site-specific nuclease. The composition
delivers active forms of site-specific nucleases to skeletal muscle or cardiac muscle.
The composition may further comprise a donor DNA or a transgene. These compositions
may be used in genome editing, genome engineering, and correcting or reducing the
effects of mutations in genes involved in genetic diseases and/or other skeletal or
cardiac muscle conditions.
[0142] The target gene may be involved in differentiation of a cell or any other process
in which activation, repression, or disruption of a gene may be desired, or may have
a mutation such as a deletion, frameshift mutation, or a nonsense mutation. If the
target gene has a mutation that causes a premature stop codon, an aberrant splice
acceptor site or an aberrant splice donor site, the site-specific nucleases may be
designed to recognize and bind a nucleotide sequence upstream or downstream from the
premature stop codon, the aberrant splice acceptor site or the aberrant splice donor
site. The site-specific nucleases may also be used to disrupt normal gene splicing
by targeting splice acceptors and donors to induce skipping of premature stop codons
or restore a disrupted reading frame. The site-specific nucleases may or may not mediate
off-target changes to protein-coding regions of the genome.
b. Adeno-Associated Virus Vectors
[0143] The composition, as described above, includes a modified adeno-associated virus (AAV)
vector. The modified AAV vector may have enhanced cardiac and skeletal muscle tissue
tropism. The modified AAV vector may be capable of delivering and expressing the site-specific
nuclease in the cell of a mammal. For example, the modified AAV vector may be an AAV-SASTG
vector (
Piacentino et al. (2012) Human Gene Therapy 23:635-646). The modified AAV vector may deliver nucleases to skeletal and cardiac muscle
in vivo. The modified AAV vector may be based on one or more of several capsid types, including
AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. The modified AAV vector may be based on AAV2
pseudotype with alternative muscle-tropic AAV capsids, such as AAV2/1, AAV2/6, AAV2/7,
AAV2/8, AAV2/9, AAV2.5 and AAV/SASTG vectors that efficiently transduce skeletal muscle
or cardiac muscle by systemic and local delivery (
Seto et al. Current Gene Therapy (2012) 12:139-151).
c. CRISPR/Cas9-based system
[0144] The present disclosure also provides DNA targeting systems or compositions of at
least one CRISPR/Cas9-based system, as described above. These compositions may be
used in genome editing, genome engineering, and correcting or reducing the effects
of mutations in genes involved in genetic diseases. The composition includes a CRISPR/Cas9-based
system that includes a Cas9 protein or Cas9 fusion protein, as described above. The
CRISPR/Cas9-based system may also include at least one gRNA, as described above.
d. Multiplex CRISPR/Cas9-Based System
[0145] The present disclosure also provides multiplex CRISPR/Cas9-based systems, as described
above. These compositions may be used in genome editing, genome engineering, and correcting
or reducing the effects of mutations in genes involved in genetic diseases. These
compositions may be used to target more than one gene. The composition includes a
modified lentiviral vector comprising a CRISPR/Cas9-based system that includes a Cas9
protein or Cas9 fusion protein, as described above and more than one gRNA, as described
above.
9. Methods of Uses
[0146] Potential applications of the compositions are diverse across many areas of science
and biotechnology. The disclosed compositions may be used to repair genetic mutations
that cause disease. The disclosed compositions may be used to disrupt genes such that
gene disruption leads to increases in muscle regeneration or muscle strength, or decreases
in muscle aging. The disclosed compositions may be used to introduce therapeutic genes
to be expressed systemically from skeletal muscle or cardiac muscle, such as clotting
factors or monoclonal antibodies. The disclosed compositions may be used to modulate
mammalian gene expression. The disclosed compositions may be used to transdifferentiate
or induce the differentiation of a cell or correct a mutant gene in a cell. Examples
of activation of genes related to cell and gene therapy, genetic reprogramming, and
regenerative medicine are provided. RNA-guided transcriptional activators may be used
to reprogram cell lineage specification. Activation of endogenous genes encoding the
key regulators of cell fate, rather than forced overexpression of these factors, may
potentially lead to more rapid, efficient, stable, or specific methods for genetic
reprogramming, transdifferentiation, and/or induced differentiation.
10. Use in Methods of Genome Editing in Muscle
[0147] The present disclosure is for use in a method of genome editing in a skeletal muscle
or cardiac muscle of a subject. The use comprises administering to the skeletal muscle
or cardiac muscle of the subject the composition for genome editing in skeletal muscle
or cardiac muscle, as described above. The genome editing may include correcting a
mutant gene or inserting a transgene. Correcting the mutant gene may include deleting,
rearranging, or replacing the mutant gene. Correcting the mutant gene may include
nuclease-mediated NHEJ or HDR.
11. Methods of Using CRISPR/Cas9-based system
[0148] Potential applications of the CRISPR/Cas9-based system are diverse across many areas
of science and biotechnology. The disclosed CRISPR/Cas9-based systems may be used
to modulate mammalian gene expression. The disclosed CRISPR/Cas9-based systems may
be used to transdifferentiate or induce differentiation of a cell or correct a mutant
gene in a cell. Examples of activation of genes related to cell and gene therapy,
genetic reprogramming, and regenerative medicine are provided. RNA-guided transcriptional
activators may be used to reprogram cell lineage specification. Although reprogramming
was incomplete and inefficient in these experiments, there are many ways by which
this method could be improved, including repeated transfections of iCas9-VP64/gRNA
combinations, stable expression of these factors, and targeting multiple genes, such
as Bm2 and Mytll in addition to Ascl1 for transdifferentiation into a neuronal phenotype.
Activation of endogenous genes encoding the key regulators of cell fate, rather than
forced overexpression of these factors, may potentially lead to more rapid, efficient,
stable, or specific methods for genetic reprogramming and transdifferentiation or
induced differentiation of a cell. Finally, Cas9 fusions to other domains, including
repressive and epigenetic-modifying domains, could provide a greater diversity of
RNA-guided transcriptional regulators to complement other RNA-based tools for mammalian
cell engineering.
a. Use in Methods of Activating Gene Expression
[0149] The present disclosure provides a mechanism for activating the expression of endogenous
genes, such as mammalian genes, based on targeting a transcriptional activator to
promoters via RNA using a CRISPR/Cas9 based system, as described above. This is fundamentally
different from previously described methods based on engineering sequence-specific
DNA-binding proteins and may provide opportunities for targeted gene regulation. Because
the generation of gRNA expression plasmids simply involves synthesizing two short
custom oligonucleotides and one cloning step, it is possible to generate many new
gene activators quickly and economically. The gRNAs can also be transfected directly
to cells following
in vitro transcription. Multiple gRNAs targeted to single promoters were shown, but simultaneous
targeting of multiple promoters could also be possible. Recognition of genomic target
sites with RNAs, rather than proteins, may also circumvent limitations of targeting
epigenetically modified sites, such as methylated DNA.
[0150] In contrast to current methods based on engineering DNA-binding proteins, Cas9 fused
to a transcriptional activation domain can be targeted by combinations of guide RNA
molecules to induce the expression of endogenous human genes. This straightforward
and versatile approach for targeted gene activation circumvents the need for engineering
new proteins and allows for widespread synthetic gene regulation.
[0151] The use may include administering to a cell or subject a CRISPR/Cas9-based system,
a polynucleotide or vector encoding said CRISPR/Cas9-based system, or DNA targeting
systems or compositions of at least one CRISPR/Cas9-based system, as described above.
The use may include administering a CRISPR/Cas9-based system, such as administering
a Cas9 fusion protein containing transcription activation domain or a nucleotide sequence
encoding said Cas9 fusion protein. The Cas9 fusion protein may include a transcription
activation domain such as aVP16 protein or a transcription co-activator such as a
p300 protein.
(1) dCas9-VP16
[0152] The Cas9 fusion protein may include a transcription activation domain such as aVP16
protein. The transcription activation domain may contain at least 1 VP16 protein,
at least 2 VP16 proteins, at least 3 VP16 proteins, at least 4 VP16 proteins (
i.e., a VP64 activator domain), at least 5 VP16 proteins, at least 6 VP16 proteins, at
least 6 VP16 proteins, or at least 10 VP16 proteins. The Cas9 protein may be a Cas9
protein in which the nuclease activity is inactivated. For example, the Cas9 protein
in the fusion protein may be iCas9 (amino acids 36-1403 of SEQ ID NO: 1), which includes
the amino acid substitutions of D10A and H840A. The Cas9 fusion protein may be iCas9-VP64.
(2) dCas9-p300
[0153] The Cas9 fusion protein may include a transcription co-activation domain such as
a p300 protein. The p300 protein (also known as EP300 or E1A binding protein p300)
is encoded by the
EP300 gene and regulates the activity of many genes in tissues throughout the body. The
p300 protein plays a role in regulating cell growth and division, prompting cells
to mature and assume specialized functions (differentiate) and preventing the growth
of cancerous tumors. The p300 protein activates transcription by connecting transcription
factors with a complex of proteins that carry out transcription in the cell's nucleus.
The p300 interaction with transcription factors is managed by one or more of p300
domains: the nuclear receptor interaction domain (RID), the CREB and MYB interaction
domain (KIX), the cysteine/histidine regions (TAZ1/CH1 and TAZ2/CH3) and the interferon
response binding domain (IBiD). The last four domains, KIX, TAZ1, TAZ2 and IBiD of
p300, each bind tightly to a sequence spanning both transactivation domains 9aaTADs
of transcription factor p53. The protein functions as histone acetyltransferase that
regulates transcription via chromatin remodeling, and is important in the processes
of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding
specifically to phosphorylated CREB protein.
[0154] The p300 protein may activate Mothers against decapentaplegic homolog 7, MAF, TSG101,
Peroxisome proliferator-activated receptor alpha, NPAS2, PAX6, DDX5, MYBL2, Mothers
against decapentaplegic homolog 1, Mothers against decapentaplegic homolog 2, Lymphoid
enhancer-binding factor 1, SNIP1, TRERF1, STAT3, EID1, RAR-related orphan receptor
alpha, ELK1, HIF1A, ING5, Peroxisome proliferator-activated receptor gamma, SS18,
TCF3, Zif268, Estrogen receptor alpha, GPS2, MyoD, YY1, ING4, PROX1, CITED1, HNF1A,
MEF2C, MEF2D, MAML1, Twist transcription factor, PTMA, 1RF2, DTX1, Flap structure-specific
endonuclease 1, Myocyte-specific enhancer factor 2A, CDX2, BRCA1, HNRPU, STAT6, CITED2,
RELA, TGS1, CEBPB, Mdm2, NCOA6, NFATC2, Thyroid hormone receptor alpha, BCL3, TFAP2A,
PCNA, P53and TAL1.
[0155] The transcription co-activation domain may include a human p300 protein or a fragment
thereof. The transcription co-activation domain may include a wild-type human p300
protein or a mutant human p300 protein, or fragments thereof. The transcription co-activation
domain may include the core lysine-acetyltranserase domain of the human p300 protein,
i.e., the p300 HAT Core (also known as "p300 WT Core"; see Fig. 58). The Cas9 protein
may be a Cas9 protein in which the nuclease activity is inactivated. For example,
the Cas9 protein in the fusion protein may be iCas9 (amino acids 36-1403 of SEQ ID
NO: 1), which includes the amino acid substitutions of D10A and H840A. The Cas9 fusion
protein may be iCas9-p300 WT Core.
(3) gRNA
[0156] The method may also include administering to a cell or subject a CRISPR/Cas9-based
system at least one gRNA, wherein the gRNAs target different DNA sequences. The target
DNA sequences may be overlapping. The number of gRNA administered to the cell may
be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs at least
4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least
7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least
10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least
13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least
16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least
18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least
30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least
45 different gRNAs, or at least 50 different gRNAs. The number of gRNA administered
to the cell may be between at least 1 gRNA to at least 50 different gRNAs, at least
1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs,
at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different
gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least
20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA
to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at
least 1 gRNA to at least 4 different gRNAs, at least 4 gRNAs to at least 50 different
gRNAs, at least 4 different gRNAs to at least 45 different gRNAs, at least 4 different
gRNAs to at least 40 different gRNAs, at least 4 different gRNAs to at least 35 different
gRNAs, at least 4 different gRNAs to at least 30 different gRNAs, at least 4 different
gRNAs to at least 25 different gRNAs, at least 4 different gRNAs to at least 20 different
gRNAs, at least 4 different gRNAs to at least 16 different gRNAs, at least 4 different
gRNAs to at least 12 different gRNAs, at least 4 different gRNAs to at least 8 different
gRNAs, at least 8 different gRNAs to at least 50 different gRNAs, at least 8 different
gRNAs to at least 45 different gRNAs, at least 8 different gRNAs to at least 40 different
gRNAs, at least 8 different gRNAs to at least 35 different gRNAs, 8 different gRNAs
to at least 30 different gRNAs, at least 8 different gRNAs to at least 25 different
gRNAs, 8 different gRNAs to at least 20 different gRNAs, at least 8 different gRNAs
to at least 16 different gRNAs, 8 different gRNAs to at least 12 different gRNAs,
at least 8 different gRNAs to at least 8 different gRNAs,
[0157] The gRNA may comprise a complementary polynucleotide sequence of the target DNA sequence
followed by NGG. The gRNA may comprise a "G" at the 5' end of the complementary polynucleotide
sequence. The gRNA may comprise at least a 10 base pair, at least a 11 base pair,
at least a 12 base pair, at least a 13 base pair, at least a 14 base pair, at least
a 15 base pair, at least a 16 base pair, at least a 17 base pair, at least a 18 base
pair, at least a 19 base pair, at least a 20 base pair, at least a 21 base pair, at
least a 22 base pair, at least a 23 base pair, at least a 24 base pair, at least a
25 base pair, at least a 30 base pair, or at least a 35 base pair complementary polynucleotide
sequence of the target DNA sequence followed by NGG. The gRNA may target at least
one of the promoter region, the enhancer region or the transcribed region of the target
gene. The gRNA may include a nucleic acid sequence of at least one of SEQ ID NOs:
5-40, 65-144, 492-515, 540-563, and 585-625.
b. Use in Methods of Repressing Gene Expression
[0158] The present disclosure provides a mechanism for repressing the expression of endogenous
genes, such as mammalian genes, based on targeting genomic regulatory elements, such
as distal enhancers, via RNA using a CRISPR/Cas9 based system, as described above.
The Cas9 fusion protein may include a transcriptional repressor, such as the KRAB
repressor. The Cas9 fusion protein may be dCas9-KRAB. The dCas9-KRAB may additionally
affect epigenetic gene regulation by recruiting heterochromatin-forming factors to
the targeted locus. The CRISPR/dCas9-KRAB system may be used to repress the transcription
of genes, but can also be used to target genomic regulatory elements which were previously
inaccessible by traditional repression methods such as RNA interference (Fig. 53B).
Delivering dCas9-KRAB with gRNAs targeted to a distal enhancer may disrupt expression
of multiple genes regulated by the targeted enhancer (see Fig. 53C). The targeted
enhancer may be any enhancer for a gene such as the HS2 enhancer.
a. Use in Methods of Transdifferentiation or Induced Differentiation
[0159] The present disclosure provides a mechanism for transdifferentiating or inducing
differentiation of cells by activating endogenous genes via RNA using a CRISPR/Cas9-based
system, as described above.
(1) Transdifferentiation
[0160] The CRISPR/Cas9-based system may be used to transdifferentiate cells. Transdifferentiation,
also known as lineage reprogramming or direct conversion, is a process where cells
convert from one differentiated cell type to another without undergoing an intermediate
pluripotent state or progenitor cell type. It is a type of metaplasia, which includes
all cell fate switches, including the interconversion of stem cells. Transdifferentiation
of cells has potential uses for disease modeling, drug discovery, gene therapy and
regenerative medicine. Activation of endogenous genes, such as
BRN2, MYT1L, ASCL1, NANOG, and/or
MYOD1, using the CRISPR/Cas9 based system described above may lead to transdifferentiation
of several cell types, such as fibroblasts, cardiomyocytes, hepatocytes, chondrocytes,
mesenchymal progenitor cells, hematopoetic stem cells, or smooth muscle cells, into
neuronal and myogenic phenotypes, respectively.
(2) Inducing Differentiation
[0161] The CRISPR/Cas9-based system may be used to induce differentiation of cells, such
as stem cells, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells,
hematopoetic stem cells, or smooth muscle cells. For example, stem cells, such as
embryonic stem cells or pluripotent stem cells, may be induced to differentiate into
muscle cells or vascular endothelial cell, i.e., induce neuronal or myogenic differentiation.
12. Uses of Multiplex CRISPR/Cas9-Based System
[0162] The multiplex CRISPR/Cas9-Based System takes advantage of the simplicity and low
cost of sgRNA design and may be helpful in exploiting advances in high-throughput
genomic research using CRISPR/Cas9 technology. For example, the single lentiviral
vectors described here are useful in expressing Cas9 and numerous sgRNAs in difficult
cell lines, such as primary fibroblasts described here (Fig. 47). The multiplex CRISPR/Cas9-Based
System may be used in the same ways as the CRISPR/Cas9-Based System described above.
[0163] In addition to the described transcriptional activation and nuclease functionality,
this system will be useful for expressing other novel Cas9-based effectors that control
epigenetic modifications for diverse purposes, including interrogation of genome architecture
and pathways of endogenous gene regulation. As endogenous gene regulation is a delicate
balance between multiple enzymes, multiplexing Cas9 systems with different functionalities
will allow for examining the complex interplay among different regulatory signals.
The vector described here should be compatible with aptamer-modified sgRNAs and orthogonal
Cas9s to enable independent genetic manipulations using a single set of sgRNAs.
[0164] The multiplex CRISPR/Cas9-Based System may be used to activate at least one endogenous
gene in a cell. The method includes contacting a cell with the modified lentiviral
vector. The endogenous gene may be transiently activated or stably activated. The
endogenous gene may be transiently repressed or stably repressed. The fusion protein
may be expressed at similar levels to the sgRNAs. The fusion protein may be expressed
at different levels compared to the sgRNAs. The cell may be a primary human cell.
[0165] The multiplex CRISPR/Cas9-Based System may be used in a method of multiplex gene
editing in a cell. The method includes contacting a cell with the modified lentiviral
vector. The multiplex gene editing may include correcting a mutant gene or inserting
a transgene. Correcting a mutant gene may include deleting, rearranging or replacing
the mutant gene. Correcting the mutant gene may include nuclease-mediated non-homologous
end joining or homology-directed repair. The multiplex gene editing may include deleting
or correcting at least one gene, wherein the gene is an endogenous normal gene or
a mutant gene. The multiplex gene editing may include deleting or correcting at least
two genes. For example, at least two genes, at least three genes, at least four genes,
at least five genes, at least six genes, at least seven genes, at least eight genes,
at least nine genes, or at least ten genes may be deleted or corrected.
[0166] The multiplex CRISPR/Cas9-Based System may be used in a method of multiplex modulation
of gene expression in a cell. The method includes contacting a cell with the modified
lentiviral vector. The method may include modulating the gene expression levels of
at least one gene. The gene expression of the at least one target gene is modulated
when gene expression levels of the at least one target gene are increased or decreased
compared to normal gene expression levels for the at least one target gene. The gene
expression levels may be RNA or protein levels.
13. Use in Methods of Correcting a Mutant Gene and Treating a Subject
[0167] The present disclosure is also for use in a method of correcting a mutant gene in
a subject. The use comprises administering to the skeletal muscle or cardiac muscle
of the subject the composition for genome editing in skeletal muscle or cardiac muscle,
as described above. Use of the composition to deliver the site-specific nuclease to
the skeletal muscle or cardiac muscle may restore the expression of a full-functional
or partially-functional protein with a repair template or donor DNA, which can replace
the entire gene or the region containing the mutation. The site-specific nuclease
may be used to introduce site-specific double strand breaks at targeted genomic loci.
Site-specific double-strand breaks are created when the site-specific nuclease binds
to a target DNA sequences, thereby permitting cleavage of the target DNA. This DNA
cleavage may stimulate the natural DNA-repair machinery, leading to one of two possible
repair pathways: homology-directed repair (HDR) or the non-homologous end joining
(NHEJ) pathway.
[0168] The present disclosure is directed to genome editing with a site-specific nuclease
without a repair template, which can efficiently correct the reading frame and restore
the expression of a functional protein involved in a genetic disease. The disclosed
site-specific nucleases may involve using homology-directed repair or nuclease-mediated
non-homologous end joining (NHEJ)-based correction approaches, which enable efficient
correction in proliferation-limited primary cell lines that may not be amenable to
homologous recombination or selection-based gene correction. This strategy integrates
the rapid and robust assembly of active site-specific nucleases with an efficient
gene editing method for the treatment of genetic diseases caused by mutations in nonessential
coding regions that cause frameshifts, premature stop codons, aberrant splice donor
sites or aberrant splice acceptor sites.
a. Nuclease mediated non-homologous end joining
[0169] Restoration of protein expression from an endogenous mutated gene may be through
template-free NHEJ-mediated DNA repair. In contrast to a transient method targeting
the target gene RNA, the correction of the target gene reading frame in the genome
by a transiently expressed site-specific nuclease may lead to permanently restored
target gene expression by each modified cell and all of its progeny.
