<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE ep-patent-document PUBLIC "-//EPO//EP PATENT DOCUMENT 1.5.1//EN" "ep-patent-document-v1-5-1.dtd">
<!--This XML data has been generated under the supervision of the European Patent Office -->
<ep-patent-document id="EP19172749B9W1" file="EP19172749W1B9.xml" lang="en" country="EP" doc-number="3563837" kind="B9" correction-code="W1" date-publ="20220216" status="c" dtd-version="ep-patent-document-v1-5-1">
<SDOBI lang="en"><B000><eptags><B001EP>ATBECHDEDKESFRGBGRITLILUNLSEMCPTIESILTLVFIROMKCYALTRBGCZEEHUPLSK..HRIS..MTNORS..SM..................</B001EP><B005EP>J</B005EP><B007EP>BDM Ver 2.0.14 (4th of August) -  2999001/0</B007EP></eptags></B000><B100><B110>3563837</B110><B120><B121>CORRECTED EUROPEAN PATENT SPECIFICATION</B121></B120><B130>B9</B130><B132EP>B1</B132EP><B140><date>20220216</date></B140><B150><B151>W1</B151><B155><B1551>de</B1551><B1552>Ansprüche EN</B1552><B1551>en</B1551><B1552>Claims EN</B1552><B1551>fr</B1551><B1552>Revendications EN</B1552><B1551>de</B1551><B1552>Ansprüche FR</B1552><B1551>en</B1551><B1552>Claims FR</B1552><B1551>fr</B1551><B1552>Revendications FR</B1552></B155></B150><B190>EP</B190></B100><B200><B210>19172749.4</B210><B220><date>20140430</date></B220><B240><B241><date>20190506</date></B241><B242><date>20200325</date></B242></B240><B250>en</B250><B251EP>en</B251EP><B260>en</B260></B200><B300><B310>13305568</B310><B320><date>20130430</date></B320><B330><ctry>EP</ctry></B330></B300><B400><B405><date>20220216</date><bnum>202207</bnum></B405><B430><date>20191106</date><bnum>201945</bnum></B430><B450><date>20211020</date><bnum>202142</bnum></B450><B452EP><date>20210531</date></B452EP><B480><date>20220216</date><bnum>202207</bnum></B480></B400><B500><B510EP><classification-ipcr sequence="1"><text>A61K   9/20        20060101AFI20210409BHEP        </text></classification-ipcr><classification-ipcr sequence="2"><text>A61K  35/76        20150101ALI20210409BHEP        </text></classification-ipcr><classification-ipcr sequence="3"><text>A61P   1/00        20060101ALI20210409BHEP        </text></classification-ipcr><classification-ipcr sequence="4"><text>A61P   1/04        20060101ALI20210409BHEP        </text></classification-ipcr><classification-ipcr sequence="5"><text>A61K   9/00        20060101ALI20210409BHEP        </text></classification-ipcr><classification-ipcr sequence="6"><text>A61P   1/12        20060101ALI20210409BHEP        </text></classification-ipcr></B510EP><B520EP><classifications-cpc><classification-cpc sequence="1"><text>A61K   9/0053      20130101 LI20150326BHEP        </text></classification-cpc><classification-cpc sequence="2"><text>A61K  35/76        20130101 FI20130923BHEP        </text></classification-cpc><classification-cpc sequence="3"><text>A61P   1/00        20180101 LI20200318BHEP        </text></classification-cpc><classification-cpc sequence="4"><text>A61P   1/04        20180101 LI20200318BHEP        </text></classification-cpc><classification-cpc sequence="5"><text>A61P   1/12        20180101 LI20200318BHEP        </text></classification-cpc><classification-cpc sequence="6"><text>Y02A  50/30        20180101 LA20200801RHEP        </text></classification-cpc></classifications-cpc></B520EP><B540><B541>de</B541><B542>BAKTERIOPHAGENTHERAPIE</B542><B541>en</B541><B542>BACTERIOPHAGE THERAPY</B542><B541>fr</B541><B542>THÉRAPIE PAR BACTÉRIOPHAGES</B542></B540><B560><B561><text>WO-A1-01/93904</text></B561><B561><text>WO-A1-2013/045863</text></B561><B561><text>WO-A2-02/11549</text></B561><B561><text>WO-A2-2012/036580</text></B561><B562><text>DOGAN BELGIN ET AL: "Multidrug resistance is common in Escherichia coli associated with ileal Crohn's disease.", INFLAMMATORY BOWEL DISEASES JAN 2013, vol. 19, no. 1, January 2013 (2013-01), pages 141-150, XP009172811, ISSN: 1536-4844</text></B562><B562><text>SHENG HAIQING ET AL: "Application of bacteriophages to control intestinal Escherichia coli O157 : H7 levels in ruminants", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 72, no. 8, August 2006 (2006-08), pages 5359-5366, XP009172812, ISSN: 0099-2240</text></B562><B562><text>WEGRZYN GRZEGORZ ET AL: "Modulation of the susceptibility of intestinal bacteria to bacteriophages in response to Ag43 phase variation -- a hypothesis.", MEDICAL SCIENCE MONITOR : INTERNATIONAL MEDICAL JOURNAL OF EXPERIMENTAL AND CLINICAL RESEARCH JUN 2002, vol. 8, no. 6, June 2002 (2002-06), pages HY15-HY18, XP009172813, ISSN: 1234-1010</text></B562><B562><text>LUSIAK-SZELACHOWSKA M ET AL: "Escherichia coli bacteriophages in human stool of patients with gastrointestinal tract diseases", GASTROENTEROLOGIA POLSKA 2008 PL, vol. 15, no. 2, 2008, pages 87-90, XP009172818, ISSN: 1232-9886</text></B562><B562><text>ROLHION NATHALIE ET AL: "Adherent-invasive Escherichia coli in inflammatory bowel disease", INFLAMMATORY BOWEL DISEASES, WILLAMS AND WILKINS, HAGERSTOWN, MD, US, vol. 13, no. 10, 1 October 2007 (2007-10-01), pages 1277-1283, XP009137421, ISSN: 1078-0998, DOI: 10.1002/IBD.20176 [retrieved on 2007-05-02]</text></B562><B562><text>MAURA DAMIEN ET AL: "Intestinal colonization by enteroaggregative Escherichia coli supports long-term bacteriophage replication in mice", ENVIRONMENTAL MICROBIOLOGY, vol. 14, no. 8, Sp. Iss. SI, August 2012 (2012-08), pages 1844-1854, XP055047555,</text></B562><B562><text>MURUGANANTHAN ARAVINTH U ET AL: "Clinical Risk Factors for Crohn's Disease Postoperative Recurrence are Reflected in Alterations in Mucosally Adherent Microbiota at Surgical Resection", GASTROENTEROLOGY, vol. 142, no. 5, Suppl. 1, May 2012 (2012-05), page S679, XP002727902, &amp; DIGESTIVE DISEASE WEEK (DDW); SAN DIEGO, CA, USA; MAY 19 -22, 2012</text></B562></B560></B500><B600><B620><parent><pdoc><dnum><anum>14724663.1</anum><pnum>2991633</pnum></dnum><date>20140430</date></pdoc></parent></B620></B600><B700><B720><B721><snm>Danglas, Pascal</snm><adr><str>Ferring International Center SA
Chemin de la Vergognausaz 50</str><city>1162 Saint-Prex</city><ctry>CH</ctry></adr></B721><B721><snm>Debarbieux, Laurent</snm><adr><str>169 Avenue de la Division Leclerc</str><city>92290 Chatenay-Malabry</city><ctry>FR</ctry></adr></B721></B720><B730><B731><snm>Ferring B.V.</snm><iid>101554501</iid><irf>205 488 a/jme</irf><adr><str>Polaris Avenue 
144</str><city>2132 JX Hoofddorp</city><ctry>NL</ctry></adr></B731><B731><snm>Institut Pasteur</snm><iid>101058628</iid><irf>205 488 a/jme</irf><adr><str>25-28, rue du Docteur Roux</str><city>75015 Paris</city><ctry>FR</ctry></adr></B731></B730><B740><B741><snm>Hoffmann Eitle</snm><iid>100061036</iid><adr><str>Patent- und Rechtsanwälte PartmbB 
Arabellastraße 30</str><city>81925 München</city><ctry>DE</ctry></adr></B741></B740></B700><B800><B830><B831>Declaration under Rule 32(1) EPC (expert solution)</B831></B830><B840><ctry>AL</ctry><ctry>AT</ctry><ctry>BE</ctry><ctry>BG</ctry><ctry>CH</ctry><ctry>CY</ctry><ctry>CZ</ctry><ctry>DE</ctry><ctry>DK</ctry><ctry>EE</ctry><ctry>ES</ctry><ctry>FI</ctry><ctry>FR</ctry><ctry>GB</ctry><ctry>GR</ctry><ctry>HR</ctry><ctry>HU</ctry><ctry>IE</ctry><ctry>IS</ctry><ctry>IT</ctry><ctry>LI</ctry><ctry>LT</ctry><ctry>LU</ctry><ctry>LV</ctry><ctry>MC</ctry><ctry>MK</ctry><ctry>MT</ctry><ctry>NL</ctry><ctry>NO</ctry><ctry>PL</ctry><ctry>PT</ctry><ctry>RO</ctry><ctry>RS</ctry><ctry>SE</ctry><ctry>SI</ctry><ctry>SK</ctry><ctry>SM</ctry><ctry>TR</ctry></B840></B800></SDOBI>
<description id="desc" lang="en"><!-- EPO <DP n="1"> -->
<heading id="h0001"><u>FIELD OF THE INVENTION</u></heading>
<p id="p0001" num="0001">The present invention lies in the field of bacteriophage therapy for use in the treatment of inflammatory bowel diseases<u>, as further defined in the claims.</u></p>
<heading id="h0002"><u>BACKGROUND</u></heading>
<p id="p0002" num="0002">Bacteriophages are viruses that infect bacteria by specific interaction.</p>
<p id="p0003" num="0003">Crohn's disease (CD), also known as regional enteritis, is an inflammatory disease of the intestines that may affect any part of the gastrointestinal tract from mouth to anus, causing a wide variety of symptoms. It primarily causes abdominal pain, diarrhea, vomiting, or weight loss, but may also cause complications outside the gastrointestinal tract such as skin rashes, arthritis, inflammation of the eye, tiredness, and lack of concentration.</p>
<p id="p0004" num="0004">Although the exact cause of CD is still unknown, a combination of environmental factors and genetic predisposition seems to cause the disease. CD is thought to be an autoimmune disease, in which the body's immune system attacks the gastrointestinal tract, causing inflammation; it is classified as a type of inflammatory bowel disease (IBD).</p>
<p id="p0005" num="0005">In patients with CD, abnormal expression of carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) is observed at the apical surface of the ileal epithelium and CD ileal lesions are colonized by pathogenic adherent-invasive <i>Escherichia coli</i> (AIEC).</p>
<p id="p0006" num="0006">There is no known pharmaceutical or surgical cure for Crohn's disease. In particular, neither IBD in general nor CD in particular can be treated with antibiotics (aiming at combatting pathogenic <i>E. coli).</i> Treatment options are restricted to controlling symptoms, maintaining remission, and preventing relapse.<!-- EPO <DP n="2"> --></p>
<p id="p0007" num="0007"><nplcit id="ncit0001" npl-type="s"><text>Maura et al, Environmental Microbiol, vol. 14, no. 8, Sp. Iss. SI, August 2012, pages 1844-1854</text></nplcit> discloses isolation of the bacteriophage CLB_P2.</p>
<p id="p0008" num="0008"><nplcit id="ncit0002" npl-type="s"><text>Belgin et al, Inflammatory Bowel Diseases, Jan 2013, vol. 19, no.1, pages 141-150</text></nplcit> discloses the treatment of Crohn's disease by antibiotics effective against AIEC.<!-- EPO <DP n="3"> --></p>
<heading id="h0003"><u>SUMMARY OF THE INVENTION</u></heading>
<p id="p0009" num="0009">The subject invention provides a pharmaceutical composition comprising:
<ul id="ul0001" list-style="none">
<li>a combination of two or more of the following strains and optionally a pharmaceutically acceptable carrier; for the treatment of inflammatory bowel disease (IBD)<u>, and</u></li>
<li><u>use thereof in</u> a method of treating inflammatory bowel disease comprising administering to a subject in need thereof <u>said combination of</u> bacteriophage strains capable of producing a lytic infection in an adherent-invasive <i>Escherichia coli</i> strain thereby treating the subjects:
<ul id="ul0002" list-style="none">
<li>a bacteriophage strain P1 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM 1-4694 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain;</li>
<li>a bacteriophage strain P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain;</li>
<li>a bacteriophage strain P3 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4696 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain;</li>
<li>a bacteriophage strain P4 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4697 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain<u>;</u><!-- EPO <DP n="4"> --></li>
<li>a bacteriophage strain P5 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4698 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain;</li>
<li>a bacteriophage strain P6 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4699 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain;</li>
<li>a bacteriophage strain P8 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I<i>-</i>4700 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain; and</li>
<li>bacteriophage strain CLB_P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4675 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</li>
</ul></li>
</ul></p>
<p id="p0010" num="0010">For the purpose of the present invention, a variant of a bacteriophage strain is regarded as having the same lytic activity as said bacteriophage strain if it performs at least "+" against at least one of the AIEC strains LF82, 07081, 07082, 07076 and 06075 in the <i>"In vitro</i> assay of the infectivity of bacteriophages in AIEC strains" described in Example 3 below. In a preferred embodiment, a variant is regarded as having the same lytic activity if it performs at least "+" against all five AIEC strains LF 82, LF 06075, LF 07076, LF 07081 and LF 07082 (AIEC strains LF 06075, LF 07076, LF 07081 and LF 07082 are also abbreviated herein as 06075, 07076, 07081 and 07082, respectively). These AIEC strains have been deposited by Université Lille 2 ― Droit et<!-- EPO <DP n="5"> --> Santé, 42 Rue Paul Duez, 59000 Lille (France) with the French National Collection at Institut Pasteur under Accession Numbers CNCM 1-4712 (LF 82), CNCM 1-4713 (LF 06075), CNCM 1-4714 (LF 07076), CNCM 1-4715 (LF 07081) and CNCM 1-4716 (LF 07082).</p>
<p id="p0011" num="0011">For the purpose of the present invention, a variant of one of the bacteriophage strains P1 to P6, P8 and CLB_P2 is regarded as having the same phenotypic characteristics as said bacteriophage strain if it has at least 80% sequence identity on at least 70% of length, preferably at least 90% sequence identity on at least 80% of length and more preferably complete sequence identity on at least 90% of length (as determined by the BLAST algorithm) with the major capsid protein of bacteriophage wV8 (for variants of P1 to P6) or bacteriophage RB69 (for variants of P8) or bacteriophage JS98 (for variants of CLB_P2), as described below in the section "Identification of Major Capsid Proteins".</p>
<p id="p0012" num="0012"><u>A</u> variant of a bacteriophage has the same lytic activity and the same phenotypic characteristics as the bacteriophage.</p>
<heading id="h0004"><u>DETAILED DESCRIPTION OF THE INVENTION</u></heading>
<p id="p0013" num="0013">The subject invention provides a pharmaceutical composition comprising: the above combination and a pharmaceutically acceptable carrier; for the treatment of inflammatory bowel disease.</p>
<p id="p0014" num="0014">An <i>"adherent-invasive Escherichia coli (AIEC) strain</i>" as used herein should be understood as referring to an <i>E. coli</i> strain having a mean invasion potential of equal to or higher than 0.1% in a cell culture of the intestinal cell line I-407. In other words, an AIEC strain has the ability to invade an intestinal cell culture of I-407 with an invasion<!-- EPO <DP n="6"> --> index equal or superior to 0.1% of the original inoculum (taken as 100%), when tested in accordance with the invasion assay described below in the section "Invasion Assay" (see also <nplcit id="ncit0003" npl-type="s"><text>Darfeuille-Michaud et al. (2004), Gastroenterology 127:412-421</text></nplcit><i>).</i></p>
<p id="p0015" num="0015">Non-limiting examples of AIEC strains are LF82, LF82SK (deposited by Université d'Auvergne, 49 Boulevard François Mitterand, 63001 Clermont-Ferrand (France) with the French National Collection at Institut Pasteur under Accession Number CNCM I-4723), those listed in Table 1 herein below and those listed in the following itemization (cf. <nplcit id="ncit0004" npl-type="s"><text>Darfeuille-Michaud et al. (2004), Gastroenterology 127:412-421</text></nplcit><i>, especially page 417, Table 2):</i> LF31, LF71, LF123, LF138, LF9, LF15, LF28, LF50, LF65, LF119, LF128, LF130, LF73, LF100, LF110, LF134, LF105, LF49-2, LB11, and LF45-2. In one embodiment, the adherent-invasive <i>Escherichia coli</i> strain is LF82, 07081, 07082, 07076 or 06075, in particular LF82.</p>
