[CROSS-REFERENCE TO RELATED APPLICATIONS]
[0001] The present application is based upon and claims the benefit of the priority from
prior Japanese Patent Application No.
2017-173823, filed on September 11, 2017; the entire contents of which are incorporated herein by reference.
[Technical Field]
[0002] The present invention relates to cabbage endowed with downy mildew resistance and
a method for breeding the same. More specifically, the present invention relates to
cabbage having a downy mildew resistant gene positioned in the vicinity of the loci
represented by SEQ ID NO. 1 to SEQ ID NO. 7, and the method for breeding the same.
[Background Art]
[0003] Downy mildew in Brassicaceae plants is a disease caused by
Hyaloperonospora brassicae, which belongs to the oomycetes, and brings about damages on many crops such as
Brassica oleracea species including cabbage, Brussels sprouts, cauliflower, broccoli, kohlrabi, Brassica
rapa species including Chinese cabbage, turnip, and Komatsuna, and
Brassica napus species including rapeseed.
[0004] The symptoms of this disease are mainly found in leaves; yellow to pale brown blotches
with unclear borders are formed and gradually enlarged, and the leaves wither, whereby
the growth is adversely influenced (Fig. 1). If the curds of broccoli and cauliflower,
or the roots of turnip or Japanese radish are infected, brown or black discoloration
occurs inside and outside the tissues, this greatly decreases their commercial values.
Especially in a highly humid environment, the disease quickly spreads and causes a
severe damage, so that chemical control with fungicides is usually carried out.
[0005] Cabbage (
B. oleracea var. capitata), which is one of the most important crops of Brassica oleracea, has abundant varieties,
and the varieties suitable to the domestic soils and climates are cultivated in many
countries in the world.
[0006] However, even though cabbage has some lines that exhibit moderate resistance against
downy mildew in an unknown heredity manner and likely due to quantitative factors,
but the presence of downy mildew resistant varieties having single, dominant resistant
factor is unknown.
[0007] Therefore, in the areas where downy mildew frequently occurs, disease control by
fungicides must be carried out for reducing the disease, and this requires much labor
and cost. Therefore, development of resistant breeding materials and resistant varieties
have been desired.
[0008] However, in spite of such strong demands, downy mildew resistant varieties of cabbage
have not been produced as far as the inventors know. The reason for this is likely
that the genetic resources of cabbage include no useful downy mildew resistant factor.
[0009] Meanwhile, for broccoli (
B. oleracea var. italica) which is a related species of cabbage, there are some reports on the heredity analysis
of downy mildew resistant factors (for example,
J. Amer Soc Hort Sci (2001), vol. 126, p. 727 (Non Patent Document 1),
Euphytica (2002), vol. 128, p. 405 (Non Patent Document 2), and
Euphytica (2003), vol. 131, p. 65 (Non Patent Document 3)).
[0010] However, these resistant factors in broccoli have not been used in breeding of cabbage.
The reason for this is likely that the morphological characters of cabbage and broccoli
are totally different. Broccoli can be hybridized with cabbage because both of them
belong to Brassica oleracea, but broccoli has many characters which are unnecessary
for cabbage, so that broccoli is very difficult to handle as a breeding material.
[Prior Art List]
Non Patent Document
[0011]
Non Patent Document 1: M. Wang et al., J. Amer Soc Hort Sci (2001), vol. 126, pp. 727-, "Inheritance of
True Leaf Stage Downy Mildew Resistance in Broccoli"
Non Patent Document 2: M. W. Farnham et al., Euphytica (2002) vol. 128, pp. 405-, "A single dominant gene
for downy mildew resistance in broccoli".
Non Patent Document 3: P. S. Coelho et al., Euphytica (2003) vol. 131, pp. 65-, "Inheritance of downy mildew
resistance in mature broccoli plants"
[SUMMARY OF THE INVENTION]
[Problems to be solved by the Invention]
[0012] The present invention is intended to provide a novel cabbage having marked resistance
against downy mildew, and a method for breeding the cabbage.
[Means for Solving Problems]
[0013] The inventors have developed markers linked to downy mildew resistant factors, and
used them in the combination of broccoli and cabbage, and succeeded in breeding a
cabbage line which has a downy mildew resistant factor and also has a high commercial
value.
