FIELD OF INVENTION
[0001] The present disclosure generally relates to the field of chimeric antigen receptor
(CAR) expression, specifically to tumor tissue specific CAR expression.
BACKGROUND
[0002] Harnessing the immune system to eradicate cancer has proved highly efficient in recent
years.
[0003] An example is engineered immune cells such as Chimeric-Antigen-Receptor T-cells (CAR-T),
which have been approved by the FDA for the treatment of various cancers after outstanding
results were shown regarding the ability to eradicate malignancies that had no other
efficient treatment.
[0004] However, although CAR expressing immune cells can reach tumors and metastasis throughout
a patient's body, the specificity of the engineered receptor does not allow fully
distinguishing between tumor cells and normal cells, with a few exceptions, since
the tumor often does not have an absolutely unique antigen that is not expressed by
some normal cells in the body. As a result, several CAR treatments caused toxic immune
response, similar to GVHD, and even death that resulted from the CAR treatment during
clinical trials.
[0005] Attempts to achieve non-constitutive expression of CAR within engineered immune cells
have been made. An example includes applying an "ON-OFF switch" within the CAR expression
vector, by utilizing a promoter activated only in the presence of an exogenously provided
molecule (such as tetracycline/doxycycline). Albeit allowing turning off the CAR expression
in case adverse symptoms is pronounced, this approach also turns off the positive
activity of the CAR T-cells against the tumor cells, and thus terminates a potent
CAR treatment.
[0006] There thus remains an unmet need for controlled CAR expression that reduces the risks
of its life-threatening "side-effect", while allowing effective elimination of tumors
SUMMARY
[0008] According to the present invention there is provided Tumor Micro-Environment (TME)
responsive expression vectors according to appended claims 1-7 and immune effector
cells according to appended claims 8-9.
[0009] The technical disclosure set out below may in some respects go beyond the scope of
the invention, which is defined by the appended claims. Elements of the disclosure
which do not fall within the scope of the claims are provided for information, namely
to place the actual invention claimed in a broader technical context.
[0010] Disclosed herein is a novel platform for regulation of effector gene expression under
the control of tumor-microenvironment-responsive promoters, optionally in conjunction
with a tet-response circuit.
[0011] The platform includes a tumor environment (TME) responsive expression vector including
a nucleic acid sequence encoding a synthetic promoter comprising one or more TME dependent
promoter response element; conjugated to effector-genes such as, but not limited to,
nucleic acid sequence encoding an effector gene (e.g. CAR).
[0012] Advantageously, the TME responsive vector is designed such that binding of two or
more factors, present in the TME, to the promoter response element, either directly
or indirectly, induces expression by the promoter. In the absence of TME factors binding,
the promoter expression is downregulated autonomously within each of the engineered
cells. This advantageously ensures that minimal to no expression of effector-mechanisms,
such as CAR, is found in tissue environments different from that of the tumor; whereas
in the tumor environment, the expression of effector mechanisms, such as CAR, is upregulated
and directing activities against the tumor while sparing normal tissues.
[0013] The expression vector include more than one TME dependent promoter response element.
This may serve to ensure that the highest expression level is solely obtained where
the specific combination of TME factors is found.
[0014] Advantageously, we may optionally further replace/change the synthetic promoter for
a custom-made promoter, such that the one or more TME dependent promoter response
elements, configured to activate the promoter, will fit the actual TME signature of
a specific patient or patient group, thus ensuring an uttermost specific and efficient
response.
[0015] In a first aspect, there is provided a tumor microenvironment (TME) responsive expression
vector comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR)
operably linked to a synthetic promoter, said promoter comprising two or more different
TME dependent promoter response elements (PRE); wherein said at least two PRE's are
an interferon-gamma-(IFN-γ) PRE and an NEκB PRE, and wherein the IFN-γ promoter response
element comprises the nucleic acid sequence set forth in SEQ ID NO: 1, and wherein
the NEκB PRE comprises the nucleic acid sequence set forth in SEQ ID NO: 2 ("K") ;
wherein said TME responsive expression vector is so designed, that the presence of
IFN-γ and TNFα in the TME, when binding to interferon-gamma-(IFN-y) PRE and NEκB PRE,
induces a higher expression level of CAR than when only IFN-γ or TNFα are pre-sent
in the TME, and minimal no or low expression of CAR occurs in the absence of IFN-γ
and TNFα, so that the CAR is upregulated and directing activities against the tumor
while sparing normal tissue.
[0016] According to some embodiments, the CAR is a chimeric antigen T-cell receptor (CAR-T),
a chimeric antigen Natural Killer (NK) cell receptor (CAR-NK), a chimeric innate receptor,
other immune-effectors including, but not limited to, cytokines, chemokines, chemokine-receptors,
proteases, micro-RNAs, or combinations thereof.
[0017] According to the invention, the promoter response element comprises an interferon-gamma
(IFN-γ) response element, a Nuclear Factor kappa-B (NF-κB) response element and optionally
one or more response elements selected from the list consisting of, but not limited
to: a hypoxia response element, an IL-6 response elements, a Heat shock protein 70
(HSP-70) response element, an IL-1 response element, an IL-4 response elements, an
IL-6 response elements, an IL-8 response element, an IL-10 response element, an IL-11
response element, an IL-12 response element, an IL-15 response element, an IL-18 response
element, an IL-17 response element, an IL-21 response element, an IL-35 response element,
a TGF-beta response element, a GM-CSF response element, a Hepatic Growth Factor (HGF)
response element, an Aryl Hydrogen Receptor (AhR) response element, a PGE2 response
element or any other suitable TME factor response element or combinations thereof.
[0018] According to some embodiments, the promoter response element may be inserted into
the synthetic promoter in a sense (5' to 3') or anti-sense (3' to 5') direction.
[0019] The promoter response element comprises at least a nucleic acid selected from the
group consisting of: GGGAATTTCC set forth in SEQ ID NO. 2, and in some embodiments
may further comprise a nucleic acid selected from the group consisting of TTCCGGGAA
set forth in SEQ ID NO. 1, GACCTTGAGTACGTGCGTCTCTGCACGTATG set forth in SEQ ID NO.
3, GCGCTTCCTGACAGTGACGCGAGCCG set forth in SEQ ID NO. 4, GCGCTTCCTGACAGTGACGCGAGCCG,
or any combination thereof.
[0021] According to the invention, the promoter response element comprises a nucleic acid
selected from the nucleic acid sequences set forth in SEQ ID Nos 2.
[0022] According to some embodiments, the promoter response element comprises a nucleic
acid selected from the nucleic acid sequences set forth in SEQ ID Nos 22-40 or any
combination thereof. Each possibility is a separate embodiment.
[0023] According to some embodiments, the promoter response element comprises the nucleic
acid sequence:

wherein Y=C or T, S= C or G and R= A or G.
[0024] According to some embodiments, the one or more TME factor comprises tumor necrosis
factor alpha (TNF-α), IFN-γ, IL-6, HSP-70 or any combination thereof.
[0025] According to some embodiments, the synthetic promoter comprises additional nucleotides
flanking the promoter response element and or spacing between promoter response elements.
[0026] The promoter response element comprises IFN-γ and NF-κB, and in further embodiments
one or more response element of any of hypoxia protein, HSP-70, IL-1, IL-4, IL-6,
IL-8 IL-10 response element, an IL-11 response element, an IL-12 response element,
an IL-15 response element, an IL-18 response element, an IL-17 response element, an
IL-21 response element, a TGF-beta response element, a GM-CSF response element, a
Hepatic Growth Factor (HGF) response element, an Aryl Hydrogen Receptor (AhR) response
element, a PGE2 response element (sense or anti-sense), which has been modified on
one or more positions.
[0027] According to some embodiments, the modification generates a sequence with increased
TME factor binding vis-à-vis the native sequence.