<p id="p0016" num="0016">In one embodiment, the adherent-invasive <i>Escherichia coli</i> strain is present in the colon of the subject. In another embodiment, the adherent-invasive <i>Escherichia coli</i> strain is present in the ileum of the subject. In yet another embodiment, the adherent-invasive <i>Escherichia coli</i> strain is present in one or more intestinal parts (small and/or large) of the subject.</p>
<p id="p0017" num="0017">In one embodiment, the bacteriophage strain is P1 <u>which can be part of the combination and is</u> deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I<i>-</i>4694 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0018" num="0018">In one embodiment, the bacteriophage strain is P2 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0019" num="0019">In one embodiment, the bacteriophage strain is P3 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession<!-- EPO <DP n="7"> --></p>
<p id="p0020" num="0020">Number CNCM I-4696 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0021" num="0021">In one embodiment, the bacteriophage strain is P4 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4697 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0022" num="0022">In one embodiment, the bacteriophage strain is P5 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4698 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0023" num="0023">In one embodiment, the bacteriophage strain is P6 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4699 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0024" num="0024">In one embodiment, the bacteriophage strain is P8 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4700 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0025" num="0025">In one embodiment, the bacteriophage strain is CLB_P2 which can be part of the combination and is deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I<i>-</i>4675 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.<!-- EPO <DP n="8"> --></p>
<p id="p0026" num="0026">In one aspect, it is envisaged that the pharmaceutical composition comprises more than one bacteriophage strain, also named "<i>a bacteriophage cocktail</i>"<i>.</i> The bacteriophage cocktail of the present invention comprises any combination of two or more of P1, P2, P3, P4, P5, P6, P8 and CLB_P2 and variants thereof having the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics. Preferably, the bacteriophages in a bacteriophage cocktail intended for treatment of a specific subject or group of subjects will be selected on the basis of the AIEC strain or AIEC strains identified and selected for combatting.</p>
<p id="p0027" num="0027">Non-limiting examples of inflammatory bowel diseases are Crohn's disease (CD), ulcerative colitis (UC), chronic inflammatory bowel disease (chronic IBD) such as but not limited to microscopic colitis, celiac disease and vasculitis. In one embodiment, the IBD is CD or UC. In another embodiment, the inflammatory bowel disease is recurrence of ileal lesions after surgery (such as surgery for the removal of at least a part of the small intestine in CD patients). The recurrence can be measured by the Rutgeerts score.</p>
<p id="p0028" num="0028">In one embodiment, the IBD is not caused by a bacterial infection. This embodiment is based on the observation that IBD is an autoimmune disease which is not generally considered a bacterial disease. Instead, a bacterial infection may be concomitant to IBD, but is not necessarily the causative agent. This observation adds to the surprising finding of the present invention, namely applying bacteriophage therapy for the treatment of a disease which is not caused by bacteria.</p>
<p id="p0029" num="0029">For that reason, there can be ― as an example ― AIEC strains in family members of subjects suffering from an IBD, although these family members do not suffer from this disease. Likewise, AIEC strains can also be found in subjects neither suffering from IBD nor being related to subjects suffering from IBD, as can also be seen from Table 1 below.</p>
<p id="p0030" num="0030">"<i>Treating</i>" as used herein should be understood to encompass a decrease in one or more symptoms characteristic of the disease; a decrease in the rate of progression of the disease; recovery from the disease, cure from the disease, maintenance of remission and prophylaxis such as prevention of relapse.<!-- EPO <DP n="9"> --></p>
<p id="p0031" num="0031">A "<i>subject</i>" as used herein can be a male or a female subject. A subject can be a human being or any other mammal.</p>
<p id="p0032" num="0032">The dose and regimen of administration of a pharmaceutical composition of the invention will necessarily be dependent upon the therapeutic effect to be achieved (e.g. treatment of IBD) and may vary with the particular bacteriophage strains in the composition, the route of administration, and the age and condition of the individual subject to whom the medicament is to be administered.</p>
<p id="p0033" num="0033">A dosage for humans is likely to contain a dose of bacteriophage between 10<sup>4</sup> and 10<sup>11</sup> plaque forming units (pfu). The desired dose may be presented as one dose per day or as multiple sub-doses administered at appropriate intervals.</p>
<p id="p0034" num="0034">In the context of the present invention the term "<i>pharmaceutically acceptable carrier</i>" relates to pharmaceutically-acceptable, non-toxic carriers, fillers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration.</p>
<p id="p0035" num="0035">The pharmaceutical compositions of the present invention may further comprise pharmaceutically acceptable auxiliary agents, and optionally other therapeutic agents. Auxiliary agents, also named accessory ingredients, encompass those conventional in the art such as, but not limited to matrix-forming agents, thickeners, binders, lubricants, pH adjusting agents, protecting agents, viscosity enhancers, wicking agents, disintegrants, including non-effervescent and effervescent disintegrants, surfactants, anti-oxidants, wetting agents, colorants, flavoring agents, taste-masking agents, sweeteners, preservatives and so forth. In addition to being pharmaceutically acceptable, the auxiliary agents must be "<i>acceptable</i>" in the sense that they are compatible with the other ingredients of the composition, including the bacteriophage.</p>
<p id="p0036" num="0036">Pharmaceutical compositions and routes of administration include those suitable for or via oral (including buccal, sublingual and intraorbital), rectal, nasal, topical (including transdermal), ocular, otic, vaginal, bronchial, pulmonary or parenteral (including subcutaneous, intramuscular, intravenous, intradermal, intraperitoneal, intrapleural, intravesicular and intrathecal) administration or administration via an implant. The<!-- EPO <DP n="10"> --> pharmaceutical composition or route of administration may be adapted to provide a targeted effect of bacteriophage strain of the invention. In a specific embodiment, a pharmaceutical composition of the invention is administered orally. The compositions may be prepared by any method well known in the art of pharmacy. Such methods include the step of bringing in association a bacteriophage strain of the invention with a pharmaceutically acceptable carrier and optionally one or more auxiliary agents.</p>
<p id="p0037" num="0037">Pharmaceutical compositions suitable for oral administration may be presented as discrete dosage units (dosage forms) such as pills, tablets, dragees or capsules, or as a powder or granules, or as a solution or suspension. The pharmaceutical composition may also be presented as a bolus or paste. The compositions can further be processed into a suppository or enema for rectal administration.</p>
<p id="p0038" num="0038">For parenteral administration, suitable compositions include aqueous and non-aqueous sterile injections. The compositions may be presented in unit-dose or multi-dose containers, for example sealed vials and ampoules, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of sterile liquid carrier, for example water, prior to use.</p>
<p id="p0039" num="0039">For transdermal administration, e.g., gels, patches or sprays can be contemplated.</p>
<p id="p0040" num="0040">Compositions or formulations suitable for pulmonary administration, e.g., by nasal inhalation, include fine dusts or mists which may be generated by means of metered dose pressurized aerosols, nebulizers or insufflators.</p>
<p id="p0041" num="0041">The specification includes a kit comprising a pharmaceutical composition of the invention and instructions for the use of the composition for a use as hereinbefore described, optionally together with packaging material.</p>
<p id="p0042" num="0042">The specification further provides a bacteriophage strain P1 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4694 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.<!-- EPO <DP n="11"> --></p>
<p id="p0043" num="0043">The specification further provides a bacteriophage strain P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0044" num="0044">The <u>specification</u> further provides a bacteriophage strain P3 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4696 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0045" num="0045">The <u>specification</u> further provides a bacteriophage strain P4 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4697 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0046" num="0046">The <u>specification</u> further provides a bacteriophage strain P5 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4698 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0047" num="0047">The specification further provides a bacteriophage strain P6 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4699 or a variant thereof, wherein the variant has the same lytic activity, preferably the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<p id="p0048" num="0048">The specification further provides a bacteriophage strain P8 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4700 or a variant thereof, wherein the variant has<!-- EPO <DP n="12"> --> the same lytic activity and the same phenotypic characteristics as said bacteriophage strain.</p>
<heading id="h0005"><u>EXAMPLES</u></heading>
<p id="p0049" num="0049">The invention is further described in the following examples, which are not in any way intended to limit the scope of the invention as claimed.</p>
<heading id="h0006"><u>METHODS</u></heading>
<heading id="h0007"><u>INVASION ASSAY</u></heading>
<p id="p0050" num="0050">The Intestine-407 (I-407) cell line derived from human embryonic jejunum and ileum was used as a model of undifferentiated intestinal epithelial cells. It was purchased from Flow Laboratories (Flow Laboratories Inc., Mc Lean, VA).</p>
<p id="p0051" num="0051">Intestine-407 cells were seeded in 24-well tissue culture plates (Polylabo, Strasbourg, France) at a density of 4,105 cells/well and incubated for 20 hours. The cell monolayers were washed twice with PBS (pH 7.2). Bacterial invasion of epithelial cells was measured using the gentamicin protection assay (<nplcit id="ncit0005" npl-type="s"><text>Falkow et al. (1987), Rev. Infect. Dis. 9 (Suppl. 5):S450-455</text></nplcit>). Each monolayer was inoculated in 1 mL of the cell culture medium lacking antibiotics with a multiplicity of infection of 10 bacteria per epithelial cell. After a 3-hour incubation period at 37°C with 5% CO<sub>2</sub>, the monolayers were washed 3 times with PBS. Fresh cell culture medium containing 100 µg/mL of gentamicin (Sigma, St. Louis, MO) was added for 1 hour to kill extracellular bacteria before lysis of the monolayers with 1% Triton X-100 (Sigma) in deionized water. This concentration of Triton X-100 had no effect on bacterial viability for at least 30 minutes. The samples were diluted and plated onto Mueller-Hinton agar plates to determine the number of colony-forming units. All results of <i>E. coli</i> invasive ability with Intestine-407 cell line were expressed as the percentage of intracellular bacteria compared with the initial inoculum, taken as 100%. All of the assays were performed at least 3 times in separate experiments.</p>
<heading id="h0008"><u>IDENTIFICATION OF MAJOR CAPSID PROTEINS</u></heading>
<p id="p0052" num="0052">Virion proteins were obtained by boiling 60 µl of a suspension of 10<sup>11</sup> pfu/ml of each bacteriophage for 10 min. 20 µl of the suspension were run on a precast 4―12% polyacrylamide gel. The gel was stained with Coomassie blue and the major bands<!-- EPO <DP n="13"> --> were excised, subjected to trypsin digestion and analyzed by mass spectrometry at the Institut Pasteur microsequencing facility.</p>
<p id="p0053" num="0053">The peptide masses obtained were compared with the information in protein databases, allowing the identification of the closest known protein, i.e. wV8 for P1 to P6 and RB69 for P8 and JS98 for CLB_P2 (see <nplcit id="ncit0006" npl-type="s"><text>A. Villegas et al, Virology Journal 2009, 6:41</text></nplcit> for characterization of wV8 and <nplcit id="ncit0007" npl-type="s"><text>S. Zuber et al., Journal of Bacteriology 2007, 189:22, 8206</text></nplcit> for characterization of RB69 and JS 98).</p>
<p id="p0054" num="0054">Alignment of the major capsid protein of bacteriophage wV8 with peptides obtained from mass spectrometry of the major capsid proteins of bacteriophages P1 to P6:
<img id="ib0001" file="imgb0001.tif" wi="145" he="27" img-content="dna" img-format="tif"/>
<img id="ib0002" file="imgb0002.tif" wi="145" he="27" img-content="dna" img-format="tif"/>
<img id="ib0003" file="imgb0003.tif" wi="145" he="27" img-content="dna" img-format="tif"/>
<img id="ib0004" file="imgb0004.tif" wi="145" he="27" img-content="dna" img-format="tif"/>
<img id="ib0005" file="imgb0005.tif" wi="145" he="27" img-content="dna" img-format="tif"/><!-- EPO <DP n="14"> -->
<img id="ib0006" file="imgb0006.tif" wi="70" he="26" img-content="dna" img-format="tif"/></p>
<p id="p0055" num="0055">Alignment of the major capsid protein of bacteriophage RB69 with peptides obtained from mass spectrometry of the major capsid protein of bacteriophage P8:
<img id="ib0007" file="imgb0007.tif" wi="145" he="8" img-content="dna" img-format="tif"/>
<img id="ib0008" file="imgb0008.tif" wi="145" he="8" img-content="dna" img-format="tif"/>
<img id="ib0009" file="imgb0009.tif" wi="145" he="9" img-content="dna" img-format="tif"/>
<img id="ib0010" file="imgb0010.tif" wi="145" he="8" img-content="dna" img-format="tif"/>
<img id="ib0011" file="imgb0011.tif" wi="145" he="9" img-content="dna" img-format="tif"/>
<img id="ib0012" file="imgb0012.tif" wi="145" he="9" img-content="dna" img-format="tif"/>
<img id="ib0013" file="imgb0013.tif" wi="145" he="9" img-content="dna" img-format="tif"/>
<img id="ib0014" file="imgb0014.tif" wi="103" he="9" img-content="dna" img-format="tif"/></p>
<p id="p0056" num="0056">Alignment of the major capsid protein of bacteriophage JS98 with peptides obtained from mass spectrometry of the major capsid protein of bacteriophage CLB_P2.