[0014] The Brassica oleracea plant obtained by hybridization of broccoli and cabbage by
the inventors had a figure of a wild species in the original hybrid and the first
backcross generation. Thereafter, the inventors repeated backcrossing for replacing
the genome region irrelevant to downy mildew with the genotype of cabbage type through
the selection of markers linked to downy mildew resistance and the application of
genome-wide markers, thereby succeeding breeding cabbage which shows high resistance
against downy mildew.
[0015] More specifically, the inventors have found a broccoli line which has downy mildew
resistance applicable to a wide range of varieties, and developed markers linked to
the downy mildew resistant factors held by the line, and proved that the use of them
allows breeding a cabbage line with a high industrial value. The use of the downy
mildew resistant cabbage or the method for breeding a downy mildew resistant cabbage
provided by the present invention allows imparting downy mildew resistance to cabbage
which has been susceptible to downy mildew.
[0016] The present invention is based on these findings.
[0017] More specifically, the present invention provides the following inventions.
<1> Cabbage or its progeny having resistance against downy mildew.
<2> The downy mildew resistant cabbage or its progeny according to <1>, having a downy
mildew resistant gene which is positioned in the vicinity of the locus represented
by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7.
<3> The downy mildew resistant cabbage or its progeny according to <1> or <2>, having
a downy mildew resistant gene which is detectable by any one or more of the primers
having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.
<4> The downy mildew resistant cabbage or its progeny according to any one of <1>
to <3>, wherein the downy mildew is a disease caused by Hyaloperonospora brassicae.
<5> The downy mildew resistant cabbage or its progeny according to any one of <1>
to <4>, wherein the downy mildew resistant gene is found in the broccoli variety specified
by Accession Number FERM BP-22343.
<6> The downy mildew resistant cabbage or its progeny according to any one of <1>
to <4>, wherein the downy mildew resistant gene is found in the cabbage variety specified
by Accession Number FERM BP-22344.
<7> A portion of a plant body of the cabbage or its progeny according to any one of
<1> to <6>.
<8> A seed of the cabbage or its progeny according to any one of <1> to <6>.
<9> First filial generation cabbage or its portion having resistance against downy
mildew specified by Accession Number FERM BP-22344, or a seed of the cabbage.
<10> A method for breeding downy mildew resistant cabbage, including introducing downy
mildew resistance from a Brassica oleracea plant having resistance against downy mildew
into desired cabbage.
<11> A method for breeding downy mildew resistant cabbage, including introducing downy
mildew resistance from a Brassica oleracea plant having resistance against downy mildew
into desired cabbage, the downy mildew resistance being confirmed by a downy mildew
resistant gene positioned in the vicinity of the locus represented by any one of SEQ
ID NO. 1 to SEQ ID NO. 7.
<12> A method for breeding the downy mildew resistant cabbage according to <10> or
<11>, wherein the Brassica oleracea plant having resistance against downy mildew is
a Brassica oleracea plant other than cabbage.
<13> The breeding method according to any one of <10> to <12>, wherein the Brassica
oleracea plant having resistance against downy mildew is a broccoli variety specified
by Accession Number FERM BP-22343.
<14> The breeding method according to <10> or <11>, wherein the Brassica oleracea
plant having resistance against downy mildew is a cabbage variety specified by Accession
Number FERM BP-22344.
<15> The breeding method according to any one of <10> to <14>, wherein the introduction
of downy mildew resistance into desired cabbage is achieved by continuous backcross
of the cabbage.
<16> The breeding method according to any one of <10> to <15>, including assaying
the presence of a downy mildew resistant gene using one or more of the DNA sequences
represented by SEQ ID NO. 1 to SEQ ID NO. 7, or one or more of the primers or primer
pairs which can amplify the DNA sequence.
<17> The breeding method according to <16>, wherein the primer is represented by any
one or more of SEQ ID NO. 8 to SEQ ID NO. 21.
<19> A marker having any one of the nucleotide sequences represented by SEQ ID NO.
1 to SEQ ID NO. 7, the marker being able to detect a downy mildew resistant locus
in a Brassica oleracea plant.
<20> A primer set including any one or more of the primers having the nucleotide sequences
represented by SEQ ID NO. 8 to SEQ ID NO. 21, the primer set being able to detect
a downy mildew resistant locus in a Brassica oleracea plant.
<21> A method for detecting downy mildew resistance in a Brassica oleracea plant,
including using any one or more of markers having the nucleotide sequences represented
by SEQ ID NO. 1 to SEQ ID NO. 7, or any one or more of the primers having the nucleotide
sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.