[0028] As a non-limiting example, the synthetic promoter may include response elements of
hypoxia protein (or other TME factor response element) as derived from various hypoxia
dependent target genes (LDHA/EPO/VEGF), such as the shared part of the HBS sequence
of the LDHA/EPO/VEGF and/or the HAS sequence of EPO gene, as well as a linker of about
6-9 nucleotides which is not found in the target genes. This sequence is referred
to as a "basic hypoxia promoter response element (PRE)", as set forth in SEQ ID NO.
42 outlined below.

[0029] According to some embodiments, the basic TME factor promoter (here basic hypoxia
PRE) may be added at the 3' at the 5' or in the middle of the synthetic promoter sequence.
According to some embodiments, the basic TME factor PRE may be inserted in a 5'-3'
orientation or in a flipped 3'-5' orientation. According to some embodiments, the
synthetic promoter may include a modified version of the basic TME factor PRE. A non-limiting
example, of a modified basic hypoxia PRE is set forth in SEQ ID 43:

wherein R= A or G, S= C or G and M = A or C.
[0030] According to some embodiments, the modified TME factor PRE is the synthetic PRE that
induce the less leakiness and the highest response to hypoxia stimulation.
[0031] A non-limiting example for a modified IFN-γ PRE is set forth in SEQ ID 44:
> ACTTCCSGGAARTAGGGTGGGCAAGTACTTCCSGGAART, wherein R= A or G and S= C or G.
[0032] A non-limiting example for a modified NF-κB PRE is set forth in SEQ ID 45:
>GGGGGTTTYCGGGGACTTTCCGGRRRTTTT wherein R= A or G andY = C or T.
[0033] The promoter response element comprises two or more promoter response elements; and
wherein binding of TME factors to the two or more TME dependent promoter response
elements induces a higher expression level of effector-genes than binding to a single
TME dependent promoter response element.
[0034] According to some embodiments, the TME responsive expression vector further comprises
an externally inducible promoter and a trans-activator. According to some embodiments,
the synthetic promoter drives expression of the trans-activator and the externally
inducible promoter drives expression of the effector-genes. According to some embodiments,
the combined presence of the inducer and the TME factor induces expression of effector-genes.
According to some embodiments, in the presence of the external inducer and in the
absence of TME factor, essentially no effector-genes expression is detected. According
to some embodiments, when the TME factor binds the promoter response element in the
absence of the external inducer, essentially no effector-genes expression is detected.
[0035] According to some embodiments, the inducible promoter is a Tet-Response-Element promoter,
and the external inducer is doxycycline and/or tetracycline.
[0036] According to some embodiments, the effector-gene may be, but is not limited to a
CAR that comprises an antigen binding domain, a transmembrane domain, and an intracellular
domain comprising a costimulatory domain and/or a primary signaling domain, wherein
said antigen binding domain binds to a tumor antigen.
[0037] According to some embodiments, the CAR may be selected from the group consisting
of CAR, a chemokine receptor, a cytokine receptor, a protein (or functional RNA) that
enhances penetration of the immune effector cell in to the tumor, such as, but not
limited to proteases of the MMP8/9, a miRNA that suppresses immuneinhibitors, such
as, but not limited to PD1 and/or CTLA4, a cytokine that brings about immune-cell
retention within the tumor, such as, but not limited to CXCL9/10 and/or CRCR3 ligands
or any other suitable effector gene a TME which specific expression profile is desired.
[0038] According to some embodiments, the vector is selected from a DNA vector, a plasmid,
a lentivirus vector, an adenoviral vector, a retrovirus vector, or other vectors for
introduction of the synthetic construct into immune cells.
[0039] According to some embodiments, the TME responsive expression vector further comprises
effector-genes encoding a protein (or functional RNA) that enhance penetration of
the immune effector cell in to the tumor, such as, but not limited to, proteases of
the MMP8/9.
[0040] According to some embodiments, the TME responsive expression vector further comprises
one or more effector-genes encoding miRNAs that suppress immuneinhibitors, such as,
but not limited to, PD1 and/or CTLA4, within the tumor.
[0041] According to some embodiments, the TME responsive expression vector further comprises
one or more effector-genes encoding cytokines bringing about immune-cell retention
within the tumor, such as, but not limited to, CXCL9/10 and/or CRCR3 ligands, thereby
generating an autocrine loop.
[0042] According to some embodiments, there is provided an immune effector cell comprising
the vector comprising a nucleic acid sequence encoding a synthetic promoter comprising
one or more TME dependent promoter response element; and a nucleic acid sequence encoding
a chimeric antigen receptor, as essentially described herein. According to some embodiments,
the TME responsive vector is designed, such that binding of one or more factors present
in the TME to the promoter response element directly or indirectly induces expression
of the effector genes, and wherein, in the absence of TME factor binding to the promoter
response element, essentially no or low/residual chimeric antigen receptor is expressed.
[0043] According to some embodiments, the immune effector cell is suitable for use as a
medicament. According to some embodiments, the immune effector cell is suitable for
treating a tumor of a patient in need thereof. According to some embodiments, the
tumor is a solid tumor. According to some embodiments, the solid tumor is a sarcoma,
a carcinomas or a lymphoma. According to some embodiments, the solid tumor is a lung
tumor, melanoma, colon cancer, breast tumor or a brain tumor.
[0044] Disclosed herein is a method for treating cancer in a patient in need thereof, the
method comprising administering immune cells comprising the expression vector as essentially
described herein.
[0045] Disclosed herein is a method for screening a patient for determination of an optimal
synthetic promoter, the method comprising obtaining a biopsy of a patient's tumor,
determining the expression levels of one or more TME factors in the biopsy; and selecting
a TME responsive expression vector having a TME dependent promoter response element
matching the determined expression level of the one or more TME factors in the biopsy.
[0046] Disclosed herein is a method for screening a biopsy for determining an optimal synthetic
promoter, the method comprising determining the expression level of one or more TME
factors in the biopsy; and selecting a TME responsive expression vector having a TME
dependent promoter response element matching the determined expression level of the
one or more TME factors in the biopsy.
[0047] The TME may be expressed by the tumor cells and/or by non-tumor TME cells.
[0048] The method further comprises introducing the selected TME responsive expression vector
into immune cells.
[0049] The immune effector cell or cell population may include, but is not limited to, T-cells
and/or Natural-Killer (NK) cells.
[0050] The immune effector cell or cell population is autologous to the patient.
[0051] The immune effector cell/cell population is isolated from the patient prior to the
treatment.
[0052] The method further comprises administering the immune effector cell or cell population
to the patient.
[0053] Certain embodiments of the present disclosure may include some, all, or none of the
above advantages. One or more technical advantages may be readily apparent to those
skilled in the art from the figures, descriptions and claims included herein. Moreover,
while specific advantages have been enumerated above, various embodiments may include
all, some or none of the enumerated advantages.
[0054] In addition to the exemplary aspects and embodiments described above, further aspects
and embodiments will become apparent by reference to the figures and by study of the
following detailed descriptions.
BRIEF DESCRIPTION OF THE FIGURES
[0055] The invention will now be described in relation to certain examples and embodiments
with reference to the following illustrative figures.
FIG. 1 schematically illustrates an expression construct comprising a synthetic promoter
directly controlling reporter- and/or CAR gene expression;
FIG. 2 schematically illustrates an expression construct comprising a synthetic promoter
indirectly controlling reporter- and/or CAR gene expression;
FIG. 3 is an illustrative flowchart of a method for screening a promoters-library for Tumor
Micro-Environment (TME) providing an optimal reporter- and/or CAR gene expression;
FIG. 4A shows a representative histogram depicting GFP-intensity (upper panel) and percentage
of GFP-positive cells (lower panel) in 293T HEK cells transduced with the expression
lentiviral construct of FIG. 2 (w. GFP reporter), including the indicated TME responsive
elements (G and K), in the presence and absence of TME factor and/or doxycycline;
FIG. 4B shows a representative FACS plot of representative replicates used for Figure 3A.