<img id="ib0015" file="imgb0015.tif" wi="143" he="9" img-content="dna" img-format="tif"/>
<img id="ib0016" file="imgb0016.tif" wi="143" he="9" img-content="dna" img-format="tif"/>
<img id="ib0017" file="imgb0017.tif" wi="144" he="9" img-content="dna" img-format="tif"/>
<img id="ib0018" file="imgb0018.tif" wi="143" he="9" img-content="dna" img-format="tif"/>
<img id="ib0019" file="imgb0019.tif" wi="144" he="9" img-content="dna" img-format="tif"/>
<img id="ib0020" file="imgb0020.tif" wi="143" he="9" img-content="dna" img-format="tif"/>
<img id="ib0021" file="imgb0021.tif" wi="143" he="9" img-content="dna" img-format="tif"/>
<img id="ib0022" file="imgb0022.tif" wi="126" he="9" img-content="dna" img-format="tif"/><!-- EPO <DP n="15"> --></p>
<heading id="h0009"><u>EXAMPLE 1</u></heading>
<heading id="h0010"><b>Isolation of AIEC strains</b></heading>
<p id="p0057" num="0057">One hundred and sixty-six (166) adherent-invasive <i>Escherichia coli (E. coli)</i> strains, including <i>E</i>. <i>coli</i> strain LF82 (Table 1), were isolated as follows: The AIEC strains were isolated from fresh feces of CD patients, their family members and control subjects. The feces were diluted in tenfold dilutions up to -9. Each dilution was plated on different media. After incubation, colonies were sub-cultured, identified and the strains were tested for invasion capacity.</p>
<p id="p0058" num="0058">In detail, immediately after emission, fresh feces were introduced in a sterile container. The atmosphere was rendered anaerobic by addition of a moistened Anaerocult<sup>®</sup>. Samples were treated the day of sampling. About 1 g of feces were introduced in 9 mL of cysteinated ¼ strength Ringer solution in pre-weighed tubes; they were reweighed after introduction of the sample to determine its exact weight (first tenfold dilution). Eight further tenfold dilutions were made and 0.1 mL of each dilution was plated on different non-selective and selective media incubated in appropriated conditions: Columbia blood agar (CS) and CSH agar incubated for one week under anaerobic conditions, MRS medium incubated for 48h in an atmosphere enriched in CO<sub>2</sub>, McConkey and Cetrimide agar incubated for 48h in air. All incubations were done at 37°C. After incubation, colonies were counted, subcultured and identified by established phenotypic criteria.</p>
<p id="p0059" num="0059">A control subject was selected <i>vis-à-vis</i> a CD patient so that the control subject was of the same sex and age as the CD patient and had a similar family size as the CD patient (to take microflora variation within a family into consideration).</p>
<p id="p0060" num="0060">The protocol was approved by the local ethical committee in 2000. The patients were followed by the EPIMAD register, which is organized under an agreement between the Institut National de la Santé et de la Recherche Médicale (INSERM) and the Institut National de Veille Sanitaire (InVS) and is also supported by the François Aupetit Association, Lion's Club of Northwestern France, Ferring Laboratories, the Société Nationale Française de Gastroentérologie and Lille University Hospital.<!-- EPO <DP n="16"> -->
<tables id="tabl0001" num="0001">
<table frame="all">
<title><u>Table 1 - AIEC strains</u></title>
<tgroup cols="8">
<colspec colnum="1" colname="col1" colwidth="18mm" align="center"/>
<colspec colnum="2" colname="col2" colwidth="21mm" align="center"/>
<colspec colnum="3" colname="col3" colwidth="21mm" align="center"/>
<colspec colnum="4" colname="col4" colwidth="21mm" align="center"/>
<colspec colnum="5" colname="col5" colwidth="18mm" align="center"/>
<colspec colnum="6" colname="col6" colwidth="18mm" align="center"/>
<colspec colnum="7" colname="col7" colwidth="28mm" align="center"/>
<colspec colnum="8" colname="col8" colwidth="26mm" align="center"/>
<thead valign="middle">
<row>
<entry><b>Number</b></entry>
<entry><b>Reference</b></entry>
<entry><b>Invasion</b><br/>
<b>I-407</b><br/>
<b>Mean (%)</b></entry>
<entry><b>Invasion</b><br/>
<b>I-407</b><br/>
<b>SEM (%)</b></entry>
<entry><b>Culture Medium <sup>1</sup></b></entry>
<entry><b>Dilution</b></entry>
<entry><b>Level of <i>E</i>. <i>coli</i> (log UFC/g) <sup>2</sup></b></entry>
<entry><b>Total Count (logUFC/g) <sup>3</sup></b></entry></row></thead>
<tbody valign="middle">
<row>
<entry/>
<entry>LF82</entry>
<entry>1.29</entry>
<entry>0.8</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.7</entry>
<entry>5.9</entry></row></tbody></tgroup>
<tgroup cols="8">
<colspec colnum="1" colname="col1" colwidth="18mm" align="center"/>
<colspec colnum="2" colname="col2" colwidth="21mm" align="center"/>
<colspec colnum="3" colname="col3" colwidth="21mm" align="center"/>
<colspec colnum="4" colname="col4" colwidth="21mm" align="center"/>
<colspec colnum="5" colname="col5" colwidth="18mm" align="center"/>
<colspec colnum="6" colname="col6" colwidth="18mm" align="center"/>
<colspec colnum="7" colname="col7" colwidth="28mm" align="center"/>
<colspec colnum="8" colname="col8" colwidth="26mm" align="center"/>
<thead valign="middle">
<row>
<entry namest="col1" nameend="col8"><i>AIEC isolated from CD patient</i></entry></row></thead>
<tbody valign="middle">
<row>
<entry>06259</entry>
<entry>C4-1</entry>
<entry>2.050</entry>
<entry>0.500</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.87</entry>
<entry>10.52</entry></row>
<row>
<entry>06254</entry>
<entry>C34-12</entry>
<entry>2.163</entry>
<entry>0.738</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.91</entry>
<entry>10.14</entry></row>
<row>
<entry>06256</entry>
<entry>C34-2</entry>
<entry>0.550</entry>
<entry>0.170</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>7.91</entry>
<entry>10.14</entry></row>
<row>
<entry>06072</entry>
<entry>C39-1</entry>
<entry>0.2075</entry>
<entry>0.147</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.02</entry>
<entry>9.93</entry></row>
<row>
<entry>06073</entry>
<entry>C39-2</entry>
<entry>0.1374</entry>
<entry>0.097</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.02</entry>
<entry>9.93</entry></row>
<row>
<entry>06075</entry>
<entry>C39-4</entry>
<entry>0.2334</entry>
<entry>0.165</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.02</entry>
<entry>9.93</entry></row>
<row>
<entry>06076</entry>
<entry>C39-7</entry>
<entry>0.5900</entry>
<entry>0.417</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.02</entry>
<entry>9.93</entry></row>
<row>
<entry>06087</entry>
<entry>C42-1</entry>
<entry>0.1095</entry>
<entry>0.055</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.82</entry>
<entry>9.58</entry></row>
<row>
<entry>06088</entry>
<entry>C42-2</entry>
<entry>0.1954</entry>
<entry>0.098</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.82</entry>
<entry>9.58</entry></row>
<row>
<entry>06089</entry>
<entry>C42-3</entry>
<entry>0.1930</entry>
<entry>0.097</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.82</entry>
<entry>9.58</entry></row>
<row>
<entry>06398</entry>
<entry>C76-10</entry>
<entry>0.131</entry>
<entry>0.036</entry>
<entry>CS ana</entry>
<entry>-5</entry>
<entry>6.09</entry>
<entry>9.99</entry></row>
<row>
<entry>06011</entry>
<entry>C84-2</entry>
<entry>0.2580</entry>
<entry>0.129</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.96</entry>
<entry>9.23</entry></row>
<row>
<entry>06023</entry>
<entry>C97-1</entry>
<entry>0.1173</entry>
<entry>0.068</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>8.14</entry>
<entry>10.03</entry></row>
<row>
<entry>06024</entry>
<entry>C97-2</entry>
<entry>0.1303</entry>
<entry>0.075</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.14</entry>
<entry>10.03</entry></row>
<row>
<entry>06026</entry>
<entry>C98-1</entry>
<entry>0.1439</entry>
<entry>0.072</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.2</entry>
<entry>9.34</entry></row>
<row>
<entry>06027</entry>
<entry>C98-2</entry>
<entry>0.1122</entry>
<entry>0.065</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.2</entry>
<entry>9.34</entry></row>
<row>
<entry>06028</entry>
<entry>C98-4</entry>
<entry>0.2310</entry>
<entry>0.133</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.20</entry>
<entry>9.34</entry></row>
<row>
<entry>06029</entry>
<entry>C99-1</entry>
<entry>1.0657</entry>
<entry>0.615</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.99</entry>
<entry>10.17</entry></row>
<row>
<entry>06030</entry>
<entry>C99-2</entry>
<entry>0.1613</entry>
<entry>0.081</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.99</entry>
<entry>10.17</entry></row>
<row>
<entry>06031</entry>
<entry>C99-3</entry>
<entry>0.2330</entry>
<entry>0.135</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.99</entry>
<entry>10.17</entry></row>
<row>
<entry>06033</entry>
<entry>C99-9</entry>
<entry>0.4667</entry>
<entry>0.269</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.99</entry>
<entry>10.17</entry></row>
<row>
<entry>06150</entry>
<entry>C187-13</entry>
<entry>0.6675</entry>
<entry>0.472</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>7.93</entry>
<entry>9.97</entry></row>
<row>
<entry>06151</entry>
<entry>C187-14</entry>
<entry>1.0350</entry>
<entry>0.732</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>7.93</entry>
<entry>9.97</entry></row>
<row>
<entry>06152</entry>
<entry>C187-15</entry>
<entry>0.4375</entry>
<entry>0.253</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>7.93</entry>
<entry>9.97</entry></row>
<row>
<entry>06166</entry>
<entry>C190-1</entry>
<entry>0.2251</entry>
<entry>0.130</entry>
<entry>McC</entry>
<entry>-8</entry>
<entry>9.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06167</entry>
<entry>C190-2</entry>
<entry>0.1247</entry>
<entry>0.072</entry>
<entry>McC</entry>
<entry>-8</entry>
<entry>9.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06168</entry>
<entry>C190-3</entry>
<entry>0.1688</entry>
<entry>0.097</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>8.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06169</entry>
<entry>C190-4</entry>
<entry>0.1373</entry>
<entry>0.079</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06170</entry>
<entry>C190-6</entry>
<entry>0.7065</entry>
<entry>0.408</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>4.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06171</entry>
<entry>C190-8</entry>
<entry>0.5827</entry>
<entry>0.336</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06172</entry>
<entry>C190-7</entry>
<entry>0.5385</entry>
<entry>0.311</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.28</entry>
<entry>10.98</entry></row>
<row>
<entry>06173</entry>
<entry>C190-12</entry>
<entry>0.5182</entry>
<entry>0.299</entry>
<entry>CS ana</entry>
<entry>-9</entry>
<entry>10.28</entry>
<entry>10.98</entry></row><!-- EPO <DP n="17"> -->
<row>
<entry>06280</entry>
<entry>C203-7</entry>
<entry>0.185</entry>
<entry>0.087</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.96</entry>
<entry>9.94</entry></row>
<row>
<entry>06281</entry>
<entry>C203-9</entry>
<entry>0.393</entry>
<entry>0.023</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.96</entry>
<entry>9.94</entry></row>
<row>
<entry>06283</entry>
<entry>C204-4</entry>
<entry>0.253</entry>
<entry>0.092</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.00</entry>
<entry>9.78</entry></row>
<row>
<entry>06271</entry>
<entry>C205-2</entry>
<entry>0.153</entry>
<entry>0.052</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.93</entry>
<entry>9.97</entry></row>
<row>
<entry>06278</entry>
<entry>C205-9</entry>
<entry>0.160</entry>
<entry>0.005</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.93</entry>
<entry>9.97</entry></row>
<row>
<entry>06351</entry>
<entry>C215-8</entry>
<entry>0.548</entry>
<entry>0.397</entry>
<entry>Cet</entry>
<entry>-5</entry>
<entry>5.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06352</entry>
<entry>C215-9</entry>
<entry>0.262</entry>
<entry>0.143</entry>
<entry>Cet</entry>
<entry>-5</entry>
<entry>5.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06353</entry>
<entry>C215-12</entry>
<entry>1.960</entry>
<entry>1.340</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06354</entry>
<entry>C215-13</entry>
<entry>1.339</entry>
<entry>1.281</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06356</entry>
<entry>C215-10</entry>
<entry>2.260</entry>
<entry>1.540</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06357</entry>
<entry>C215-11</entry>
<entry>2.195</entry>
<entry>1.355</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06358</entry>
<entry>C215-1</entry>
<entry>1.110</entry>
<entry>0.590</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06359</entry>
<entry>C215-2</entry>
<entry>1.523</entry>
<entry>0.928</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06360</entry>
<entry>C215-3</entry>
<entry>0.165</entry>
<entry>0.064</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06361</entry>
<entry>C215-4</entry>
<entry>0.315</entry>
<entry>0.135</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>06362</entry>
<entry>C215-5</entry>
<entry>0.980</entry>
<entry>0.720</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>3.93</entry>
<entry>9.91</entry></row>
<row>
<entry>07074</entry>
<entry>C43-1</entry>
<entry>1.5825</entry>
<entry>1.3675</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.26</entry>
<entry>9.66</entry></row>
<row>
<entry>07075</entry>
<entry>C44-1</entry>
<entry>0.1822</entry>
<entry>0.0755</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.01</entry>
<entry>9.91</entry></row>
<row>
<entry>07076</entry>
<entry>C44-2</entry>
<entry>0.5950</entry>
<entry>0.3350</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.01</entry>
<entry>9.91</entry></row>
<row>
<entry>07077</entry>
<entry>C44-3</entry>
<entry>0.1432</entry>
<entry>0.0486</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.01</entry>
<entry>9.91</entry></row>
<row>
<entry>07078</entry>
<entry>C44-4</entry>
<entry>0.3086</entry>
<entry>0.1764</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.01</entry>
<entry>9.91</entry></row>
<row>
<entry>07081</entry>
<entry>C44-9</entry>
<entry>0.5525</entry>
<entry>0.2675</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.01</entry>
<entry>9.91</entry></row>
<row>
<entry>07082</entry>
<entry>C45-1</entry>
<entry>0.4675</entry>
<entry>0.0925</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.94</entry>
<entry>9.46</entry></row>
<row>
<entry>07086</entry>
<entry>C45-9</entry>
<entry>0.2110</entry>
<entry>0.0842</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.94</entry>
<entry>9.46</entry></row>
<row>
<entry>07093</entry>
<entry>C50-2</entry>
<entry>1.3125</entry>
<entry>0.9375</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.99</entry>
<entry>7.69</entry></row>
<row>
<entry>07035</entry>
<entry>C66-2</entry>
<entry>0.6475</entry>
<entry>0.3125</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>8.01</entry>
<entry>9.53</entry></row>
<row>
<entry>07045</entry>
<entry>C71-1</entry>
<entry>0.2079</entry>
<entry>0.1226</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.95</entry>
<entry>10.58</entry></row>
<row>
<entry>07046</entry>
<entry>C71-2</entry>
<entry>0.2030</entry>
<entry>0.0719</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.95</entry>
<entry>10.58</entry></row>
<row>
<entry>07048</entry>
<entry>C71-5</entry>
<entry>0.2388</entry>
<entry>0.1382</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.95</entry>
<entry>10.58</entry></row>
<row>
<entry>07051</entry>
<entry>C100-11A</entry>
<entry>0.6325</entry>
<entry>0.3425</entry>
<entry>MRS</entry>
<entry>-4</entry>
<entry>5.07</entry>
<entry>10.47</entry></row>
<row>
<entry>07003</entry>
<entry>C112-4</entry>
<entry>0.2513</entry>
<entry>0.0861</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.14</entry>
<entry>10.88</entry></row>
<row>
<entry>07006</entry>
<entry>C112-10</entry>
<entry>0.8913</entry>
<entry>0.1863</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.14</entry>