[0170] Nuclease mediated NHEJ gene correction may correct the mutated target gene and offers
several potential advantages over the HDR pathway. For example, NHEJ does not require
a donor template, which may cause nonspecific insertional mutagenesis. In contrast
to HDR, NHEJ operates efficiently in all stages of the cell cycle and therefore may
be effectively exploited in both cycling and post-mitotic cells, such as muscle fibers.
This provides a robust, permanent gene restoration alternative to oligonucleotide-based
exon skipping or pharmacologic forced read-through of stop codons and could theoretically
require as few as one drug treatment. NHEJ-based gene correction using a CRISPR/Cas9-based
system, as well as other engineered nucleases including meganucleases and zinc finger
nucleases, may be combined with other existing
ex vivo and
in vivo platforms for cell- and gene-based therapies, in addition to the plasmid electroporation
approach described here. For example, delivery of a CRISPR/Cas9-based system by mRNA-based
gene transfer or as purified cell permeable proteins could enable a DNA-free genome
editing approach that would circumvent any possibility of insertional mutagenesis.
b. Homology-Directed Repair
[0171] Restoration of protein expression from an endogenous mutated gene may involve homology-directed
repair. The method as described above further includes administrating a donor template
to the cell. The donor template may include a nucleotide sequence encoding a full-functional
protein or a partially-functional protein. For example, the donor template may include
a miniaturized dystrophin construct, termed minidystrophin ("minidys"), a full-functional
dystrophin construct for restoring a mutant dystrophin gene, or a fragment of the
dystrophin gene that after homology-directed repair leads to restoration of the mutant
dystrophin gene.
c. Use in Methods of Correcting a Mutant Gene and Treating a Subject Using CRISPR/Cas9
[0172] The present disclosure is also directed to genome editing with the CRISPR/Cas9-based
system to restore the expression of a full-functional or partially-functional protein
with a repair template or donor DNA, which can replace the entire gene or the region
containing the mutation. The CRISPR/Cas9-based system may be used to introduce site-specific
double strand breaks at targeted genomic loci. Site-specific double-strand breaks
are created when the CRISPR/Cas9-based system binds to a target DNA sequences using
the gRNA, thereby permitting cleavage of the target DNA. The CRISPR/Cas9-based system
has the advantage of advanced genome editing due to their high rate of successful
and efficient genetic modification. This DNA cleavage may stimulate the natural DNA-repair
machinery, leading to one of two possible repair pathways: homology-directed repair
(HDR) or the non-homologous end joining (NHEJ) pathway. For example, a CRISPR/Cas9-based
system directed towards the dystrophin gene may include a gRNA having a nucleic acid
sequence of any one of SEQ ID NOs: 65-115.
[0173] The present disclosure is directed to genome editing with CRISPR/Cas9-based system
without a repair template, which can efficiently correct the reading frame and restore
the expression of a functional protein involved in a genetic disease. The disclosed
CRISPR/Cas9-based system and methods may involve using homology-directed repair or
nuclease-mediated non-homologous end joining (NHEJ)-based correction approaches, which
enable efficient correction in proliferation-limited primary cell lines that may not
be amenable to homologous recombination or selection-based gene correction. This strategy
integrates the rapid and robust assembly of active CRISPR/Cas9-based system with an
efficient gene editing method for the treatment of genetic diseases caused by mutations
in nonessential coding regions that cause frameshifts, premature stop codons, aberrant
splice donor sites or aberrant splice acceptor sites.
[0174] The present disclosure is for use in methods of correcting a mutant gene in a cell
and treating a subject suffering from a genetic disease, such as DMD. The use may
include administering to a cell or subject a CRISPR/Cas9-based system, a polynucleotide
or vector encoding said CRISPR/Cas9-based system, or composition of said CRISPR/Cas9-based
system as described above. The use may include administering a CRISPR/Cas9-based system,
such as administering a Cas9 protein or Cas9 fusion protein containing a second domain
having nuclease activity, a nucleotide sequence encoding said Cas9 protein or Cas9
fusion protein, and/or at least one gRNA, wherein the gRNAs target different DNA sequences.
The target DNA sequences may be overlapping. The number of gRNA administered to the
cell may be at least 1 gRNA, at least 2 different gRNA, at least 3 different gRNA
at least 4 different gRNA, at least 5 different gRNA, at least 6 different gRNA, at
least 7 different gRNA, at least 8 different gRNA, at least 9 different gRNA, at least
10 different gRNA, at least 15 different gRNA, at least 20 different gRNA, at least
30 different gRNA, or at least 50 different gRNA, as described above. The gRNA may
include a nucleic acid sequence of at least one of SEQ ID NOs: 65-115. The method
may involve homology-directed repair or non-homologous end joining.
14. Use in Methods of Treating a Disease
[0175] The present disclosure is for use in a method of treating a subject in need thereof.
The use comprises administering to a tissue of a subject the composition for altering
gene expression and engineering or altering genomic DNA in a cell or subject genome
editing, as described above. The use may comprises administering to the skeletal muscle
or cardiac muscle of the subject the composition for genome editing in skeletal muscle
or cardiac muscle, as described above. The subject may be suffering from a skeletal
muscle or cardiac muscle condition causing degeneration or weakness or a genetic disease.
For example, the subject may be suffering from Duchenne muscular dystrophy, as described
above.
a. Duchenne muscular dystrophy
[0176] The disclosure, as described above, may be used for correcting the dystrophin gene
and recovering full-functional or partially-functional protein expression of said
mutated dystrophin gene. In some aspects the disclosure is for use in reducing the
effects (
e.g., clinical symptoms/indications) of DMD in a patient. In some aspects the disclosure
is for use in treating DMD in a patient. In some aspects the disclosure is for use
in preventing DMD in a patient. In some aspects the disclosure is for use in preventing
further progression of DMD in a patient.
15. Constructs and Plasmids
[0177] The compositions, as described above, may comprise genetic constructs that encodes
the CRISPR/Cas9-based system, as disclosed herein. The genetic construct, such as
a plasmid, may comprise a nucleic acid that encodes the CRISPR/Cas9-based system,
such as the Cas9 protein and Cas9 fusion proteins and/or at least one of the gRNAs.
The compositions, as described above, may comprise genetic constructs that encodes
the modified AAV vector and a nucleic acid sequence that encodes the site-specific
nuclease, as disclosed herein. The genetic construct, such as a plasmid, may comprise
a nucleic acid that encodes the site-specific nuclease. The compositions, as described
above, may comprise genetic constructs that encodes the modified lentiviral vector,
as disclosed herein. The genetic construct, such as a plasmid, may comprise a nucleic
acid that encodes the Cas9-fusion protein and at least one sgRNA. The genetic construct
may be present in the cell as a functioning extrachromosomal molecule. The genetic
construct may be a linear minichromosome including centromere, telomeres or plasmids
or cosmids.
[0178] The genetic construct may also be part of a genome of a recombinant viral vector,
including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus
associated virus. The genetic construct may be part of the genetic material in attenuated
live microorganisms or recombinant microbial vectors which live in cells. The genetic
constructs may comprise regulatory elements for gene expression of the coding sequences
of the nucleic acid. The regulatory elements may be a promoter, an enhancer, an initiation
codon, a stop codon, or a polyadenylation signal.
[0179] The nucleic acid sequences may make up a genetic construct that may be a vector.
The vector may be capable of expressing the fusion protein, such as the Cas9-fusion
protein or site-specific nuclease, in the cell of a mammal. The vector may be recombinant.
The vector may comprise heterologous nucleic acid encoding the fusion protein, such
as the Cas9-fusion protein or site-specific nuclease. The vector may be a plasmid.
The vector may be useful for transfecting cells with nucleic acid encoding the Cas9-fusion
protein or site-specific nuclease, which the transformed host cell is cultured and
maintained under conditions wherein expression of the Cas9-fusion protein or the site-specific
nuclease system takes place.
[0180] Coding sequences may be optimized for stability and high levels of expression. In
some instances, codons are selected to reduce secondary structure formation of the
RNA such as that formed due to intramolecular bonding.
[0181] The vector may comprise heterologous nucleic acid encoding the CRISPR/Cas9-based
system or the site-specific nuclease and may further comprise an initiation codon,
which may be upstream of the CRISPR/Cas9-based system or the site-specific nuclease
coding sequence, and a stop codon, which may be downstream of the CRISPR/Cas9-based
system or the site-specific nuclease coding sequence. The initiation and termination
codon may be in frame with the CRISPR/Cas9-based system or the site-specific nuclease
coding sequence. The vector may also comprise a promoter that is operably linked to
the CRISPR/Cas9-based system or the site-specific nuclease coding sequence. The promoter
operably linked to the CRISPR/Cas9-based system or the site-specific nuclease coding
sequence may be a promoter from simian virus 40 (SV40), a mouse mammary tumor virus
(MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine
immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus
promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter
such as the CMV immediate early promoter, Epstein Barr virus (EBV) promoter, or a
Rous sarcoma virus (RSV) promoter. The promoter may also be a promoter from a human
gene such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin,
human muscle creatine, or human metalothionein. The promoter may also be a tissue
specific promoter, such as a muscle or skin specific promoter, natural or synthetic.
Examples of such promoters are described in US Patent Application Publication No.
US20040175727.
[0182] The vector may also comprise a polyadenylation signal, which may be downstream of
the CRISPR/Cas9-based system or the site-specific nuclease. The polyadenylation signal
may be a SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone
(bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or
human β-globin polyadenylation signal. The SV40 polyadenylation signal may be a polyadenylation
signal from a pCEP4 vector (Invitrogen, San Diego, CA).
[0183] The vector may also comprise an enhancer upstream of the CRISPR/Cas9-based system,
i.e., the Cas9 protein or Cas9 fusion protein coding sequence or sgRNAs, or the site-specific
nuclease. The enhancer may be necessary for DNA expression. The enhancer may be human
actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such
as one from CMV, HA, RSV or EBV. Polynucleotide function enhancers are described in
U.S. Patent Nos. 5,593,972,
5,962,428, and
WO94/016737. The vector may also comprise a mammalian origin of replication in order to maintain
the vector extrachromosomally and produce multiple copies of the vector in a cell.
The vector may also comprise a regulatory sequence, which may be well suited for gene
expression in a mammalian or human cell into which the vector is administered. The
vector may also comprise a reporter gene, such as green fluorescent protein ("GFP")
and/or a selectable marker, such as hygromycin ("Hygro").
[0184] The vector may be expression vectors or systems to produce protein by routine techniques
and readily available starting materials including
Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring
Harbor (1989). The vector may comprise the nucleic acid sequence encoding the CRISPR/Cas9-based
system, including the nucleic acid sequence encoding the Cas9 protein or Cas9 fusion
protein and the nucleic acid sequence encoding the at least one gRNA comprising the
nucleic acid sequence of at least one of SEQ ID NOs: 5-40, 65-144, 492-515, 540-563,
and 585-625.
16. Pharmaceutical Compositions
[0185] The composition may be in a pharmaceutical composition. The pharmaceutical composition
may comprise about 1 ng to about 10 mg of DNA encoding the CRISPR/Cas9-based system
or CRISPR/Cas9-based system protein component,
i.e., the Cas9 protein or Cas9 fusion protein. The pharmaceutical composition may comprise
about 1 ng to about 10 mg of the DNA of the modified AAV vector and nucleotide sequence
encoding the site-specific nuclease. The pharmaceutical composition may comprise about
1 ng to about 10 mg of the DNA of the modified lentiviral vector. The pharmaceutical
compositions are formulated according to the mode of administration to be used. In
cases where pharmaceutical compositions are injectable pharmaceutical compositions,
they are sterile, pyrogen free and particulate free. An isotonic formulation is preferably
used. Generally, additives for isotonicity may include sodium chloride, dextrose,
mannitol, sorbitol and lactose. In some cases, isotonic solutions such as phosphate
buffered saline are preferred. Stabilizers include gelatin and albumin. A vasoconstriction
agent may be added to the formulation.
[0186] The composition may further comprise a pharmaceutically acceptable excipient. The
pharmaceutically acceptable excipient may be functional molecules as vehicles, adjuvants,
carriers, or diluents. The pharmaceutically acceptable excipient may be a transfection
facilitating agent, which may include surface active agents, such as immune-stimulating
complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl
lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene,
hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations,
or nanoparticles, or other known transfection facilitating agents.
[0187] The transfection facilitating agent is a polyanion, polycation, including poly-L-glutamate
(LGS), or lipid. The transfection facilitating agent is poly-L-glutamate, and more
preferably, the poly-L-glutamate is present in the composition for genome editing
in skeletal muscle or cardiac muscle at a concentration less than 6 mg/ml. The transfection
facilitating agent may also include surface active agents such as immune-stimulating
complexes (ISCOMS), Freunds incomplete adjuvant, LPS analog including monophosphoryl
lipid A, muramyl peptides, quinone analogs and vesicles such as squalene and squalene,
and hyaluronic acid may also be used administered in conjunction with the genetic
construct. The DNA vector encoding the composition may also include a transfection
facilitating agent such as lipids, liposomes, including lecithin liposomes or other
liposomes known in the art, as a DNA-liposome mixture (see for example
WO9324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other
known transfection facilitating agents. Preferably, the transfection facilitating
agent is a polyanion, polycation, including poly-L-glutamate (LGS), or lipid.
17. Methods of Delivery
[0188] Provided herein is a method for delivering the pharmaceutical formulations, preferably
compositions described above, for providing genetic constructs. The delivery of the
compositions may be the transfection or electroporation of the composition as a nucleic
acid molecule that is expressed in the cell and delivered to the surface of the cell.
The nucleic acid molecules may be electroporated using BioRad Gene Pulser Xcell or
Amaxa Nucleofector lib devices. Several different buffers may be used, including BioRad
electroporation solution, Sigma phosphate-buffered saline product #D8537 (PBS), Invitrogen
OptiMEM I (OM), or Amaxa Nucleofector solution V (N.V.). Transfections may include
a transfection reagent, such as Lipofectamine 2000.
[0189] Upon delivery of the composition to the tissue, and thereupon the vector into the
cells of the mammal, the transfected cells will express the fusion protein, such as
a CRISPR/Cas9-based system and/or a site-specific nuclease. The composition may be
administered to a mammal to alter gene expression or to re-engineer or alter the genome.
For example, the composition may be administered to a mammal to correct the dystrophin
gene in a mammal. The mammal may be human, non-human primate, cow, pig, sheep, goat,
antelope, bison, water buffalo, bovids, deer, hedgehogs, elephants, llama, alpaca,
mice, rats, or chicken, and preferably human, cow, pig, or chicken.
a. CRISPR/Cas9-based system
[0190] The vector encoding a CRISPR/Cas9-based system protein component,
i.e., the Cas9 protein or Cas9 fusion protein, may be delivered to the mammal by DNA injection
(also referred to as DNA vaccination) with and without in vivo electroporation, liposome
mediated, nanoparticle facilitated, and/or recombinant vectors. The recombinant vector
may be delivered by any viral mode. The viral mode may be recombinant lentivirus,
recombinant adenovirus, and/or recombinant adeno-associated virus.
[0191] The nucleotide encoding a CRISPR/Cas9-based system protein component,
i.e., the Cas9 protein or Cas9 fusion protein, may be introduced into a cell to genetically
correct the target gene or alter gene expression of a gene, such as activate or repress
endogenous genes. For example, a nucleotide encoding a CRISPR/Cas9-based system protein
component,
i.e., the Cas9 protein or Cas9 fusion protein, directed towards a mutant dystrophin gene
by the gRNA may be introduced into a myoblast cell from a DMD patient. Alternatively,
they may be introduced into a fibroblast cell from a DMD patient, and the genetically
corrected fibroblast cell may be treated with MyoD to induce differentiation into
myoblasts, which may be implanted into subjects, such as the damaged muscles of a
subject to verify that the corrected dystrophin protein was functional and/or to treat
the subject. The modified cells may also be stem cells, such as induced pluripotent
stem cells, bone marrow-derived progenitors, skeletal muscle progenitors, human skeletal
myoblasts from DMD patients, CD133+ cells, mesoangioblasts, and MyoD- or Pax7-transduced
cells, or other myogenic progenitor cells. For example, the CRISPR/Cas9-based system
may cause neuronal or myogenic differentiation of an induced pluripotent stem cell.
18. Routes of Administration
[0192] The compositions may be administered to a subject by different routes including orally,
parenterally, sublingually, transdermally, rectally, transmucosally, topically, via
inhalation, via buccal administration, intrapleurally, intravenous, intraarterial,
intraperitoneal, subcutaneous, intramuscular, intranasal intrathecal, and intraarticular
or combinations thereof. For veterinary use, the composition may be administered as
a suitably acceptable formulation in accordance with normal veterinary practice. The
veterinarian may readily determine the dosing regimen and route of administration
that is most appropriate for a particular animal. The compositions may be administered
by traditional syringes, needleless injection devices, "microprojectile bombardment
gone guns", or other physical methods such as electroporation ("EP"), "hydrodynamic
method", or ultrasound.
[0193] The composition may be delivered to the mammal by several technologies including
DNA injection (also referred to as DNA vaccination) with and without
in vivo electroporation, liposome mediated, nanoparticle facilitated, recombinant vectors
such as recombinant lentivirus, recombinant adenovirus, and recombinant adenovirus
associated virus. The composition may be injected into the skeletal muscle or cardiac
muscle. For example, the composition may be injected into the tibialis anterior muscle.
19. Cell types
[0194] Any of these delivery methods and/or routes of administration could be utilized with
a myriad of cell types, for example, those cell types currently under investigation
for cell-based therapies. Cell types may be fibroblasts, pluripotent stem cells, cardiomyocytes,
hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoetic stem cells,
smooth muscle cells, or K562 human erythroid leukemia cell line.
a. DMD
[0195] Cell types currently under investigation for cell-based therapies of DMD include
immortalized myoblast cells, such as wild-type and DMD patient derived lines, for
example Δ48-50 DMD, DMD 8036 (del48-50), C25C14 and DMD-7796 cell lines, primal DMD
dermal fibroblasts, induced pluripotent stem cells, bone marrow-derived progenitors,
skeletal muscle progenitors, human skeletal myoblasts from DMD patients, CD133+ cells,
mesoangioblasts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor
cells, hematopoetic stem cells, smooth muscle cells, and MyoD- or Pax7-transduced
cells, or other myogenic progenitor cells. Immortalization of human myogenic cells
may be used for clonal derivation of genetically corrected myogenic cells. Cells may
be modified
ex vivo to isolate and expand clonal populations of immortalized DMD myoblasts that contain
a genetically corrected dystrophin gene and are free of other nuclease-introduced
mutations in protein coding regions of the genome. Alternatively, transient
in vivo delivery of nucleases by non-viral or non-integrating viral gene transfer, or by
direct delivery of purified proteins and gRNAs containing cell-penetrating motifs
may enable highly specific correction
in situ with minimal or no risk of exogenous DNA integration.
20. Kits
[0196] Disclosed herein is a kit, which may be used to edit a genome in skeletal muscle
or cardiac muscle, such as correcting a mutant gene. The kit comprises a composition
for genome editing in skeletal muscle or cardiac muscle, as described above, and instructions
for using said composition. Instructions included in kits may be affixed to packaging
material or may be included as a package insert. While the instructions are typically
written or printed materials they are not limited to such. Any medium capable of storing
such instructions and communicating them to an end user is contemplated by this disclosure.
Such media include, but are not limited to, electronic storage media (
e.g., magnetic discs, tapes, cartridges, chips), optical media (
e.g., CD ROM), and the like. As used herein, the term "instructions" may include the address
of an internet site that provides the instructions.
[0197] The composition for genome editing in skeletal muscle or cardiac muscle may include
a modified AAV vector and a nucleotide sequence encoding a site-specific nuclease,
as described above. The site-specific nuclease may include a ZFN, a TALEN, or CRISPR/Cas9-based
system, as described above, that specifically binds and cleaves a mutated gene. The
site-specific nuclease, as described above, may be included in the kit to specifically
bind and target a particular region in the mutated gene. The site-specific nuclease
may be specific for a mutated dystrophin gene, as described above. The kit may further
include donor DNA, a gRNA, or a transgene, as described above.
a. CRISPR/Cas9-based system
[0198] Disclosed herein is a kit, which may be used to correct a mutated gene. The kit comprises
at least one component for correcting a mutated gene and instructions for using the
CRISPR/Cas9-based system. Instructions included in kits may be affixed to packaging
material or may be included as a package insert. While the instructions are typically
written or printed materials they are not limited to such. Any medium capable of storing
such instructions and communicating them to an end user is contemplated by this disclosure.