Advantageous Effects of Invention
[0018] The downy mildew resistant cabbage of the present invention has marked resistance
against downy mildew caused by
Hyaloperonospora brassicae. Additionally, the use of the downy mildew resistant cabbage according to the present
invention as a material allows further breeding a novel downy mildew resistant cabbage
line. Furthermore, the use of a marker linked with downy mildew resistance according
to the present invention allows detection or selection of downy mildew resistance
even no inoculation test is carried out. The cultivation of a cabbage line bred according
to the present invention allows cabbage cultivation even in areas where the cultivation
has been difficult because of the occurrence of downy mildew, and reduces the labor
and cost of chemical spraying which has been necessary in cultivation. Additionally,
the downy mildew resistant cabbage according to the present invention allows shipping
of fresh vegetables cultivated with a reduced number of chemical spraying, and further
suppresses the occurrence of diseases, this allows harvest of fresh vegetables with
a high excellent product rate.
[BRIEF DESCRIPTION OF DRAWINGS]
[0019]
Fig. 1 illustrates a symptom by a downy mildew inoculation test (the left illustrates
a susceptible line, and the right illustrates resistance line). In the figure, for
the left susceptible line, formation of yellow to brown lesions is observed on the
surface of leaves.
Fig. 2 illustrates an electrophoretic pattern of a DNA marker linked to the vicinity
of a downy mildew resistant factor (Example 2).
Fig. 3 illustrates a linkage map in the vicinity of a downy mildew resistant factor
(Example 3).
Fig. 4 illustrates an index of disease severity score in field trial production of
Example 5.
Fig. 5 illustrates the result of field trial production of a cabbage line bred according
to the present invention (Example 5), including the condition of "CB-20" (original
parental line) and the isogenic line introduced with a downy mildew resistant factor.
Fig. 6 illustrates the result of field trial production of three cabbage lines bred
by the present invention (Example 5).
Fig. 7 illustrates the result of trial production of the first filial generation (F1)
variety using the cabbage parental line "DMR-CB-20" bred by the present invention
(Example 6).
Fig. 8-1 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).
Fig. 8-2 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).
Fig. 8-3 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).
Fig. 8-4 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).
Fig. 8-5 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).
[EMBODIMENTS FOR CARRYING OUT THE INVENTION]
[0020] The present invention is described below in detail.
Downy mildew resistant cabbage
[0021] The present invention relates to, as described above, cabbage having resistance against
downy mildew (downy mildew resistant cabbage), or its progeny.
[0022] In the present description, "progeny" includes hybrids obtained by hybridizing the
downy mildew resistant cabbage according to the present invention and a Brassica oleracea
plant which can be hybridized with the plant. Accordingly, "progeny" also includes,
for example, those obtained by hybridizing the downy mildew resistant cabbage according
to the present invention as a pollen parent (male parent) and a Brassica oleracea
plant as a seed parent (female parent) which can be hybridized with the plant. Additionally,
"progeny" also includes, for example, the plants obtained by cell fusion of the downy
mildew resistant cabbage according to the present invention and a plant which can
be fused with the cabbage, and interspecific hybrid plants.
[0023] The term "Brassica oleracea plant" means a cruciferous plant, which is a Brassica
oleracea plant belonging to genus Brassica, and includes, for example,
B. oleracea var. capitata (cabbage),
B. oleracea var. italica (broccoli),
B. oleracea var. botrytis (cauliflower),
B. oleracea var. gemmifera (brussels sprout),
B. oleracea var. gongyloides (kohlrabi),
B. oleracea var. acephara (ornamental cabbage, kale), and
B. oleracea var. albograbra (Chinese kale).
[0024] The "cabbage" herein means a plant species belonging to Brassica oleracea, and is
a plant species classified as
B. oleracea var. capitata.
[0025] In the present description, "downy mildew" means a disease caused by an oomycete
of the family Peronosporaceae, preferably a disease caused by
Hyaloperonospora brassicae. Accordingly, resistance against downy mildew herein means resistance against the
diseases caused by these pathogens.
[0026] Accordingly, the downy mildew resistant cabbage according to the present invention
shows resistance against downy mildew fungus (preferably
Hyaloperonospora brassicae), and gives single, dominant expression. The use of this plant as a material allows
breeding a novel cabbage parental line having downy mildew resistance.
[0027] The "parental line" herein means a line bred for producing a hybrid variety and usually
a hybrid variety is produced by hybridizing two or more parental lines having different
phenotypes.