<entry>10.88</entry></row>
<row>
<entry>07022</entry>
<entry>C121-8</entry>
<entry>0.1903</entry>
<entry>0.0448</entry>
<entry>Cet</entry>
<entry>-5</entry>
<entry>6.14</entry>
<entry>10.88</entry></row>
<row>
<entry>07101</entry>
<entry>C55-1</entry>
<entry>0.678</entry>
<entry>0.022</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.95</entry>
<entry>10.38</entry></row>
<row>
<entry>07103</entry>
<entry>C55-3</entry>
<entry>9.175</entry>
<entry>2.775</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.95</entry>
<entry>10.38</entry></row>
<row>
<entry>07107</entry>
<entry>C55-8A</entry>
<entry>4.425</entry>
<entry>0.075</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.95</entry>
<entry>10.38</entry></row><!-- EPO <DP n="18"> -->
<row>
<entry>07111</entry>
<entry>C60-1</entry>
<entry>0.232</entry>
<entry>0.028</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.84</entry>
<entry>8.20</entry></row>
<row>
<entry>07113</entry>
<entry>C60-3</entry>
<entry>0.340</entry>
<entry>0.105</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.84</entry>
<entry>8.20</entry></row>
<row>
<entry>07126</entry>
<entry>C231-1</entry>
<entry>0.323</entry>
<entry>0.097</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>7.94</entry>
<entry>10.62</entry></row>
<row>
<entry>07127</entry>
<entry>C231- 2</entry>
<entry>0.141</entry>
<entry>0.030</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.94</entry>
<entry>10.62</entry></row>
<row>
<entry>07128</entry>
<entry>C231-5</entry>
<entry>0.365</entry>
<entry>0.095</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.94</entry>
<entry>10.62</entry></row>
<row>
<entry>07134</entry>
<entry>C233-1</entry>
<entry>0.645</entry>
<entry>0.090</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>3.98</entry>
<entry>6.18</entry></row>
<row>
<entry>07135</entry>
<entry>C233-3</entry>
<entry>1.510</entry>
<entry>0.390</entry>
<entry>McC</entry>
<entry>-2</entry>
<entry>2.98</entry>
<entry>6.18</entry></row>
<row>
<entry>07136</entry>
<entry>C233-2</entry>
<entry>2.090</entry>
<entry>0.260</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>3.98</entry>
<entry>6.18</entry></row>
<row>
<entry>07137</entry>
<entry>C233-11</entry>
<entry>1.108</entry>
<entry>0.168</entry>
<entry>CSH</entry>
<entry>-3</entry>
<entry>3.98</entry>
<entry>6.18</entry></row></tbody></tgroup>
<tgroup cols="8">
<colspec colnum="1" colname="col1" colwidth="18mm" align="center"/>
<colspec colnum="2" colname="col2" colwidth="21mm" align="center"/>
<colspec colnum="3" colname="col3" colwidth="21mm" align="center"/>
<colspec colnum="4" colname="col4" colwidth="21mm" align="center"/>
<colspec colnum="5" colname="col5" colwidth="18mm" align="center"/>
<colspec colnum="6" colname="col6" colwidth="18mm" align="center"/>
<colspec colnum="7" colname="col7" colwidth="28mm" align="center"/>
<colspec colnum="8" colname="col8" colwidth="26mm" align="center"/>
<thead valign="middle">
<row>
<entry namest="col1" nameend="col8"><i>AIEC isolated from family members of CD patients</i></entry></row></thead>
<tbody valign="middle">
<row>
<entry>06066</entry>
<entry>C22-9</entry>
<entry>0.2710</entry>
<entry>0.192</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>7.94</entry>
<entry>10.12</entry></row>
<row>
<entry>06381</entry>
<entry>C33-5</entry>
<entry>0.465</entry>
<entry>0.185</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.90</entry>
<entry>9.46</entry></row>
<row>
<entry>06258</entry>
<entry>C35-5</entry>
<entry>0.873</entry>
<entry>0.428</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.64</entry>
<entry>10.14</entry></row>
<row>
<entry>06086</entry>
<entry>C41-7</entry>
<entry>0.1242</entry>
<entry>0.072</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.91</entry>
<entry>10.14</entry></row>
<row>
<entry>06384</entry>
<entry>C47-2</entry>
<entry>0.180</entry>
<entry>0.010</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.07</entry>
<entry>9.62</entry></row>
<row>
<entry>06386</entry>
<entry>C47-4</entry>
<entry>0.121</entry>
<entry>0.047</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.07</entry>
<entry>9.62</entry></row>
<row>
<entry>06097</entry>
<entry>C64-2</entry>
<entry>1.4550</entry>
<entry>1.029</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.03</entry>
<entry>9.80</entry></row>
<row>
<entry>06099</entry>
<entry>C64-5</entry>
<entry>0.1175</entry>
<entry>0.068</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.03</entry>
<entry>9.80</entry></row>
<row>
<entry>06100</entry>
<entry>C64-6</entry>
<entry>1.1225</entry>
<entry>0.794</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.03</entry>
<entry>9.8</entry></row>
<row>
<entry>06006</entry>
<entry>C81-1</entry>
<entry>0.2850</entry>
<entry>0.202</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.96</entry>
<entry>9.64</entry></row>
<row>
<entry>06007</entry>
<entry>C81-2</entry>
<entry>0.3200</entry>
<entry>0.226</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.96</entry>
<entry>9.64</entry></row>
<row>
<entry>06016</entry>
<entry>C85-1</entry>
<entry>0.7540</entry>
<entry>0.435</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>8.01</entry>
<entry>10.16</entry></row>
<row>
<entry>06019</entry>
<entry>C85-5</entry>
<entry>1.4775</entry>
<entry>1.045</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.01</entry>
<entry>10.16</entry></row>
<row>
<entry>06394</entry>
<entry>C87-7</entry>
<entry>0.130</entry>
<entry>0.030</entry>
<entry>MRS</entry>
<entry>-2</entry>
<entry>3.03</entry>
<entry>9.42</entry></row>
<row>
<entry>06020</entry>
<entry>C92-1</entry>
<entry>0.1253</entry>
<entry>0.072</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.09</entry>
<entry>9.64</entry></row>
<row>
<entry>06021</entry>
<entry>C92-2</entry>
<entry>0.1678</entry>
<entry>0.097</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.09</entry>
<entry>9.64</entry></row>
<row>
<entry>06022</entry>
<entry>C92-4</entry>
<entry>0.1229</entry>
<entry>0.071</entry>
<entry>McC</entry>
<entry>-2</entry>
<entry>3.09</entry>
<entry>9.64</entry></row>
<row>
<entry>06396</entry>
<entry>C95-1</entry>
<entry>4.975</entry>
<entry>2.575</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.1</entry>
<entry>9.75</entry></row>
<row>
<entry>06037</entry>
<entry>C102-1</entry>
<entry>0.6767</entry>
<entry>0.391</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.90</entry>
<entry>8.55</entry></row>
<row>
<entry>06040</entry>
<entry>C102-7</entry>
<entry>0.2342</entry>
<entry>0.135</entry>
<entry>CS ana</entry>
<entry>-6</entry>
<entry>6.9</entry>
<entry>8.55</entry></row>
<row>
<entry>06080</entry>
<entry>C107-2</entry>
<entry>0.5050</entry>
<entry>0.357</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.1</entry>
<entry>9.55</entry></row>
<row>
<entry>06042</entry>
<entry>C107-3</entry>
<entry>0.1900</entry>
<entry>0.110</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.1</entry>
<entry>9.55</entry></row>
<row>
<entry>06043</entry>
<entry>C107-5</entry>
<entry>1.7600</entry>
<entry>1.245</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.1</entry>
<entry>9.55</entry></row>
<row>
<entry>06045</entry>
<entry>C107-10</entry>
<entry>0.1975</entry>
<entry>0.140</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.1</entry>
<entry>9.55</entry></row>
<row>
<entry>06046</entry>
<entry>C108-2</entry>
<entry>0.3925</entry>
<entry>0.278</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.12</entry>
<entry>10.54</entry></row>
<row>
<entry>06049</entry>
<entry>C108-10</entry>
<entry>0.2425</entry>
<entry>0.171</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>8.12</entry>
<entry>10.54</entry></row><!-- EPO <DP n="19"> -->
<row>
<entry>06057</entry>
<entry>C133-1</entry>
<entry>0.2475</entry>
<entry>0.175</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.98</entry>
<entry>10.49</entry></row>
<row>
<entry>06101</entry>
<entry>C133-4</entry>
<entry>0.1809</entry>
<entry>0.090</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.98</entry>
<entry>10.49</entry></row>
<row>
<entry>06160</entry>
<entry>C189-2</entry>
<entry>1.3483</entry>
<entry>0.778</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.07</entry>
<entry>10.19</entry></row>
<row>
<entry>06164</entry>
<entry>C189-16B</entry>
<entry>0.3295</entry>
<entry>0.190</entry>
<entry>CSH</entry>
<entry>-8</entry>
<entry>8.07</entry>
<entry>10.19</entry></row>
<row>
<entry>06176</entry>
<entry>C191-4</entry>
<entry>0.3975</entry>
<entry>0.281</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.96</entry>
<entry>10.34</entry></row>
<row>
<entry>06177</entry>
<entry>C191-5</entry>
<entry>0.3185</entry>
<entry>0.225</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.96</entry>
<entry>10.34</entry></row>
<row>
<entry>06293</entry>
<entry>C207-6</entry>
<entry>0.175</entry>
<entry>0.111</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.93</entry>
<entry>10.13</entry></row>
<row>
<entry>06295</entry>
<entry>C208-6</entry>
<entry>0.116</entry>
<entry>0.047</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.91</entry>
<entry>10.57</entry></row>
<row>
<entry>06301</entry>
<entry>C211-1</entry>
<entry>0.285</entry>
<entry>0.242</entry>
<entry>McC</entry>
<entry>-2</entry>
<entry>2.87</entry>
<entry>10.07</entry></row>
<row>
<entry>06329</entry>
<entry>C218-2</entry>
<entry>0.649</entry>
<entry>0.439</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.88</entry>
<entry>10.06</entry></row>
<row>
<entry>06338</entry>
<entry>C218-13</entry>
<entry>0.208</entry>
<entry>0.047</entry>
<entry>Cet</entry>
<entry>-5</entry>
<entry>5.88</entry>
<entry>10.06</entry></row>
<row>
<entry>06341</entry>
<entry>C218-16</entry>
<entry>0.304</entry>
<entry>0.218</entry>
<entry>Cet</entry>
<entry>-4</entry>
<entry>4.88</entry>
<entry>10.06</entry></row>
<row>
<entry>07064</entry>
<entry>C225-1</entry>
<entry>0.1280</entry>
<entry>0.0058</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.90</entry>
<entry>10.10</entry></row>
<row>
<entry>07065</entry>
<entry>C225-2</entry>
<entry>0.8354</entry>
<entry>0.7146</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.90</entry>
<entry>10.10</entry></row>
<row>
<entry>07066</entry>
<entry>C225-5</entry>
<entry>0.9200</entry>
<entry>0.4150</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.87</entry>
<entry>9.49</entry></row>
<row>
<entry>07067</entry>
<entry>C225-6</entry>
<entry>1.0792</entry>
<entry>0.5977</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.87</entry>
<entry>9.49</entry></row>
<row>
<entry>07068</entry>
<entry>C226-1</entry>
<entry>0.1193</entry>
<entry>0.0334</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.06</entry>
<entry>10.58</entry></row>
<row>
<entry>07073</entry>
<entry>C227-4</entry>
<entry>0.2164</entry>
<entry>0.1568</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.88</entry>
<entry>10.06</entry></row>
<row>
<entry>07120</entry>
<entry>C228-2</entry>
<entry>0.228</entry>
<entry>0.013</entry>
<entry>McC</entry>
<entry>-2</entry>
<entry>3.17</entry>
<entry>9.72</entry></row>
<row>
<entry>07121</entry>
<entry>C229-1</entry>
<entry>0.126</entry>
<entry>0.012</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.06</entry>
<entry>9.50</entry></row>
<row>
<entry>07122</entry>
<entry>C229-2</entry>
<entry>0.117</entry>
<entry>0.034</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.06</entry>
<entry>9.50</entry></row>
<row>
<entry>07123</entry>
<entry>C229-7</entry>
<entry>0.190</entry>
<entry>0.045</entry>
<entry>Cet</entry>
<entry>-5</entry>
<entry>6.06</entry>
<entry>9.50</entry></row>
<row>
<entry>07131</entry>
<entry>C232-5</entry>
<entry>0.190</entry>
<entry>0.122</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.98</entry>
<entry>9.60</entry></row>
<row>
<entry>07138</entry>
<entry>C235-1</entry>
<entry>0.658</entry>
<entry>0.193</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.02</entry>
<entry>9.42</entry></row></tbody></tgroup>
<tgroup cols="8">
<colspec colnum="1" colname="col1" colwidth="18mm" align="center"/>
<colspec colnum="2" colname="col2" colwidth="21mm" align="center"/>
<colspec colnum="3" colname="col3" colwidth="21mm" align="center"/>
<colspec colnum="4" colname="col4" colwidth="21mm" align="center"/>
<colspec colnum="5" colname="col5" colwidth="18mm" align="center"/>
<colspec colnum="6" colname="col6" colwidth="18mm" align="center"/>
<colspec colnum="7" colname="col7" colwidth="28mm" align="center"/>
<colspec colnum="8" colname="col8" colwidth="26mm" align="center"/>
<thead valign="middle">
<row>
<entry namest="col1" nameend="col8"><i>AIEC isolated from control subjects</i></entry></row></thead>
<tbody valign="middle">
<row>
<entry>06235</entry>
<entry>C174-6</entry>
<entry>2.833</entry>
<entry>2.468</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.05</entry>
<entry>10.59</entry></row>
<row>
<entry>06242</entry>
<entry>C177-1</entry>
<entry>0.251</entry>
<entry>0.175</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.99</entry>
<entry>9.95</entry></row>
<row>
<entry>06103</entry>
<entry>C177-13</entry>
<entry>0.1461</entry>
<entry>0.073</entry>
<entry>CS ana</entry>
<entry>-7</entry>
<entry>7.99</entry>
<entry>9.95</entry></row>
<row>
<entry>06105</entry>
<entry>C177-2</entry>
<entry>0.1571</entry>
<entry>0.079</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.99</entry>
<entry>9.95</entry></row>
<row>
<entry>06106</entry>
<entry>C178-23</entry>
<entry>0.4527</entry>
<entry>0.261</entry>
<entry>CSH</entry>
<entry>-5</entry>
<entry>6.03</entry>
<entry>10.24</entry></row>
<row>
<entry>06108</entry>
<entry>C179-7</entry>
<entry>0.1103</entry>
<entry>0.064</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.07</entry>
<entry>10.53</entry></row>
<row>
<entry>06142</entry>
<entry>C181-5</entry>
<entry>1.1525</entry>
<entry>0.815</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>4.01</entry>
<entry>9.96</entry></row>
<row>
<entry>06143</entry>
<entry>C183-12</entry>
<entry>0.2117</entry>
<entry>0.122</entry>
<entry>CSH</entry>
<entry>-7</entry>
<entry>8.2</entry>
<entry>9.95</entry></row>
<row>
<entry>06121</entry>
<entry>C183-2</entry>
<entry>0.1867</entry>
<entry>0.108</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.2</entry>
<entry>9.95</entry></row>
<row>
<entry>06122</entry>
<entry>C183-5</entry>
<entry>1.1025</entry>
<entry>0.780</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>3.20</entry>
<entry>9.95</entry></row>
<row>
<entry>06145</entry>
<entry>C184-17</entry>
<entry>0.1095</entry>
<entry>0.077</entry>
<entry>CSH</entry>
<entry>-5</entry>
<entry>6.09</entry>
<entry>9.64</entry></row><!-- EPO <DP n="20"> -->
<row>
<entry>06146</entry>
<entry>C185-22</entry>
<entry>0.3933</entry>
<entry>0.227</entry>
<entry>CSH</entry>
<entry>-5</entry>
<entry>5.88</entry>
<entry>9.88</entry></row>
<row>
<entry>06126</entry>
<entry>C185-1</entry>
<entry>0.6050</entry>
<entry>0.428</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.88</entry>
<entry>9.88</entry></row>
<row>
<entry>06135</entry>
<entry>C185-2</entry>
<entry>0.4500</entry>
<entry>0.318</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.88</entry>
<entry>9.88</entry></row>
<row>
<entry>06136</entry>
<entry>C185-3</entry>
<entry>0.4875</entry>
<entry>0.345</entry>
<entry>McC</entry>
<entry>-2</entry>
<entry>2.88</entry>
<entry>9.88</entry></row>
<row>
<entry>06137</entry>
<entry>C185-6</entry>
<entry>0.3125</entry>
<entry>0.221</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.88</entry>
<entry>9.88</entry></row>
<row>
<entry>06127</entry>
<entry>C186-1</entry>
<entry>0.1063</entry>
<entry>0.053</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.86</entry>
<entry>10.04</entry></row>
<row>
<entry>06129</entry>
<entry>C186-4</entry>
<entry>0.4700</entry>
<entry>0.332</entry>
<entry>Cet</entry>
<entry>-3</entry>
<entry>3.86</entry>
<entry>10.04</entry></row>
<row>
<entry>06158</entry>
<entry>C188-15</entry>
<entry>0.1052</entry>
<entry>0.061</entry>
<entry>CS ana</entry>
<entry>-6</entry>
<entry>6.94</entry>
<entry>9.60</entry></row>