FIG. 5 shows a representative FACS plot gating GFP-positive 293T HEK cells transfected with
the expression construct of FIG. 2 (w. GFP reporter), including the indicated TME
responsive elements (G and K), in the presence and absence of TME factor and/or doxycycline;
FIG. 6 shows representative histograms quantifying the reporter intensity within the GFP-positive
293T HEK cells transfected with the expression construct of FIG. 2 (w. GFP reporter),
including the indicated TME responsive elements (G and K), in the presence and absence
of TME factor and/or doxycycline;
FIG. 7 shows a representative histogram quantifying the reporter intensity within the GFP-positive
293T HEK cells transfected with the expression construct of FIG. 2 (w. GFP reporter),
including the indicated TME responsive elements (G, K, J and H), in the presence and
absence of TME factor and/or doxycycline;
FIG. 8 shows exemplary FACS sorting results used to identify and sort for cells having a
desired, optimal reporter gene expression profile.
DETAILED DESCRIPTION
[0056] In the following description, various aspects of the disclosure will be described.
For the purpose of explanation, specific configurations and details are set forth
in order to provide a thorough understanding of the different aspects of the disclosure.
However, it will also be apparent to one skilled in the art that the disclosure may
be practiced without specific details being presented herein. Furthermore, well-known
features may be omitted or simplified in order not to obscure the disclosure.
Definitions
[0057] Unless defined otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the art to which the
invention pertains.
[0058] The term "a" and "an" refers to one or to more than one (i.e., to at least one) of
the grammatical object of the article. By way of example, "an element" means one element
or more than one element.
[0059] The term "about" when referring to a measurable value such as an amount, a temporal
duration, and the like, is meant to encompass variations of ±20% or in some instances
±10%, or in some instances ±5%, or in some instances ±1%, or in some instances ±0.1%
from the specified value, as such variations are appropriate to perform the disclosed
methods.
[0060] The term "Chimeric Antigen Receptor" or alternatively a "CAR" refers to a recombinant
polypeptide construct comprising at least an extracellular antigen binding domain,
a transmembrane domain and a cytoplasmic signaling domain (also referred to herein
as "an intracellular signaling domain") comprising a functional signaling domain derived
from a stimulatory molecule as defined below. In some embodiments, the domains in
the CAR polypeptide construct are in the same polypeptide chain, e.g., comprise a
chimeric fusion protein. In some embodiments, the domains in the CAR polypeptide construct
are not contiguous with each other, e.g., are in different polypeptide chains. According
to some embodiments, the CAR may broadly refer to any moiety that is expressed by
the immune cell and has a cytotoxic effect on the target cancer cell, i.e. a ligand
that activates a death receptor on the target.
[0061] The terms, "tumor environment", "tumor microenvironment" and "TME" may be used interchangeably
and refer to the cellular environment in which the tumor exists, including surrounding
blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells,
lymphocytes, signaling molecules and the extracellular matrix (ECM).
[0062] The term "antigen" refers to a molecule that provokes an immune response. This immune
response may involve antibody production, or the activation of specific immunologically-competent
cells, or both. The skilled artisan will understand that any macromolecule, including
virtually all proteins or peptides, can serve as an antigen. Furthermore, one skilled
in the art will understand that an antigen need not be encoded solely by a full-length
nucleotide sequence of a gene. It is readily apparent that the present invention includes,
but is not limited to, the use of partial nucleotide sequences of more than one gene
and that these nucleotide sequences are arranged in various combinations to encode
polypeptides that elicit the desired immune response. It is readily apparent that
an antigen can be generated synthesized or can be derived from a biological sample,
or might be a macromolecule besides a polypeptide. Such a biological sample can include,
but is not limited to, a tissue sample, a tumor sample, a cell or a fluid with other
biological components.
[0063] The term "anti-tumor effect", refers to a biological effect which can be manifested
by various means, including, but not limited to, e.g., a decrease in tumor volume,
a decrease in the number of tumor cells, a decrease in the number of metastases, an
increase in life expectancy, a decrease in tumor cell proliferation, a decrease in
tumor cell survival, or amelioration of various physiological symptoms associated
with the cancerous condition.
[0064] The term "autologous" refers to any material derived from the same individual to
whom it is later to be re-introduced into the individual. The term "allogeneic" refers
to any material derived from a different individual than to whom the material is introduced.
[0065] The term "conservative sequence modifications" refers to amino acid modifications
that do not significantly affect or alter the binding characteristics of a factor
thereto. Such conservative modifications include amino acid substitutions, additions
and deletions.
[0066] As used herein, the term "Immune effector cell" refers to a cell that is involved
in an immune response. Examples include various types, and sub-types of T cells, B
cells, natural killer (NK) cells, Innate Lymphocyte Cells (ILCs), natural killer T
(NKT) cells, Mast cells, Macrophage, Monocytes, Dendritic cells, Basophil, Neutrophils
and Eosinophil.
[0067] The term "expression" refers to the transcription and/or translation of a particular
nucleotide sequence driven by a promoter.
[0068] The term "expression vector" refers to a vector comprising a recombinant polynucleotide
comprising expression control sequences operatively linked to a nucleotide sequence
to be expressed. Expression vectors include all those known in the art, including
cosmids, plasmids, episomes, transposons and viruses (e.g., lentiviruses, retroviruses,
adenoviruses, and adeno-associated viruses) that incorporate the recombinant nucleotide
sequences.
[0069] As used herein, the term "TME responsive expression vector" refers to an expression
vector configured to express a gene product in the presence of factors constituting,
defining or otherwise associated with a tumor environment.
[0070] As used herein, the term "promoter" refers to a DNA sequence recognized by the synthetic
machinery of the cell, or introduced synthetic machinery, required to initiate the
specific transcription of a polynucleotide sequence.
[0071] As used herein, the term "promoter/regulatory sequence" and "promoter response element
(PRE)" may be used interchangeably and refer to nucleic acid sequences required for
expression of a gene product operably linked to the promoter/regulatory sequence.
As used herein, the term "TME factor" refers to a factor present and active in a TME
such as but not limited to cytokines, transcription factors etc. As used herein, the
term "PRE linked to a TME-associated factor refers to PRE that is activated following
the excreted effect of the TME-associated factor. E.g "hypoxia PRE" refers to PRE
that is activated following hypoxia in the TME. " IFN-γ PRE" refers to PRE that is
activated following the presence of IFN-γ in the TME. In some instances, this sequence
may be the core promoter sequence and, in other instances, this sequence may also
include an enhancer sequence and other regulatory elements, which are required for
expression of the gene product. The promoter/regulatory sequence may, for example,
be one which expresses the gene product in a tissue specific manner.
[0072] As used herein, the term "constitutive" promoter refers to a nucleotide sequence
which, when operably linked with a polynucleotide encoding a gene product, causes
the gene product to be produced in a cell under most or all physiological conditions
of the cell.
[0073] As used herein, the term "inducible" promoter refers to a nucleotide sequence which,
when operably linked with a polynucleotide encoding a gene product, causes the gene
product to be substantially enhanced only when an inducer is present. "Induction"
may include both the initiation of expression from an OFF state into an ON state,
as well as the enhancement of expression from relative-LOW to relative-HIGH.
[0074] As used herein, the terms "TME specific promoter", "TME inducible promoter" and "TME
responsive promoter" may be used interchangeably and refer to a nucleotide sequence
which causes the gene product to be induced within TME.