[0028] Accordingly, the "downy mildew resistance" in the present invention means resistance
against a downy mildew pathogen
Hyaloperonospora brassicae, and is more specifically based on the factor positioned in the vicinity of SEQ ID
NO. 1 to SEQ ID NO. 7.
[0029] That is, according to a preferred embodiment of the present invention, the downy
mildew resistant cabbage or its progeny according to the present invention has a downy
mildew resistant gene positioned in the vicinity of the locus represented by any one
or more of SEQ ID NO. 1 to SEQ ID NO. 7.
[0030] Here, the definition "represented by any one or more of SEQ ID NO. 1 to SEQ ID NO.
7" includes the case where the nucleotide sequences represented by SEQ ID NO. 1 to
SEQ ID NO. 7 are within the range of certain sequence identity, or of the range having
partial mutation. The sequences of the range which can be handled equally to those
of SEQ ID NO. 1 to SEQ ID NO. 7 can be easily understood by those skilled in the art.
[0031] Accordingly, for example, the definition "represented by any one or more of SEQ ID
NO. 1 to SEQ ID NO. 7" is used in the sense of including the case represented by any
one or more of the following nucleotide sequences (a) to (c):
- (a) any one or more of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ
ID NO. 7.
- (b) any one or more of the nucleotide sequence having sequence identity of 95% or
more to the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, and
- (c) any one or more nucleotide sequences prepared by deletion, substitution, insertion,
and/or addition of one or a plurality of the nucleotide sequences represented by SEQ
ID NO. 1 to SEQ ID NO. 7.
[0032] Therefore, according to a preferred embodiment of the present invention, the downy
mildew resistant cabbage or its progeny according to the present invention is regarded
as having a downy mildew resistant gene positioned in the vicinity of the locus represented
by any one or more of the nucleotide sequences represented by the above-described
(a) to (c).
[0033] In the (b), "having sequence identity of 95% or more to the nucleotide sequences
represented by SEQ ID NO. 1 to SEQ ID NO. 7" includes SEQ ID numbers having sequence
identity of at least 95%, preferably at least 96%, even more preferably at least 97%,
yet even more preferably 98%, and particularly preferably at least 99% to the nucleotide
sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7 as calculated by using a known
algorithm for homology search such as BLAST and FASTA (for example, using a parameter
of default, or initial setting).
[0034] The term "sequence identity" herein means, for example, the percentage (%) of the
number of identical nucleotides to the total number of the nucleotides including gaps,
when two base (nucleotide) sequences are aligned (where a gap may be introduced or
not introduced).
[0035] In the (c), "a plurality of" in "deletion, substitution, insertion, and/or addition
of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ
ID NO. 7" is, for example, about 10, preferably eight, more preferably six, even more
preferably five, yet even more preferably four, further yet even more preferably three,
and further yet even more preferably two, and particularly preferably one.
[0036] According to a preferred embodiment of the present invention, SEQ ID NO. 1 to SEQ
ID NO. 7 may be SEQ ID NO. 22 to 28, respectively. SEQ ID NO. 22 to 28 include the
sequences outside the sequences of SEQ ID NO. 1 to 7 between primers (including the
sequences of the primers), and were discovered by the inventors in the below-described
Example 2.
[0037] Accordingly, the phrase "represented by any one or more of SEQ ID NO. 22 to 28" means
that only the parts of SEQ ID NO. 1 to 7 included in these sequences include that
represented by any one or more of the above-described nucleotide sequences (a) to
(c), and the case in which SEQ ID NO. 22 to 28 are represented by any one or more
of the following nucleotide sequences (a') to (c').
(a') any one or more of the nucleotide sequences represented by SEQ ID NO. 22 to SEQ
ID NO. 28,
(b') any one or more of the nucleotide sequences having sequence identity of 95% or
more to the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28, and
(c') any one or more of the nucleotide sequences prepared by deletion, substitution,
insertion, and/or addition of one or a plurality of the nucleotide sequences represented
by SEQ ID NO. 22 to SEQ ID NO. 28.
[0038] In the (b'),"having sequence identity of 95% or more to the nucleotide sequences
represented by SEQ ID NO. 22 to SEQ ID NO. 28" includes SEQ ID numbers having sequence
identity of at least 95%, preferably at least 96%, even more preferably at least 97%,
yet even more preferably 98%, and particularly preferably at least 99% to the nucleotide
sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28 as calculated by using a known
algorithm for homology search such as BLAST and FASTA (for example, using a parameter
of default, or initial setting).