<row>
<entry>06196</entry>
<entry>C192-11</entry>
<entry>0.508</entry>
<entry>0.279</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.92</entry>
<entry>9.44</entry></row>
<row>
<entry>06197</entry>
<entry>C195-1</entry>
<entry>0.206</entry>
<entry>0.157</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.95</entry>
<entry>9.72</entry></row>
<row>
<entry>06198</entry>
<entry>C195-2</entry>
<entry>1.806</entry>
<entry>1.363</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>4.95</entry>
<entry>9.72</entry></row>
<row>
<entry>06200</entry>
<entry>C195-6</entry>
<entry>2.498</entry>
<entry>1.482</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.95</entry>
<entry>9.72</entry></row>
<row>
<entry>06201</entry>
<entry>C196-1</entry>
<entry>0.218</entry>
<entry>0.105</entry>
<entry>McC</entry>
<entry>-7</entry>
<entry>7.87</entry>
<entry>9.61</entry></row>
<row>
<entry>06204</entry>
<entry>C196-4</entry>
<entry>0.307</entry>
<entry>0.163</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>5.87</entry>
<entry>9.61</entry></row>
<row>
<entry>06212</entry>
<entry>C197-1</entry>
<entry>3.133</entry>
<entry>1.438</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.86</entry>
<entry>10.32</entry></row>
<row>
<entry>06213</entry>
<entry>C197-2</entry>
<entry>0.445</entry>
<entry>0.042</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>6.86</entry>
<entry>10.32</entry></row>
<row>
<entry>06216</entry>
<entry>C197-6</entry>
<entry>0.886</entry>
<entry>0.782</entry>
<entry>Cet</entry>
<entry>-2</entry>
<entry>2.86</entry>
<entry>10.32</entry></row>
<row>
<entry>06217</entry>
<entry>C198-1</entry>
<entry>0.143</entry>
<entry>0.112</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.07</entry>
<entry>10.03</entry></row>
<row>
<entry>06218</entry>
<entry>C198-2</entry>
<entry>0.113</entry>
<entry>0.096</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.07</entry>
<entry>10.03</entry></row>
<row>
<entry>06221</entry>
<entry>C199-3</entry>
<entry>5.367</entry>
<entry>3.132</entry>
<entry>McC</entry>
<entry>-4</entry>
<entry>5.06</entry>
<entry>9.79</entry></row>
<row>
<entry>06222</entry>
<entry>C199-4</entry>
<entry>1.353</entry>
<entry>0.942</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>4.06</entry>
<entry>9.79</entry></row>
<row>
<entry>06223</entry>
<entry>C199-5</entry>
<entry>2.980</entry>
<entry>2.122</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>4.06</entry>
<entry>9.79</entry></row>
<row>
<entry>06224</entry>
<entry>C199-6</entry>
<entry>5.398</entry>
<entry>2.837</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>4.06</entry>
<entry>9.79</entry></row>
<row>
<entry>06225</entry>
<entry>C200-1</entry>
<entry>0.538</entry>
<entry>0.277</entry>
<entry>McC</entry>
<entry>-3</entry>
<entry>4.06</entry>
<entry>9.79</entry></row>
<row>
<entry>07032</entry>
<entry>C222-1</entry>
<entry>0.1038</entry>
<entry>0.0783</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.14</entry>
<entry>10.88</entry></row>
<row>
<entry>07033</entry>
<entry>C222-2</entry>
<entry>1.2425</entry>
<entry>0.6575</entry>
<entry>McC</entry>
<entry>-6</entry>
<entry>7.14</entry>
<entry>10.88</entry></row>
<row>
<entry>07125</entry>
<entry>C230-1</entry>
<entry>0.300</entry>
<entry>0.055</entry>
<entry>McC</entry>
<entry>-5</entry>
<entry>6.0</entry>
<entry>10.2</entry></row></tbody></tgroup>
<tgroup cols="8" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="18mm" align="justify"/>
<colspec colnum="2" colname="col2" colwidth="21mm"/>
<colspec colnum="3" colname="col3" colwidth="21mm"/>
<colspec colnum="4" colname="col4" colwidth="21mm"/>
<colspec colnum="5" colname="col5" colwidth="18mm"/>
<colspec colnum="6" colname="col6" colwidth="18mm"/>
<colspec colnum="7" colname="col7" colwidth="28mm"/>
<colspec colnum="8" colname="col8" colwidth="26mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col8"><sup>1</sup> McC = McConkey Agar (bioMérieux)<br/>
Cet = Cetrimide Agar (bioMérieux)<br/>
CS ana = anaerobic Columbia blood agar<br/>
MRS = Man Rogosa Sharp Agar (Oxoid)<br/>
CSH = Columbia SH Agar<br/>
<b><sup>2</sup></b> The "level of <i>E. coli"</i> refers to the amount of the AIEC strain in the feces.<br/>
<b><sup>3</sup></b> "Total Count" refers to all bacterial species in feces.</entry></row></tbody></tgroup>
</table>
</tables></p>
<p id="p0061" num="0061">CS ana culture medium has the following composition (per liter medium):
<ul id="ul0003" list-style="dash" compact="compact">
<li>39 g of Columbia blood agar base (Oxoid)</li>
<li>5 g of glucose<!-- EPO <DP n="21"> --></li>
<li>0.3 g of cysteine chlorohydrate</li>
<li>5 g of agar</li>
<li>pH 7.0 ± 0.2</li>
</ul></p>
<p id="p0062" num="0062">The mixture is sterilized for 15 minutes at 121°C. Just before plating, 5% of horse blood is added.</p>
<p id="p0063" num="0063">CSH culture medium has the following composition (per liter medium):
<ul id="ul0004" list-style="dash" compact="compact">
<li>39 g of Columbia blood agar base (Oxoid)</li>
<li>3 g of cysteine chlorohydrate</li>
<li>pH 6.8 ± 0.2</li>
</ul></p>
<p id="p0064" num="0064">The mixture is sterilized for 15 minutes at 121°C. Just before plating, 2 ml of sterile ammonium citrate solution (0.25 g/10 ml water) are added. After incubation, bacteria using cysteine (and releasing sulfide) result in black colonies on this medium.</p>
<heading id="h0011"><u>EXAMPLE 2</u></heading>
<heading id="h0012"><b>Phage isolation</b></heading>
<p id="p0065" num="0065">Phages were isolated from sewage water as follows: sewage water was filtered at 0.2 µm and mixed with an equal volume of 2X Luria-Bertani (LB) medium. This mixture was inoculated with a fresh culture of LF82 strain and incubated on a shaker at 37°C overnight. Chloroform (1/10 volume) was added to the flask and placed on a shaker for one hour. The medium was centrifuged at 10,000 g for 10 min. 1 ml of the supernatant was collected and 1/10 vol. of chloroform was added. After a brief mix by vortex, the Eppendorf tube was centrifuged at 7,500 g for 5 min. To determine if phages were present in this extract, a drop (10 µl) of the supernatant was applied on an LB agar plate and allowed to dry. Using a platinum wire, the plate was streaked from the drop through the rest of the plate to isolate individual phages. 1 ml of a growing culture of LF82 strain was applied to cover the entire plate; the excess was removed and the plate was incubated at 37°C overnight. One or two plaques were picked up and resuspended in 200 µl of SM buffer (10 mM TrisHCl pH7, NaCl 200 mM, gelatin 0.03%). 20 µl of chloroform was added in each tube and tubes were briefly mixed by vortex and centrifuged at 7,500 g for 5 min. 10 µl of the supernatant was applied on a LB plate and allowed to dry and the previous procedure was repeated at least three times. Once the majority of isolated plaques were homogenous, 10 µl of the last resuspended plaque were added to 1 ml of growing culture of LF82 strain at OD 0.1 at 600 nm. This culture tube was incubated at 37°C for 2 to 4 hours until lysis occurred. After addition<!-- EPO <DP n="22"> --> of 1/10 vol. of chloroform, the culture was transferred to an Eppendorf tube, centrifuged at 7,500 g for 5 min and cooled to 4°C, thereby obtaining the primary stock. Several dilutions of this stock were kept at 4°C and used to infect a larger volume of culture in order to prepare larger amounts of phages. Seven (7) phages were obtained as follows:
<ul id="ul0005" list-style="bullet" compact="compact">
<li>vB_EcoM_LF82_P1 (herein before and after P1) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4694;</li>
<li>vB_EcoM_LF82_P2 (herein before and after P2) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695;</li>
<li>vB_EcoM_LF82_P3 (herein before and after P3) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4696;</li>
<li>vB_EcoM_LF82_P4 (herein before and after P4) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4697;</li>
<li>vB_EcoM_LF82_P5 (herein before and after P5) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4698;</li>
<li>vB_EcoM_LF82_P6 (herein before and after P6) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4699; and</li>
<li>vB_EcoM_LF82_P8 (herein before and after P8) deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4700.</li>
</ul></p>
<p id="p0066" num="0066">CLB_P2, deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4675, and its isolation is described in detail in <nplcit id="ncit0008" npl-type="s"><text>Maura et al. Environmental Microbiology (2012) 14(8), 1844-1854</text></nplcit>.</p>
<p id="p0067" num="0067">P1 to P6 phages belong to the wV8 bacteriophage family.</p>
<p id="p0068" num="0068">P8 belongs to the RB69 bacteriophage family.<!-- EPO <DP n="23"> --></p>
<p id="p0069" num="0069">CLB_P2 belongs to the JS98 bacteriophage family.</p>
<p id="p0070" num="0070">The classification into the wV8, RB69 and JS98 bacteriophage families was done based on the sequence of the major capsid protein.</p>
<heading id="h0013"><u>EXAMPLE 3</u></heading>
<heading id="h0014"><b><i>In vitro</i> assays of the infectivity of bacteriophages in AIEC strains</b></heading>
<p id="p0071" num="0071">Plaque assay was carried out by contacting serial dilutions of bacteriophage solutions (from not diluted to 10<sup>-8</sup> dilution) with a Petri dish which surface was covered by one bacterium. After overnight incubation at 37°C plaques were counted. When the bacterium tested was the bacterial host (reference host) used to isolate bacteriophages it was considered that the plaque assay gave an efficiency of 100%. When the bacterium tested was not the original host, then the results were expressed by comparison to the reference host. A result greater than 80% (+++) means that the bacterium is a highly efficient host compared to the reference host, while a result between 0.1 and 80% (++) means that the bacterium is an efficient host, and a result below 0.1% (+) but above 0 means that the bacterium is a moderately efficient host, and finally 0 (-) means that the bacterium is totally resistant.</p>
<heading id="h0015"><b>Results</b></heading>
<p id="p0072" num="0072">Table 2 shows the result of the host spectrum of the 8 phages (as isolated/identified in Example 2) on 38 strains (out of the 166 strains isolated in Example 1, Table 1)
<tables id="tabl0002" num="0002">
<table frame="all">
<title><u>Table 2 Strains tested and effective efficiency of plating (EOP) obtained for each bacteriophage</u></title>
<tgroup cols="9">
<colspec colnum="1" colname="col1" colwidth="29mm"/>
<colspec colnum="2" colname="col2" colwidth="14mm"/>
<colspec colnum="3" colname="col3" colwidth="14mm"/>
<colspec colnum="4" colname="col4" colwidth="14mm"/>
<colspec colnum="5" colname="col5" colwidth="14mm"/>
<colspec colnum="6" colname="col6" colwidth="14mm"/>
<colspec colnum="7" colname="col7" colwidth="14mm"/>
<colspec colnum="8" colname="col8" colwidth="14mm"/>
<colspec colnum="9" colname="col9" colwidth="17mm"/>
<thead valign="top">
<row>
<entry align="center"><b>Bacterial Strain</b></entry>
<entry namest="col2" nameend="col9" align="center"><b>Bacteriophage</b></entry></row>
<row>
<entry align="center"/>
<entry align="center"><b>P1</b></entry>
<entry align="center"><b>P2</b></entry>
<entry align="center"><b>P3</b></entry>
<entry align="center"><b>P4</b></entry>
<entry align="center"><b>P5</b></entry>
<entry align="center"><b>P6</b></entry>
<entry align="center"><b>P8</b></entry>
<entry align="center"><b>CLB P2</b></entry></row></thead>
<tbody>
<row>
<entry align="center"><b>LF82</b></entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry></row>
<row>
<entry align="center"><b>06023</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>06030</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+</entry>
<entry align="center">+++</entry></row>
<row>
<entry align="center"><b>06033</b></entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+++</entry></row>
<row>
<entry align="center"><b>06066</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+++</entry>
<entry align="center">-</entry></row><!-- EPO <DP n="24"> -->
<row>
<entry align="center"><b>06072</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>06073</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+</entry>
<entry align="center">+++</entry></row>
<row>
<entry align="center"><b>06075</b></entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>06088</b></entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06089</b></entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06122</b></entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06150</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06351</b></entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>06353</b></entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06354</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06356</b></entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06357</b></entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06358</b></entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06359</b></entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06361</b></entry>
<entry align="center">+</entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>06362</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07045</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07046</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07048</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07051</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07075</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07076</b></entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07077</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07078</b></entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07081</b></entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">+</entry>
<entry align="center">+</entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07082</b></entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07107</b></entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">-</entry>
<entry align="center">+++</entry></row>
<row>
<entry align="center"><b>07126</b></entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07127</b></entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">+++</entry>
<entry align="center">+++</entry>
<entry align="center">++</entry>
<entry align="center">++</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07128</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07134</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row>
<row>
<entry align="center"><b>07135</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">++</entry></row>
<row>
<entry align="center"><b>07136</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry></row><!-- EPO <DP n="25"> -->
<row>
<entry align="center"><b>07137</b></entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">-</entry>
<entry align="center">++</entry>
<entry align="center">-</entry></row></tbody></tgroup>
</table>
</tables>
<tables id="tabl0003" num="0003">
<table frame="all">
<title><u>Table 3 number of strains infected by phages:</u></title>
<tgroup cols="9">
<colspec colnum="1" colname="col1" colwidth="18mm"/>
<colspec colnum="2" colname="col2" colwidth="10mm"/>
<colspec colnum="3" colname="col3" colwidth="10mm"/>
<colspec colnum="4" colname="col4" colwidth="10mm"/>
<colspec colnum="5" colname="col5" colwidth="10mm"/>
<colspec colnum="6" colname="col6" colwidth="10mm"/>
<colspec colnum="7" colname="col7" colwidth="10mm"/>
<colspec colnum="8" colname="col8" colwidth="10mm"/>
<colspec colnum="9" colname="col9" colwidth="16mm"/>
<thead valign="top">
<row>
<entry><b>Efficacy</b></entry>
<entry><b>P1</b></entry>
<entry><b>P2</b></entry>
<entry><b>P3</b></entry>
<entry><b>P4</b></entry>
<entry><b>P5</b></entry>
<entry><b>P6</b></entry>
<entry><b>P8</b></entry>
<entry><b>CLB P2</b></entry></row></thead>
<tbody>
<row>
<entry>+</entry>
<entry>3</entry>
<entry>5</entry>