Such media include, but are not limited to, electronic storage media (
e.g., magnetic discs, tapes, cartridges, chips), optical media (
e.g., CD ROM), and the like. As used herein, the term "instructions" may include the address
of an internet site that provides the instructions.
[0199] At least one component may include at least one CRISPR/Cas9-based system, as described
above, which specifically targets a gene. The kit may include a Cas9 protein or Cas9
fusion protein, a nucleotide sequence encoding said Cas9 protein or Cas9 fusion protein,
and/or at least one gRNA. The CRISPR/Cas9-based system, as described above, may be
included in the kit to specifically bind and target a particular target region upstream,
within or downstream of the coding region of the target gene. For example, a CRISPR/Cas9-based
system may be specific for a promoter region of a target gene or a CRISPR/Cas9-based
system may be specific for a mutated gene, for example a mutated dystrophin gene,
as described above. The kit may include donor DNA, as described above.
21. Examples
[0200] Having now described the present disclosure in detail, the same will be more clearly
understood by reference to the following examples, which are merely intended only
to illustrate some aspects and embodiments of the disclosure, and should not be viewed
as limiting to the scope of the disclosure.
[0201] The present invention has multiple aspects, illustrated by the following non-limiting
examples.
Example 1
Materials and Methods
[0202] Cell culture and transfection. HEK293T cells were obtained from the American Tissue Collection Center (ATCC) through
the Duke University Cancer Center Facilities and were maintained in DMEM supplemented
with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C with 5% CO
2. HEK293T cells were transfected with Lipofectamine 2000 (Invitrogen) according to
manufacturer's instructions. Transfection efficiencies were routinely higher than
80% as determined by fluorescence microscopy following delivery of a control eGFP
expression plasmid. Cas9 expression plasmid was transfected at a mass ratio of 3:1
to either the individual gRNA expression plasmids or the identical amount of gRNA
expression plasmid consisting of a mixture of equal amounts of the four gRNAs.
[0203] Primary mouse embryonic fibroblasts (PMEF-HL, Millipore, Billerica, MA) were seeded
(75,000 per well) in 24-well TCPS plates (BD, Franklin Lakes, NJ) and maintained at
37°C and 5% CO
2 in complete MEF medium consisting of high glucose DMEM supplemented with 10% Premium
Select FBS (Atlanta Biologicals, Lawrenceville, GA), 25 µg mL
-1 gentamicin (Invitrogen), 1X GlutaMAX, non-essential amino acids, sodium pyruvate,
and β-mercaptoethanol (Invitrogen). MEF transfections were performed with a single
1 µg cm
-2 dose of total plasmid DNA, delivered as cationic nanocomplexes following electrostatic
condensation with poly(CBA-ABOL) in serum- and antibiotic-free OptiMEM, as described
previously (
Adler et al. Molecular therapy. Nucleic acids 1, e32 (2012)). OptiMEM was replaced with complete MEF medium 4 hrs after transfection. 48 hrs
after transfection, MEFs were processed for qRT-PCR, or the complete MEF medium was
replaced with N3 neural induction medium containing: DMEM/F-12 (Invitrogen), 1X N-2
Supplement (Invitrogen), 10 ng mL
-1 human bFGF2 (Stemgent, Cambridge, MA), and 25 µg mL
-1 gentamicin (Invitrogen). A GFP reporter vector (pmax-GFP, 3486 bp, Amaxa, Cologne,
Germany) was used to optimize transfection conditions. Cas9 expression plasmid was
transfected at a mass ratio of 3:1 or 1:1 to an equal mixture of four gRNA expression
plasmids.
[0204] Plasmids. The plasmids encoding wild-type and H840A Cas9 were obtained from Addgene (Plasmid
#39312 and Plasmid #39316;
Jinek, et al. Science 337, 816-821 (2012)). H840A Cas9 was cloned into the vector pcDNA3.1 in frame with a FLAG epitope tag
and a nuclear localization sequence (NLS) at the N-terminus with a primer pair that
introduced the D10A mutation. The VP64 domain, an NLS, and an HA epitope tag were
cloned in frame with the Cas9 ORF at the C-terminus (Fig. 1a, Fig. 9a). The tracrRNA
and crRNA expression cassettes (
Cong et al. Science 339, 819-923 (2013)) were ordered as gBlocks (Integrated DNA Technologies (IDT)) and cloned into a pZDonor
plasmid (Sigma) with Kpnl and SacII sites. A chimeric guide RNA expression cassette
(
Mali et al. Science 339, 823-826 (2013)) was also ordered as gBlocks with modifications to include a BbsI restriction site
to facilitate rapid cloning of new guide RNA spacer sequences (Fig. 9b). The oligonucleotides
containing the target sequences were obtained from IDT, hybridized, phosphorylated,
and cloned in the appropriate plasmids using BbsI sites. The target sequences are
provided in Table 2.
Table 2 Target sequences of gRNAs
| Target |
Name |
Sequence |
SEQ ID NO |
| ASCL1 |
CR1 |
GCTGGGTGTCCCATTGAAA |
5 |
| CR2 |
CAGCCGCTCGCTGCAGCAG |
6 |
| CR3 |
TGGAGAGTTTGCAAGGAGC |
7 |
| CR4 |
GTTTATTCAGCCGGGAGTC |
8 |
| NANOG |
CR1 |
CGCCAGGAGGGGTGGGTCTA |
9 |
| CR2 |
CCTTGGTGAGACTGGTAGA |
10 |
| CR3 |
GTCTTCAGGTTCTGTTGCT |
11 |
| CR4 |
ATATTCCTGATTTAAAAGT |
12 |
| VEGFA |
CR1 |
TTAAAAGTCGGCTGGTAGC |
13 |
| CR2 |
CGGGCCGGGGGCGGGGTCC |
14 |
| CR3 |
GCCCGAGCCGCGTGTGGAA |
15 |
| CR4 |
CCTTCATTGCGGCGGGCTG |
16 |
| TERT |
CR1 |
CCGACCCCTCCCGGGTCCC |
17 |
| CR2 |
CAGGACCGCGCTTCCCACG |
18 |
| CR3 |
TGCACCCTGGGAGCGCGAG |
19 |
| CR4 |
CCGCACGCACCTGTTCCCA |
20 |
| IL1B |
CR1 |
AAAACAGCGAGGGAGAAAC |
21 |
| CR2 |
TTAACTTGATTGTGAAATC |
22 |
| CR3 |
AAAACAATGCATATTTGCA |
23 |
| CR4 |
AAAATCCAGTATTTTAATG |
24 |
| IL1R2 |
CR1 |
ACCCAGCACTGCAGCCTGG |
25 |
| CR2 |
AACTTATGCGGCGTTTCCT |
26 |
| CR3 |
TCACTTTAAAACCACCTCT |
27 |
| CR4 |
GCATCTTTTTCTCTTTAAT |
28 |
| IL1RN |
CR1 |
TGTACTCTCTGAGGTGCTC |
29 |
| CR2 |
ACGCAGATAAGAACCAGTT |
30 |
| CR3 |
CATCAAGTCAGCCATCAGC |
31 |
| CR4 |
GAGTCACCCTCCTGGAAAC |
32 |
| HBG1/2 |
CR1 |
GCTAGGGATGAAGAATAAA |
33 |
| CR2 |
TTGACCAATAGCCTTGACA |
34 |
| CR3 |
TGCAAATATCTGTCTGAAA |
35 |
| CR4 |
AAATTAGCAGTATCCTCTT |
36 |
| MYOD1 |
CR1 |
CCTGGGCTCCGGGGCGTTT |
37 |
| CR2 |
GGCCCCTGCGGCCACCCCG |
38 |
| CR3 |
CTCCCTCCCTGCCCGGTAG |
39 |
| CR4 |
AGGTTTGGAAAGGGCGTGC |
40 |
[0205] Western blot. Cells were lysed in 50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 0.5% Triton X-100, and 0.1%
SDS. Lysates were mixed with loading buffer, boiled for 5 min, and equal volumes of
protein were run in NuPAGE
® Novex 4-12% or 10% Bis-Tris Gel polyacrylamide gels and transferred to nitrocellulose
membranes. Non-specific antibody binding was blocked with 50 mM Tris/150 mM NaCl/0.1%
Tween-20 (TBS-T) with 5% nonfat milk for 30 min. The membranes were incubated with
primary antibodies (HRP-conjugated anti-Flag (Cell Signaling, Cat#2044) in 5% BSA
in TBS-T diluted 1:1000 overnight; anti-GAPDH (Cell Signaling, clone 14C10) in 5%
milk in TBS-T diluted 1 :5000 for 30 min; anti-ASCL1 (Santa Cruz, clone sc-48449)
in 5% BSA diluted 1:500; or anti-g-globin (Santa Cruz, clone 51-7) in 5% milk diluted
1:500 and the membranes were washed with TBS-T for 30 min. Membranes labeled with
primary antibodies were incubated with anti-rabbit HRP-conjugated antibody (Sigma-Aldrich)
diluted 1:5000 for 30 min, anti-goat (1:3000) or anti-mouse (1:5000) and washed with
TBS-T for 30 min. Membranes were visualized using the Immun-Star WesternC
™ Chemiluminescence Kit (Bio-Rad) and images were captured using a ChemiDoc
™ XRS+ System and processed using ImageLab software (Bio-Rad).
[0206] ELISA. Serum-free culture media (OPTI-MEM) was collected and frozen at -80°C. Human IL-1ra
secretion into culture media was quantified via enzyme-linked immunosorbent assay
(ELISA), according to the manufacturer's protocols (R&D Systems, Cat. No. DY280).
The standard curve was prepared by diluting recombinant human IL-1ra in OPTI-MEM and
the IL-1ra in culture media was measured undiluted. The samples were concentrated
about 8 fold via centrifugation through 3 kDa MWCO filters for 20 min (Amicon Ultra,
Cat # UFC500396). Reported values were corrected by the concentration factor for each
sample.
[0207] Optical density was measured at 450 nm, with a wavelength correction at 540 nm. Each
standard and sample was assayed in duplicate. The duplicate readings were averaged
and normalized by subtracting the average zero standard optical density. A standard
curve was generated by log-transforming the data and performing a linear regression
of the IL-1ra concentration versus the optical density. Reported values are the mean
and standard error of the mean from three independent experiments (
n = 3) that were performed on different days with technical duplicates that were averaged
for each experiment.
[0208] qRT-PCR. Total RNA was isolated using the RNeasy Plus RNA isolation kit (Qiagen). cDNA synthesis
was performed using the SuperScript
® VILO
™ cDNA Synthesis Kit (Invitrogen). Real-time PCR using PerfeCTa
® SYBR
® Green FastMix was performed with the CFX96 Real-Time PCR Detection System (Bio-Rad)
with oligonucleotide primers reported in Table 3 that were designed using Primer3Plus
software and purchased from IDT.
Table 3 Sequences of primers used for qRT-PCR.
| Target |
Forward Primer |
SEQ ID NO |
Reverse Primer |
SEQ ID NO |
| hASCL1 |
GGAGCTTCTCGACTTCACCA |
41 |
AACGCCACTGACAAGAAAGC |
53 |
| NANOG |
GATTTGTGGGCCTGAAGAAA |
42 |
CAGATCCATGGAGGAAGGAA |
54 |
| VEGFA |
AAGGAGGAGGGCAGAATCAT |
43 |
GGGTACTCCTGGAAGATGTCC |
55 |
| TERT |
AAACCTTCCTCAGCTATGCCC |
44 |
GTTTGCGACGCATGTTCCTC |
56 |
| IL1B |
AGCTGATGGCCCTAAACAGA |
45 |
AAGCCCTTGCTGTAGTGGTG |
57 |
| IL1R2 |
CAGGAGGACTCTGGCACCTA |
46 |
CGGCAGGAAAGCATCTGTAT |
58 |
| IL1RN |
GGAATCCATGGAGGGAAGAT |
47 |
TGTTCTCGCTCAGGTCAGTG |
59 |
| HBG1/2 |
GCTGAGTGAACTGCACTGTGA |
48 |
GAATTCTTTGCCGAAATGGA |
60 |
| MYOD1 |
CTCTCTGCTCCTTTGCCACA |
49 |
GTGCTCTTCGGGTTTCAGGA |
61 |
| GAPDH |
CAATGACCCCTTCATTGACC |
50 |
TTGATTTTGGAGGGATCTCG |
62 |
| mASCL1 |
GGAACAAGAGCTGCTGGACT |
51 |
GTTTTTCTGCCTCCCCATTT |
63 |
| mGAPDH |
AACTTTGGCATTGTGGAAGG |
52 |
GGATGCAGGGATGATGTTCT |
64 |
[0209] Primer specificity was confirmed by agarose gel electrophoresis and melting curve
analysis. Reaction efficiencies over the appropriate dynamic range were calculated
to ensure linearity of the standard curve
(Fig. 10). The results are expressed as fold-increase mRNA expression of the gene of interest
normalized to GAPDH expression by the ΔΔC
T method. Reported values are the mean and standard error of the mean from three independent
experiments performed on different days (n = 3) with technical duplicates that were
averaged for each experiment.
[0210] RNA-Seq. RNA seq libraries were constructed. Briefly, first strand cDNA was synthesized from
oligo dT Dynabead
® (Invitrogen) captured mRNA using SuperScript
® VILO
™ cDNA Synthesis Kit (Invitrogen). Second strand cDNA was synthesized using DNA Polymerase
I (New England Biolabs). cDNA was purified using Agencourt AMPure XP beads (Beckman
Coulter) and Ncxtcra transposase (Illumina; 5 min at 55°C) was used to simultaneously
fragment and insert sequencing primers into the double-stranded cDNA. Transposition
reactions were halted using QG buffer (Qiagen) and fragmented cDNA was purified on
AMPure XP beads. Indexed sequencing libraries were generated by 6 cycles of PCR.
[0211] Libraries were sequenced using 50-bp single end reads on two lanes of an Illumina
HiSeq 2000 instrument, generating between 29 million and 74 million reads per library.
Reads were aligned to human RefSeq transcripts using Bowtie (Langmeadet al.
Genome biology 10, R25 (2009)). The statistical significance of differential expression, including correction
for multiple hypothesis testing, was calculated using DESeq (
Anders et al. Genome biology 11, R106 (2010)). Raw RNA-seq reads and the number of reads aligned to each RefSeq transcript have
been deposited for public access in the Gene Expression Omnibus (GEO), with accession
number currently pending.
[0212] Immunofluorescence staining. For detection of Tuj1 and MAP2 expression, transfected MEFs were fixed at day 10
of culture in N3 medium with 4% PFA (EMS, Hatfield, PA) at room temperature (RT) for
20 min. Cells were then incubated in blocking buffer containing 0.2% Triton X-100,
3% w/v BSA, and 10% goat serum (Sigma-Aldrich, Saint Louis, MO) for two hrs at room
temperature with rabbit anti-Tuj1 (Covance, Princeton, New Jersey, clone TUJ1 1-15-79,
1:500) and mouse anti-MAP2 (BD, clone Ap20, 1:500), or for an additional 24 hrs at
4 °C with mouse anti-Ascl1 (BD clone 24B72D11.1, 1:100). The cells were then washed
three times with PBS, incubated for 1 hr at room temperature in blocking buffer with
Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 594 goat anti-rabbit IgG (Invitrogen,
1 :200), and washed three times with PBS. Stained MEFs were then scanned with a Nikon
Eclipse TE2000-U inverted fluorescence microscope with a ProScanII motorized stage
(Prior Scientific, Rockland, MA) to produce large mosaic images of each complete culture
area. These mosaics were processed with a FIJI macro to automatically and uniformly
threshold each image according to local contrast, exclude small debris, and to count
the number of Tuj1
+ cells in each well.
[0213] Statistics. Statistical analysis was performed by Tukey's test with alpha equal to 0.05 in JMP
10 Pro.
Example 2
Results
[0214] To create a CRISPR/Cas9-based transcriptional activation system, catalytic residues
of Cas9 (D10A, H840A) were mutated to create iCas9 and genetically fused with a C-terminal
VP64 acidic transactivation domain
(Fig. 1a,b). Robust expression of iCas9-VP64 was observed from the transfected plasmid in
human embryonic kidney (HEK) 293T cells by western blot of the N-terminal Flag epitope
tag
(Fig. 3). The CRISPR system recognizes its target through base pairing of a 20 bp sequence
in the gRNA to a complementary DNA target, which is followed by the NGG protospacer-adjacent
motif (PAM) sequence, where N is any base pair. Combinations of synthetic transcription
factors targeted to endogenous human promoters result in synergistic and robust activation
of gene expression. Therefore four gRNA target sites followed by the NGG PAM sequence
were identified in the promoter of the
IL1RN gene within 500 bp of the transcriptional start site
(Fig. 4, Table 2). To compare crRNA- and gRNA-based targeting strategies, the four target site sequences
were introduced into crRNA and gRNA expression plasmids
17 and co-transfected with the iCas9-VP64 expression plasmid into HEK293T cells. Although
substantial induction of
IL1RN expression was observed by qRT-PCR in samples treated with the combination of crRNAs,
much higher levels were achieved with the combination of gRNAs
(Fig. 1c). No changes to gene expression were observed in cells treated with gRNAs and an expression
plasmid for iCas9 without VP64, demonstrating the critical role of the activation
domain in modulating gene expression
(Fig. 1c). Nuclease activity at these target sites was confirmed to have been abrogated in the
iCas9-VP64 system by performing the Surveyor assay to detect DNA repair events in
samples treated with iCas9-VP64 and wild-type Cas9
(Fig. 5). By transfecting each of the four gRNAs individually or in combination, targeting
multiple sites in the promoter with combinations of gRNAs showed robust increases
in gene expression (Fig.
1d). High levels of
IL1RN expression were observed only when the gRNA combinations were co-transfected with
iCas9-VP64
(Fig. 1d), as seen with other classes of engineered transcription factors. Similarly, production
of the IL-1 receptor antagonist (IL-1ra) protein, encoded by the
IL1RN gene, was only observed in three of the six samples treated with the combination
of gRNAs across three different experiments, whereas it was never detected in samples
treated with single gRNAs or control plasmid
(Fig. 1e). To examine the specificity of gene activation by iCas9-VP64, global gene expression
of HEK293T cells treated with the combination of four gRNAs by RNA-seq was assessed
(Fig. 11). Notably, the only genes with significantly increased expression relative to control
(false discovery rate ≤ 3 x 10
-4) were the four isoforms expressed from the
IL1RN locus
(Fig. 4), indicating a high level of specificity of gene activation.
[0215] To demonstrate the general applicability of this system, four gRNAs were designed
to target each of the promoters of eight other genes relevant to medicine and biotechnology,
including
ASCL1, NANOG, HBG1/
2, MYOD1, VEGFA, TERT, IL1B, and
IL1R2 (Fig. 4, Table 2). Forced expression of
ASCL1 and
MYOD1 leads to transdifferentiation of several cell types into neuronal and myogenic phenotypes,
respectively.
NANOG is a marker of pluripotency and that is also used in genetic reprogramming strategies.
Activation of the homologs
HBG1 and
HBG2, which encode γ-globin during fetal development, can be used as a therapeutic strategy
to compensate for β-globin mutations in sickle cell disease. Up-regulation of
VEGFA by synthetic transcription factors has been explored as a strategy to enhance tissue
regeneration and wound healing. The forced expression of telomerase, encoded by the
TERT gene, can be used to immortalize cell lines.
IL1B encodes the IL-1β cytokine that mediates inflammation and autoimmunity. IL-1β signaling
can be blocked by expression of IL-1ra or the decoy receptor encoded by
IL1R2. Expression of each of these genes was enhanced by co-transfection of expression plasmids
for iCas9-VP64 and the four gRNAs into HEK293T cells, as determined by qRT-PCR
(Fig. 2). In some cases expression of a single gRNA was sufficient to induce gene expression,
but in all cases co-transfection of the four gRNAs led to synergistic effects
(Fig. 2a-d). Notably, chromatin accessibility, as determined by DNase-seq, was not a predictor
of successful gene activation
(Fig. 4). RNA-seq was performed on cells transfected with iCas9-VP64 and the four gRNAs targeting
HBG1, three of which also target
HBG2. This revealed specific and reproducible increases in expression of both
HBG1 and
HBG2, which cannot be distinguished by RNA-seq, although statistical significance was not
achieved due to low total expression levels
(Fig. 6). Increases in protein expression of Ascl1 and γ-globin following treatment with iCas9-VP64
and the four gRNAs were detected by western blot
(Fig. 7), corroborating higher mRNA levels observed by qRT-PCR
(Fig. 2). Low baseline levels of Ascl1 and γ-globin protein expression were detectable in empty
vector controls. As preliminary evidence that the activation of gene targets by iCas9-VP64
can lead to secondary changes in gene networks and cell phenotypes, expression plasmids
for iCas9-VP64 and the four gRNAs targeting
ASCL1 were co-transfected into murine embryonic fibroblasts (MEFs)
(Fig. 8). Forced expression of Ascl1 in MEFs has been shown to partially activate the neuronal
gene network, including the downstream target Tuj 1. Because the gRNA target sites
arc conserved in the human and mouse
ASCL1 promoters
(Fig. 8a), activation of
ASCL1 expression was also observed in MEFs treated with plasmids encoding iCas9-VP64 and
the four gRNAs
(Fig. 8b). Furthermore, cells expressing Ascl1 and the neuronal marker Tuj1 were readily detected
by immunofluorescence staining 12 days after transfection in the iCas9-VP64/gRNA-treated
samples
(Fig. 8c-h). No Tuj1-positive cells were observed in the cells treated with the control plasmid.