[0075] As used herein, the term "Synthetic promoter" refers to DNA sequences artificially
synthesized as opposed to cloning of naturally occurring promoters.
[0076] The terms "cancer associated antigen" and "tumor antigen" may be used interchangeably
and refer to a molecule (typically a protein, carbohydrate or lipid) that is expressed
on the surface of a cancer cell, either entirely or as a fragment and which is useful
for the preferential targeting of a pharmacological agent to the cancer cell. In some
embodiments, a tumor antigen is a marker expressed by both normal cells and cancer
cells. In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed
in a cancer cell in comparison to a normal cell, for instance, 1-fold over expression,
2-fold overexpression, 3-fold overexpression or more in comparison to a normal cell.
In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately
synthesized in the cancer cell, for instance, a molecule that contains deletions,
additions or mutations in comparison to the molecule expressed on a normal cell.
[0077] As used herein, the term "treating" refers to the reduction or amelioration of the
progression, severity and/or duration of a proliferative disorder, or the amelioration
of one or more symptoms (preferably, one or more discernible symptoms) of a proliferative
disorder resulting from the treatment. In other embodiments the term refers to the
inhibition of the progression of a proliferative disorder. In other embodiments, the
term refers to the reduction or stabilization of tumor size or cancerous cell count.
The term "transfected" refers to a process by which an exogenous nucleic acid is transferred
or introduced into a host cell. The cell includes the primary subject cell and its
progeny.
[0078] The terms "specifically binds" and "binding" refer to a factor such as a transcription-factor,
which recognizes and binds a cognate nucleic acid sequence.
[0079] As used herein, the terms "substantially" and "essentially" with regards to the absence
of gene expression in a non-tumor environment, i.e. in healthy tissue, may include
no or residual expression levels only. According to some embodiments, substantially
no expression (such as in healthy tissue) may refer to expression levels at levels
that are biologically/functionally ineffective against normal healthy tissues, while
inducing effective levels within TME.
[0080] Ranges: throughout this disclosure, various aspects of the invention can be presented
in a range format. It should be understood that the description in range format is
merely for convenience and brevity and should not be construed as an inflexible limitation
on the scope of the invention. Accordingly, the description of a range should be considered
to have specifically disclosed all the possible subranges as well as individual numerical
values within that range. For example, description of a range such as from 1 to 6
should be considered to have specifically disclosed sub-ranges such as from 1 to 3,
from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual
numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another
example, a range such as 95-99% identity, includes something with 95%, 96%, 97%, 98%
or 99% identity, and includes sub-ranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98%
and 98-99% identity. This applies regardless of the breadth of the range.
Description
[0081] According to the invention, there is provided a tumor microenvironment (TME) responsive
expression vector comprising a nucleic acid sequence encoding a chimeric antigen receptor
(CAR) operably linked to a synthetic promoter, said promoter comprising two or more
different TME dependent promoter response elements (PRE); wherein said at least two
PRE's are an interferon-gamma-(IFN-γ) PRE and an NEκB PRE, and wherein the IFN-γ promoter
response element comprises the nucleic acid sequence set forth in SEQ ID NO: 1, and
wherein the NEκB PRE comprises the sequence set forth in SEQ ID NO: 2 ("K") ; wherein
said TME responsive expression vector is so designed, that the presence of IFN-γ and
TNFα in the TME, when binding to interferon-gamma-(IFN-γ) PRE and NEκB PRE, induces
a higher expression level of CAR than when only IFN-γ or TNFα are pre-sent in the
TME, and minimal no or low expression of CAR occurs in the absence of IFN-γ and TNFα,
so that the CAR is upregulated and directing activities against the tumor while sparing
normal tissue.
[0082] It is understood that a trade-off may be made between including fewer response elements,
so that a broad spectrum of cancers can be targeted utilizing a same TME responsive
expression construct and including a more comprehensive combination of response elements
increasing the specificity of the expression construct to tumor tissue as opposed
to normal tissue.
[0083] According to some embodiments, the CAR is a chimeric antigen T-cell receptor (CAR-T)
or a chimeric antigen Natural Killer (NK) cell receptor (CAR-NK).
[0084] According to the invention, the promoter response element includes/encompasses interferon-gamma
(IFN-γ, G)-response elements/binding sites, one or more Nuclear Factor kappa-B (NF-κB,
K)-response elements/binding sites, and optionally one or more heat shock protein
70 (HSP-70) response elements/binding sites, one or more hypoxia response (H) elements/binding
sites, one or more Interleukin 6 (IL-6, J) response elements/binding sites or any
combination thereof. Each possibility is a separate embodiment.
[0085] According to the invention, the promoter response element comprises two or more promoter
response elements/binding sites. The two or more promoter response elements/binding
sites include an NF-xB-response elements/binding site and an IFN-γ-response elements/binding
site. According to some embodiments, binding of TME factors to the two or more TME
dependent promoter response elements induces a higher expression level of CAR than
binding to a single TME dependent promoter response element. As a non-limiting example,
binding of NF-κB to the NF-xB-response elements/binding site and TNF-α to the IFN-γ-response
elements/binding site of the promoter may, according to some embodiments, induce a
higher expression of the CAR than binding of NF-κB or TNF-α alone.
[0086] According to the invention, the promoter response element comprises a nucleic acid
selected from the group consisting of GGGAATTTCC set forth in SEQ ID NO. 2 (abbreviated
herein as K), As a non-limiting example, the promoter response element comprises both
the nucleic acid sequence TTCCGGGAA set forth in SEQ ID NO. 1 and the nucleic acid
sequence GGGAATTTCC set forth in SEQ ID NO. 2 (abbreviated G1K1). According to some
embodiments, the nucleic acids may be coextensive. As a non-limiting example, the
nucleic acid sequence GACCTTGAGTACGTGCGTCTCTGCACGTATG set forth in SEQ ID NO. 3 may
be immediately followed by the nucleic acid sequence GCGCTTCCTGACAGTGACGCGAGCCG set
forth in SEQ ID NO. 4 (abbreviated H1J1. According to some embodiments, the nucleic
acids may be separated by a spacer sequence. As a non-limiting example, the nucleic
acid sequence TTCCGGGAA set forth in SEQ ID NO. 1 and the nucleic acid sequence GGGAATTTCC
set forth in SEQ ID NO. 2 may be spaced apart by a spacer element within the same
synthetic promoter.
[0087] According to some embodiments, the TME responsive expression vector further includes
a nucleic acid sequence encoding an externally inducible promoter and a nucleic acid
sequence encoding a trans-activator, e.g. rtTA3. According to some embodiments, the
synthetic promoter drives expression of the trans-activator and the inducible promoter
drives expression of the CAR. According to some embodiments, only the combined presence
of the external inducer and the TME factor results in CAR expression. According to
some embodiments, the presence of the external inducer in the absence of TME factor,
causes substantially no induction of CAR expression. According to some embodiments,
the presence of the external inducer in the absence of TME factor, causes minimal
induction of CAR expression. According to some embodiments, when the TME factor binds
the promoter response element in the absence of the external inducer, essentially
no CAR expression is induced. According to some embodiments, a minor level of CAR
expression is also found in the un-induced state. Such minimal expression may serve
to ensure that CAR-T memory is maintained.
[0088] According to some embodiments, the inducible promoter may be a Tet-Response-Element
promoter, and the external inducer may be doxycycline and/or tetracycline. According
to some embodiments, the Tet-Response-Element may be activated by the combined presence
of the trans-activator and doxycycline and/or tetracycline. The tetracycline (Tet)-On
system is an inducible gene expression system for mammalian cells, in which the reverse
Tet transactivator (rtTA) fusion protein, which is composed of the doxycycline-binding
Tet-repressor mutant protein and the C-terminal activator domain from the herpes simplex
virus VP16 protein, is engineered to control gene expression by providing doxycycline
(Dox). In the presence of Dox, rtTA activates a minimal promoter that is fused downstream
of an array (e.g. seven) repeated Tet-operator sequences. Until recently, all Tet-On
systems had required two separate vectors, one to introduce rtTA and another with
the inducible promoter to control the gene of interest. However, a one-vector system
has recently been developed, which has enabled transduction of a gene of interest
into primary immune cells. By utilizing this one-vector system, it is possible to
control target expression and functions using the Tet-On inducible system.