<entry>6</entry>
<entry>9</entry>
<entry>9</entry>
<entry>8</entry>
<entry>8</entry>
<entry align="center">0</entry></row>
<row>
<entry>++</entry>
<entry>10</entry>
<entry>8</entry>
<entry>8</entry>
<entry>6</entry>
<entry>6</entry>
<entry>7</entry>
<entry>1</entry>
<entry align="center">13</entry></row>
<row>
<entry>+++</entry>
<entry>5</entry>
<entry>6</entry>
<entry>5</entry>
<entry>4</entry>
<entry>4</entry>
<entry>4</entry>
<entry>4</entry>
<entry align="center">5</entry></row>
<row>
<entry><b>Total/38</b></entry>
<entry>18</entry>
<entry>19</entry>
<entry>19</entry>
<entry>19</entry>
<entry>19</entry>
<entry>19</entry>
<entry>13</entry>
<entry align="center">18</entry></row></tbody></tgroup>
<tgroup cols="9" rowsep="0">
<colspec colnum="1" colname="col1" colwidth="18mm" align="justify"/>
<colspec colnum="2" colname="col2" colwidth="10mm"/>
<colspec colnum="3" colname="col3" colwidth="10mm"/>
<colspec colnum="4" colname="col4" colwidth="10mm"/>
<colspec colnum="5" colname="col5" colwidth="10mm"/>
<colspec colnum="6" colname="col6" colwidth="10mm"/>
<colspec colnum="7" colname="col7" colwidth="10mm"/>
<colspec colnum="8" colname="col8" colwidth="10mm"/>
<colspec colnum="9" colname="col9" colwidth="16mm"/>
<tbody>
<row>
<entry namest="col1" nameend="col9">Numbers indicate the number of strains<br/>
infected by one bacteriophage</entry></row></tbody></tgroup>
</table>
</tables></p>
<heading id="h0016"><u>EXAMPLE 4</u></heading>
<heading id="h0017"><b><i>In vivo</i> replication of bacteriophages in the gut of mice</b></heading>
<p id="p0073" num="0073"><i>In vivo</i> replication of bacteriophages in the gut of mice was evaluated as follows:<br/>
First, the strain LF82 was engineered to carry two antibiotic resistance genes conferring respectively resistance to Streptomycin and Kanamycin. This new bacterial strain was named LF82SK and its invasive properties were verified as to be similar to the original LF82 strain.</p>
<p id="p0074" num="0074">Three (3) groups of two (2) mice each:
<ul id="ul0006" list-style="none" compact="compact">
<li>Group 1: non-colonized mice + phages</li>
<li>Group 2: LF82SK colonized mice</li>
<li>Group 3: LF82SK colonized mice + phages</li>
</ul></p>
<p id="p0075" num="0075">Streptomycin (5 g/L) was added to drinking water of all animals 3 days before day 0 and kept along the experiment.</p>
<p id="p0076" num="0076">At day 0, LF82SK was administered to Group 2 and 3 in order to allow the strain to colonize mice's gut.</p>
<p id="p0077" num="0077">At day 4, 200 µl of a cocktail of P2 + P6 bacteriophages was administered to Group 1 and 3 (gavage solution 10<sup>8</sup> pfu/ml) once in the morning and once in the afternoon. P2+P6 bacteriophages were also added to the drinking water (10<sup>8</sup> pfu/ml). At day 5 in the morning, mice were sacrificed to evaluate the number of bacteria and bacteriophages in the ileum and in the feces.<!-- EPO <DP n="26"> --></p>
<heading id="h0018">Results:</heading>
<heading id="h0019"><i>Bacteria (E. coli):</i></heading>
<p id="p0078" num="0078">
<ul id="ul0007" list-style="none" compact="compact">
<li>Group 1: no bacteria;</li>
<li>Group 2: in ileum - 10<sup>6</sup> cfu/g organ; in feces - 10<sup>8</sup> cfu/organ;</li>
<li>Group 3: in ileum and feces: bacteria all lysed by phages.</li>
</ul></p>
<heading id="h0020"><i>Phages:</i></heading>
<p id="p0079" num="0079">
<ul id="ul0008" list-style="none" compact="compact">
<li>Group 1: in ileum - 10<sup>6</sup> pfu/g organ; in feces - 10<sup>7</sup> pfu/organ;</li>
<li>Group 2: no phages</li>
<li>Group 3: in ileum - 10<sup>6</sup> pfu/g organ; in feces - 10<sup>10</sup> pfu/organ;</li>
</ul></p>
<p id="p0080" num="0080">In the feces, there were 100 times more phages in Group 3 than in Group 1 showing the multiplication of the phages <i>in vivo.</i></p>
<heading id="h0021"><u>EXAMPLE 5</u></heading>
<heading id="h0022"><b><i>In vivo</i> replication of bacteriophages in the gut of mice</b></heading>
<p id="p0081" num="0081"><i>In vivo</i> replication of bacteriophages in the gut of mice was evaluated as follows:<br/>
12 mice were dispatched into three (3) groups of four (4) mice each:
<ul id="ul0009" list-style="none" compact="compact">
<li>Group 1: non-colonized mice + phages</li>
<li>Group 2: LF82SK-colonized mice</li>
<li>Group 3: LF82SK-colonized mice + phages</li>
</ul></p>
<p id="p0082" num="0082">Streptomycin (5 g/L) was added to drinking water of all animals 3 days before day 0 and kept along the experiment.</p>
<p id="p0083" num="0083">At day 0, LF82SK was given to mice of Group 2 and 3 in order to allow the strain to colonize mice's gut.</p>
<p id="p0084" num="0084">At day 4, bacteriophages (cocktail of P2+P6+P8 at 10<sup>8</sup> pfu/mL each) were added in the drinking water of Group 1 and 3.</p>
<p id="p0085" num="0085">At day 5, mice were sacrificed to evaluate the number of bacteria and bacteriophages in the ileum and in the feces. 100 µl of ileal homogenates from the three groups were taken to extract whole DNA using Maxwell<sup>®</sup> 16 Tissue DNA purification kit from Promega.</p>
<heading id="h0023">Results:</heading><!-- EPO <DP n="27"> -->
<heading id="h0024"><i>Bacteria (E. coli):</i></heading>
<p id="p0086" num="0086">
<ul id="ul0010" list-style="none" compact="compact">
<li>Group 1: no bacteria;</li>
<li>Group 2: in ileum - 3.2·10<sup>6</sup> cfu/g of organ; in feces - 1.2·10<sup>9</sup> cfu/g of feces;</li>
<li>Group 3: in ileum and feces: bacteria all lysed by phages.</li>
</ul></p>
<heading id="h0025"><i>Phages:</i></heading>
<p id="p0087" num="0087">
<ul id="ul0011" list-style="none" compact="compact">
<li>Group 1: in ileum - 1.4·10<sup>6</sup> pfu/g of organ ; in feces - 5.2·10<sup>6</sup> pfu/g of feces;</li>
<li>Group 2: no phages</li>
<li>Group 3: in ileum - 2.6·10<sup>6</sup> pfu/g of organ; in feces - 1.0·10<sup>9</sup> pfu/g of feces;</li>
</ul></p>
<p id="p0088" num="0088">In the feces, there were 200 times more phages in Group 3 than in Group 1 showing the multiplication of the phages <i>in vivo.</i></p>
<p id="p0089" num="0089">DNA extracted from ileal sections was used to run quantitative PCR using two sets of primers. One set of primers (SEQ ID NO: 30-31) served to amplify DNA from "all bacteria" present in the sample while the second set (SEQ ID NO: 32-33) was used to amplify specifically DNA from "<i>E. coli</i>" bacteria. After normalization, results were expressed as the ratio of <i>E. coli</i> versus all bacteria.</p>
<p id="p0090" num="0090">Group 1: qPCR amplifications were successful with all bacteria primers but not with <i>E</i>. <i>coli</i> primers. The ratio could not be calculated.</p>
<p id="p0091" num="0091">Group 2: qPCR amplifications were successful with both set of primers. The average ratio was 0.6 (60% of total bacteria were <i>E. coli</i> bacteria)</p>
<p id="p0092" num="0092">Group 3: qPCR amplifications were successful with both set of primers. The average ratio was 0.1 (10% of total bacteria were <i>E. coli</i> bacteria). Note that one mouse displayed a ratio of 0.4 while the three others displayed much lower values (0.06; 0.0002; 0.002).</p>
<p id="p0093" num="0093">In consequence bacteriophages were able to reduce the level of ileal colonization of LF82 bacteria by at least one order of magnitude in three mice out of four.</p>
<heading id="h0026"><u>EXAMPLE 6</u></heading>
<heading id="h0027"><b><i>In vivo</i> assay of the infectivity of bacteriophages</b></heading>
<p id="p0094" num="0094">Two cocktails of phages are selected for testing in wild-type (WT) mice and in CEACAM6 mice infected with the LF82 <i>E. coli</i> strain isolated from the CD patients.<!-- EPO <DP n="28"> --> In both WT mice and in CEACAM6 mice infected with the LF82 <i>E. coli</i> strain isolated from the CD patients, bacteriophages are administered to the mice by oral gavage in CMC. This kind of administration has many advantages: known quantity of bacteriophage administration and immediate gastric acidity neutralization. Phages are daily administered to the mice during the entire study.
<ul id="ul0012" list-style="dash" compact="compact">
<li>Mice are sacrificed at 5 days after LF82 administration.</li>
<li>Main criteria: quantification of LF82 in ileal and colonic adherent flora of the mice.</li>
<li>Minor criteria:
<ul id="ul0013" list-style="none" compact="compact">
<li>∘ Evaluation of weight</li>
<li>∘ Stool consistency.</li>
<li>∘ Presence of fecal blood (macro and bio)</li>
</ul></li>
<li>Luminal flora (conventional flora + LF82 + phages)
<ul id="ul0014" list-style="none" compact="compact">
<li>∘ At sacrifice: Macroscopic and histologic examinations, adherent ileal and colonic flora + LF82 + phages,</li>
<li>∘ At sacrifice: Macroscopic and histologic examinations, adherent ileal and colonic flora + LF82 + phages,</li>
</ul></li>
</ul></p>
<p id="p0095" num="0095">Biological parameters of inflammation are monitored, and bacteriophage translocation in the mesenteric lymph nodes (MLN), liver and spleen is searched for.</p>
<p id="p0096" num="0096">Inflammation markers (MPO, pro-inflammatory cytokines IL-6, IL-12 and antiinflammatory cytokines IL-10) are monitored. Bacteriophage and AIEC translocation in MLN, liver and spleen is searched for.</p>
<p id="p0097" num="0097">Follow-up of bacteriophage elimination takes place in stools of mice receiving the bacteriophage cocktail without the LF82 strain.</p>
<heading id="h0028"><u>EXAMPLE 7</u></heading>
<heading id="h0029"><b><i>In vivo</i> assay of a cocktail of phages on the LF82 strain.</b></heading>
<p id="p0098" num="0098"><i>In vivo</i> replication of bacteriophages (cocktail of P2+P6+P8+CLB P2) in the gut of mice was evaluated as follows:<br/>
20 mice were dispatched into two (2) groups of ten (10) mice each:
<ul id="ul0015" list-style="none" compact="compact">
<li>Group 1: LF82SK-colonized mice<!-- EPO <DP n="29"> --></li>
<li>Group 2: LF82SK-colonized mice + phages</li>
</ul></p>
<p id="p0099" num="0099">Streptomycin (5 g/L) was added to drinking water of all animals 3 days before day 0 and kept along the experiment.</p>
<p id="p0100" num="0100">At day 0, LF82SK was given to mice of both groups in order to allow the strain to colonize mice's gut.</p>
<p id="p0101" num="0101">At day 3, bacteriophages (cocktail of P2+P6+P8+CLB_P2 at 10<sup>8</sup> pfu/mL each) were given to mice of Group 2 by gavage.</p>
<p id="p0102" num="0102">At day 4 and 7, 5 mice of each group were sacrificed to evaluate the number of bacteria and bacteriophages in the ileum, in the colon and in the feces. 100 µl of ileal and colonic homogenates from the two groups were taken to extract whole DNA using Maxwell<sup>®</sup> 16 Tissue DNA purification kit from Promega.</p>
<heading id="h0030">Results:</heading>
<heading id="h0031"><u>Level of LF82 in stools:</u></heading>
<p id="p0103" num="0103">At day 4 and 7 levels of LF82 were:
<ul id="ul0016" list-style="none" compact="compact">
<li>in group 1: 7 10<sup>9</sup> ; 1 10<sup>9</sup> cfu/g</li>
<li>in group 2: 8 10<sup>7</sup> ; 5 10<sup>8</sup> cfu/g</li>
</ul></p>
<heading id="h0032"><u>Level of Phages in stools:</u></heading>
<p id="p0104" num="0104">At day 4 and 7 levels of Phages were:
<ul id="ul0017" list-style="none" compact="compact">
<li>in group 1: none</li>
<li>in group 2: 5 10<sup>9</sup>; 6 10<sup>9</sup> pfu/g</li>
</ul></p>
<p id="p0105" num="0105">In the presence of the phage cocktail the level of LF82 in stools was significantly lower than in their absence showing that the phage cocktail was able to infect LF82 inside mice's gut.</p>
<heading id="h0033"><u>Level of LF82 in organs:</u></heading>
<p id="p0106" num="0106">at day 4 levels of LF82 were:
<ul id="ul0018" list-style="none" compact="compact">
<li>in ileum of group 1: 100% of bacteria are E. coli (LF82)</li>
<li>in ileum of group 2: 20% of bacteria are E. coli (LF82)</li>
<li>in colon of group 1: 40% of bacteria are E. coli (LF82)</li>
<li>in colon of group 2: 2% of bacteria are E. coli (LF82)</li>
</ul><!-- EPO <DP n="30"> --></p>
<p id="p0107" num="0107">at day 7 levels of LF82 were:
<ul id="ul0019" list-style="none" compact="compact">
<li>in ileum of group 1: 100% of bacteria are E. coli (LF82)</li>
<li>in ileum of group 2: 50% of bacteria are E. coli (LF82)</li>
<li>in colon of group 1: 25% of bacteria are E. coli (LF82)</li>
<li>in colon of group 2: 10% of bacteria are E. coli (LF82)</li>
</ul></p>
<heading id="h0034"><u>Level of Phages in organs:</u></heading>
<p id="p0108" num="0108">at day 4 levels of Phages were:
<ul id="ul0020" list-style="none" compact="compact">
<li>in ileum of group 1: none</li>
<li>in ileum of group 2: 7 10<sup>8</sup> pfu/g</li>
<li>in colon of group 1: none</li>
<li>in colon of group 2: 5 10<sup>10</sup> pfu/g</li>
</ul></p>
<p id="p0109" num="0109">at day 7 levels of LF82 were:
<ul id="ul0021" list-style="none" compact="compact">
<li>in ileum of group 1: none</li>
<li>in ileum of group 2: 7 10<sup>8</sup> pfu/g</li>
<li>in colon of group 1: none</li>
<li>in colon of group 4: 2 10<sup>8</sup> pfu/g</li>
</ul></p>
<p id="p0110" num="0110">At day 2 and 5 the level of LF82 was reduced in both ileum and colon in the group treated by phages. This shows that phages infect LF82 in gut sections and not only in stools. Concomitantly, the level of phages at day 7 stays as high as at day 2 showing that phage can last several days in the gut after a unique initial administration.</p>
<heading id="h0035"><u>EXAMPLE 8</u></heading>
<heading id="h0036"><b><i>In vivo</i> assay of the infectivity of bacteriophages</b></heading>
<p id="p0111" num="0111"><i>In vivo</i> assay of the infectivity of bacteriophages (cocktail of P2+P6+P8) in CEACAM6 mice infected with LF82SK was evaluated as follows:<br/>
48 mice were dispatched into three (4) groups as follows:
<ul id="ul0022" list-style="none" compact="compact">
<li>Group 1: non-colonized mice (8 mice)</li>
<li>Group 2: non-colonized mice + phages (12 mice)</li>
<li>Group 3: LF82SK-colonized mice (16 mice)</li>
<li>Group 4: LF82SK-colonized mice + phages (12 mice)</li>
</ul><!-- EPO <DP n="31"> --></p>
<p id="p0112" num="0112">DSS (dextran sulfate) 0.25% was introduced in the drinking water 3 days before day 0 and kept along the experiment.</p>
<p id="p0113" num="0113">Streptomycin (5mg) was administrated by oral gavage to all animals 1 day before day 0.</p>
<p id="p0114" num="0114">At day 0, LF82SK was administered to mice of Group 3 and 4 in order to allow the strain to colonize mice's gut.</p>
<p id="p0115" num="0115">At day 1, phages (cocktail of P2+P6+P8 at 10<sup>7</sup> pfu/mL each) were administered once to each mouse of Group 2 and 4 by oral gavage in CMC. This kind of administration has many advantages: known quantity of bacteriophage administration and immediate gastric acidity neutralization.</p>
<p id="p0116" num="0116">At day 1, 4 mice from Group 3 were sacrificed to evaluate the number of bacteria in the ileum, in the colon and in the feces before the administration of phages.</p>
<p id="p0117" num="0117">At day 2, respectively 4, 6, 6 and 6 mice from Groups 1, 2, 3 and 4 were sacrificed to evaluate the number of bacteria and bacteriophages in the ileum, in the colon and in the feces.</p>
<p id="p0118" num="0118">At day 5, respectively 4, 6, 6 and 6 mice from Groups 1, 2, 3 and 4 were sacrificed to evaluate the number of bacteria and bacteriophages in the ileum, in the colon and in the feces.</p>
<p id="p0119" num="0119">100 µl of ileal, colon and feces homogenates from the four groups were taken to extract whole DNA using Maxwell<sup>®</sup> 16 Tissue DNA purification kit from Promega. Weight, stool consistency and presence of fecal blood were monitored daily.</p>
<p id="p0120" num="0120">DNA extracted from ileal sections was used to run quantitative PCR using one set of primers (SEQ ID NO: 44-45) to amplify a specific gene (pMT1) from LF82. Results were expressed as the number of copies of this gene per gram of tissues.