[0216] Thus far there has not been any comprehensive survey of the specificity of Cas9/CRISPR
activity in mammalian cells. Using RNA-seq, targeted gene activation was shown to
be exquisitely specific with no detectable off-target gene activation
(Fig. 1f,
Fig. 6). IL1RN and
HBG1/
2 were chosen for this specificity analysis as the gene products, IL-1ra and γ-globin,
may not generate secondary effects on gene expression in HEK293T cells. Exploiting
the synergistic activity of multiple weak transcriptional activators, in contrast
to using a single strong activator, may increase specific gene regulation since it
is unlikely that multiple adjacent off-target sites would exist at another locus.
Interestingly, the
IL32 gene was moderately downregulated (false discovery rate < 0.03) in both the samples
treated with iCas9-VP64 and either the
IL1RN- or
HBG1/2-targeted gRNAs compared to control samples treated with only an empty expression
plasmid
(Fig. 1f,
Fig. 6). Because both the
IL1RN and
HBG1/
2-targeted samples were similarly affected, it is unlikely that this is the result
of off-target iCas9-VP64 activity related to the identity of the target sequences.
[0217] To evaluate the specificity with which iCas9-VP64 binds the genome, ChIP sequencing
was performed using an anti-HA antibody on cells treated with iCas9-VP64 and four
gRNAs targeting the IL1RN promoter. The experiment revealed that iCas9 targets the
IL1RN promoter (Fig. 15). Moreover, the experiment revealed an extremely high level
of specificity. The iCas9 had only 10 potential off-target binding sites (FDR < 5%).
To further query the specificity, RNA sequencing experiments were performed with iCas9
EGEMs and found that only IL1RN gene isoforms increased in expression relative to
control (FDR ≤ 3 x 10.4).
Example 3
CRISPRs Targeting the Dystrophin Gene - Methods and Materials
[0218] Plasmid constructs. The expression cassettes for the
S. pyogenes sgRNA and human codon optimized Cas9 (hCas9) nuclease were used, as previously described
(
Perez-Pinera et al., Nat Methods 10:973-976 (2013)). In order to create a fluorescent reporter system to enrich CRISPR/Cas9-modified
cells, a GeneBlock (IDT) was synthesized containing a portion of the 3' end of the
Cas9 coding sequence fused to a T2A skipping peptide immediately upstream of a multiple
cloning site and subsequently cloned into the hCas9 expression vector. An eGFP reporter
gene was then cloned into the T2A vector to allow co-translation of Cas9 and eGFP
proteins from the same expression vector (hCas9-T2A-GFP, SEQ ID NO: 116).
[0219] Cell culture and transfection. HEK293T cells were obtained from the American Tissue Collection Center (ATCC) through
the Duke Cell Culture Facility and were maintained in DMEM supplemented with 10% bovine
calf serum and 1% penicillin/streptomycin. Immortalized myoblasts (
Mamchaoui, K. et al. Skelet Muscle 1, 1-11 (2011)) (one from a wild-type donor, and two Δ48-50 DMD patient derived lines) were maintained
in skeletal muscle media (PromoCell) supplemented with 20% bovine calf serum (Sigma),
50 µg/ml fetuin, 10 ng/ml human epidermal growth factor (Sigma), 1 ng/ml human basic
fibroblast growth factor (Sigma), 10 µg/ml human insulin (Sigma), 1% GlutaMAX (Invitrogen),
and 1% penicillin/streptomycin (Invitrogen). Primary DMD dermal fibroblasts were obtained
from the Coriell Cell repository (GM05162A, Δ46-50) and maintained in DMEM supplemented
with 10% fetal bovine serum, 1 ng/mL human basic fibroblast growth factor, and 1%
penicillin/streptomycin. All cell lines were maintained at 37°C and 5% CO
2.
[0220] HEK293T cells were transfected with Lipofectamine 2000 (Invitrogen) with 400 ng of
each expression vector according to the manufacturer's protocol in 24 well plates.
Immortalized myoblasts and primary fibroblasts were transfected with 5 µg of each
expression vector by electroporation using the Gene Pulser XCell (BioRad) with PBS
as an electroporation buffer using optimized conditions for each line (Fig. 1) (
Ousterout et al. Mol Ther 21:1718-1726 (2013)). Transfection efficiencies were measured by delivering an eGFP expression plasmid
(pmaxGFP, Clontech) and using flow cytometry. These efficiencies were routinely ≥95%
for HEK293T and ≥70% for the primary fibroblasts and immortalized myoblasts. For all
experiments, the indicated mass of electroporated plasmid corresponds to the amount
used for each CRISPR/Cas9-based system.
[0221] Cel 1 quantification of endogenous gene modification (Surveyor Assay). CRISPR/Cas9-based system-induced lesions at the endogenous target site were quantified
using the Surveyor nuclease assay (
Guschin, D.Y. et al. Meth Mol Biol 649, 247-256 (2010)), which can detect mutations characteristic of nuclease-mediated NHEJ. After transfection,
cells were incubated for 3 or 10 days at 37°C and genomic DNA was extracted using
the DNeasy Blood and Tissue kit (QIAGEN). The target locus was amplified by 35 cycles
of PCR with the AccuPrime High Fidelity PCR kit (Invitrogen) using primers specific
to each locus (see Table 4), such as 5'- GAGTTTGGCTCAAATTGTTACTCTT-3' (SEQ ID NO:
60) and 5'-GGGAAATGGTCTAGGAGAGTAAAGT-3' (SEQ ID NO: 61).
Table 4 Summary of top 10 off target sites predicted in silico and activity at each
site as detected by the Surveyor assay in HEK293T cells transfected with Cas9 and
the indicated sgRNA expression cassettes. n.d.: not detected.
| SEQ ID NO. |
Guide |
Target |
Sequence |
PAM |
Score |
Chr |
Gene |
Intron/Ex on |
# MMs |
% indels |
| 67 |
CR3 |
Guide |
GCCTACTCAGACTGTTACTC |
- |
- |
- |
- |
- |
- |
- |
| 150 |
Target |
tCCTACTCAGACTGTTACTC |
TGG |
- |
X |
DMD |
Exon |
1 |
13.0 |
| 151 |
OT1 |
tCCTACTCAcACTGTTACTC |
AGG |
7.4 |
1 |
STRIP1 |
Intron |
2 |
9.3 |
| 152 |
OT2 |
aCCTgCTCAcACTGTTACTC |
CAG |
2.5 |
2 |
ARHGAP25 |
Intron |
3 |
n.d. |
| 151 |
OT3 |
GCaTtCTCAaACTGTTACTC |
AGG |
2.4 |
13 |
None |
None |
3 |
n.d. |
| 154 |
OT4 |
GgaTtC TCAcACTGTTAC TC |
GGG |
1.3 |
14 |
PGPEPI |
Exon |
a |
n.d. |
| 155 |
OT5 |
aCaTACTtAtACTGTTACTC |
TAG |
1.3 |
19 |
MDGA2 |
Intron |
4 |
n.d. |
| 156 |
OT6 |
tatTcCTaAGACTGTTACTC |
AAG |
0.9 |
8 |
LPPR1 |
Intron |
5 |
n.d. |
| 157 |
OT7 |
aaggACTaAGACTGTTACTC |
GGG |
0.9 |
9 |
RNF122 |
Intron |
5 |
n.d. |
| 158 |
OT8 |
GagctCTCAtACTGTTACTC |
TAG |
0.8 |
3 |
DNMBP |
Exon |
5 |
n.d. |
| 159 |
OT9 |
GCaaAaTgAGACTGTTACTC |
CAG |
0.8 |
5 |
SLC 12A2 |
Intron |
4 |
n.d. |
| 160 |
OT10 |
cCtcAtTCAGACTGTTACTC |
AAG |
0.9 |
4 |
KCNIP4 |
Intron |
4 |
n.d. |
| 65 |
CR1 |
Guide |
GATTGGCTTTGATTTCCCTA |
- |
- |
- |
- |
- |
- |
- |
| 161 |
Target |
cATTGGCTTTGATTTCCCTA |
GGG |
- |
X |
DMD |
Intron |
1 |
8.3 |
| 162 |
OT1 |
aATTGGCATTGATTTCCCTA |
GAG |
7.1 |
16 |
None |
None |
2 |
0.8 |
| 163 |
OT2 |
cATTGGCTTTaATTTCCCTA |
TAG |
4.8 |
4 |
None |
None |
2 |
n.d. |
| 164 |
OT3 |
GATaGGCTgTGATTTCCCTA |
GAG |
3.9 |
9 |
None |
None |
2 |
n.d. |
| 165 |
OT4 |
GAaTaGCcTTGATTTCCCTA |
AAG |
2.4 |
1 |
None |
None |
3 |
n.d. |
| 166 |
OT5 |
aATTtGCTTTGATTTCCCTg |
AGG |
1.5 |
1 |
TIMM17A |
Intron |
3 |
n.d. |
| 167 |
OT6 |
GATgtGCTTTGATTTCCCTt |
GGG |
1.4 |
17 |
MYO1D |
Intron |
3 |
n.d. |
| 168 |
OT7 |
aATTGGtTTTaATTTCCCTA |
AAG |
1.1 |
8 |
PIK1A |
Intron |
3 |
n.d. |
| 169 |
OT8 |
aATTGGgTTTGATTTCCCTt |
TGG |
1.1 |
11 |
MS4A1 |
Intron |
3 |
n.d. |
| 170 |
OT9 |
GATgGGtTTTtATTTCCCTA |
GAG |
1.0 |
11 |
None |
None |
3 |
n.d. |
| 171 |
OT10 |
GAaTGGtTTTGATTTCCCTg |
GAG |
1.0 |
11 |
None |
None |
3 |
n.d. |
| 69 |
CR5 |
Guide |
GCAGTTGCCTAAGAACTGGT |
- |
- |
- |
- |
- |
- |
- |
| 172 |
Target |
aCAGTTGCCTAAGAACTGGT |
GGG |
- |
X |
DMD |
Intron |
1 |
14.0 |
| 173 |
OT1 |
cCAGTTGtCTAAGAACTGGg |
GAG |
1.5 |
5 |
NRG1 |
Intron |
3 |
n.d. |
| 174 |
OT2 |
GCAGTTGCCTgtGAACTGGT |
AGG |
1.4 |
X |
None |
None |
2 |
n.d. |
| 175 |
OT3 |
GCAGaTGCagAAGAACTGGT |
GAG |
1.4 |
19 |
SMIM7 |
Intron |
3 |
n.d. |
| 176 |
OT4 |
GCAGTTcCagAAGAACTGGT |
GAG |
0.9 |
11 |
GLB1L2 |
Intron |
3 |
n.d. |
| 177 |
OT5 |
caAcTTGCCTAtGAACTGGT |
AGG |
0.7 |
8 |
ASAP1 |
Intron |
4 |
n.d. |
| 178 |
OT6 |
aCAccTGCCTAAGAACTGGa |
GGG |
0.7 |
11 |
None |
None |
4 |
n.d. |
| 179 |
OT7 |
tCAGgTGgCTAACTAACTGGg |
TGG |
0.7 |
14 |
NIN |
Intron |
4 |
n.d. |
| 180 |
OT8 |
GaAGTTGgCcAAGAACTGGa |
GAG |
0.6 |
7 |
None |
None |
4 |
n.d. |
| 181 |
OT9 |
GCtGcTGCCcAAGAACTGGc |
AGG |
0.6 |
11 |
AMOTL1 |
Intron |
4 |
n.d. |
| 182 |
OT10 |
tCAGcTGgCTAAGAACgGGT |
AAG |
0.6 |
7 |
ACTR3C |
Intron |
4 |
n.d. |
| 70 |
CR6 |
Guide |
GGGGCTCCACCCTCACGAGT |
- |
- |
- |
- |
- |
- |
- |
| 183 |
Target |
aGGGCTCCACCCTCACGAGT |
GGG |
- |
x |
DMD |
Intron |
1 |
19.9 |
| 184 |
OT1 |
GcaGCTCagCCCTCACGAGT |
CAG |
0.8 |
3 |
None |
None |
4 |
n.d. |
| 185 |
OT2 |
GGGGCTtCAgCaTCACGAGT |
GAG |
0.9 |
8 |
None |
None |
3 |
n.d. |
| 186 |
OT3 |
GGGGCTCtcCCCTCACtAGT |
GAG |
0.6 |
8 |
None |
None |
3 |
n.d. |
| 187 |
O14 |
GGGGaTCCACCtTCACcAGT |
CAG |
0.6 |
2 |
None |
None |
3 |
n.d. |
| 188 |
O15 |
aGGGCTggACCCTCACaAGT |
AAG |
0.4 |
16 |
AXIN1 |
Intron |
4 |
n.d. |
| 199 |
OT6 |
tGGtCTCCtCCCcCACGAGT |
GGG |
0.4 |
2 |
None |
None |
4 |
n.d. |
| 190 |
OT7 |
aGGGCTCCcaCCcCACGAGT |
GAG |
0.3 |
5 |
None |
None |
4 |
n.d. |
| 191 |
OT8 |
GaGGCTCCAtaCTCACcAGT |
GAG |
0.3 |
11 |
None |
None |
4 |
n.d. |
| 192 |
OT9 |
GGaGCTgCcCCtTCACGAGT |
GGG |
0.3 |
3 |
None |
None |
4 |
n.d. |
| 193 |
OT10 |
atGaCTCCACCCTCAaGAGT |
AAG |
0.3 |
8 |
AGPATS |
None |
4 |
n.d. |
| 100 |
CR36 |
Guide |
GCCTTCTTTATCCCCTATCG |
- |
- |
- |
- |
- |
- |
- |
| 194 |
Target |
GCCTTCTTTATCCCCTATCG |
AGG |
|
X |
DMD |
Intron |
0 |
20.6 |
| 195 |
OT1 |
GtCTgCTgTgTCCCCTATCG |
GGG |
1.3 |
21 |
None |
None |
4 |
n.d. |
| 196 |
OT2 |
cCCTTCTcTA TCCCCTg TCG |
TGG |
1.3 |
8 |
None |
None |
3 |
n.d. |
| 197 |
OT3 |
GCCTTCTTTATCCCCTcTCt |
TGG |
0.9 |
10 |
None |
None |
2 |
0.5 |
| 198 |
OT4 |
GCgcTCTTTtTCCCCTATCt |
TAG |
0.6 |
16 |
None |
None |
4 |
n.d. |
| 199 |
OT5 |
GCCcTCTgTcTCCCCTgTCG |
CAG |
0.5 |
1 |
NFASC |
None |
4 |
n.d. |
| 200 |
OT6 |
tCCATCTtTgTCCCCTATtG |
AGG |
0.5 |
10 |
None |
None |
4 |
n.d. |
| 201 |
OT7 |
aCCtTCTCTcTCCCCTATaG |
AGG |
0.5 |
5 |
LOC100996185 |
Intron |
4 |
n.d. |
| 202 |
OT8 |
GttTTCTTTtTCCCCTATgG |
GAG |
0.5 |
3 |
None |
None |
4 |
n.d. |
| 203 |
OT9 |
tgCTTCTTaATCCCCTATCa |
AAG |
0.4 |
7 |
None |
None |
4 |
n.d. |
| 204 |
OT10 |
aCCTTCTTacTCCCCTATCc |
GGG |
0.4 |
10 |
ADARB2 |
None |
4 |
n.d. |
[0222] The resulting PCR products were randomly melted and reannealed in a thermal cycler
with the program: 95°C for 240 s, followed by 85°C for 60 s, 75°C for 60 s, 65°C for
60 s, 55°C for 60 s, 45°C for 60 s, 35°C for 60 s, and 25°C for 60 s with a -0.3°C/s
rate between steps. Following reannealing, 8 µL of PCR product was mixed with 1 µL
of Surveyor Nuclease S and 1 µL of Enhancer S (Transgenomic) and incubated at 42°C
for 1 hr. After incubation, 6 µL of digestion product was loaded onto a 10% TBE polyacrylamide
gel and run at 200V for 30 min. The gels were stained with ethidium bromide and quantified
using ImageLab (Bio-Rad) by densitometry as previously described (
Guschin, et al. Meth Mol Biol 649, 247-256 (2010)).
[0223] Fluorescence-activated cell sorting of myoblasts. DMD myoblasts were electroporated with 5 micrograms each of hCas9-T2A-GFP and sgRNA
expression vectors and incubated at 37°C and 5% CO
2. Three days after electroporation, cells were trypsinized and collected for FACS
sorting using a FACSvantage II sorting machine. GFP-positive cells were collected
and grown for analysis.
[0224] PCR-based assay to detect genomic deletions. The exon 51 or exon 45-55 loci were amplified from genomic DNA by PCR (Invitrogen
AccuPrime High Fidelity PCR kit) using primers flanking each locus. The flanking primers
were CelI-CR1/2-F and CelI-CR5-R for exon 51 or CelI-CR6-F and CelI-CR36-R for exon
45-55 analysis (Table 4). PCR products were separated on TAE-agarose gels and stained
with ethidium bromide for analysis.
[0225] PCR-based detection of translocations. Loci with predicted possible translocations were amplified by a two-step nested PCR
(Invitrogen AccuPrime High Fidelity PCR kit for each step) of genomic DNA from cells
transfected with Cas9 alone (control) or Cas9 with sgRNA. In the first step, translocations
that may occur at each on-target and off-target sgRNA target site were amplified by
35 cycles of PCR using combinations of Surveyor primers for each locus that were modified
to include restriction sites to facilitate cloning and sequencing analysis (Table
4). One microliter of each PCR reaction was subjected to a second round of amplification
by 35 rounds of PCR using nested primer sets custom designed for each individual predicted
translocation (Table 4). Each second nested PCR primer binds within the same approximate
region within the primary amplicon; however, each pair was optimized using Primer3
online bioinformatics software to ensure specific detection of each translocation.
PCR amplicons corresponding to the expected length of predicted translocations and
only present in cells treated with sgRNA were purified (QIAGEN Gel Extraction kit)
and analyzed by Sanger sequencing.
[0227] Western blot analysis. To assess dystrophin protein expression, immortalized myoblasts were differentiated
into myofibers by replacing the growth medium with DMEM supplemented with 1% insulin-transferrin-selenium
(Invitrogen) and 1% antibiotic/antimycotic (Invitrogen) for 4-7 days, such as 6 or
7 days. Fibroblasts were transdifferentiated into myoblasts by inducing MyoD overexpression
and incubating the cells in DMEM supplemented with 1% insulin-transferrin-selenium
(Invitrogen), 1% antibiotic/antimycotic (Invitrogen) and 3 µg/mL doxycycline for 15
days. Dystrophin expression was assessed at 3 days after transfecting HEK293T cells.
Cells were trypsinized, collected and lysed in RIPA buffer (Sigma) supplemented with
a protease inhibitor cocktail (Sigma) and the total protein amount was quantified
using the bicinchoninic acid assay according to the manufacturer's instructions (Pierce).
Samples were then mixed with NuPAGE loading buffer (Invitrogen) and 5% β-mercaptoethanol
and heated to 85°C for 10 minutes. Twenty-five micrograms of protein were separated
on 4-12% NuPAGE Bis-Tris gels (Invitrogen) with MES buffer (Invitrogen). Proteins
were transferred to nitrocellulose membranes for 1-2 hrs in transfer buffer containing
10-20% methanol, such as 10% methanol, and 0.01% SDS. The blot was then blocked for
1 hr with 5% milk-TBST at room temperature. Blots were probed with the following primary
antibodies: MANDYS8 to detect dystrophin (1:100, Sigma D8168) and rabbit anti-GAPDH
(1:5000, Cell Signaling 2118S). Blots were then incubated with mouse or rabbit horseradish
peroxidase-conjugated secondary antibodies (Santa Cruz) and visualized using the ChcmiDoc
chemilumescent system (BioRad) and Western-C ECL substrate (BioRad).