[0089] According to some embodiments, the CAR molecule encoded by the CAR sequence comprises
an antigen binding domain, a transmembrane domain, and an intracellular domain, optionally
comprising a costimulatory domain and/or a primary signaling domain. According to
some embodiments, the antigen binding domain binds to a tumor antigen. Non-limiting
examples of tumor antigens include: thyroid stimulating hormone receptor (TSHR); CD171
; CS- 1 (CD2 subset 1 , CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-
1 (CLL- 1); ganglioside GD3 (aNeu5Ac(2- 8)aNeu5Ac(2-3)bDGalp(] -4)bDGlcp(l-l )Cer);
Tn antigen (Tn Ag); Fms-Like Tyrosine Kinase 3 (FLT3); CD38; CD44v6; B7H3 (CD276);
KIT (CD117); Interleukin- 13 receptor subunit alpha-2 (IL- 13Ra2); Interleukin 11
receptor alpha (ILl lRa); prostate stem cell antigen (PSCA); Protease Serine 21 (PRSS21);
vascular endothelial growth factor receptor 2 (VEGFR2); Lewis(Y) antigen; CD24; Plateletderived
growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen-4 (SSEA-4);
Mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR);
neural cell adhesion molecule (NCAM); carbonic anhydrase IX (CAIX); Proteasome (Prosome,
Macropain) Subunit, Beta Type, 9 (LMP2); ephrin type-A receptor 2 (EphA2); Fucosyl
GM1 ; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(l
-4)bDGlcp(l -l)Cer; TGS5 ; high molecular weight- melanoma-associated antigen (HMWMAA);
o-acetyl- GD2 ganglioside (OAcGD2); Folate receptor beta; tumor endothelial marker
1 (TEM1/CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); G protein-coupled
receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61);
CD97; CD179a; anaplastic lymphoma kinase (ALK); Polysialic acid; placenta-specific
1 (PLAC1); hexasaccharide portion of globoH glycoceramide (GloboH); mammary gland
differentiation antigen (NY-BR- 1); uroplakin 2 (UPK2); Hepatitis A virus cellular
receptor 1 (HAVCR1); adrenoceptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled
receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); Olfactory receptor
51E2 (OR51E2); TCR Gamma Alternate Reading Frame Protein (TARP); Wilms tumor protein
(WT1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML); sperm
protein 17 (SPA17); X Antigen Family, Member 1A (XAGE1); angiopoietin-binding cell
surface receptor 2 (Tie 2); melanoma cancer testis antigen- 1 (MAD-CT-1); melanoma
cancer testis antigen-2 (MAD- CT-2); Fos-related antigen 1 ; p53 mutant; human Telomerase
reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor
of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion
gene); N- Acetyl glucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3);
Androgen receptor; Cyclin B 1 ; v-myc avian myelocytomatosis viral oncogene neuroblastoma
derived homolog (MYCN); Ras Homolog Family Member C (RhoC); Cytochrome P450 1B 1 (CYP1B
1); CCCTC-Binding Factor (Zinc Finger Protein)-Like (BORIS); Squamous Cell Carcinoma
Antigen Recognized By T Cells 3 (SART3); Paired box protein Pax-5 (PAX5); proacrosin
binding protein sp32 (OY-TES 1); lymphocyte-specific protein tyrosine kinase (LCK);
A kinase anchor protein 4 (AKAP-4); synovial sarcoma, X breakpoint 2 (SSX2); CD79a;
CD79b; CD72; Leukocyte- associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment
of IgA receptor (FCAR); Leukocyte immunoglobulin-like receptor subfamily A member
2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family
12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing
mucin-like hormone receptor- like 2 (EMR2); lymphocyte antigen 75 (LY75); Glypican-3
(GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda- like polypeptide 1
(IGLL1) and any combination thereof. Each possibility is a separate embodiment.
[0090] According to some embodiments, the TME responsive expression vector further comprises
effector-genes encoding a protein (or functional RNA) that enhance penetration of
the immune effector cell in to the tumor, such as, but not limited to, proteases of
the MMP8/9.
[0091] According to some embodiments, the TME responsive expression vector further comprises
one or more effector-genes encoding miRNAs that suppress immuneinhibitors, such as,
but not limited to, PD1 and/or CTLA4, within the tumor.
[0092] According to some embodiments, the TME responsive expression vector further comprises
one or more effector-genes encoding cytokines bringing about immune-cell retention
within the tumor, such as, but not limited to, CXCL9/10 and/or CRCR3 ligands, thereby
generating an autocrine loop.
[0093] According to some embodiments, the vector may be any suitable vector allowing expression
in mammalian cells, such as human cells. According to some embodiments, the vector
may be selected from a DNA vector, an RNA vector, a plasmid, a lentivirus vector,
an adenoviral vector, or a retrovirus vector. Each possibility is a separate embodiment.
[0094] According to some embodiments, a TME vector library may be created, which library
includes TME vectors, each having a unique TME responsive expression element profile.
[0095] According to some embodiments, there is provided an immune effector cell or cell
population comprising the hereindisclosed tumor environment (TME) responsive expression
vector. According to some embodiments, the immune effector cell or cell population
is an NK cell or a T-cell.
[0096] Disclosed herein is a method for treating cancer in a patient in need thereof, the
method comprising administering an effective amount of an immune effector cell comprising
the hereindisclosed tumor environment (TME) responsive expression vector.
[0097] The method further comprises administrating to the patient an external inducer, such
as, but not limited to, tetracycline and/or doxycycline. The external inducer may
be provided before, concurrently with, or after the administration of the immune effector
cell having the hereindisclosed tumor environment (TME) responsive expression vector.
[0098] The method may include a step of evaluating CAR expression levels and/or checking
the patient for adverse effects. The CAR expression levels may be evaluated before
administering the external inducer. The CAR expression levels may be evaluated, during
and/or after administrating the external inducer. As a non-limiting example, a first
bolus of external inducer may be initially given, followed by an evaluation of CAR
expression. A second bolus may then be administered based on the CAR expression level
detected and the patient's response to the treatment. The external inducer may be
provided repeatedly, for example every 10 hours, every day, every two days or any
other suitable time interval. The administering of the external inducer may be terminated
if adverse effects are detected. The amount of external inducer administered may be
increased/decreased based on the evaluated CAR expression levels and/or based on the
patient's response to the treatment.
[0099] Disclosed herein is a method for screening a patient for determination of an optimal
synthetic promoter for CAR expression. The method includes obtaining a biopsy of a
patient's tumor, determining the expression profile of one or more TME factors in
the biopsy; and selecting and/or engineering a TME responsive expression vector having
a TME dependent promoter response element matching the expression profile of the one
or more TME factors in the biopsy. The TME may be expressed by the tumor cells and/or
by non-tumor TME cells. The non-tumor TME cells may be the immune effector cells.
[0100] A tissue sample obtained from the patient's tumor and optionally also from healthy
tissue may be grown
in-vitro and a library of TME-responsive vectors and may be used to screen for the vector
proving most effective and selective for treatment, namely a vector having a TME response
profile matching that of the tumor. This to obtain maximum expression in tumor tissue,
while also being unique to the tumor, so that no or minimal expression is obtained
in healthy tissue.