[0039] In the (c'), "a plurality of" in "deletion, substitution, insertion, and/or addition
of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 22 to
SEQ ID NO. 28" is, for example, about 10, preferably eight, more preferably six, even
more preferably five, yet even more preferably four, further yet even more preferably
three, and further yet even more preferably two, and particularly preferably one.
[0040] For the "vicinity" referred to in the present invention, the degree of the distance
can be easily understood by those skilled in the art from the relationship between
the position of the marker and downy mildew resistant genes, and ordinary acquaintance
of those skilled in the art. For example, depending on analysis conditions, it may
be a distance of about 10 cM or less (for example, 7 cM).
[0041] Additionally, by using the nucleotide sequence represented by SEQ ID NO. 1 to SEQ
ID NO. 7 as markers, the presence of a downy mildew resistant gene positioned in the
vicinity of them can be estimated or confirmed from the loci represented by these
sequences.
[0042] Accordingly, another embodiment of the invention provides a marker which can detect
a downy mildew resistant locus in a Brassica oleracea plant, the marker having any
one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.
[0043] Also provided is a method for detecting downy mildew resistance in a Brassica oleracea
plant, including detecting the presence of a downy mildew resistant gene by using
a marker of any one or more of the DNA sequences represented by SEQ ID NO. 1 to SEQ
ID NO. 7.
[0044] The "any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO.
7" may include any one of the nucleotide sequences represented by the above-described
(a) to (c), as long as a downy mildew resistant gene can be specified.
[0045] The detection of these markers can be performed according to a method known to those
skilled in the art, such as the PCR method, real time PCR method, RFLP method, LAMP
method, or SNPs genotyping chip method.
[0046] As described above, the use of these markers and the detection method allows confirmation
whether the object is "a downy mildew resistant cabbage or its progeny having a downy
mildew resistant gene positioned in the vicinity of the locus represented by any one
or more of SEQ ID NO. 1 to SEQ ID NO. 7".
[0047] A preferred embodiment of the present invention includes a downy mildew resistant
gene which can be detected by one or more primers or primer pairs which can amplify
the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.
[0048] According to a more preferred embodiment of the present invention, the downy mildew
resistant cabbage or its progeny according to the present invention has a downy mildew
resistant gene which can be detected by any one or more of the primers having the
nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21. These primers may
be hereinafter referred to as "DMTLR markers".
[0049] Here, when a DNA marker "has" a nucleotide sequence, it means that the marker has
the nucleotide sequence. For the DNA marker in the present invention, any one or several
(for example, one, two or three, preferably one or two, more preferably one) of the
nucleotides within the corresponding nucleotide sequence may be substituted, deleted,
added, or deleted, or, the sequence may include a portion of the corresponding nucleotide
sequence and have certain properties. In these cases, the word "has" may be replaced
with "includes". Additionally, when the substitution, deletion, addition, or deletion
of one nucleotide is acceptable, "has" may be replaced with "substantially includes".
[0050] The downy mildew resistance herein can be detected and confirmed by carrying out
PCR by using the primers represented by the nucleotide sequences 8 to 21.
[0051] Another embodiment of the invention provides a primer set which can detect a downy
mildew resistant locus in a Brassica oleracea plant, the primer set including any
one or more of the primes having the nucleotide sequences represented by SEQ ID NO.
8 to SEQ ID NO. 21.
[0052] Another embodiment of the invention provides a method for detecting downy mildew
resistance in a Brassica oleracea plant, including using any one or more of the markers
having the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or any
one or more of the primers having the nucleotide sequences represented by SEQ ID NO.
8 to SEQ ID NO. 21.
[0053] The use of these DNA markers allows efficient breeding a novel cabbage line having
downy mildew resistance, without selection by an inoculation test.
[0054] The downy mildew resistant cabbage according to the present invention has the following
characteristics.
- (1) Specifically, it is a plant having any of the DNA sequences represented by SEQ
ID NO. 1 to SEQ ID NO. 7 in the vicinity of a downy mildew resistant locus, and shows
downy mildew resistance owing to the inclusion of the allele.