[0228] Transplantation into immunodeficient mice. All animal experiments were conducted under protocols approved by the Duke Institutional
Animal Care & Use Committee. Cells were trypsinized, collected and washed in 1X Hank's
Balanced Salt Solution (HBSS, Sigma). Two million cells were pelleted and resuspended
in five µL 1X HBSS (Sigma) supplemented with cardiotoxin (Sigma #C9759) immediately
prior to injection. These cells were transplanted into the hind limb tibialis anterior
(TA) muscle of NOD.SCID.gamma (NSG) mice (Duke CCIF Breeding Core) by intramuscular
injection. Four weeks after injection, mice were euthanized and the TA muscles were
harvested.
[0229] Immunofluorescence staining. Harvested TA muscles were incubated in 30% glycerol overnight at 4°C before mounting
and freezing in Optimal Cutting Temperature compound. Serial 10 micron sections were
obtained by cryosectioning of the embedded muscle tissue at -20°C. Cryosections were
then washed in PBS to remove the OCT compound and subsequently blocked for 30-60 minutes
at room temperature in PBS containing 10% heat-inactivated fetal bovine serum for
spectrin detection or 5% heat-inactivated fetal bovine serum for dystrophin detection.
Cryosections were incubated overnight at 4°C with the following primary antibodies
that are specific to human epitopes only: anti-spectrin (1:20, Leica NCL-SPEC1) or
anti-dystrophin (1:2, Leica NCL-DYS3). After primary staining, spectrin or dystrophin
expression was detected using a tyramide-based immunofluorescence signal amplification
detection kit (Life Technologies, TSA Kit #22, catalog #T-20932,). Briefly, cryosections
were incubated with 1:200 goat anti-mouse biotin-XX secondary (Life Technologies #B2763)
in blocking buffer for 1 hr at room temperature. The signal was then amplified using
streptavidin-HRP conjugates (1:100, from TSA Kit) in blocking buffer for 1 hr at room
temperature. Finally, cryosections were incubated with tyramide-AlexaFluor488 conjugates
(1:100, TSA kit) in manufacturer-provided amplification buffer for 10 minutes at room
temperature. Stained cryosections were then mounted in ProLong AntiFade (Life Technologies
#P36934) and visualized with conventional fluorescence microscopy.
[0230] Cytotoxicity assay. To quantitatively assess potential sgRNA or SpCas9 nuclease-associated cytotoxicity,
HEK293T cells were transfected with 10 ng of a GFP reporter and 100 ng SpCas9 expression
vector and 100 ng sgRNA expression vector using Lipofectamine 2000 according to the
manufacturer's instructions (Invitrogen). The percentage of GFP positive cells was
assessed at 2 and 5 days by flow cytometry. The survival rate was calculated as the
decrease in GFP positive cells from days 2 to 5 and normalized to cells transfected
with an empty nuclease expression vector as described (
Cornu et al., Meth Mol Biol 649:237-245 (2010)).
Example 4
CRISPRs Targeting the Dystrophin Gene - Results
[0231] The CRISPR/Cas9-based system was designed to target the dystrophin gene. Various
gRNAs were chosen to target different regions of the human and mouse dystrophin gene
based on NNNNN NNNNN NNNNN NNNNN NGG and GNNNN NNNNN NNNNN NNNNN NGG (see Tables 6,
7 and 8).
Table 6
| Name (SEQ ID NO) |
Species |
Gene |
Target |
Strand |
19bp for chimeric (add G on 5' end) |
PAM |
| DCR1 (65) |
Human |
DMD |
Intron 50 |
+ |
attggctttgaritcccta |
GGG |
| DCR2 (66) |
Human |
DMD |
Intron 50 |
- |
tgtagagtaagtcagccta |
TGG |
| DCR3 (67) |
Human |
DMD |
Exon 51-55' |
+ |
cctactcagactgttactc |
TGG |
| DCR4 (68) |
Human |
DMD |
Exon 51-53' |
+ |
ttggacagaacttaccgac |
TGG |
| DCR5 (69) |
Human |
DMD |
Intron 51 |
- |
cagttgcctaagaactggt |
GGG |
| DCR6 (70) |
Human |
DMD |
Intron 44 |
- |
GGGCTCCACCCTCACGAGT |
GGG |
| DCR7 (71) |
Human |
DMD |
Intron 55 |
+ |
TTTGCTTCGCTATAAAACG |
AGG |
| DCR8 (72) |
Human |
DMD |
Exon 41 |
+ |
TCTGAGGATGGGGCCGCAA |
TGG |
| DCR9 (73) |
Human |
DMD |
Exon 44 |
- |
GATCTGTCAAATCGCCTGC |
AGG |
| DCR10 (74) |
Human |
DMD |
Exon 45 |
+ |
CCAGGATGGCATTGGGCAG |
CGG |
| DCR11 (75) |
Human |
DMD |
Exon 45 |
+ |
CTGAATCTGCGGTGGCAGG |
AGG |
| DCR12 (76) |
Human |
DMD |
Exon 46 |
- |
TTCTTTTGTTCTTCTAGCc |
TGG |
| DCR13 (77) |
Human |
DMD |
Exon 46 |
+ |
GAAAAGCTTGAGCAAGTCA |
AGG |
| DCR14 (78) |
Human |
DMD |
Exon 47 |
+ |
GAAGAGTTGCCCCTGCGCC |
AGG |
| DCR15 (79) |
Human |
DMD |
Exon 47 |
+ |
ACAAATCTCCAGTGGATAA |
AGG |
| DCR16 (80) |
Human |
DMD |
Exon 48 |
- |
TGTTTCTCAGGTAAAGCTC |
TGG |
| DCR17 (81) |
Human |
DMD |
Exon 48 |
+ |
GAAGGACCATTTGACGTTa |
AGG |
| DCR18 (82) |
Human |
DMD |
Exon 49 |
- |
AACTGCTATTTCAGTTTCc |
TGG |
| DCR19 (83) |
Human |
DMD |
Exon 49 |
+ |
CCAGCCACTCAGCCAGTGA |
AGG |
| DCR20 (84) |
Human |
DMD |
Exon 50 |
+ |
gtatgcttttctgttaaag |
AGG |
| DCR21 (85) |
Human |
DMD |
Exon 50 |
+ |
CTCCTGGACTGACCACTAT |
TGG |
| DCR22 (86) |
Human |
DMD |
Exon 52 |
+ |
GAACAGAGUCGTCCCCAGT |
TGG |
| DCR23 (87) |
Human |
DMD |
Exon 52 |
+ |
GAGGCTAGAACAATCATTA |
CGG |
| DCR24 (88) |
Human |
DMD |
Exon 53 |
+ |
ACAAGAACACCTTCAGAAC |
CGG |
| DCR25 (89) |
Human |
DMD |
Exon 53 |
- |
GGTTTCTGTGATTTTCTTT |
TGG |
| DCR26 (90) |
Human |
DMD |
Exon 54 |
+ |
GGCCAAAGACCTCCGCCAG |
TGG |
| DCR27 (91) |
Human |
DMD |
Exon 54 |
+ |
TTGGAGAAGCATTCATAAA |
AGG |
| DCR28 (92) |
Human |
DMD |
Exon 55 |
- |
TCGCTCACTCACCctgcaa |
AGG |
| DCR29 (93) |
Human |
DMD |
Exon 55 |
+ |
AAAAGAGCTGATGAAACAA |
TGG |
| DCR30 (94) |
Human |
DMD |
5'UTR/Exon 1 |
+ |
TAcACTTTTCaAAATGCTT |
TGG |
| DCR31 (95) |
Human |
DMD |
Exon 51 |
+ |
gagatgatcatcaagcaga |
AGG |
| DCR32 (96) |
Mouse |
DMD |
mdx mutation |
+ |
ctttgaaagagcaaTaaaa |
TGG |
| DCR33 (97) |
Human |
DMD |
Intron 44 |
- |
CACAAAAGTCAAATCGGAA |
TGG |
| DCR34 (98) |
Human |
DMD |
Intron 44 |
- |
ATTTCAATATAAGATTCGG |
AGG |
| DCR35 (99) |
Human |
DMD |
Intron 55 |
- |
CTTAAGCAATCCCGAACTC |
TGG |
| DCR36 (100) |
Human |
DMD |
Intron 55 |
- |
CCTTCTTTATCCCCTATCG |
AGG |
| DCR40 (104) |
Mouse |
DMD |
Exon 23 |
- |
aggccaaacctcggcttac |
NNGRR |
| DCR41 (105) |
Mouse |
DMD |
Exon 23 |
+ |
TTCGAAAATTTCAGgtaag |
NNGRR |
| DCR42 (106) |
Mouse |
DMD |
Exon 23 |
+ |
gcagaacaggagataacag |
NNGRRT |
| DCR43 (107) |
Mouse |
ACVR2B |
Exon 1 |
+ |
gcggccctcgcccttctct |
ggggat |
| DCR48 (108) |
Human |
DMD |
Intron 45 |
- |
TAGTGATCGTGGATACGAG |
AGG |
| DCR49 (109) |
Human |
DMD |
Intron 45 |
- |
TACAGCCCTCGGTGTATAT |
TGG |
| DCR50 (110) |
Human |
DMD |
Intron 52 |
- |
GGAAGGAATTAAGCCCGAA |
TGG |
| DCR51 (111) |
Human |
DMD |
Intron 53 |
- |
GGAACAGCTTTCGTAGTTG |
AGG |
| DCR52 (112) |
Human |
DMD |
Intron 54 |
+ |
ATAAAGTCCAGTGTCGATC |
AGG |
| DCR53 (113) |
|
|
Intron 54 |
+ |
AAAACCAGAGCTTCGGTCA |
AGG |
| DCR54 (114) |
Mouse |
Rosa26 |
ZFN region |
+ |
 |
TGG |
| DCR55 (115) |
Mouse |
Rosa26 |
mRNA |
- |
 |
TGG |
| DCR49 (116) |
Human |
DMD |
Ex 51 |
- |
gtgtcaccagagtaacagt |
ctgagt |
| DCR50 (117) |
Human |
DMD |
Ex 51 |
+ |
tgatcatcaagcagaaggt |
atgag |
| DCR60 (118) |
Mouse |
DMD |
Exon 23 |
+ |
AACTTCGAAAATTTCAGgta |
agccgagg |
| DCR61 (119) |
Mouse |
DMD |
Intron 22 |
+ |
gaaactcatcaaatatgcgt |
gttagtgt |
| DCR62 (120) |
Mouse |
DMD |
Intron 22 |
- |
tcatttacactaacacgcat |
atttgatg |
| DCR63 (121) |
Mouse |
DMD |
Intron 22 |
i |
gaatgaaactcatcaaatat |
gcgtgtta |
| DCR64 (122) |
Mouse |
DMD |
Intron 23 |
- |
tcatcaatatctttgaagga |
ctctgggt |
| DCR65 (123) |
Mouse |
DMD |
Intron 23 |
- |
tgttttcataggaaaaatag |
gcaagttg |
| DCR66 (124) |
Mouse |
DMD |
Intron 23 |
+ |
aattggaaaatgtgatggga |
aacagata |
| DCR67 (125) |
Human |
DMD |
Exon 51 |
+ |
algatcatcaagcagaaggl |
atgagaaa |
| DCR68 (126) |
Human |
DMD |
Exon 51 |
+ |
agatgatcatcaagcagaag |
gtatgaga |
| DCR69 (127) |
Human |
DMD |
Exon 51 |
- |
cattttttctcataccttct |
gcttgatg |
| DCR70 (128) |
Human |
DMD |
Exon 51 |
+ |
tcctactcagactgttactc |
tggtgaca |
| DCR71 (129) |
Human |
DMD |
Exon 51 |
- |
acaggttgtgtcaccagagt |
aacagtct |
| DCR72 (130) |
Human |
DMD |
Exon 51 |
- |
ttatcattttttctcatacc |
ttctgctt |
| DCR73 (131) |
Human |
DMD |
Intron 51 |
- |
ttgcctaagaactggtggga |
aatggtct |
| DCR74 (132) |
Human |
DMD |
Intron 51 |
- |
aaacagttgcctaagaactg |
gtgggaaa |
| DCR75 (133) |
Human |
DMD |
Intron 51 |
+ |
tttcccaccagttcttaggc |
aactgttt |
| DCR76 (134) |
Human |
DMD |
Intron 50 |
+ |
tggctttgatttccctaggg |
tccagctt |
| DCR77 (135) |
Human |
DMD |
Intron 50 |
- |
tagggaaatcaaagccaatg |
aaacgltc |
| DCR78 (136) |
Human |
DMD |
Intron 50 |
- |
gaccctagggaaatcaaagc |
caatgaaa |
| DCR79 (137) |
Human |
DMD |
Intron 44 |
- |
TGAGGGCTCCACCCTCACGA |
GTGGGTTT |
| DCR80 (138) |
Human |
DMD |
Intron 44 |
- |
AAGGATTGAGGGCTCCACCC |
TCACGAGT |
| DCR81 (139) |
Human |
DMD |
Intron 44 |
- |
GCTCCACCCTCACGAGTGGG |
TTTGGTTC |
| DCR82 (140) |
Human |
DMD |
Intron 55 |
- |
TATCCCCTATCGAGGAAACC |
ACGAGTTT |
| DCR83 (141) |
Human |
DMD |
Intron 55 |
+ |
GATAAAGAAGGCCTATTTCA |
TAGAGTTG |
| DCR84 (142) |
Human |
DMD |
Intron 55 |
- |
AGGCCTTCTTTATCCCCTAT |
CGAGGAAA |
| DCR85 (143) |
Human |
DMD |
Intron 44 |
- |
TGAGGGCTCCACCCTCACGA |
GTGGGT |
| DCR86 (144) |
Human |
DMD |
Intron 55 |
+ |
GATAAAGAAGGCCTATTTCA |
TAGAGT |
Table 7
| Name |
Notes |
% Mod |
| DCR1 |
Delete exon 51 |
6.6 |
| DCR2 |
Delete exon 51 |
10.3 |
| DCR3 |
Frameshift |
13 |
| DCR4 |
Delete exon 51 |
11.9 |
| DCR5 |
Delete exon 51 |
12.4 |
| DCR6 |
As close to exon 44 as possible in intron 44 (in case of patient deletions) |
16.1 |
| DCR7 |
As close to exon 56 as possible in intron 55 (in case of patient deletions) |
6.8 |
| DCR8 |
Can correct exon 42-43 deletion (-1/+2) only, (-2/+1) is not correctable by this |
17.3 |
| DCR9 |
Skip exon 44 (5') |
14.4 |
| DCR10 |
Frameshift |
14.9 |
| DCR11 |
Correct downstream of exon 45 |
<1 |
| DCR12 |
5' splice acceptor/frameshift |
<1 |
| DCR13 |
Correct downstream of exon 46 |
16.9 |
| DCR14 |
Frameshift |
17.2 |
| DCR15 |
Correct downstream of exon 47 |
15.4 |
| DCR16 |
Frameshift |
11.5 |
| DCR17 |
Correct downstream of exon 48 |
<1 |
| DCR18 |
5' splice acceptor/frameshift |
1.8 |
| DCR19 |
Correct downstream of exon 49 |
33.7 |
| DCR20 |
5' splice acceptor |
14.9 |
| DCR21 |
Correct downstream of exon 50 |
24.1 |
| DCR22 |
Frameshift |
25.9 |
| DCR23 |
Correct downstream of exon 52 |
25.2 |
| DCR24 |
Frameshift (can only correct +1 frame) |
24.8 |
| DCR25 |
Correct downstream of exon 53 |
2.6 |
| DCR26 |
Frameshift |
24.5 |
| DCR27 |
Correct downstream of exon 54 |
13.4 |
| DCR28 |
5' splice acceptor |
21.6 |
| DCR29 |
Correct downstream of exon 55 |
19.2 |
| DCR30 |
Integrate minidys in exon 1 |
not tested |
| DCR31 |
Correct downstream of exon 51 |
18.9 |
| DCR32 |
Delete stop codon |
not tested |
| DCR33 |
Alternative to CR6 |
1.3 |
| DCR34 |
Alternative to CR6 |
13.2 |
| DCR35 |
Alternative to CR7 |
22.5 |
| DCR36 |
Alternative to CR7 |
26.4 |
| DCR40 |
Disrupt exon 23 5' splice donor (correct mdx mutation) |
|
| DCR41 |
Disrupt exon 23 5' splice donor (correct mdx mutation) |
|
| DCR42 |
Delete exon 53 mdx4cv mutation |
|
| DCR43 |
Disrupt myostatin receptor |
|
Table 8
| Name |
Cas9 |
|
Notes |
Cas9 used |
| DCR49 |
S. Aureus |
|
Frameshift in exon 51 |
SaCas9 (from Zhang pX441) (NNGRRT PAM) |
| DCR50 |
S. Aureus |
|
Disrupt 5' end of exon 51 |
SaCas9 (from Zhang pX441) (NNGRR PAM) |
| DCR60 |
N. Meningitidis |
NNNNGANN |
Target 3' splice donor of exon 23 to bypass mdx mutation |
NmCas9 (NNNNGANN PAM) |
| DCR61 |
N.Meningitidis |
NNNNGNNT |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGNNT PAM) |
| DCR62 |
N. Meningitidis |
NNNNGANN |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGANN PAM) |
| DCR63 |
N. Meningitidis |
NNNNGTTN |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGTTN PAM) |
| DCR64 |
N. Meningitidis |
NNNNGNNT |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGNNT PAM) |
| DCR65 |
N. Meningitidis |
NNNNGTTN |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGTTN PAM) |
| DCR66 |
N. Meningitidis |
NNNNGANN |
Delete exon 23 and bypass mdx mutation |
NmCas9 (NNNNGANN PAM) |
| DCR67 |
N. Meningitidis |
NNNNGANN |
Target 3' splice donor of exon 51 to skip exon |
NmCas9 (NNNNGANN PAM) |
| DCR68 |
N. Meningitidis |
NNNNGANN |
Target 3' splice donor of exon 51 to skip exon |
NmCas9 (NNNNGANN PAM) |
| DCR69 |
N. Meningitidis |
NNNNGANN |
Target 3' splice donor of exon 51 to skip exon |
NmCas9 (NNNNGANN PAM) |
| DCR70 |
N. Meningitidis |
NNNNGANN |
Frameshift in exon 51 |
NmCas9 (NNNNGANN PAM) |
| DCR71 |
N. Meningitidis |
NNNNGNNT |
Frameshift in exon 51 |
NmCas9 (NNNNGNNT PAM) |
| DCR72 |
N. Meningitidis |
NNNNGNNT |
Target 3' splice donor of exon 51 to skip exon |
NmCas9 (NNNNGNNT PAM) |
| DCR73 |
N. Meningitidis |
NNNNGNNT |
Delete exon 51 (bind as close to DCR5 as possible) |
NmCas9 (NNNNGNNT PAM) |
| DCR74 |
N. Meningitidis |
NNNNGANN |
Delete exon 51 (bind as close to DCR5 as possible) |
NmCas9 (NNNNGANN PAM) |
| DCR75 |
N. Meningitidis |
NNNNGTTN |
Delete exon 51 (bind as close to DCR5 as possible) |
NmCas9 (NNNNGTTN PAM) |
| DCR76 |
N. Meningitidis |
NNNNGNNT |
Delete exon 51 (bind as close to DCR1/2 as possible) |
NmCas9 (NNNNGNNT PAM) |
| DCR77 |
N. Meningitidis |
NNNNGTTN |
Delete exon 51 (bind as close to DCR1/2 as possible) |
NmCas9 (NNNNGTTN PAM) |
| DCR78 |
N. Meningitidis |
NNNNGANN |
Delete exon 51 (bind as close to DCR1/2 as possible) |
NmCas9 (NNNNGANN PAM) |
| DCR79 |
N. Meningitidis |
NNNNGNNT |
Delete exons 45-55 - overlaps NNNNGTTN PAM, bind as close to DCR6 as possible |
NmCas9 (NNNNGNNT PAM) |
| DCR80 |
N. Meningitidis |
NNNNGANN |
Delete exons 45-55, bind as close to DCR6 as possible |
NmCas9 (NNNNGANN PAM) |
| DCR81 |
N. Meningitidis |
NNNNGTTN |
Delete exons 45-55, bind as close to DCR6 as possible |
NmCas9 (NNNNGTTN PAM) |
| DCR82 |
N. Meningitidis |
NNNNGNNT |
Delete exons 45-55, bind as close to DCR36 as possible - overlaps NNNNGTTN PAM |
NmCas9 (NNNNGNNT PAM) |
| DCR83 |
N. Meningitidis |
NNNNGTTN |
Delete exons 45-55, bind as close to DCR36 as possible |
NmCas9 (NNNNGTTN PAM) |
| DCR84 |
N. Meningitidis |
NNNNGANN |
Delete exons 45-55, bind as close to DCR36 as possible |
NmCas9 (NNNNGANN PAM) |
| DCR85 |
S. Aureus |
NNGRRT |
Delete exons 45-55, bind as close to DCR6 as possible |
SaCas9 (from Zhang pX441) (NNGRRT PAM) |
| DCR86 |
S. Aureus |
NNGRRT |
Delete exons 45-55, bind as close to DCR36 as possible |
SaCas9 (from Zhang pX441) (NNGRRT PAM) |
[0232] In particular, 400 ng of Cas9 was co-transfected into HEK 293T cells with either
400 ng of empty vector or gRNA that targets the region encompassing Exon 51,
i.e., CR1, CR2, CR3, CR4, and CR5 (see Fig. 11(b)). Genomic DNA was harvested at 2 days
post-transfection and analyzed using the Surveyor assay (see Figs. 11(a) and 11(c)).