<ul id="ul0023" list-style="none" compact="compact">
<li>LF82 pMT1 F (SEQ ID NO:44) CCATTCATGCAGCAGCTCTTT</li>
<li>LF82 pMT1 R (SEQ ID NO:45) ATCGGACAACATTAGCGGTGT</li>
</ul></p>
<heading id="h0037">Results:</heading>
<p id="p0121" num="0121">Values represent the median values obtained for each group of mice.</p>
<p id="p0122" num="0122">In group 1, neither LF82 nor Phages were detected along the experiment.<!-- EPO <DP n="32"> --></p>
<heading id="h0038"><u>Level of LF82 in stools:</u></heading>
<p id="p0123" num="0123">
<ul id="ul0024" list-style="none" compact="compact">
<li>At day 1: the level of LF82 in Groups 3 and 4 were 5 10<sup>9</sup> and 6 10<sup>9</sup> cfu/g resp.</li>
<li>At day 2, 3 and 5 levels of LF82 were:
<ul id="ul0025" list-style="none" compact="compact">
<li>in group 3: 3 10<sup>9</sup> ; 5 10<sup>8</sup> ; 5 10<sup>7</sup> cfu/g</li>
<li>in group 4: 5 10<sup>5</sup> ; 5 10<sup>5</sup>; 5 10<sup>3</sup> cfu/g</li>
</ul></li>
</ul></p>
<heading id="h0039"><u>Level of Phages in stools:</u></heading>
<p id="p0124" num="0124">At day 2, 3 and 5 levels of Phages were:
<ul id="ul0026" list-style="none" compact="compact">
<li>in group 2: 5 10<sup>5</sup> pfu/g; not detected; not detected</li>
<li>in group 4: 1 10<sup>9</sup>; 1 10<sup>7</sup>; 5 10<sup>6</sup> pfu/g</li>
</ul></p>
<p id="p0125" num="0125">In the presence of phages the level of LF82 in stools was significantly lower than in their absence. Concomitantly, the level of phages was significantly higher in mice colonised by LF82 than in LF82-free mice. Both data confirmed that phages can infect LF82 in the gut.</p>
<heading id="h0040"><u>Level of LF82 in organs:</u></heading>
<p id="p0126" num="0126">
<ul id="ul0027" list-style="none" compact="compact">
<li>at day 2 levels of LF82 were:
<ul id="ul0028" list-style="none" compact="compact">
<li>in ileum of group 3: 2 10<sup>6</sup> copies of pMT1/g</li>
<li>in ileum of group 4: 8 10<sup>4</sup> copies of pMT1/g</li>
<li>in colon of group 3: 2 10<sup>7</sup> copies of pMT1/g</li>
<li>in colon of group 4: 1 10<sup>5</sup> copies of pMT1/g</li>
</ul></li>
<li>at day 5 levels of LF82 were:
<ul id="ul0029" list-style="none" compact="compact">
<li>in ileum of group 3: 5 10<sup>4</sup> copies of pMT1/g</li>
<li>in ileum of group 4: 8 10<sup>4</sup> copies of pMT1/g</li>
<li>in colon of group 3: 6 10<sup>6</sup> copies of pMT1/g</li>
<li>in colon of group 4: 2 10<sup>5</sup> copies of pMT1/g</li>
</ul></li>
</ul></p>
<heading id="h0041"><u>Level of Phages in organs:</u></heading>
<p id="p0127" num="0127">
<ul id="ul0030" list-style="none" compact="compact">
<li>at day 2 levels of Phages were:
<ul id="ul0031" list-style="none" compact="compact">
<li>in ileum of group 2: not detected</li>
<li>in ileum of group 4: 8 10<sup>5</sup> pfu/g<!-- EPO <DP n="33"> --></li>
<li>in colon of group 2: 5 10<sup>4</sup> pfu/g</li>
<li>in colon of group 4: 5 10<sup>6</sup> pfu/g</li>
</ul></li>
<li>at day 5 levels of LF82 were:
<ul id="ul0032" list-style="none" compact="compact">
<li>in ileum of group 2: not detected</li>
<li>in ileum of group 4: not detected</li>
<li>in colon of group 2: not detected</li>
<li>in colon of group 4: 2 10<sup>4</sup> pfu/g</li>
</ul></li>
</ul></p>
<p id="p0128" num="0128">At day 2, the level of LF82 was reduced in both ileum and colon in the group treated by phages. This shows that phages infected LF82 in gut sections and not only in stools. Concomitantly, the level of phages was significantly higher in mice colonised by LF82 than in LF82-free mice.</p>
<p id="p0129" num="0129">At day 5, the level of LF82 in ileum was too weak to see a difference between the two groups while in colon samples the level of LF82 was still reduced in the group that received phages compared to the groups that did not. Concomitantly, we could only detect phages in colon of mice colonised by LF82. This shows that the effect of phages in reducing LF82 can last several days after the initial administration.</p>
<p id="p0130" num="0130">Despite high colonisation level of LF82 observed in this experiment, no sign of colitis was observed in any of the groups.<!-- EPO <DP n="34"> --></p>
<heading id="h0042">SEQUENCE LISTING</heading>
<p id="p0131" num="0131">
<ul id="ul0033" list-style="none">
<li>&lt;110&gt; Ferring B.V. Institut Pasteur</li>
<li>&lt;120&gt; BACTERIOPHAGE THERAPY</li>
<li>&lt;130&gt; HE 171 371</li>
<li>&lt;150&gt; <patcit id="pcit0001" dnum="EP13305568" dnum-type="L"><text>EP 13305568.1</text></patcit><br/>
&lt;151&gt; 2013-04-30</li>
<li>&lt;160&gt; 45</li>
<li>&lt;170&gt; BiSSAP 1.3</li>
<li>&lt;210&gt; 1<br/>
&lt;211&gt; 368<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Bacteriophage wV8</li>
<li>&lt;400&gt; 1
<img id="ib0023" file="imgb0023.tif" wi="137" he="161" img-content="dna" img-format="tif"/><!-- EPO <DP n="35"> -->
<img id="ib0024" file="imgb0024.tif" wi="137" he="21" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 2<br/>
&lt;211&gt; 27<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1 aligning with position 10-36 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 2
<img id="ib0025" file="imgb0025.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; <b>3</b><br/>
&lt;211&gt; <b>55</b><br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P2 aligning with position 8-62 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 3
<img id="ib0026" file="imgb0026.tif" wi="137" he="32" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 4<br/>
&lt;211&gt; 39<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1-P6 aligning with position 77-115 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 4
<img id="ib0027" file="imgb0027.tif" wi="137" he="24" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 5<br/>
&lt;211&gt; 16<br/>
&lt;212&gt; PRT<br/>
<!-- EPO <DP n="36"> -->&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1-P6 aligning with position 124-139 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 5
<img id="ib0028" file="imgb0028.tif" wi="136" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 6<br/>
&lt;211&gt; 9<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1-P5 aligning with position 147-155 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 6
<img id="ib0029" file="imgb0029.tif" wi="77" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 7<br/>
&lt;211&gt; 15<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P6 aligning with position 147-161 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 7
<img id="ib0030" file="imgb0030.tif" wi="128" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 8<br/>
&lt;211&gt; 22<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1 aligning with position 162-183 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 8
<img id="ib0031" file="imgb0031.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 9<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
<!-- EPO <DP n="37"> -->&lt;223&gt; Peptide from bacteriophage strain P3 aligning with position 163-183 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 9
<img id="ib0032" file="imgb0032.tif" wi="136" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 10<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P5-P6 aligning with position 163-183 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 10
<img id="ib0033" file="imgb0033.tif" wi="136" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 11<br/>
&lt;211&gt; 16<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1 and P3-P6 aligning with position 192-207 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 11
<img id="ib0034" file="imgb0034.tif" wi="137" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 12<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P2 aligning with position 192-212 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 12
<img id="ib0035" file="imgb0035.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 13<br/>
&lt;211&gt; 22<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="38"> --></li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1 aligning with position 219-240 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 13
<img id="ib0036" file="imgb0036.tif" wi="136" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 14<br/>
&lt;211&gt; 49<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P2 aligning with position 219-267 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 14
<img id="ib0037" file="imgb0037.tif" wi="137" he="28" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 15<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P3-P4 aligning with position 221-240 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 15
<img id="ib0038" file="imgb0038.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 16<br/>
&lt;211&gt; 47<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P5 aligning with position 221-267 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 16
<img id="ib0039" file="imgb0039.tif" wi="137" he="21" img-content="dna" img-format="tif"/><!-- EPO <DP n="39"> -->
<img id="ib0040" file="imgb0040.tif" wi="92" he="5" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 17<br/>
&lt;211&gt; 40<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P6 aligning with position 221-260 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 17
<img id="ib0041" file="imgb0041.tif" wi="137" he="24" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 18<br/>
&lt;211&gt; 7<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1, P3 and P4 aligning with position 261-267 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 18
<img id="ib0042" file="imgb0042.tif" wi="60" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 19<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1-P2 aligning with position 317-336 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 19
<img id="ib0043" file="imgb0043.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 20<br/>
&lt;211&gt; 8<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P1-P6 aligning with position 355-362 of the major capsid protein of bacteriophage wV8 (SEQ ID NO: 1)</li>
<li>&lt;400&gt; 20
<img id="ib0044" file="imgb0044.tif" wi="69" he="9" img-content="dna" img-format="tif"/><!-- EPO <DP n="40"> --></li>
<li>&lt;210&gt; 21<br/>
&lt;211&gt; 522<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Bacteriophage RB69</li>
<li>&lt;400&gt; 21
<img id="ib0045" file="imgb0045.tif" wi="137" he="218" img-content="dna" img-format="tif"/><!-- EPO <DP n="41"> -->
<img id="ib0046" file="imgb0046.tif" wi="137" he="40" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 22<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 143-162 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 22
<img id="ib0047" file="imgb0047.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 23<br/>
&lt;211&gt; 12<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 269-280 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 23
<img id="ib0048" file="imgb0048.tif" wi="103" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 24<br/>
&lt;211&gt; 14<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 306-319 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 24
<img id="ib0049" file="imgb0049.tif" wi="119" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 25<br/>
&lt;211&gt; 13<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 330-342 of the major capsid protein of bacteriophage RB69 (SEQ ID<!-- EPO <DP n="42"> --> NO: 21)</li>
<li>&lt;400&gt; 25
<img id="ib0050" file="imgb0050.tif" wi="111" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 26<br/>
&lt;211&gt; 7<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 346-352 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 26
<img id="ib0051" file="imgb0051.tif" wi="60" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 27<br/>
&lt;211&gt; 14<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 368-381 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 27
<img id="ib0052" file="imgb0052.tif" wi="120" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 28<br/>
&lt;211&gt; 50<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 412-461 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)</li>
<li>&lt;400&gt; 28
<img id="ib0053" file="imgb0053.tif" wi="137" he="32" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 29<br/>
&lt;211&gt; 44<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain P8 aligning with position 467-510 of the major capsid protein of bacteriophage RB69 (SEQ ID NO: 21)<!-- EPO <DP n="43"> --></li>
<li>&lt;400&gt; 29
<img id="ib0054" file="imgb0054.tif" wi="138" he="24" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 30<br/>
&lt;211&gt; 18<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; All bacteria 16S gene forward primer</li>
<li>&lt;400&gt; 30<br/>
cggtgaatac gttcccgg 18</li>
<li>&lt;210&gt; 31<br/>
&lt;211&gt; 22<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; All bacteria 16S gene reverse primer</li>
<li>&lt;400&gt; 31<br/>
tacggctacc ttgttacgac tt 22</li>
<li>&lt;210&gt; 32<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; E. coli 16S gene forward primer</li>
<li>&lt;400&gt; 32<br/>
catgccgcgt gtatgaagaa 20</li>
<li>&lt;210&gt; 33<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; E. coli 16S gene reverse primer</li>
<li>&lt;400&gt; 33<br/>
cgggtaacgt caatgagcaa a 21</li>
<li>&lt;210&gt; 34<br/>
&lt;211&gt; 519<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Bacteriophage JS98</li>
<li>&lt;400&gt; 34<!-- EPO <DP n="44"> -->
<img id="ib0055" file="imgb0055.tif" wi="130" he="233" img-content="dna" img-format="tif"/><!-- EPO <DP n="45"> -->
<img id="ib0056" file="imgb0056.tif" wi="119" he="12" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 35<br/>
&lt;211&gt; 13<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 127-139 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 35
<img id="ib0057" file="imgb0057.tif" wi="111" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 36<br/>
&lt;211&gt; 12<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 266-277 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 36
<img id="ib0058" file="imgb0058.tif" wi="103" he="8" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 37<br/>
&lt;211&gt; 14<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 303-316 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 37
<img id="ib0059" file="imgb0059.tif" wi="119" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 38<br/>
&lt;211&gt; 13<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 327-339 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 38
<img id="ib0060" file="imgb0060.tif" wi="111" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 39<br/>
&lt;211&gt; 22<br/>
&lt;212&gt; <b>PRT</b><br/>
<!-- EPO <DP n="46"> -->&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 343-364 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 39
<img id="ib0061" file="imgb0061.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 40<br/>
&lt;211&gt; 10<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 369-378 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 40
<img id="ib0062" file="imgb0062.tif" wi="86" he="9" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 41<br/>