- (2) The use of a line having the above-described sequence as a hybridizing material
allows breeding a novel cabbage parental line having downy mildew resistance. The
introduction of downy mildew resistance can be confirmed by an inoculation test. Alternatively,
new markers may be designed from the DNA markers made based on SEQ ID NO. 1 to SEQ
ID NO. 7, and the DNA sequences positioned in the vicinity of the SEQ ID NO. 1 to
SEQ ID NO. 7 based on official information, and used for the selection of resistant
plants. Furthermore, the use of markers in the vicinity of a downy mildew resistant
locus also allows selection of individuals from which the non-target character linked
to the downy mildew resistant locus has been separated.
- (3) The cabbage of the present invention thus developed has resistance against a downy
mildew pathogen, Hyaloperonospora brassicae, and thus allows reduction of labor and cost of fungicide spraying for disease control
during the cultivation period.
[0055] According to a preferred embodiment of the present invention, the downy mildew resistant
cabbage or its progeny according to the present invention may be any of the followings:
- 1) a downy mildew resistant cabbage or its progeny, where a downy mildew resistant
gene is found in a broccoli variety specified by Accession Number FERM BP-22343;
- 2) a downy mildew resistant cabbage or its progeny, where a downy mildew resistant
gene is found in a cabbage variety specified by Accession Number FERM BP-22344; and
- 3) a first filial generation cabbage having resistance against downy mildew, which
is specified by Accession Number FERM BP-22344.
[0056] Here, the downy mildew resistant gene is "found" means that the gene existing in
the specific variety is included in downy mildew resistant cabbage or its progeny.
More specifically, the downy mildew resistant cabbage or its progeny having a downy
mildew resistant gene found in the broccoli variety specified by Accession Number
FERM BP-22343 includes the broccoli variety specified by Accession Number FERM BP-22343
and any one as long as they have the downy mildew resistant gene found in the broccoli
variety specified by Accession Number FERM BP-22343.
[0057] According to another embodiment of the invention, the present invention also relates
to a portion of the plant body of the downy mildew resistant cabbage or its progeny
according to the present invention, or seeds of them.
[0058] The "a portion of the plant body" includes organs such as flower, leaf, stem, and
root, or a part or tissues of them, or cells or cell aggregates from these organs
or tissues.
Method for breeding downy mildew resistant cabbage
[0059] The method for breeding the downy mildew resistant cabbage according to the present
invention includes, as described above, introducing downy mildew resistance from a
Brassica oleracea plant having resistance against downy mildew into desired cabbage.
[0060] The "Brassica oleracea plant having resistance against downy mildew" means a Brassica
oleracea plant which has ability to restrict the growth and development of downy mildew
pathogen (preferably Hyaloperonospora brassicae) or the damage it causes, and can
be obtained by, for example, carrying out an inoculation test using the provided downy
mildew pathogen (preferably
Hyaloperonospora brassicae), and judging whether the plant has resistance against it. More preferably, in this
inoculation test, the resistant factor held by the plant is a Brassica oleracea plant
showing single dominant expression. More specifically, for example, an inoculation
test is carried out according to the below-described Example 1, and this allows confirmation
whether the object is "a Brassica oleracea plant having resistance against downy mildew"
which can be used in the breeding method of the present invention.
[0061] Preferably, the "Brassica oleracea plant having resistance against downy mildew"
is a Brassica oleracea plant other than cabbage.
[0062] More preferably, the "Brassica oleracea plant having resistance against downy mildew"
is a broccoli variety specified by Accession Number FERM BP-22343, or a cabbage variety
specified by Accession Number FERM BP-22344.
[0063] In the breeding method of the present invention, "introducing downy mildew resistance
into desired cabbage" means introducing the factor of downy mildew resistance" of
the "Brassica oleracea plant having resistance against downy mildew" into desired
cabbage so as to impart downy mildew resistance to the cabbage.
[0064] The "desired cabbage" means cabbage which has no downy mildew resistance, and cabbage
which can be hybridized with a "Brassica oleracea plant having resistance against
downy mildew" and wants the introduction of downy mildew resistance. This cabbage
has a useful character as cabbage.
[0065] The "downy mildew resistance" referred to herein can be confirmed by a known means
such as an inoculation test of downy mildew, more specifically, a downy mildew resistant
gene positioned in the vicinity of the locus represented by any one or more of SEQ
ID NO. 1 to SEQ ID NO. 7.
[0066] The introduction of downy mildew resistance means the introduction of a gene which
can express downy mildew resistance into desired cabbage. In the present invention,
typically, this introduction can be achieved the "Brassica oleracea plant having resistance
against downy mildew" and the desired cabbage, selecting that having desired downy
mildew resistance from the hybrid progenies thus obtained, and carrying out backcrossing
using the cabbage as the backcross parent.