[0101] The method disclosed herein further includes introducing the selected TME responsive
expression vector into an immune effector cell or cell population. The immune effector
cell or cell population is an NK cell or a T-cell. The immune effector cell or cell
population is autologous to the patient. The immune effector cell or cell population
are isolated from the patient prior to the treatment.
[0102] The method disclosed herein further includes administering the immune effector cell
or cell population to the patient.
[0103] Reference is now made to
FIG. 1 which schematically illustrates an expression construct
100 comprising a synthetic promoter directly controlling expression of a CAR (or a reporter
gene), according to some embodiments. Expression construct
100, when introduced into a host immune effector cell, is configured to directly induce
transcription of the CAR (or the GFP marker) in a tissue environment in which a TME
factor, matching the TME response element of expression construct
100, is prevalent.
[0104] Expression construct
100 includes the following elements:
Synth.Pro.: a synthetic promoter composed of (i) a minimal transcription promoter having a TATAA
box that can initiate expression with adequate proximal elements; and (ii) unique
combinations of promoter response elements, here IFN-γ response element (abbreviated
"G"), NF-kB-response elements (abbreviated "K"), Hypoxia response Elements (abbreviated
as "H"), and/or IL-6 response elements (abbreviated "J").
[0105] TME: marks the area of the promoter in which the promoter response element sequences are
located and to which inducible factors present in the TME can bind, thereby activating
the synthetic promoter (e.g. IFN-γ, TNF-α, Hypoxia and IL-6).
[0106] Puro: a resistance gene that is also transcribed by the synthetic promoter. The resistance
gene may as here be shown to be a puromycin resistance gene; however other resistance
genes are also applicable and within the scope of this disclosure. The resistance
gene is introduced to enable positive
in vitro selection of cells transduced with the vector.
[0107] IRES: Internal Ribosome Entry Site enables translation of both the resistance gene and
the target gene (e.g. CAR or a GFP marker) from the same mRNA.
[0108] Reference is now made to
FIG. 2 which schematically illustrates an expression construct
200 comprising a synthetic promoter indirectly controlling expression of a CAR (or a
reporter gene), according to some embodiments. Expression construct
200, when introduced into a host immune effector cell, is configured to induce transcription
of a transactivator in a tissue environment in which a TME factor, matching the TME
response element of expression construct
200, is prevalent. The transactivator will then induce expression of the CAR if an exogenously
administered inducer (here doxycycline) is provided. Such indirect induction of CAR
expression provides an ON-OFF safety mechanism, enabling cessation of CAR expression
in case non-specific expression is detected or adverse effects observed.
[0109] Expression construct
200 includes the following elements:
Synth.Pro.: a synthetic promoter composed of (i) a minimal transcription promoter having a TATAA
box that can initiate expression with adequate proximal elements; and (ii) unique
combinations of promoter response elements, here IFN-γ response element (abbreviated
"G"), NF-kB-response elements (abbreviated "K"), Hypoxia response Elements (abbreviated
as "H"), and/or IL-6 response elements (abbreviated "J").
[0110] TME: marks the area of the promoter in which the promoter response element sequences are
located and to which inducible factors present in the TME can bind, thereby activating
the synthetic promoter (e.g. IFN-γ, TNF-α, Hypoxia and IL-6).
[0111] Puro: a resistance gene that is also transcribed by the synthetic promoter. The resistance
gene may as here be shown to be a puromycin resistance gene; however other resistance
genes are also applicable and within the scope of this disclosure. The resistance
gene is introduced to enable positive
in vitro selection of cells transduced with the vector.
rtTA3: trans-activator gene the transcription of which transcription is mediated by the
synthetic promoter.
[0112] IRES: the IRES element enables transcription of both the resistance gene and the transactivator
gene (here rtTA3) from the same synthetic promoter.
[0113] Dox: doxycycline, a potent analog of tetracycline, which serves as a co-activator to the
trans-activator.
[0114] TRE3G: a Tet-Response-Element promoter that is activated by the combined presence of the
rtTA3 and exogenous doxycycline and which mediates the transcription of CAR (or a
reporter gene or other target gene). This is the basis of the enhancementsafety vector
that, on the one hand, allows an amplified, TME specific CAR expression in conjunction
with an additional safety layer by constructing the abovementioned synthetic promoter
in front of the rtTA3 trans-activator and the reporter gene/CAR under the Tet-Response-Element
promoter. The inclusion of rtTA-tet response provides an amplification of the transcription
as it recruits the VP 16 transcription activator. In addition, the tetracycline/doxycycline-inducible
element adds another layer of safety as it is active only in the presence of the tetracycline
(or Dox), thus allowing it to turn the system OFF easily.
miRE: the micro-RNA element (miRE) is providing both transcription-ending for the TRE3G
promoter-transcribed ORF and concurrent expression of miR for the silencing of other
genes of interest (e.g. silencing of the endogenous T-cell Receptor or immune checkpoint
receptors like PD-1).
[0115] Disclosed herein is a method for screening a promoter-library for having an optimal
Tumor Micro-Environment (TME) expression pattern, i.e. promoters inducing strong expression
in a TME, yet having little, if any, expression in non-TME.
[0116] The promoter library includes expression constructs with candidate synthetic promoters
that are constructed and optionally tested functionally
in vitro.
[0117] The promoters in the library have nucleic-acid sequences with expected binding-sites
of transcription-factors that are activated within TMEs.
[0118] The promoter includes more than one candidate nucleic-acid sequence, the candidate
nucleic acid sequences being spaced apart by nucleotide sequences (also referred to
herein as "spacers").
[0119] The promoter further includes a minimal-promoter sequence followed by a reporter
gene, such as fluorescent-proteins.
[0120] The construct includes two fluorescent reporters: a first reporter having a cryptic
off-frame ATG-start codon, and a second reporter positioned after an Internal-Ribosome-Entry-Site
(IRES) enabling independent translation thereof. The first fluorescent reporter will
be poorly translated, yielding a signal only when highly transcribed, while the second
fluorescent reporter is independently translated, also when transcribed at low-levels.
[0121] The library of candidate promoters includes promoters with a constant "core" portion,
and variable nucleotides that are based on the binding-sites of the transcription
factors of interest. Spacer-sequences, tandem-repeats of binding-sites, and the composition
of various binding-sites of multiple factors are also enabling the generation of the
libraries. The complexity may be limited by focusing variable-nucleotide on strategic
positions, based on an analysis of multiple binding-sites of the transcription-factors
of interest. The complexity may be increased by addition of variable nucleotides and/or
repeats of binding-sites and/or the spacers between them.
[0122] As a non-limiting example, the core-sites with specific variable nucleotides may
include, but not be limited to: AYTTCCSGGAART for STAT1-binding, and GGRRRTTYYC for
NF-kB, where A=adenine, T=thymidine, C= cytidine, G=guanine, Y=C/T, S=C/G, R=A/G.
Non-limiting examples of suitable spacers include: AGGGTGGGCAAGT, tctaga, GGGGACTTTCC.
[0123] The promoters are cloned into an expression-vector, such as, but not limited to,
a pHage2 lentiviral vector with the above described first and second fluorescentreporters,
as well as additional sequences needed for plasmid propagation and for the generation
of lentiviral particles.
[0124] The synthetic promoter sequences may be cloned into the expression vector using any
cloning technique. Non-limiting examples of suitable cloning techniques include "classical"
cloning using restriction-enzymes, and in-fusion cloning.
[0125] Optionally, PCR-amplification of the promoter library using a non-proof-reader polymerase
may be utilized to introduce random mutations, which may further increase the variability
and complexity of the library.
[0126] Lentiviruses may be generated by common techniques, such as by transient co-transfection
of the expression vector, together with packaging-plasmids, in 293T-HEK cells. Cell-lines
of interest (e.g. 293 cells) may then be transduced with the virus (preferably at
a MOI<0.3) to obtain a single copy per cell, and may afterwards be expanded as needed.