[0233] The CRISPR/Cas9-based system was used in DMD 8036 (del48-50) cells to determine if
the system could repair a mutant dystrophin gene. 5 µg of Cas9 was co-transfected
into DMD 8036 (del48-50) cells with either 7.5 µg of empty vector or gRNA. In particular,
7.5 µg of CR1 ("DCR1"), 7.5 µg of CR5 ("DCR5"), 15 µg of CR3 ("DCR3") or 7.5 µg of
a combination of CR1 and CR5 (DCR1+DCR5) were used. Genomic DNA was harvested at 3
days post-transfection and analyzed using the Surveyor assay (Fig. 12) or PCR analysis
across the entire locus (Fig. 13). This locus was amplified by PCR using primers flanking
the region containing the genomic targets for CR1 and CR5 (the forward primer: 5'-gagaggttatgtggctttacca
(SEQ ID NO:457), the reverse primer: 5'-ctgcgtagtgccaaaacaaa (SEQ ID NO:458)), resulting
in a 1447 bp band for the wild-type locus or an expected size of approximately 630
bp for the deleted locus. After 7 days of differentiation, western blot of the treated
cells shows expression of dystrophin protein (see Fig. 14).
Example 5
Targeting CRISPR/Cas9 to Hotspot Mutations in the Human Dystrophin Gene
[0234] To utilize the CRISPR/Cas9 gene editing platform for correcting a wide range of dystrophin
mutations, dozens of sgRNAs targeted to the hotspot mutation region between exons
45-55 were created (Fig. 16). The
S. pyogenes system that utilizes a human-codon optimized SpCas9 nuclease and a chimeric single-guide
RNA (sgRNA) expression vector to guide efficient site-specific gene editing was used.
Similar to Example 4 targeting exon 51 with TALENs, protospacers were selected to
target the 5' and 3' ends of exons 45 through 55 which meet the 5'-NRG-3' PAM requirement
of SpCas9. Small insertions or deletions created by NHEJ-based DNA repair within these
exons can generate targeted frameshift mutations that address various dystrophin mutations
surrounding each exon (Figs. 16A-16B). For example, CR3 was designed to correct dystrophin
mutations or deletions surrounding exon 51 by introducing small insertions or deletions
in the 5' end of exon 51 to restore the downstream dystrophin reading frame (Fig.
16B). Additionally, sgRNAs were designed to employ the multiplex capability of the
CRISPR/Cas9 system and specifically delete individual exons or a series of exons to
restore the dystrophin reading frame, similar to the methods of oligonucleotide-based
exon skipping. For this purpose, sgRNAs were targeted to the intronic regions surrounding
exon 51 (Fig. 16C) or exons 45-55 (Fig. 16D). These sgRNAs were intentionally targeted
to sites nearest to the downstream or upstream exon intended to be included in the
resulting transcript to minimize the likelihood that the background patient deletion
would include the intronic sgRNA target sites.
Example 6
Screening of sgRNAs Targeted to the Dystrophin Gene in Human Cells
[0235] Gene editing frequency in the human HEK293T cell line was assessed to rapidly determine
different sgRNA targeting efficiencies. HEK293Ts were transfected with constructs
encoding human codon-optimized SpCas9 and the indicated sgRNA. Each sgRNA was designed
to modify the dystrophin gene as indicated. The frequency of gene modification at
day 3 or day 10 post-transfection was determined by the Surveyor assay. The ratio
of measured Surveyor signal at day 3 and day 10 was calculated to quantify the stability
of gene editing frequencies for each sgRNA in human cells. As quantified by the Surveyor
assay 3 days post-transfection, 29/32 (~90%) of the sgRNAs tested were able to mediate
highly efficient gene modification at the intended locus (Table 9, Fig. 17). The gene
editing frequencies were stable for almost all of the sgRNAs (<25% signal change from
day 3 to day 10, Table 9, Fig. 18), indicating that gene editing mediated by each
individual sgRNA was well-tolerated. A notable exception is CR33, which had no detectable
activity at day 10, although activity may be below the sensitivity of the Surveyor
assay (est. ~1%).
Table 9 Measured activity of sgRNAs in human cells
| Target |
sgRNA # |
% modified alleles at day 3 |
% modified alleles at dav 10 |
% change dav 10/day 3 |
| Multiplex deletion of exon 51 |
| Int 50 |
CR1 |
6.6 |
9.3 |
41.8 |
| Int 50 |
CR2 |
10.3 |
14.0 |
36.2 |
| Ex 51 |
CR4 |
11.9 |
14.4 |
21.3 |
| Int 51 |
CR5 |
12.4 |
13.3 |
7.8 |
| Multiplex deletion of exons 45-55 |
| Int 44 |
CR6 |
16.1 |
16.9 |
4.3 |
| Int 44 |
CR33 |
1.3 |
<1 |
n.d. |
| Int 44 |
CR34 |
13.2 |
11.0 |
-16.6 |
| Int 55 |
CR7 |
6.8 |
7.1 |
5.3 |
| Int 55 |
CR35 |
22.5 |
20.9 |
-7.1 |
| Int 55 |
CR36 |
26.4 |
24.7 |
-6.4 |
| Targeted frameshifts |
| Ex 45 |
CR10 |
14.9 |
16.3 |
9.3 |
| Ex 45 |
CR11 |
<1 |
<1 |
n.d. |
| Ex 46 |
CR12 |
<1 |
<1 |
n.d. |
| Ex 46 |
CR13 |
16.9 |
18.4 |
9.2 |
| Ex 47 |
CR14 |
17.2 |
17.6 |
2.9 |
| Ex 47 |
CR15 |
15.4 |
15.3 |
-0.9 |
| Ex 48 |
CR16 |
11.5 |
10.9 |
-5.0 |
| Ex 48 |
CR17 |
<1 |
<1 |
n.d. |
| Ex 49 |
CR18 |
1.8 |
2.2 |
20.1 |
| Ex 49 |
CR19 |
33.7 |
38.4 |
13.9 |
| Ex 50 |
CR20 |
14.9 |
13.7 |
-7.6 |
| Ex 50 |
CR21 |
24.1 |
20.8 |
-13.5 |
| Ex 51 |
CR3 |
13.0 |
16.7 |
28.0 |
| Ex 51 |
CR31 |
18.9 |
16.9 |
-10.2 |
| Ex 52 |
CR22 |
25.9 |
20.3 |
-21.6 |
| Ex 52 |
CR23 |
25.2 |
24.0 |
-4.8 |
| Ex 53 |
CR24 |
24.8 |
23.6 |
-4.6 |
| Ex 53 |
CR25 |
2.6 |
2.9 |
9.5 |
| Ex 54 |
CR26 |
24.5 |
22.0 |
-10.1 |
| Ex 54 |
CR27 |
13.4 |
12.6 |
-5.9 |
| Ex 55 |
CR28 |
21.6 |
19.8 |
-8.4 |
| Ex 55 |
CR29 |
19.2 |
19.6 |
2.2 |
Example 7
Enrichment of Gene-Edited Cells Using a Fluorescence-Based Reporter System
[0236] sgRNAs were selected to correct specific mutations in DMD patient myoblast cell lines.
After transfection into DMD myoblasts, unexpectedly low or undetectable gene modification
activity was observed as measured by the Surveyor assay (Fig. 19C, bulk population).
Flow cytometry was used to select for transfected cells co-expressing GFP through
a 2A ribosomal skipping peptide linked to the SpCas9 protein (Fig. 19A). The addition
of this fluorescent reporter to the SpCas9 expression vector did not seem to significantly
impact gene editing activity in HEK293T cells (Fig. 19B). A low percentage of transfected
myoblasts (~0.5-2%) expressed the fluorescent reporter at 3 days after electroporation,
despite high transfection efficiencies of control GFP expression plasmids (typically
>70%, Fig. 19D, pmaxGFP). Given the high levels of CRISPR/Cas9 activity in the easily
transfected HEK293T line, inefficient transgene expression after electroporation of
SpCas9-T2A-GFP and sgRNA constructs into the DMD cells may explain the low observed
gene editing efficiencies in unsorted cells. After sorting the GFP-positive DMD myoblasts,
a substantial increase was observed in detectable activity at most sgRNA target loci
(Fig. 19C). Therefore, all subsequent experiments used cells sorted for SpCas9 expression
by expression of this fluorescent reporter.
Example 8
Restoration of Dystrophin Expression by Targeted Frameshifts
[0237] Small insertions and deletions created by NHEJ DNA repair may be used to create targeted
frameshifts to correct aberrant reading frames. A sgRNA, CR3, was designed to restore
the dystrophin reading frame by introducing small insertions and deletions within
exon 51 (Figs. 16B, 20A). The types of insertions and deletions generated by CRISPR/Cas9
at this locus were assessed by Sanger sequencing of alleles from the genomic DNA of
HEK293T cells co-transfected with expression plasmids for SpCas9 and the CR3 sgRNA
(Fig. 20B). Notably, the insertions and deletions resulted in conversion to all three
reading frames (Figs. 20B, 20C). To demonstrate genetic correction in a relevant patient
cell line, expression plasmids for SpCas9 and the CR3 sgRNA were electroporated into
a DMD myoblast line with a deletion of exons 48-50 that is correctable by creating
frameshifts in exon 51. The treated cells were sorted, verified to have gene modification
activity by the Surveyor assay (CR3, Fig. 19C sorted population), and differentiated
into myotubes to test for restored dystrophin expression. Expression of dystrophin
protein was observed concomitant with the detectable nuclease activity (Fig. 20D).
The S.
pyogenes CRISPR/Cas9 system presents a powerful method to quickly generate targeted frameshifts
to address a variety of patient mutations and restore expression of the human dystrophin
gene.
Example 9
Multiplex CRISPR/Cas9 Gene Editing Mediates Genomic Deletion of Exon 51 and Rescues
Dystrophin Protein Expression
[0238] The multiplexing capability of the CRISPR/Cas9 system presents a novel method to
efficiently generate genomic deletions of specific exons for targeted gene correction.
DMD patient myoblasts with background deletions correctable by exon 51 skipping were
treated with two combinations of sgRNAs flanking exon 51 (CR1/CR5 or CR2/CR5) and
sorted to enrich for gene-edited cells as in Fig. 19. As detected by end-point PCR
of the genomic DNA from these treated cells, the expected genomic deletions were only
present when both sgRNAs were electroporated into the cells with SpCas9 (Fig. 21A).
Sanger sequencing confirmed the expected junction of the distal chromosomal segments
(Fig. 21B) for both deletions. After differentiating the sorted myoblasts, a deletion
of exon 51 from the mRNA transcript was detected only in the cells treated with both
sgRNAs (Fig. 21C). Finally, restored dystrophin protein expression was detected in
the treated cells concomitant with observed genome- and mRNA-level deletions of exon
51 (Fig. 21D).
Example 10
Dystrophin Rescue by a Multi-Exon Large Genomic Deletion
[0239] Although addressing patient-specific mutations is a powerful use of the CRISPR/Cas9
system, it would be advantageous to develop a single method that can address a myriad
of common patient deletions. For example, a promising strategy is to exclude the entire
exon 45-55 region as a method to correct up to 62% of known patient deletions. Multiplex
CRISPR/Cas9-based gene editing was tested to determine if it may be able to generate
efficient deletion of the exon 45-55 locus in human cells. After transfection into
HEK293T cells, the expected deletion of -336,000 bp was detected by PCR of the genomic
DNA (Fig. 22A). Similarly, this deletion was detected by PCR of the genomic DNA from
SpCas9/sgRNA-treated DMD patient cells harboring a background deletion of exons 48-50
of unknown length (Fig. 22A). Sanger sequencing of this deletion band from the genomic
DNA of treated DMD cells revealed the expected junctions of intron 44 and intron 55
immediately adjacent to the sgRNA target sites (Fig. 22B). After differentiation of
treated DMD cells, the expected deletion of exons 45-55 was detected in the dystrophin
mRNA transcript and verified to be a fusion of exons 44 and 56 by Sanger sequencing
(Fig. 22C). Restored protein expression was observed by western blot in the sorted
cell populations containing the CRISPR/Cas9-induced deletion of exons 45-55 from the
genome and resulting mRNA transcripts (Fig. 22D). These data demonstrate that multiplex
CRISPR/Cas9 editing presents a single universal method to restore the dystrophin reading
frame in more than 60% of DMD patient mutations.
Example 11
Transplantation of Corrected Myoblasts into Immunodeficient Mice
[0240] A promising method for DMD therapy is to correct a population of autologous patient
muscle progenitor cells that can be engrafted into the patient's skeletal muscle tissue
to rescue dystrophin expression. To demonstrate the ability of the corrected cells
to express human dystrophin in vivo, a population of DMD myoblasts that were treated
with sgRNAs CR1 and CR5, which flank exon 51, was transplanted and sorted for expression
of GFP as before (Fig. 19, Fig. 23). After 4 weeks, muscle fibers positive for human
spectrin, which is expressed by both corrected and uncorrected cells, were detected
in cryosections of injected muscle tissue (Fig. 24). A number of these fibers were
also positive for human dystrophin with expression localized to the sarcolemma, demonstrating
functional gene correction in these cells (Fig. 24, Fig. 25). No fibers positive for
human dystrophin were observed in sections from mice injected with the untreated DMD
myoblasts (Fig. 24, Fig. 25), indicating that the CRISPR/Cas9-modified cells were
the source of human dystrophin expression.
Example 12
Off-target and Cytotoxicity Analysis
[0241] The relative cytotoxicity of the CRISPR/Cas9 system was assessed in human cells for
select sgRNAs by adapting a flow cytometry-based GFP retention assay as previously
described (
Ousterout et al., Mol Ther 21:1718-1726 (2013)). Minimal cytotoxicity was observed for SpCas9 co-expressed with or without sgRNAs
after transfection into human cells (Fig. 26A). Publicly available tools are available
to assess and prioritize potential CRISPR/Cas9 activity at off-target loci based on
predicted positional bias of a given mismatch in the sgRNA protospacer sequence and
the total number of mismatches to the intended target site (
Hsu et al., Nat Biotechnol 31:827-826 (2013)). This public webserver was used to predict the most likely off-target sites for
the sgRNAs used to correct the dystrophin gene in this study (Table 4). The top ten
potential off-target sites were assessed by the Surveyor assay in HEK293T cells treated
with SpCas9 and individual sgRNA expression cassettes for CR1, CR3, CR5, CR6, or CR36.
CR1, CR3 and CR36 each had one of these ten predicted off-target loci demonstrate
significant levels of gene modification (Table 4 and Fig. 27). Interestingly, the
CR3 off-target sequence had substantial homology and similar modification frequencies
to the intended on-target (9.3% at OT-1 vs. 13.3% at intended site (Table 4 and Fig.
27). Notably, CR3-OT1 was the only one of these three off-target sites to show significant
levels of activity in the sorted hDMD cells by the Surveyor assay (Fig. 26B).
[0242] Nuclease activity at off-target sites may cause unintended chromosomal rearrangements
by distal re-ligation between cleaved target and off-target loci on distinct chromosomes.
This presents a significant concern for deletion-based gene correction strategies
due to the increased potential for off-target activity by using two or more nucleases,
such as in multiplex CRISPR/Cas9 gene editing. Potential translocations were probed
for using a highly sensitive nested genomic PCR assay to detect translocations at
the validated off-target loci (Table 4) during both single and multiplex CRISPR/Cas9
editing strategies. Using this assay, translocations were readily detected between
on-target and off-target sites in the model HEK293T cell line that also shows high
levels of off-target activity (Fig. 26C and Fig. 28A, 28B). Sanger sequencing of the
PCR amplicons confirmed the identity of the predicted translocation event for each
primer pair (Figs. 29-30). A subset of the translocations detected in the HEK293T
cells were also detectable by nested PCR in the sorted hDMD myoblasts, although the
signal was considerably weaker and the sequence identity was not confirmed due to
low yield of product (Fig. 26D and Figs. 28A, 28C). Translocations were not detected
using this assay in HEK293T or sorted hDMD cells treated with CR6 or CR6/CR36, respectively,
(Fig. 28) that had low levels of off-target activity at CR6-OT3 only in HEK293T cells
(Table 4). These results underscore the importance of selecting highly specific sgRNAs,
particularly for multiplex editing applications, and show that this approach can benefit
from ongoing efforts to improve the specificity of the CRISPR/Cas9 system. These data
suggest that the selected sgRNAs are able to correct the dystrophin gene without significant
toxicity and with only a single strongly predicted off-target site with detectable
levels of activity.
Example 13
Discussion
[0243] Genome editing is a powerful tool for correcting genetic disease and the recent development
of the CRISPR/Cas9 system is dramatically accelerating progress in this area. The
correction of DMD, the most common genetic disease that also currently has no approved
therapeutic options, was demonstrated. Many gene- and cell-based therapies for DMD
are in preclinical development and clinical trials, and genome editing methods are
compatible with many of these approaches. For example, genome editing may be combined
with patient-specific cell-based therapies for DMD. The CRISPR/Cas9 system may function
in human pluripotent stem cells and other human cell lines, as well as human skeletal
myoblasts, as shown. Importantly, gene editing with CRISPR/Cas9 did not abolish the
myogenic capacity of these cells, as demonstrated by efficient dystrophin expression
in vitro and in vivo after transplantation into immunodeficient mice. Thus, this strategy
should be compatible with cell-based therapies for DMD.
[0244] Additionally, an enriched pool of gene-corrected cells demonstrated expression of
human dystrophin in vivo following engraftment into immunodeficient mice. CRISPR/Cas9
gene editing did not have significant toxic effects in human myoblasts as observed
by stable gene editing frequencies and minimal cytotoxicity of several sgRNAs. However,
gene editing activity was confirmed at three out of 50 predicted off-target sites
across five sgRNAs and CRISPR/Cas9-induced chromosomal translocations between on-target
and off-target sites were detectable. The CRISPR/Cas9 technology is an efficient and
versatile method for correcting a significant fraction of dystrophin mutations and
can serve as a general platform for treating genetic disease.
[0245] Additionally, direct transfection of the sgRNA and Cas9 mRNA, in contrast to the
plasmid-based delivery method used here, may be used to increase specificity and safety
by reducing the duration of Cas9 expression and eliminating the possibility of random
plasmid integration. Alternatively, delivery of the CRISPR/Cas9 system directly to
skeletal and/or cardiac muscle by viral, plasmid, or RNA delivery vectors may be used
for in vivo genome editing and translation of this approach. The large size of S.
pyogenes Cas9 gene (~4.2 kilobases) presents a challenge to its use in size-restricted
adeno-associated viral vectors. However, Cas9 genes from other species, such as N.
meningitidis and S. thermophilus, are short enough to efficiently package both Cas9
and sgRNA expression cassettes into single AAV vectors for in vivo gene editing applications.
[0246] The CRISPR/Cas9 system enabled efficient modification of nearly 90% of tested targets,
consistent with other reports of robust activity of this system at diverse loci. The
robustness and versatility of this technology is a significant advancement towards
at-will creation of patient-specific gene editing. Low levels of dystrophin, including
as little as 4% of wild-type expression, may be sufficient to improve survival, motor
function, and cardiac function in a mouse model. The levels of CRISPR/Cas9 activity
may be sufficient for therapeutic benefit.
[0247] The use of multiplexing with CRISPR/Cas9 to delete exons also presents a unique set
of opportunities and challenges. The deletion of complete exons from the genome to
restore dystrophin expression was performed, in contrast to restoring the reading
frame of the dystrophin gene with small indels generated by NHEJ-based DNA repair
following the action of a single nuclease. The protein product of the edited gene
is predictable and already characterized in Becker muscular dystrophy patients with
the naturally occurring deletion, in contrast to the random indels created by intraexonic
action of a single nuclease that will lead to the creation of novel epitopes from
each DNA repair event. Furthermore, the product resulting from the exon deletions
will lead to restored dystrophin for every successful gene editing event, whereas
modifying the gene with random indels within exons will only restore the reading frame
in the one-third of editing events that leads to the correct reading frame.