[0067] The means of confirming downy mildew resistance in the hybrid progeny after hybridizing
may be an inoculation test of downy mildew (for example, Example 1 may be referred
to), or the selection of a resistant plant may use the DNA markers made based on SEQ
ID NO. 1 to SEQ ID NO. 7, and the markers newly designed from the DNA sequences positioned
in the vicinity of the SEQ ID NO. 1 to SEQ ID NO. 7, which are selected based on official
information. These markers include the marker having any one of the nucleotide sequences
represented by SEQ ID NO. 1 to SEQ ID NO. 7 and the primers having the nucleotide
sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21. These confirmation means may
be used in the process of backcross in the same manner, thereby selecting the progeny
of downy mildew resistance.
[0068] According to a preferred embodiment of the present invention, the breeding method
of the present invention includes the assay of the presence of a downy mildew resistant
gene using any one or more of the markers of the DNA sequences represented by SEQ
ID NO. 1 to SEQ ID NO. 7, or one or more of the primers or primer pairs which can
amplify the DNA sequences. Yet more preferably, the primers are represented by any
one or more of SEQ ID NO. 8 to SEQ ID NO. 21.
[0069] According to a preferred embodiment of the present invention, the breeding method
of the present invention is carried out by introducing downy mildew resistance into
desired cabbage by continuous backcross of the cabbage. More specifically, the breeding
method of the present invention includes hybridizing a Brassica oleracea plant having
resistance against downy mildew and desired cabbage, selecting a hybrid progeny having
downy mildew resistance, and continuous backcrossing it by using the desired cabbage
as backcross parent.
[0070] When backcross is carried out, generally, the number of backcrossing is preferably
about five to seven.
[0071] When efficient backcross is carried out, a genome-wide DNA marker may be used to
bring the object close to the backcross parent in the early stage.
[0072] For example, the first backcross generation (BC1F1) is a segregated generation, the
genome substitutional rates of these individuals are different, and the enlargement
of the size of the population allows the acquisition of individuals in which 90% or
more of the genome region shows the same genotype as the backcross parent. The selection
of these individuals allows conformance of the region other than the downy mildew
resistant locus to the same genotype as the backcross parent with a few number of
generations.
[0073] As a specific means useful as a genome-wide DNA marker, when the genome sequence
information of the backcross parent is available, the DNA markers based on the information
may be made for genotyping each locus.
[0074] Even when there is no genome sequence information of the backcross parent, the individual
having a genotype close to that of the backcross parent can be selected from the segregated
generation using random PCR method such as RAPD (random amplified polymorphic DNA),
SRAP (sequence-related amplified polymorphism), or AFLP (amplified fragment length
polymorphism). Alternatively, if SNPs genotyping chips (for example, the products
of Affymetrix or Illumina), which are designed for exhaustively analyzing many SNPs
scattered in a genome, are available, such means may be used for the analysis.
[0075] The downy mildew resistant line thus bred can be used not only as a direct variety,
but also as parents or one parent in an F1 seed producing system.
[0076] Accordingly, another embodiment of the invention also provides a method of producing
a F1 line using the downy mildew resistant line, which is obtained by the breeding
method of the present invention, as the line of parents or one parent, and a method
for producing the seeds of the F1 line.
[EXAMPLES]
[0077] The present invention is specifically described below with reference to the following
examples, but the present invention will not be limited by these examples.
Example 1:
[0078] By using genetic resources of broccoli held by Sakata Seed Corporation as materials,
two lines of broccoli ("BR-23" and "BR-35") that show resistance against both of two
downy mildew isolates (isolates Dm-A and Dm-B (where the isolate Dm-B has a wider
spectrum of virulence to different varieties than Dm-A)) were found.
[0079] In order to identify the downy mildew resistant locus held by these resistant lines,
firstly, by using the "BR-23" line as the material, the two lines ("BR-4" and "BR-24")
showing susceptibility to the above-described two isolates were hybridized, thus making
the F2 population and the BC1F1 population shown in Table 1.
[0080] As the indication of generation, F1 means the first filial generation, and BC1 means
the generation subjected to backcross once. More specifically, "BC1F1" means the generation
subjected to backcross once after passing the stage of the first filial generation.