[0127] The method disclosed herein further includes identifying cells with optimal promoters,
i.e. promoters inducing strong expression in a TME, yet having little if any expression
in non-TME. The cells may be identified by growing the transduced cells with and without
stimulus and in the presence/absence of the relevant TME factors, such as, but not
limited to: TNF-alpha, IFN-gamma, Hypoxia, IL-6 and TGF-beta. The cells are then sorted
(e.g. using FACS) according to their expression of the reporter genes. Cells with
very-high expression that gain dual-colors of both the first and the second fluorescent
reporters may be separated from cells with moderate-high expression of the second
reporter only.
[0128] It is understood that other techniques may be used. For example, the first and second
reporters may be antibiotic resistance genes in which case the sorting may be made
identifying antibiotic resistant cells.
[0129] The sorted cells are further expanded without stimulating cytokines and then sorted
for negative/low expression of the first reporter in order to avoid constitutiveactive
promoters. Cells that show negative/low first reporter expression in the absence of
stimulation are then further expanded.
[0130] The method disclosed herein may further include additional stimulation-sorting steps,
by essentially repeating the positive and negative selections described above.
[0131] Once a desired-phenotype is obtained, the method disclosed herein may further include
extracting genomic DNA from the cells (optionally after an additional expanding of
the cells) using conventional molecular biology. The promoters of the vectors are
extracted using PCR; for example, using primers specific to sequences upstream and
downstream of the integrated library. The primers include additional extended portions
allowing direct sequencing using commercial services.
[0132] The method disclosed herein further includes comparing the sequences of the enriched
promoters to the sequences of the library, and optionally also to known promoters
to identify novel optimal promoter sequences.
[0133] The method further includes validating the activity of the identified optimal promoters
in the screened cell-line and/or in other cell-lines and/or in primary immunecells
of interest.
[0134] Reference is now made to
FIG. 3, which is an illustrative flowchart
300 of the method for screening a promoters-library for providing an optimal Tumor Micro-Environment
(TME) CAR-expression pattern.
[0135] In step
310 of the method a library (e.g. lentiviral (LV) library) including candidate promoters
is constructed, as essentially described herein.
[0136] In step
320 cell lines (e.g. 293 cells) are infected with the lentiviruses of the library. Once
cell lines expressing the promoter constructs are generated, in step
330, the cells are grown in the presence or absence of stimuli (rtTA3 and doxycycline)
and in the presence or absence of stimulating cytokines and then sorted (e.g. by FACS)
according to their reporter gene expression profile, by separating cells with very-high
expression that gain dual-colors of both the first and the second fluorescent reporters
from cells with moderate-high expression of the TME dependent reporter only. As explained
herein, this step may be repeated to further enhance the sensitivity and/or specificity
of the promoter.
[0137] In step
340 cells having a desired expression profile (high expression of both promoters in the
presence of stimuli and cytokines, while having little or no expression of the second),
TME dependent reporter, in the absence of cytokines, are identified, and their promoter
sequenced (step
350).
[0138] The following examples illustrate the invention but should not be construed as limiting
its scope, which is defined by the claims.
EXAMPLES
Example 1 - Defining response elements
[0139] Promoters, including the following response elements sequences, are listed in Table
1 below. The response elements were constructed just before a minimal transcription
promoter with a TATAA box that can initiate expression with adequate proximal elements.
[0140] The factors or combination of factors binding to the response elements listed in
Table 1 (e.g. TNF-α, NF-κB and IL-6) are characteristic for many TME, and certain
combinations of these factors may specifically represent a TME signature/profile.
[0141] However, it is noted, that the aforementioned factors may not be present in all TMEs.
Similarly, additional factors may also be found in certain TMEs. Accordingly, other
response elements may be included or may substitute the aforementioned response elements,
and such additions and/or substitutions are within the scope of this disclosure.
[0142] Moreover, as explained herein, it is understood that a trade-off may be made between
including less or more response elements. For example, including fewer types of response
elements may enable targeting the expression to a broad spectrum of cancers, utilizing
a same TME responsive expression construct. As another example, including a more comprehensive/exhaustive
combination of response elements may increase the specificity of the expression construct
to tumor tissue as opposed to normal/healthy tissue.
Example 2 - Controlling promoter leakiness:
[0143] A major aspect of the invention is gaining an endogenous-induction of immuneeffector
genes within TME. The synthetic promoter disclosed herein is configured to induce
the expression within TME, while substantially limiting expression in healthy tissues.
Therefore, the leakiness of the synthetic promoters was evaluated.
[0144] Two types of leakiness were envisaged.
[0145] The first type of leakiness manifests as transcription from the TME stimulated promoter,
in the absence of TME factors, whether of CAR/GFP reporter, as in the case of expression
construct
100 of
FIG. 1 or of the transactivator, as in the case of expression construct
200 of
FIG. 2. This type of leakiness may be due to induction of the minimal promoter, without
an exogenously provided TME-related stimulus, either because the cells tested endogenously
express the factors, or due to promoter leakiness
per se.
[0146] The second type of leakiness level, relevant for the expression constructs including
a Tet-Response-Element promoter, such as expression construct
200 of
FIG. 2, refers to expression of CAR/GFP reporter in the absence of doxycycline/tetracycline.
This type of leakiness may be due to (i) presence of residual tet/dox in media or
sera used and thus be an artifact of the
in-vitro setting; or (ii) promoter leakiness
per se.
[0147] HEK293T cells were transduced with the expression vectors disclosed in FIG. 2 and
the following response elements:
- 1. G2 (2×IFN-γ),
- 2. G1K0.6 (combination of 1×IFN-γ and 60% of NF-κB sequence element), or
- 3. G3K3 (combination of 3xIFN-y and 3×NF-κB).
[0148] The cells underwent selection with puromycin to ensure the survival of only vector-transduced
cells.
[0149] The GFP-intensity as well as the percentage of GFP-positive cells were tested.
[0150] As seen from the histograms of
FIG. 4A as well as in the representative FACS plot in
FIG. 4B, in all three instances, adding doxycycline to the cell media did not, by itself,
induce GFP expression (i.e. no increase in GFP intensity or in the percentage of GFP-positive
cells was observed). However, in the combined presence of Doxycycline and TNF-α and/or
IFN-γ, GFP intensity as well as the percentage of GFP-positive cells were markedly
increased.
[0151] These results clearly demonstrate that the herein disclosed expression constructs
enable TME specific expression.
Example 3 - Response element synergism
[0152] It was hypothesized that including combinations of TME responsive elements would
provide a synergistic expression.
[0153] The effect of including a number of IFN-γ elements (2, 4, and 6) as compared to a
single IFN-γ element, reached a plateau already after two IFN-γ elements, both in
the frequency of GFP-positive cells and in the GFP intensity (data not shown).
[0154] However, as seen from
FIG. 5, a synergism was advantageously observed when NF-κB responsive elements were added
to the IFN-γ elements, in that a promoter including three IFN-γ element response elements
and three NF-κB response elements provided significantly higher percentages of GFP
positive cells than a promoter including only IFN-γ response elements.
Example 4 - TME profiling
[0155] Intensity and frequency of GFP expression, upon stimulus with a combination of inflammatory
cytokines versus stimulus with single cytokines, was also tested. In short, HEK293T
cells were transduced with vectors containing one of the following synthetic promoters:
- 1. G1K0.6: 1×IFN-γ and 60% of NF-κB,
- 2. G3K3: combination of 3×IFN-γ and 3×NF-κB.
[0156] This time the cells were harvested without prior puromycin selection, and the results
thus represent the entire cell population, transduced as well as non-transduced cells.