&lt;211&gt; 20<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 409-428 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 41
<img id="ib0063" file="imgb0063.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 42<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 438-458 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 42
<img id="ib0064" file="imgb0064.tif" wi="137" he="16" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 43<br/>
&lt;211&gt; 49<br/>
&lt;212&gt; PRT<br/>
&lt;213&gt; Artificial Sequence<!-- EPO <DP n="47"> --></li>
<li>&lt;220&gt;<br/>
&lt;223&gt; Peptide from bacteriophage strain CLB_P2 aligning with position 464-512 of the major capsid protein of bacteriophage JS98 (SEQ ID NO: 34)</li>
<li>&lt;400&gt; 43
<img id="ib0065" file="imgb0065.tif" wi="137" he="29" img-content="dna" img-format="tif"/></li>
<li>&lt;210&gt; 44<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; forward primer to amplify a specific gene (pMT1) from LF82</li>
<li>&lt;400&gt; 44<br/>
ccattcatgc agcagctctt t 21</li>
<li>&lt;210&gt; 45<br/>
&lt;211&gt; 21<br/>
&lt;212&gt; DNA<br/>
&lt;213&gt; Artificial Sequence</li>
<li>&lt;220&gt;<br/>
&lt;223&gt; reverse primer to amplify a specific gene (pMT1) from LF82</li>
<li>&lt;400&gt; 45<br/>
atcggacaac attagcggtg t 21</li>
</ul></p>
</description>
<claims id="claims01" lang="en"><!-- EPO <DP n="48"> -->
<claim id="c-en-01-0001" num="0001">
<claim-text>A pharmaceutical composition comprising a combination of two or more of
<claim-text>― the bacteriophage strain P1 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4694 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P1;</claim-text>
<claim-text>― the bacteriophage strain P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P2;</claim-text>
<claim-text>― the bacteriophage strain P3 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4696 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P3;</claim-text>
<claim-text>― the bacteriophage strain P4 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4697 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P4;</claim-text>
<claim-text>― the bacteriophage strain P5 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4698 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P5;</claim-text>
<claim-text>― the bacteriophage strain P6 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4699 or a variant thereof, wherein the variant has<!-- EPO <DP n="49"> --> the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P6;</claim-text>
<claim-text>― the bacteriophage strain P8 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4700 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P8;</claim-text>
<claim-text>― the bacteriophage strain CLB_P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4675 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain CLB_P2.</claim-text></claim-text></claim>
<claim id="c-en-01-0002" num="0002">
<claim-text>The pharmaceutical composition according to claim 1 comprising:
<claim-text>― the bacteriophage strain P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4695 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P2;</claim-text>
<claim-text>― the bacteriophage strain P8 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4700 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain P8; and</claim-text>
<claim-text>― the bacteriophage strain CLB_P2 deposited with the French National Collection of Microorganisms at the Institut Pasteur under Accession Number CNCM I-4675 or a variant thereof, wherein the variant has the same lytic activity and the same phenotypic characteristics as said bacteriophage strain CLB_P2.</claim-text></claim-text></claim>
<claim id="c-en-01-0003" num="0003">
<claim-text>The pharmaceutical composition according to any one of claims 1 or 2, wherein said pharmaceutical composition is for use in the treatment of inflammatory bowel disease.<!-- EPO <DP n="50"> --></claim-text></claim>
<claim id="c-en-01-0004" num="0004">
<claim-text>The pharmaceutical composition according to any one of claims 1 or 2 or the pharmaceutical composition for use according to claim 3, said pharmaceutical composition comprising a pharmaceutically acceptable carrier.</claim-text></claim>
<claim id="c-en-01-0005" num="0005">
<claim-text>The pharmaceutical composition for use according to any one of claims 3 or 4, wherein the inflammatory bowel disease is Crohn's disease.</claim-text></claim>
<claim id="c-en-01-0006" num="0006">
<claim-text>The pharmaceutical composition for use according to any one of claims 3 to 5, wherein the pharmaceutical composition is for oral administration.</claim-text></claim>
</claims>
<claims id="claims02" lang="de"><!-- EPO <DP n="51"> -->
<claim id="c-de-01-0001" num="0001">
<claim-text>Pharmazeutische Zusammensetzung, umfassend eine Kombination von zwei oder mehreren von
<claim-text>― dem Bakteriophagenstamm P1, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4694, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P1;</claim-text>
<claim-text>― dem Bakteriophagenstamm P2, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4695, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P2;</claim-text>
<claim-text>― dem Bakteriophagenstamm P3, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4696, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P3;</claim-text>
<claim-text>― dem Bakteriophagenstamm P4, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4697, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die<!-- EPO <DP n="52"> --> gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P4;</claim-text>
<claim-text>― dem Bakteriophagenstamm P5, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4698, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P5;</claim-text>
<claim-text>― dem Bakteriophagenstamm P6, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4699, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P6;</claim-text>
<claim-text>― dem Bakteriophagenstamm P8, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4700, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P8;</claim-text>
<claim-text>― dem Bakteriophagenstamm CLB_P2, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4675, oder einer Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm CLB_P2.</claim-text></claim-text></claim>
<claim id="c-de-01-0002" num="0002">
<claim-text>Pharmazeutische Zusammensetzung gemäß Anspruch 1, umfassend:<!-- EPO <DP n="53"> -->
<claim-text>― den Bakteriophagenstamm P2, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4695, oder eine Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P2;</claim-text>
<claim-text>― den Bakteriophagenstamm P8, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4700, oder eine Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm P8; und</claim-text>
<claim-text>― den Bakteriophagenstamm CLB_P2, hinterlegt bei der French National Collection of Microorganisms am Institut Pasteur unter der Hinterlegungsnummer CNCM I-4675, oder eine Variante davon, wobei die Variante die gleiche lytische Aktivität und die gleichen phänotypischen Charakteristika aufweist wie der Bakteriophagenstamm CLB_2.</claim-text></claim-text></claim>
<claim id="c-de-01-0003" num="0003">
<claim-text>Pharmazeutische Zusammensetzung gemäß irgendeinem der Ansprüche 1 oder 2, wobei die pharmazeutische Zusammensetzung zur Verwendung bei der Behandlung von entzündlicher Darmerkrankung ist.</claim-text></claim>
<claim id="c-de-01-0004" num="0004">
<claim-text>Pharmazeutische Zusammensetzung gemäß irgendeinem der Ansprüche 1 oder 2 oder pharmazeutische Zusammensetzung zur Verwendung gemäß Anspruch 3, wobei die pharmazeutische Zusammensetzung einen pharmazeutisch akzeptablen Träger umfasst.<!-- EPO <DP n="54"> --></claim-text></claim>
<claim id="c-de-01-0005" num="0005">
<claim-text>Pharmazeutische Zusammensetzung zur Verwendung gemäß irgendeinem der Ansprüche 3 oder 4, wobei die entzündliche Darmerkrankung Morbus Crohn ist.</claim-text></claim>
<claim id="c-de-01-0006" num="0006">
<claim-text>Pharmazeutische Zusammensetzung zur Verwendung gemäß irgendeinem der Ansprüche 3 bis 5, wobei die pharmazeutische Zusammensetzung für die orale Verabreichung ist.</claim-text></claim>
</claims>
<claims id="claims03" lang="fr"><!-- EPO <DP n="55"> -->
<claim id="c-fr-01-0001" num="0001">
<claim-text>Composition pharmaceutique comprenant une combinaison de deux ou plus parmi
<claim-text>- la souche de bactériophage P1 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4694 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P1 ;</claim-text>
<claim-text>- la souche de bactériophage P2 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4695 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P2 ;</claim-text>
<claim-text>- la souche de bactériophage P3 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4696 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P3 ;</claim-text>
<claim-text>- la souche de bactériophage P4 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4697 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P4 ;</claim-text>
<claim-text>- la souche de bactériophage P5 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4698 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P5 ;</claim-text>
<claim-text>- la souche de bactériophage P6 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4699 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P6 ;</claim-text>
<claim-text>- la souche de bactériophage P8 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4700 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P8 ;</claim-text>
<claim-text>- la souche de bactériophage CLB_P2 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4675 ou<!-- EPO <DP n="56"> --> une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage CLB_P2.</claim-text></claim-text></claim>
<claim id="c-fr-01-0002" num="0002">
<claim-text>Composition pharmaceutique selon la revendication 1, comprenant :
<claim-text>- la souche de bactériophage P2 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4695 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P2 ;</claim-text>
<claim-text>- la souche de bactériophage P8 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4700 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage P8 ; et</claim-text>
<claim-text>- la souche de bactériophage CLB_P2 déposée à la Collection Nationale Française de Microorganismes de l'Institut Pasteur sous le numéro d'accession CNCM I-4675 ou une variante de celle-ci, dans laquelle la variante présente la même activité lytique et les mêmes caractéristiques phénotypiques que ladite souche de bactériophage CLB_P2.</claim-text></claim-text></claim>
<claim id="c-fr-01-0003" num="0003">
<claim-text>Composition pharmaceutique selon l'une quelconque des revendications 1 ou 2, dans laquelle ladite composition pharmaceutique est destinée à une utilisation dans le traitement d'une maladie inflammatoire de l'intestin.</claim-text></claim>
<claim id="c-fr-01-0004" num="0004">
<claim-text>Composition pharmaceutique selon l'une quelconque des revendications 1 ou 2 ou composition pharmaceutique pour une utilisation selon la revendication 3, ladite composition pharmaceutique comprenant un véhicule pharmaceutiquement acceptable.</claim-text></claim>
<claim id="c-fr-01-0005" num="0005">
<claim-text>Composition pharmaceutique pour une utilisation selon l'une quelconque des revendications 3 ou 4, dans laquelle la maladie inflammatoire de l'intestin est la maladie de Crohn.</claim-text></claim>
<claim id="c-fr-01-0006" num="0006">
<claim-text>Composition pharmaceutique pour une utilisation selon l'une quelconque des revendications 3 à 5, dans laquelle la composition pharmaceutique est destinée à une administration orale.</claim-text></claim>
</claims>
<ep-reference-list id="ref-list">
<heading id="ref-h0001"><b>REFERENCES CITED IN THE DESCRIPTION</b></heading>
<p id="ref-p0001" num=""><i>This list of references cited by the applicant is for the reader's convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.</i></p>
<heading id="ref-h0002"><b>Patent documents cited in the description</b></heading>
<p id="ref-p0002" num="">
<ul id="ref-ul0001" list-style="bullet">
<li><patcit id="ref-pcit0001" dnum="EP13305568" dnum-type="L"><document-id><country>EP</country><doc-number>13305568</doc-number><date>20130430</date></document-id></patcit><crossref idref="pcit0001">[0131]</crossref></li>
</ul></p>
<heading id="ref-h0003"><b>Non-patent literature cited in the description</b></heading>
<p id="ref-p0003" num="">
<ul id="ref-ul0002" list-style="bullet">
<li><nplcit id="ref-ncit0001" npl-type="s"><article><author><name>MAURA et al.</name></author><atl/><serial><sertitle>Environmental Microbiol</sertitle><pubdate><sdate>20120800</sdate><edate/></pubdate><vid>14</vid><ino>8</ino></serial><location><pp><ppf>1844</ppf><ppl>1854</ppl></pp></location></article></nplcit><crossref idref="ncit0001">[0007]</crossref></li>
<li><nplcit id="ref-ncit0002" npl-type="s"><article><author><name>BELGIN et al.</name></author><atl/><serial><sertitle>Inflammatory Bowel Diseases</sertitle><pubdate><sdate>20130100</sdate><edate/></pubdate><vid>19</vid><ino>1</ino></serial><location><pp><ppf>141</ppf><ppl>150</ppl></pp></location></article></nplcit><crossref idref="ncit0002">[0008]</crossref></li>
<li><nplcit id="ref-ncit0003" npl-type="s"><article><author><name>DARFEUILLE-MICHAUD et al.</name></author><atl/><serial><sertitle>Gastroenterology</sertitle><pubdate><sdate>20040000</sdate><edate/></pubdate><vid>127</vid></serial><location><pp><ppf>412</ppf><ppl>421</ppl></pp></location></article></nplcit><crossref idref="ncit0003">[0014]</crossref><crossref idref="ncit0004">[0015]</crossref></li>
<li><nplcit id="ref-ncit0004" npl-type="s"><article><author><name>FALKOW et al.</name></author><atl/><serial><sertitle>Rev. Infect. Dis.</sertitle><pubdate><sdate>19870000</sdate><edate/></pubdate><vid>9</vid><ino>5</ino></serial><location><pp><ppf>450</ppf><ppl>455</ppl></pp></location></article></nplcit><crossref idref="ncit0005">[0051]</crossref></li>
<li><nplcit id="ref-ncit0005" npl-type="s"><article><author><name>A. VILLEGAS et al.</name></author><atl/><serial><sertitle>Virology Journal</sertitle><pubdate><sdate>20090000</sdate><edate/></pubdate><vid>6</vid></serial><location><pp><ppf>41</ppf><ppl/></pp></location></article></nplcit><crossref idref="ncit0006">[0053]</crossref></li>
<li><nplcit id="ref-ncit0006" npl-type="s"><article><author><name>S. ZUBER et al.</name></author><atl/><serial><sertitle>Journal of Bacteriology</sertitle><pubdate><sdate>20070000</sdate><edate/></pubdate><vid>189</vid><ino>22</ino></serial><location><pp><ppf>8206</ppf><ppl/></pp></location></article></nplcit><crossref idref="ncit0007">[0053]</crossref></li>
<li><nplcit id="ref-ncit0007" npl-type="s"><article><author><name>MAURA et al.</name></author><atl/><serial><sertitle>Environmental Microbiology</sertitle><pubdate><sdate>20120000</sdate><edate/></pubdate><vid>14</vid><ino>8</ino></serial><location><pp><ppf>1844</ppf><ppl>1854</ppl></pp></location></article></nplcit><crossref idref="ncit0008">[0066]</crossref></li>
</ul></p>
</ep-reference-list>
</ep-patent-document>