[0248] All of the sgRNAs tested were not associated with significant cytotoxic effects in
human cells. Three potential off-target sites out of 50 total tested sites for the
five sgRNAs used were identified to restore dystrophin expression. Furthermore, chromosomal
translocations between the intended on-target sites and these off-target sites were
detectable by highly sensitive nested PCR assays in HEK293T cells expressing high
levels of Cas9 and sgRNAs. Notably, the off-target activity and translocations identified
in HEK293T cells, which is an immortalized and aneuploid cell line that expresses
very high levels of Cas9 and sgRNA, did not occur at as high a level and in some cases
were undetectable in the hDMD myoblasts. Importantly, this level of specificity may
be tolerable given the severity of DMD, the lack of an apparent cytotoxic effect in
human cells
Example 14
[0250] To verify that adult post-mitotic skeletal muscle were efficiently targeted by the
Rosa26 ZFN following AAV transfer, AAV-SASTG vectors encoding the Rosa26 ZFN were
injected directly into the tibialis anterior (TA) muscle of 6 week old C57BL6/J mice
at titers of le10 vector genomes (vg) or 2.5el0 vg per muscle. Mice were sacrificed
4 weeks after injection and the TA muscles were harvested and partitioned into several
fragments for genomic DNA extraction and analysis (Fig. 31). Genomic DNA was PCR amplified
and subjected to the Surveyor assay to detect NHEJ mutations characteristic of ZFN
mutagenesis at the Rosa26 target site (Fig. 32). Fig. 32 shows Surveyor analysis of
Rosa26 ZFN activities in skeletal muscle in vitro and in vivo following delivery of
AAV-SASTG-ROSA. Proliferating C2C 12s were transduced with the indicated amount of
virus and harvested at 4 days post-infection (Fig. 32(a)). C2C 12s were incubated
in differentiation medium for 5 days and then transduced with the indicated amount
of AAV-SASTG-ROSA virus in 24 well plates (Fig. 32(b)). Samples were collected at
10 days post-transduction. The indicated amount of AAV-SASTG-ROSA was injected directly
into the tibialis anterior of C57BL/6J mice and muscles were harvested 4 weeks post-infection.
The harvested TA muscles were partitioned into 8 separate pieces for genomic DNA analysis,
each shown in a separate lane (Fig. 32(c)). Notably, high levels of gene modification
were detected in all fragments at the highest dose (2.5cl0 vg).
Example 15
AAV-CRISPR Constructs for Targeting Mutant Dystrophin Genes
[0251] AAV constructs are designed to therapeutically correct mutations of the dystrophin
gene that cause Duchenne muscular dystrophy and skeletal and cardiac muscle degeneration.
CRISPR/Cas9 systems can be delivered using the AAV to restore the dystrophin reading
frame by deleting exon 51, deleting exons 45-55, disrupting splice donor or acceptor
sites, or creating frameshifts within exon 51 (
Ousterout et al., Molecular Therapy 2013) to restore the dystrophin reading frame and protein expression. The CRISPR/Cas9
system will include a Cas9 having a sequence of SEQ ID NO: 64 or 114 (See Figs. 40
and 41). gRNAs that could be combined with these Cas9s, targeting their respective
PAM sequences, are provided (see Figs. 40 and 41; see also Tables 2 and 3).
Example 16
Generation of Induced Neurons (iNs)
[0252] The generation of induced neurons (iNs) from other cell lineages has potential applications
in regenerative medicine and the study of neurological diseases. The direct conversion
of mouse embryonic fibroblasts (MEFs) to functional neuronal cells may occur through
the delivery of a cocktail of three neuronal transcription factors -
BRN2,
ASCL1, and
MYT1L (BAM factors, Fig. 48). Other methods may include additional factors to induce various
neuronal subtypes. These experiments require transcription factors to be delivered
ectopically, and the activation of the corresponding endogenous loci to sustain the
neuronal phenotype. The CRISPR/Cas9 system was engineered as a versatile transcription
factor to activate endogenous genes in mammalian cells with the capacity to target
any promoter in the genome through an RNA-guided mechanism (Figs. 49A,49B).
[0253] Materials & Methods. The CRISPR/Cas9-transcription factor was used to activate the endogenous genes encoding
ASCL1 and
BRN2 to directly reprogram MEFs to functional induced neurons.
[0254] Cell Culture: MEFs were seeded in either 24-well TCPS plates or on poly-D-lysine/laminin-coated
coverslips. Following transduction of dCas9-VP64 and transfection of the gRNAs (see
Tables 10 and 11 for sequences of gRNAs), the cells were cultured in MEF medium (
Adler et al. Mol Ther Nucleic Acids 1 :e32 (2012)) for 24 hrs and then transferred to N3 neural induction medium (
Vierbuchen et al. Nature 463:1035-1041 (2010)) for the duration of the experiment (Fig. 49B).
Table 10 gRNAs for mouse ASCL1 (CR13):
| Oligo (5' to 3') |
5' overhang |
|
ASCL1 Target Sequence |
|
SEQ ID NO |
| CR13-1 S: |
cacc |
G |
CAGCCGCTCGCTGCAGCAG (SEQ ID NO: 468 ) |
|
492 |
| CR13-1 AS: |
AAAC |
|
CTGCTGCAGCGAGCGGCTG (SEQ ID NO: 469) |
C |
493 |
| CR13-2 S: |
cacc |
G |
GCTGGGTGTCCCATTGAAA (SEQ ID NO: 470) |
|
494 |
| CR13-2 AS: |
AAAC |
|
TTTCAATGGGACACCCAGC (SEQ ID NO: 471) |
C |
495 |
| CR13-3 S: |
cacc |
G |
GTTTATTCAGCCGGGAGTC (SEQ ID NO: 472) |
|
496 |
| CR13-3 AS: |
AAAC |
|
GACTCCCGGCTGAATAAAC (SEQ ID NO: 473) |
C |
497 |
| CR13-4 S: |
cacc |
G |
TGGAGAGTTTGCAAGGAGC (SEQ ID NO: 474) |
|
498 |
| CR13-4 AS: |
AAAC |
|
GCTCCTTGCAAACTCTCCA (SEQ ID NO: 475) |
C |
499 |
| CR13-5 S: |
cacc |
G |
CCCTCCAGACTTTCCACCT (SEQ ID NO: 476) |
|
500 |
| CR13-5 AS: |
AAAC |
|
AGGTGGAAAGTCTGGAGGG (SEQ ID NO: 477) |
C |
501 |
| CR13-6 S: |
cacc |
G |
AATTTTCTTCCAAGTTCTC (SEQ ID NO: 478) |
|
502 |
| CR13-6 AS: |
AAAC |
|
GAGAACTTGGAAGAAAATT (SEQ ID NO: 479) |
C |
503 |
| CR13-7 S: |
cacc |
G |
CTGCGGAGAGAAGAAAGGG (SEQ ID NO: 480) |
|
504 |
| CR13-7 AS: |
AAAC |
|
CCCTTTCTTCTCTCCGCAG (SEQ ID NO: 481) |
C |
505 |
| CR13-8 S: |
cacc |
G |
AGAGCCACCCCCTGGCTCC (SEQ ID NO: 482) |
|
506 |
| CR13-8 AS: |
AAAC |
|
GGAGCCAGGGGGTGGCTCT (SEQ ID NO: 483) |
C |
507 |
| CR13-9 S: |
cacc |
G |
cgaagccaaccgcggcggg (SEQ ID NO: 484) |
|
508 |
| CR13-9 AS: |
AAAC |
|
cccgccgcggttggcttcg (SEQ ID NO: 485) |
C |
509 |
| CR13-10 S: |
cacc |
G |
agagggaagacgatcgccc (SEQ ID NO: 486) |
|
510 |
| CR13-10 AS: |
AAAC |
|
gggcgatcgtcttccctct (SEQ ID NO: 487) |
C |
511 |
| CR13-11 S: |
cacc |
G |
cccctttaactttcctccg (SEQ ID NO: 488) |
|
512 |
| CR13-11 AS: |
AAAC |
|
cggaggaaagttaaagggg (SEQ ID NO: 489) |
C |
513 |
| CR13-12 S: |
cacc |
G |
gcagccccgcttccttcaa (SEQ ID NO: 490) |
|
514 |
| CR13-12 AS: |
AAAC |
|
ttgaaggaagcggggctgc (SEQ ID NO: 491) |
C |
515 |
Table 11 gRNAs for mouse BRN2 (CR16):
| Oligo (5' to 3') |
5' overhang |
|
BRN2 Target Sequence |
|
SEQ ID NO |
| CR16-1 S: |
cacc |
G |
CGAGAGCGAGAGGAGGGAG (SEQ ID NO: 516 ) |
|
540 |
| CR16-1 AS: |
AAAC |
|
CTCCCTCCTCTCGCTCTCG (SEQ ID NO: 517) |
C |
541 |
| CR16-2 S: |
cacc |
G |
GAGAGAGCTTGAGAGCGCG (SEQ ID NO: 518) |
|
542 |
| CR16-2 AS: |
AAAC |
|
CGCGCTCTCAAGCTCTCTC (SEQ ID NO: 519) |
C |
543 |
| CR16-3 S: |
cacc |
G |
GGTGGAGGGGGCGGGGCCC (SEQ ID NO: 520) |
|
544 |
| CR16-3 AS: |
AAAC |
|
GGGCCCCGCCCCCTCCACC (SEQ ID NO: 521) |
C |
545 |
| CR16-4 S: |
cacc |
G |
GGTATCCACGTAAATCAAA (SEQ ID NO: 522) |
|
546 |
| CR16-4 AS: |
AAAC |
|
TTTGATTTACGTGGATACC (SEQ ID NO: 523) |
C |
547 |
| CR16-5 S: |
cacc |
G |
CCAATCACTGGCTCCGGTC (SEQ ID NO: 524) |
|
548 |
| CR16-5 AS: |
AAAC |
|
GACCGGAGCCAGTGATTGG (SEQ ID NO: 525) |
C |
549 |
| CR16-6 S: |
cacc |
G |
GGCGCCCGAGGGAAGAAGA (SEQ ID NO: 526) |
|
550 |
| CR16-6 AS: |
AAAC |
|
TCTTCTTCCCTCGGGCGCC (SEQ ID NO: 527) |
C |
551 |
| CR16-7 S: |
cacc |
G |
GGGTGGGGGTACCAGAGGA (SEQ ID NO: 528) |
|
552 |
| CR16-7 AS: |
AAAC |
|
TCCTCTGGTACCCCCACCC (SEQ ID NO: 529) |
C |
553 |
| CR16-8 S: |
cacc |
G |
CCGGGGACAGAAGAGAGGG (SEQ ID NO: 530) |
|
554 |
| CR16-8 AS: |
AAAC |
|
CCCTCTCTTCTGTCCCCGG (SEQ ID NO: 531) |
C |
555 |
| CR16-9 S: |
cacc |
G |
gagagagagtgggagaagc (SEQ ID NO: 532) |
|
556 |
| CR16-9 AS: |
AAAC |
|
gcttctcccactctctctc (SEQ ID NO: 533) |
C |
557 |
| CR16-10 S: |
cacc |
G |
aaagtaactgtcaaatgcg (SEQ ID NO: 534) |
|
558 |
| CR16-10 AS: |
AAAC |
|
cgcatttgacagttacttt (SEQ ID NO: 535) |
C |
559 |
| CR16-11 S: |
cacc |
G |
ttaaccagagcgcccagtc (SEQ ID NO: 536) |
|
560 |
| CR16-11 AS: |
AAAC |
|
gactgggcgctctggttaa (SEQ ID NO: 537) |
C |
561 |
| CR16-12 S: |
cacc |
G |
cgtcggagctgcccgctag (SEQ ID NO: 538) |
|
562 |
| CR16-12 AS: |
AAAC |
|
ctagcgggcagctccgacg (SEQ ID NO: 539) |
C |
563 |
[0255] qRT-PCR & IF: Activation of endogenous
ASCL1 was assessed by qRT-PCR and immunofluorescence in MEFs on day 3 following delivery
of either dCas9-VP64 and gRNAs,
ASCL1 cDNA, or a negative control vector encoding luciferase. The generation of iNs was
evaluated by
TUJ1 and
MAP2 co-staining and identification of cells with neuronal morphology and extended processes.
[0256] Live Cell Reporters: After 7-8 days in N3 medium, MEFs cultured on poly-D-lysine/laminin-coated coverslips
were transduced with viruses carrying hSyn-RFP and MAP2-GCamP5 reporters to identify
the most mature iNs for functional characterization via calcium imaging and electrophysiology
(Fig. 49B).
[0257] Results. dCas9-VP64 and gRNAs targeted to the
ASCL1 promoter activated the endogenous gene in MEFs. Co-delivery of 8 gRNAs activated
the endogenous gene 400-fold, a significant increase (p<0.05) over the 100-fold activation
induced by the co-delivery of 4 gRNAs (Fig 50A). Nuclear-localized
Ascl1 protein was detected by immunofluorescence in MEFs. Ectopic
Ascl1 expression produced more
Ascl1 protein than dCas9-VP64 with either gRNA cocktail, but did not activate the endogenous
locus by day 3 (Fig. 50A,50B).
TUJ1 and
MAP2 co-positive cells with extended processes were identified by immunofluorescence after
13 days in neurogenic medium following delivery of dCas9-VP64 and gRNAs targeting
the
ASCL1 and
BRN2 promoters (Fig. 4A first row). A similar number of
TUJ1 and
MAP2 co-positive cells were identified with ectopic expression of the BAM factors (Fig.
51A second row). Cells with a neuronal morphology expressing the hSyn-RFP reporter
were visible in culture as early as day 11 in neurogenic medium (Fig. 51B). A cell
expressing the MAP2-GCaMP5 calcium indicator exhibited KCl-induced depolarization
detected with a fluorescent microscope (Fig. 52A,52B).
[0258] The direct conversion of mouse embryonic fibroblasts to
TUJ1 and
MAP2 co-positive cells with a neuronal morphology was accomplished through activation
of endogenous BRN2 and
ASCL1 by CRISPR/Cas9-based transcription factors. Though dCas9-VP64 produces less protein
than ectopic expression of
ASCL1 (Fig. 50B), the generation of neuronal-like cells is similar. The activation of the
endogenous loci may induce a reprogramming cascade of events that is not mechanistically
identical to that generated with ectopic expression.
[0259] dCas9-VP64 was able to penetrate heterochromatin and activated stably silenced endogenous
genes, a characteristic of only a subset of "pioneer" transcription factors. As a
result, converting cell lineage with CRISPR/Cas9-transcription factors may better
overcome epigenetic barriers to reprogramming than ectopic expression of transcription
factors, particularly in hard-to-reprogram cell-types, such as adult human cells.
This may have clinical importance in the field of regenerative medicine, as it is
often desired to use autologous sources in cell replacement therapies.
Example 17
Multiplex CRISPR/Cas9-Based Genome Engineering - Materials and Methods
[0260] Plasmid constructs. The expression cassettes for the
S. pyogenes sgRNA and human codon optimized Cas9 (hCas9) nuclease were used, as described above.
Additional promoters for mU6 (
Ohshima et al., Nucleic Acids Res 9:5145-5158 (1981)), H1 (
Myslinski et al., Nucleic Acids Res 29:2502-2509 (2001)), and 7SK (
Murphy et al., Cell 51:81-87 (1987)) pol-III promoters were synthesized using GeneBlocks (IDT) and cloned in place of
the hU6 sgRNA expression cassette. A GeneBlock (IDT) was cloned onto the 3' end of
the Cas9 coding sequence to fuse a T2A skipping peptide and eGFP gene immediately
after Cas9 to monitor vector expression. The coding region for hCas9-T2A-GFP (SEQ
ID NO: 145) was then transferred into a lentiviral expression vector containing the
human ubiquitin C (hUbC) promoter to drive expression of hCas9-T2A-GFP, as well as
restriction sites to facilitate Golden Gate cloning of sgRNA expression cassettes
immediately upstream of the hUbC promoter (Fig. 42A).
[0261] Protocol for assembly of custom lentiviral vectors. Assembly of custom lentiviral vectors expressing up to four sgRNAs of choice and
active Cas9, dCas9, or dCas9-VP64 was accomplished in less than five days. The cloning
method used the Golden Gate cloning and type IIS restriction enzymes that cleave outside
their recognition sequence to create unique overhangs. Golden Gate assembly expedited
cloning as all four expression cassettes were ligated into the final lentiviral vector
in one step. The lentiviral vector expressed active Cas9, cCas9, or dCas9-VP64 in
addition to one, two, three, or four sgRNAs expressed from independent promoters.
[0262] Step 1: Single stranded oligos containing each 20 bp protospacer were annealed in
such a fashion to create sticky ends and were ligated into the desired pZDonor-promoter
vector. Order two single stranded oligos for each desired genomic target. To anneal
the complimentary oligos, mix 8 µL sense oligo + 8 µL antisense oligo (both at 10mM)
+ 2 µL. 10X ligase buffer. The oligos are melted and reannealed in a PCR machine with
the program: 96°C for 300 seconds, followed by 85°C for 20 seconds, 75°C for 20 seconds,
65°C for 20 seconds, 55°C for 20 seconds, 45°C for 20 seconds, 35°C for 20 seconds,
and 25°C for 20 seconds with a -0.3°C /second rate between steps. To phosphorylate
the sticky ends, add 1 µL 25mm ATP + 1 microliter T4 Polynucleotide Kinase (NEB) and
incubate at 37°C for 60 minutes followed by 65°C for 20 minutes to heat inactivate
the enzyme. Each protospacer was ligated into the desired expression vector using
T4 DNA ligase (NEB) incubated at 16°C for 60 minutes using 50ng of vector and 1 µL
of annealed oligonucleotides in a 10 µL reaction volume according to manufacturer's
instructions. Five microliters of each ligation was transformed into XL1 blue chemically
competent bacteria (Agilent) following the manufacturer's instructions. Plate transformation
onto LB agar plates containing 50 µg/mL kanamycin (Sigma) and incubate overnight at
37°C. In our experience, >90% of the colonies will contain the desired ligation product.
Sequencing using the M13 reverse standard sequencing primer was performed to validate
each final sgRNA construct prior to moving onto step 2.
[0263] Step 2: Construct the four promoter-gRNA cassettes into a lentiviral destination vector
using Golden Gate assembly. After completion of step 1, there are four independent plasmids each expressing a
different sgRNA from a different promoter. To assemble the four different promoter-sgRNA
constructs into the desired destination vector, combine 200 ng of each sgRNA expression
plasmid and desired lentiviral destination vector with 1 µL of T4 DNA ligase (NEB),
1 µL BsmBI FastDigest (Fisher Scientific), and 2 µL 10X T4 ligase buffer (NEB) in
a 20 µL reaction volume. Incubate the reaction as follows: 37°C for 10 minutes, 16°C
for 15 minutes, 37°C for 30 minutes, 80°C for 5 minutes. Transform 5 µL of ligation
reaction into SURE 2 chemically competent cells (Agilent) following the manufacturer's
instructions. Plate transformations onto LB agar plates containing 100 µg/mL ampicillin
and incubate overnight at 37°C. Optionally, colonies can be screened by lacZ-based
blue/white screening using IPTG and X-gal; however, in our experience, >90% of the
transformants contain the proper ligation product. Due to the inverted repeats formed
by the opposing sgRNA expression cassettes, the final constructs may be unstable and
thus we recommend maintaining these plasmids in the SURE 2 cell line and screening
the final plasmid with a test PCR using the sense primer 5'-TCGGGTTTATTACAGGGACAGCAG-3'
(SEQ ID NO:464) and antisense primer 5'-TCTAAGGCCGAGTCTTATGAGCAG-3' (SEQ ID NO:465).
These primers amplify across the four promoter-gRNA region. Due to the repetitive
nature, a distinct banding pattern should be observed with the largest product approximately
1800 bp in size.
[0264] Cell culture and transfection. HEK293T cells were obtained from the American Tissue Collection Center (ATCC, Manassas,
VA) through the Duke University Cancer Center Facilities and were maintained in DMEM
supplemented with 10% FBS and 1% penicillin streptomycin. Primary human dermal fibroblasts
(Catalog ID: GM03348) were obtained from Coriell Institute (Camden, New Jersey) and
were maintained in DMEM supplemented with 10% FBS and 1% penicillin streptomycin.
All cells were cultured at 37 °C with 5% CO
2. HEK293T cells were transfected with Lipofectamine 2000 (Life Technologies) with
200 ng of each sgRNA expression vector (800 ng total pDNA) according to the manufacturer's
protocol in 24 well plates.
[0265] Viral production and transduction. All lentiviral vectors used is this study are second generation and were produced
using standard viral production methods. Briefly, 3.5 million HEK293Ts were plated
per 10 cm dish. The following day, cells were transfected by the calcium phosphate
transfection method with 20 µg of transfer vector, 6 µg of pMD2G, and 10 µg psPAX2.