[0157] FIG. 6 shows representative FACS plots (upper panels), gating GFP-positive cells (GFP+),
as well as histograms (lower panels) showing a quantification of the GFP intensity
(Median) for each tested condition.
[0158] Notably, transducing cells with the expression construct, having a G3K3 response
element, showed cumulative expression, per cytokine added. In cells transduced with
the expression construct having a G1K0.6 response element, adding each of IFN-γ and
TNF-α separately caused only low levels of expression, whereas combined treatment
with both IFN-γ and TNF-α induced substantial higher expression levels.
[0159] These results clearly show that controlled levels of expression can be achieved using
the hereindisclosed expression constructs. Preferably, the construct utilized should
be accustomed to the TME profile of the cells treated/targeted so as to optimize the
expression level based on need.
Example 5 - 3-factor response element
[0160] Following the study with combinations of two response elements IFN-γ and NF-κB (G
and K), response elements including binding sites of additional factors, namely IL-6
and hypoxia (J and H), were also evaluated essentially as described above.
[0161] HEK293T cells were transduced with vectors containing one of the following synthetic
promoters:
- 1. G1K0.6J1: 1×IFN-γ, 60% of NF-κB, 1×IL-6 response element sequences.
- 2. G1K0.6H1: 1×IFN-γ, 60% of NF-κB, 1×Hypoxia response element sequences.
[0162] GFP intensity and frequency of expression, was evaluated by FACS before and after
stimulation with the indicated factors. Cells were harvested without selection.
[0163] FIG. 7 shows FACS plots (upper panels) of GFP-positive cells (GFP+) for each promoter and
on each condition and histogram (lower panels) depicting quantification of the expression
intensity (as Median) of the GFP-positive cells at each condition.
[0164] As seen from
FIG. 7, the insertion of a third response element downstream to G1K0.6 elements did not
further contribute to its synergistic effect. It is noted that this may not necessarily
be a general observation but rather be representative of the specific cell line tested.
Example 6 - screening for optimal promoter sequences
[0165] In order to identify promoters providing an optimal CAR expression profile, a lentiviral
library of candidate promoters was constructed. The library includes constructs with
promoters having a constant "core" portion, and variable nucleotides that are based
on the binding-sites of the transcription factors of interest. Spacer-sequences, tandem-repeats
of binding-sites, and the composition of various binding-sites of multiple factors
are also included. The variability of the promoters was generated by changing, adding
and/or deleting nucleotides at strategic and/or random positions of the promoters.
Complexity was further increased by varying the number of binding-site repeats and/or
the spacers between them. A total of 65,536 promoter sequences were included in the
screen.
[0166] The constructs of the library include a fluorescent reporter (GFP) having a cryptic
off-frame ATG-start codon ensuring that the reporter gene is only translated in the
presence of high level of transcripts, i.e. high levels of transcription factor, here
TME transcription factors. The constructs also include a second reporter (DsRed) positioned
after an Internal-Ribosome-Entry-Site (IRES) enabling independent translation thereof,
also at low levels of transcripts.
[0167] The constructs were then cloned into lentiviral vectors, and viruses were generated
by transient co-transfection of the lentiviral vector together with packaging-plasmids
into 293T-HEK cells.
[0168] 293 cells were then infected (transduced) with the lentiviruses to obtain cell lines
having incorporated into their genome a promoter construct of the library.
[0169] Subsequently, the transduced cells were then grown for 48h in the presence or absence
of 250U/mL TNF, IFN or TNF and IFN and subsequently subjected to FACS sorting. Initially,
cells showing high GFP expression or high GFP and DsRed expression in the presence
of TNF, IFN or TNF and IFN were gated ("positive" sorting). As seen from the upper
panel of
FIG. 8, in the absence of cytokines, only 0.09% of the cells showed high GFP expression,
while in the presence of TNF, IFN or TNF and IFN 0.2% of the cells had high GFP expression.
[0170] The gated cells were then subjected to a round of "negative" sorting after having
been grown in the absence of cytokines (
FIG. 8 second panel). During this sorting step, cells having no or little GFP expression
in the absence of cytokines were acquired, whereas cells with promoters causing constitutive
expression were discarded (or separately sorted).
[0171] The positive and negative rounds of sorting were repeated twice (
FIG. 8 3
rd and 4
th panels) until a final population, being 1.94% of the initial population, was acquired,
which population being characterized by having high GFP expression, i.e. having an
expression pattern highly sensitive to the presence/absence of TNF and/or IFN.
[0172] The acquired cells were propagated, and their promoter was sequenced using promoter
specific primers. The screen identified 19 sequences out of the 65,536 sequences included
in the screen. 18 were essentially similar but differed in 16 nucleotides (bold and
underlined) plus in some instances some additional more random changes. An additional
sequence (SEQ ID NO: 41) somewhat different from the other 18 was also retrieved
[0173] Table 2 below provides the sequences of promoters providing an optimal CAR expression
profile, retrieved from the screen.
Example 7 - Designing new PRE-based libraries and combining basic sequence or library-optimized
sequence with other PREs into the same synthetic promoter
[0174] To generate a library of a specific PRE, either alone or combined with other PREs
we took the following general approach, here described in detail while using the hypoxia
PRE element as an example.
[0175] PRE sequences utilized in hypoxia dependent promoters of different genes were collected.
[0176] Based on the sequences a basic, non-naturally occurring hypoxia PRE element was generated
by taking portions from natural occurring sequences suggested to function as hypoxia
PRE in different genes. The portions include:
HBS sequence (ACGTG) found for example in the hypoxia dependent LDHA/EPO/VEGF genes.
[0177] Linker 1 (GCTGGAGT) an 8-nucleotide linker, not found in the promoters of natural
target genes (not part of LDHA/EPO/VEGF genes).
[0178] HAS (CACAG) found for example in the hypoxia dependent EPO gene.
[0179] Linker 2 (TCCTCTT) a 7-nucleotide linker, not found in the promoters of natural target
genes (not part of LDHA/EPO/VEGF genes).
[0180] These sequences were linearly combined into one sequence and then doubled in tandem
to obtain the sequence set forth in SEQ ID. NO. 42

[0181] Representing a "basic hypoxia PRE". It is understood that the basic hypoxia PRE is
exemplary only and that other combinations, linkers, number of PREs as well as their
orientations can also be envisaged.
[0182] The "basic hypoxia sequence" can then be added to additional PRE sequences (of the
same or a different TME) to generate modified/alternative synthetic promoters. Non-limiting
examples of optional modified/alternative synthetic promoters based on a basic TME
factor (here hypoxia) PRE include
(i) Single or combined PREs,
As a non-limiting example, the basic hypoxia PRE may be combined with G1K1 sequence
(set forth in SEQ ID NO. 9), thereby generating the sequence set forth in SEQ ID NO.
46 (also referred to as H1G1K1).


(ii) Alternative positioning: the basic TME factor PRE can be added 5 prime and/or
3 prime and/or the middle of the synthetic promoter.
(ii) Alternative orientation: the basic TME factor PRE can be flipped and added as
above in (i) and (ii).
As a non-limiting example the basic hypoxia PRE may be combined with G1K1 sequence
(set forth in SEQ ID NO. 9) in a flipped configuration thereby generating the sequence
set forth in SEQ ID NO. 47 (also referred to as H1flipG1K1.

(iv) Alternative Sequence. Nucleotides of the basic TME factor PRE sequence can be
substituted. For example, as set forth in SEQ ID NO. 43.

[0183] Following the generation of the library, the library screen for the best sequences;
i.e. the sequences that induce the less leakiness and the highest response to hypoxia
stimulation, as essentially described in Example 6.
[0184] It is understood that the described approach for designing "basic response elements"
and then generating a library of modified/alternative PREs based on the "basic response
element" - may be adapted for all of the herein described TME factor PREs.