The media was changed 12-14 hrs post transfection. The viral supernatant was collected
24 and 48 hrs after this media change, passed through a 0.45 micron filter and pooled.
For transduction, the cell medium was replaced with viral supernatant supplemented
with 4 µg/mL polybrene. The viral supernatant was exchanged for fresh medium 12-24
hrs later.
[0266] Reverse Transcription PCR. RNA was isolated using the miRNeasy Mini RNA isolation kit (Qiagen). DNAse digestion
was performed using the DNA-free Kit (Applied Biosystcms). cDNA synthesis was performed
using the SuperScript VILO cDNA Synthesis Kit (Invitrogen). cDNA was PCR amplified
using Taq DNA polymerase (NEB) and the resulting product was run on TAE agarose gels..
Images were captured using a ChemiDoc XRS+ System and processed using ImageLab software
(Bio-Rad).
[0267] Quantitative Real Time PCR. RNA was isolated using the RNeasy Plus RNA isolation kit (Qiagen). cDNA synthesis
was performed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen). Real-time
PCR using PerfeCTa SYBR Green FastMix (Quanta Biosciences) was performed with the
CFX96 Real-Time PCR Detection System (Bio-Rad). Primer specificity was confirmed by
agarose gel electrophoresis and melting curve analysis. Reaction efficiencies over
the appropriate dynamic range were calculated to ensure linearity of the standard
curve. The results are expressed as fold-increase mRNA expression of the gene of interest
normalized to
β-Actin expression using the ΔΔCt method. Reported values are the mean and S.E.M. from two
independent experiments (n = 2) where technical replicates were averaged for each
experiment.
[0268] Western Blot. Cells were lysed in RIPA Buffer (Sigma) supplemented with protease inhibitor cocktail
(Sigma). Protein concentration was measured using BCA protein assay reagent (Thermo
Scientific) and BioTek Synergy 2 Multi-Mode Microplate Reader. Lysates were mixed
with loading buffer and boiled for 5 min; 25µg of protein were run in NuPage 10% Bis-Tris
Gel polyacrylamide gels (Bio-Rad) and transferred to nitrocellulose membranes. Nonspecific
antibody binding was blocked with TBST (50mM Tris, 150mM NaCl and 0.1% Tween-20) with
5% nonfat milk for 1 hr at room temperature. The membranes were incubated with primary
antibodies: (anti-MyoD (1:250, Santa Cruz Sc-32758) in 5% BSA in TBST overnight at
4°C; anti-Myogenin (1:250, Santa Cruz Sc-12732) in 5% BSA overnight at 4°C; anti-FLAG-HRP
(1:1000, Cell Signaling 2044) in 5% milk in TBST for 60 min at room temperature; anti-GAPDH
(1:5000, Cell Signaling, clone 14C10) in 5% milk in TBST for 30 min at room temperature.
Membranes were then washed three times with TBST for 15 minutes total. Membranes were
incubated with anti-rabbit HRP-conjugated antibody (Sigma, A 6154) or anti-mouse HRP-conjugated
antibody (Santa Cruz, SC-2005) diluted 1:5,000 for 30 min and washed with TBST three
times for 15 min each. Membranes were visualized using the ImmunStar WesternC Chemiluminescence
Kit (Bio-Rad) and images were captured using a ChemiDoc XRS+ System and processed
using ImageLab software (Bio-Rad).
[0269] Cel-I quantification of endogenous gene modification . CRISPR/Cas9 nuclease lesions at the endogenous target site were quantified using
the Surveyor nuclease assay, which can detect mutations characteristic of nuclease-mediated
NHEJ. After transfection or transduction, cells were incubated for 3-10 days at 37°C
and genomic DNA was extracted using the ON easy Blood and Tissue kit (Qiagen). The
target locus was amplified by 35 cycles of PCR with the AccuPrime High Fidelity PCR
kit (Invitrogen). The resulting PCR products were randomly melted and reannealed in
a PCR machine with the program: 95°C for 240 seconds, followed by 85°C for 60 seconds,
75°C for 60 seconds, 65°C for 60 seconds, 55°C for 60 seconds, 45°C for 60 seconds,
35°C for 60 seconds, and 25°C for 60 seconds with a -0.3°C /second rate between steps.
Following re-annealing, 8 µL of PCR product was mixed with 1 µL of Surveyor Nuclease
S and 1 µL of Enhancer S (Transgenomic, Omaha, NE) and incubated at 42°C.' for 1 hr.
After incubation, 6 µL of digestion product was loaded onto a 10% TBE polyacrylamide
gel and run at 200 V for 30 minutes. The gels were stained with ethidium bromide and
quantified using ImageLab (Bio-Rad) by densitometry (
Perez-Pinera et al., Nucleic Acids Res 40:3741-3751 (2012)).
[0270] Statistical Analysis. At least two independent experiments were compiled as means and standard errors of
the mean. Effects were evaluated with multivariate ANOVA and Dunnett's post hoc test
using JMP 10 Pro.
Example 18
Development of a single lentiviral vector for multiplex CRISPR/Cas9 applications
[0271] A limitation of current CRISPR/Cas9 gene editing systems, particularly transactivator
systems, is the simultaneous and efficient delivery of multiple sgRNAs and Cas9 protein
for multiplex gene editing and synergistic gene activation applications, especially
in difficult to transfect cell types. To overcome this limitation, we developed a
single lentiviral vector that efficiently expresses Cas9 and up to four sgRNAs. In
order to maximize the expression efficiency of each sgRNA, this vector expresses four
sgRNAs from four independent pol III promoters (human U6 promoter, mouse U6 promoter,
7SK, and H1). We validated sgRNA expression from each promoter using end-point RT-PCR
to detect a sgRNA targeting the AAVS1 locus (Fig. 42A). To test the activity of each
sgRNA expression construct, we co-transfected each promoter construct expressing an
sgRNA targeting AAVS1 independently with an active Cas9 expression construct into
human HEK293T cells. Notably, we detected consistent and high levels of gene modification
at the target locus for each sgRNA that are comparable to a well-characterized zinc-finger
nuclease with high activity at the AAVS1 locus (Fig. 42B). Furthermore, lentiviral
delivery of different Cas9-based constructs, including an active Cas9 nuclease, dead
Cas9, and dead Cas9 fused to the VP64 transactivator domain, resulted in expression
of full-length Cas9 protein in HEK293T cells as determined by western blot (Fig. 42C).
[0272] Using these components, we developed a Golden Gate cloning method to facilitate rapid
and efficient cloning of multiple sgRNA expression cassettes into a single lentiviral
vector expressing the desired Cas9 effector (Fig. 43). In the first step, oligonucleotides
encoding sgRNA protospacer sequences are cloned independently into different expression
vectors, each with a distinct promoter driving sgRNA expression. In the second step,
each sgRNA expression construct is subcloned into a lentiviral Cas9 expression vector
of choice by Golden Gate assembly. This strategy allows for robust and rapid cloning
of up to four sgRNAs into a single lentiviral vector for gene editing or activation
applications. To express less than four sgRNAs, a PolyT terminator sequence is cloned
down-stream of unused promoters to prevent transcription from the unused promoters.
Each vector co-expresses the choice Cas9 with eGFP via a 2A skipping peptide to enable
fluorescence-activated flow sorting and enrichment of cells with a high multiplicity
of infection. Finally, the entire region containing the sgRNA and Cas9 expression
cassettes is flanked by loxP sites to mediate removal by Cre-lox excision.
Example 19
Validation of a single lentiviral sgRNA/Cas9 expression vector for multiplex genome
engineering
[0273] To validate the independent activity of each sgRNA, we assembled a single lentiviral
vector expressing active Cas9 and four sgRNAs, each targeting an independent loci
(Fig. 44A). As control vectors, we assembled constructs expressing only one sgRNA
along with polyT protospacers in the other three positions. We transduced HEK293Ts
and primary fibroblasts with lentiviral vectors expressing the indicated sgRNAs and
monitored gene modification frequencies at 7 or 10 days post-transduction, respectively
(Fig. 44B). In both cell types, the single lentiviral vector mediated highly efficient
multiplex editing at all four loci (Fig. 44B). Interestingly, expression of all four
sgRNAs together resulted in higher modification frequencies than a single sgRNA alone
at 3 out of 4 loci in fibroblasts (Fig. 44B). We observed efficient multiplex gene
editing in fibroblasts, which are conventionally a difficult to transfect cell type.
These data demonstrate that a single lentivirus can express four active sgRNAs efficiently
and that this lentiviral platform can be used to target four distinct loci for multiplex
CRISPR/Cas9 gene editing.
Example 20
Transient RNA-guided gene activation in cell lines stably expressing a lentiviral
Cas9-based transactivator
[0274] Next, we were interested in developing a system that enables transient gene activation
by transfecting sgRNAs into model cell lines stably expressing Cas9. HEK293Ts were
transduced with different Cas9-T2A-GFP and GFP expression was monitored using flow
cytometry. Following normal passaging every 2-3 days, each cell line exhibited stable
GFP expression for up to 35 days post transduction. Transduced HEK293Ts were then
transfected with one to four separate sgRNA expression constructs targeting either
the IL1RN or HBG1 promoter. Transient transfection of these sgRNA constructs in stable
dCas9-VP64 expressing cells lines resulted in tunable endogenous gene activation (Figs.
45A,45B). Gene activation following transient transfection of sgRNA constructs in
cells expressing dCas9-VP64 reached a maximum level of activation approximately 3-6
post-transfection and fell to undetectable levels by 20 days post-transfection (Figs.
45C,45D). Furthermore, we were able to re-activate each gene by a second transfection
of all four sgRNA constructs targeting each promoter, although activation levels were
significantly lower than observed from the first transfection (Figs. 45C, 45D). This
reduction in activity after the second transfection may be due to reduced vector expression
or competitive growth of untransduced cells. Despite this, these data demonstrate
that lentiviral Cas9 combined with transient sgRNA delivery can be used as a versatile
system to tunably and transiently activate and re-activate target genes in a Cas9
stably tranduced cell line.
Example 21
Stable gene activation in HEK293T cells using a single lentiviral sgRNA/Cas9 transactivator
expression vector
[0275] Lentiviral delivery may enable stable, long-term gene activation by CRISPR/Cas9 transactivation.
To test this, HEK293Ts were transduced using a single lentiviral vector encoding dCas9-VP64
and one to four sgRNA expression cassettes. Similar to our transient transfection
results (Fig. 45), we were able to tunably and robustly activate expression of endogenous
IL1RN and HBG1 genes (Figs. 46A,46B). Gene activation induced by co-transfection of
HEK293T cells with dCas9-VP64 and four sgRNAs targeted to the IL1RN and HBG1 promoters
peaked three-five days post-transfection and gene expression returned to background
levels 15-20 days post-transfection (Fig. 4c). In contrast, lentiviral delivery of
dCas9-VP64 and the same four IL1RN or HBG1-targeted sgRNAs induced sustained gene
activation for more than 20 days post-transduction (Figs. 46C,46D). Thus, single lentiviral
delivery of multiplex dCas9-VP64 transactivators is a useful platform to efficiently
and stably upregulate target endogenous genes.
Example 22
dCas9-KRAB - Targeting the HS2 Enhancer
[0276] The HS2 enhancer is a well-characterized distal regulatory element necessary for
activation of the globin gene locus. dCas9-KRAB with gRNAs targeted to the HS2 enhancer
were delivered to determine if this system would repress γ-, ε-, and β-globin expression
in the K562 human erythroid leukemia cell line (Fig. 54). A panel of gRNAs was created
targeting different sites along the core region of the HS2 enhancer (SEQ ID NO: 467).
See Table 12.
[0277] Screening single gRNAs at the globin locus by CRISPR/dCas9. dCas9 and dCas9-KRAB effectors were delivered lentivirally 5 - 8 days prior to electroporation
with 5 µg of a plasmid encoding the U6-sgRNA expression (Fig. 55A). Cells that were
not electroporated with gRNA (no gRNA) and cells treated with a gRNA targeting a different
locus (IL1RN) were included as controls. Multiple gRNAs effected potent repression
of ε-, γ-, and β-globin genes when assayed 3 days post-transfection, with up to 80%
knockdown achieved (Figs. 55B, 55C, 55D). Expressing a gRNA with either dCas9 or dCas9-KRAB
inhibited gene expression at the globin locus. Generally, treatment with dCas9-KRAB
resulted in stronger repression for a given gRNA compared to dCas9 alone, suggesting
an important role for the KRAB domain in recruiting heterochromatin factors that enhance
repression. The repression levels achieved are dependent on the amount of gRNA plasmid
delivered by transfection only in the dCas9-KRAB treated cells (Figs. 56A, 56B, 56C).
Increasing the dose of Cr4 gRNA plasmid up to 10 µg increases silencing levels of
the globin genes in dCas9-KRAB-treated cells.
[0278] Stable silencing of globin genes by dCas9-KRAB. dCas9/dCas9-KRAB were co-expressed with single gRNAs lentivirally in K562s (Fig.
57A). Cells that were not treated with lentivirus (NT), treated with dCas9/dCas9-KRAB
without a gRNA (no gRNA), and with dCas9/dCas9-KRAB and gRNA targeting a different
locus (IL1RN) were included as controls. Cells treated with lentivirus were selected
from days 4 to 7. Multiple gRNAs effected potent transcriptional repression of ε-,
γ-, and β-globin genes when assayed 7 days after transduction, with up to 95% knockdown
achieved (Figs. 57B, 57C, 57D). Expression of ε-globin was silenced the most in response
gRNAs targeted to the HS2 enhancer. Treatment with dCas9-KRAB with a gRNA resulted
in dramatically more repression than treatment with dCas9 and gRNA.
[0279] These findings demonstrate that dCas9-KRAB targeted to the HS2 enhancer by gRNAs
effects potent repression of the distal globin genes. This is the first example of
targeted epigenetic control of distal regulatory elements in mammalian cells by the
CRISPR/Cas9 system. Enhancers regulate development and disease, and this disclosure
provides a method to probe and control enhancer function and may be used to determine
the effects of dCas9-KRAB on local chromatin accessibility and genome-wide expression.
Example 23
dCas9-p300
[0280] A dCas9-p300 fusion protein was designed and compared to dCas9-VP64 fusion protein
(see Fig. 59). The amino acid constructs of dCas9 constructions are shown in Fig.
61A-61C. Cells from the
Human
Embryonic
Kidney tissue culture line HEK293T (ATCC; CRL-11268) were seeded at a density of 1.5e5
cells per well in 24-well tissue culture dishes one day prior to transfection with
Lipofectamine 2000 transfection reagent (Life Technologies). 24 hrs later cells were
transfected with 1µL Lipofectamine 2000, 375 ng dCas9 expression construct (dCas9,
dCas9VP64, or dCas9p300 respectively), and 125 ng of pooled gRNA expression plasmids
(4 each at equimolar ratios). Table 13 shows the gRNA information.
Table 13 gRNA information
| Target Location |
Protospacer Sequence (5'- 3') |
Genomic Location (GRCh38 Primary Assembly) |
Reference |
| IL1RN Promoter |
TGTACTCTCTGAGGTGCTC (SEQ ID NO: 606) |
Chr2: 113117865-113117883 |
Perez-Pinera et al., Nat Methods, 2013 |
| IL1RN Promoter |
ACGCAGATAAGAACCAGTT (SEQ ID NO: 607) |
Chr2: 113117714-113117732 |
Perez-Pinera et al., Nat Methods, 2013 |
| IL1RN Promoter |
CATCAAGTCAGCCATCAGC (SEQ ID NO: 608) |
Chr2: 113117781-113117799 |
Perez-Pinera et al., Nat Methods, 2013 |
| IL1RN Promoter |
GAGTCACCCTCCTGGAAAC (SEQ ID NO: 609) |
Chr2: 113117749-113117767 |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Promoter |
CCTGGGCTCCGGGGCGTTT (SEQ ID NO: 610) |
Chr11: 17719509-17719527 |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Promoter |
GGCCCCTGCGGCCACCCCG (SEQ ID NO: 611) |
Chr11: 17719422-17719440 |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Promoter |
CTCCCTCCCTGCCCGGTAG (SEQ ID NO: 612) |
Chr11: 17719350-17719368 |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Promoter |
AGGTTTGGAAAGGGCGTGC (SEQ ID NO: 613) |
Chr11: 17719290-17719308 |
Perez-Pinera et al., Nat Methods, 2013 |
| Oct4 Promoter |
ACTCCACTGCACTCCAGTCT (SEQ ID NO: 614) |
Chr6: 31170953-31170934 |
Hu et al., Nucleic Acids Res, 2014 |
| Oct4 Promoter |
TCTGTGGGGGACCTGCACTG (SEQ ID NO: 615) |
Chr6: 31170885-31170866 |
Hu et al., Nucleic Acids Res, 2014 |
| Oct4 Promoter |
GGGGCGCCAGTTGTGTCTCC (SEQ ID NO: 616) |
Chr6: 31170855-31170836 |
Hu et al., Nucleic Acids Res, 2014 |
| Oct4 Promoter |
ACACCATTGCCACCACCATT (SEQ ID NO: 617) |
Chr6: 31170816-31170797 |
Hu et al., Nucleic Acids Res, 2014 |
[0281] The 3 days post-transfection cells were harvested and assayed by RT-QPCR for mRNA
expression. The RT-QPCR primer sequences are listed in Table 14.
Table 14 RT-QPCR Primers
| Primer Target |
Primer Sequence (5'- 3') |
Reference |
| GAPDH Forward |
CAATGACCCCTTCATTGACC (SEQ ID NO: 618) |
Perez-Pinera et al., Nat Methods, 2013 |
| GAPDH Reverse |
TTGATTTTGGAGGGATCTCG (SEQ ID NO: 619) |
Perez-Pinera et al., Nat Methods, 2013 |
| IL1RN Forward |
GGAATCCATGGAGGGAAGAT (SEQ ID NO: 620) |
Perez-Pinera et al., Nat Methods, 2013 |
| IL1RN Reverse |
TGTTCTCGCTCAGGTCAGTG (SEQ ID NO: 621) |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Forward |
CTCTCTGCTCCTTTGCCACA (SEQ ID NO: 622) |
Perez-Pinera et al., Nat Methods, 2013 |
| MyoD Reverse |
GTGCTCTTCGGGTTTCAGGA (SEQ ID NO: 623) |
Perez-Pinera et al., Nat Methods, 2013 |
| Oct4 Forward |
CGAAAGAGAAAGCGAACCAGTATCGAGAAC (SEQ ID NO: 624) |
Hu et al., Nucleic Acids Res, 2014 |
| Oct4 Reverse |
CGTTGTGCATAGTCGCTGCTTGATCGC (SEQ ID NO: 625) |
Hu et al., Nucleic Acids Res, 2014 |
[0282] RT-QPCR was normalized to
GAPDH expression using the ΔΔC
t method. Results are expressed as fold-increase expression of the gene of interest
relative to cells treated with Lipofectamine only without DNA transfected ("No DNA")
(See Figs. 60A-60C).
[0283] Fig. 62 shows that mutating residues in the p300 HAT domain causes a loss of its
ability to activate gene expression. Fig. 63 shows that multiple gRNAs work synergistically
with dCas-9-p300, as showed with dCas-9-VP64.
Example 24
[0284] Fig. 66 shows TALEN mediated integration of minidystrophin at the 5'UTR of the Dp427m
skeletal muscle isoform of dystrophin in skeletal myoblast cell lines derived from
human DMD patients carrying different deletions in the dystrophin gene. DMD patient
cells were electroporated with constructs encoding a TALEN pair active at the 5'UTR
locus and a donor template carrying the minidystrophin gene. Fig. 66(a) shows a schematic
of how minidystrophin was integrated into the 5'UTR. Fig. 66(b) shows that hygromycin-resistant
clonal cell lines were isolated and screened by PCR for successful site-specific integrations
at the 5'UTR using the primers shown in Fig. 66(a). Asterisks indicate clones selected
for further analysis in Fig. 66(c). Fig. 66(c) shows that clonally isolated DMD myoblasts
with detected integration events were differentiated for 6 days and assessed for expression
of an HA tag fused to the C terminus of minidystrophin.
[0285] It is understood that the foregoing detailed description and accompanying examples
are merely illustrative and are not to be taken as limitations upon the scope of the
invention, which is defined solely by the appended claims and their equivalents.
Appendix
[0286]
hCas9-T2A-GFP DNA sequence: SEQ ID NO: 145 (SpCas9 human optimized sequence, HA tag, T2A peptide, eGFP sequence)

AAV/Rosa26 construct (SEQ ID NO: 456)


HS2 Enhancer Target Sequence (SEQ ID NO:467)

dSpCas9-KRAB Sequence (SEQ ID NO:466)