[0081] These populations thus obtained were subjected to an inoculation test using an isolate
with a wider spectrum of virulence, Dm-B.
[0082] In the inoculation test, the degree of occurrence of disease (disease severity) was
evaluated for the first to third true leaves of each individual according to the following
disease severity score:
0: no symptom,
1: brown blotches are formed, no spore formation,
2: slight spore formation on brown blotches,
3: moderate spore formation, and
4: a large amount of spore formation.
[0083] The result is as shown in Table 1.
[0084] As indicated by the result, in the F2 population, the ratio of resistance : susceptibility
was 3 : 1, while in the BC1F1 hybridized with a susceptible line, the ratio was 1
: 1. These findings revealed that the present disease resistant factor works in a
single dominant manner.
[Table 1]
| Genetic analysis using broccoli "BR-23" (small population) |
| Line |
Generation |
Expected value |
Number of individuals |
Disease severity |
mapping population |
| 0 |
1 |
2 |
3 |
4 |
| BR-23 |
Resistant parent |
R:S = 1:0 |
39 |
|
29 |
10 |
|
|
|
| BR-4 |
Susceptible parent |
R:S = 0:1 |
20 |
|
|
|
|
20 |
|
| BR-24 |
Susceptible parent |
R:S = 0:1 |
20 |
|
|
|
|
20 |
|
| (BR-23 x BR-4) self |
F2 |
R:S = 3:1 |
60 |
|
3 |
35 |
1 |
21 |
mapping population-1 |
| (BR-23 x BR-24) self |
F2 |
R:S = 3:1 |
65 |
|
2 |
49 |
3 |
11 |
mapping population-2 |
| BR-23 x (BR-23 x BR-4) |
BC1F1 |
R:S = 1:0 |
40 |
|
16 |
24 |
|
|
|
| BR-23 x (BR-23 x BR-24) |
BC1F1 |
R:S = 1:0 |
39 |
|
7 |
32 |
|
|
|
| (BR-23 x BR-4) x BR-4 |
BC1F1 |
R:S=1:1 |
39 |
|
3 |
19 |
|
17 |
mapping population-3 |
| BR-24 x (BR-23 x BR-24) |
BC1F1 |
R:S =1:1 |
40 |
|
1 |
19 |
|
20 |
mapping population-4 |
Example 2:
[0085] In Table 1, by using the F2 population that showed segregation of resistance and
susceptibility (the mapping population-1 and -2) and the BC1F1 population (the mapping
population-3 and -4) as the materials, the RAPD markers were searched by the bulked
segregant analysis method (BSA method).
[0086] As the RAPD primers, 1180 kinds of 10mer primers designed by Operon Technologies,
Inc. and 460 kinds of 12mer primers designed by BEX Co., Ltd. were used.
[0087] As the bulk DNA, four resistant individuals and four susceptible individuals were
selected from the mapping population-4, and their DNAs were used to make a bulk DNA
of resistant individuals and a bulk DNA of susceptible individuals were made.
[0088] As the primary screening of the RAPD markers, the two kinds of bulk DNAs were subjected
to RAPD (randomly amplified polymorphic DNA) by using 1640 kinds of primers, thereby
selecting 245 kinds of markers that showed polymorphism.
[0089] In the secondary screening, two individuals that showed resistance and two individuals
that showed susceptibility were selected from the mapping population-4, and used as
templates to select 36 kinds of markers that showed the similar patterns to the polymorphism
shown in the primary screening.
[0090] In the tertiary screening, four individuals that showed resistance and four individuals
that showed susceptibility were selected from the mapping population-4, and used as
templates to select 11 kinds of markers that showed the similar patterns to the polymorphism
shown in the secondary screening.
[0091] In this state, those showed the almost same segregation pattern of the markers as
the phenotype were applied to all the individuals of the mapping population-1 to the
mapping population-4, and the degree of contradiction between these markers and the
score of the phenotype was confirmed, and the markers having a strong correlation
with the phenotype were selected.
[0092] In the above-described test, seven kinds of markers of the 11 kinds of markers which
had been confirmed to be linked with the downy mildew resistant factor were analyzed
for the nucleotide sequences of the amplified DNA fragments, and sequence-specific
primers were designed, thus attempting conversion to SCAR (sequence characterized
amplified region).
[0093] Firstly, the DNA fragments amplified by RAPD were cut out from an agarose gel, cloned,
and then their nucleotide sequences were analyzed. As a result of this, the nucleotide
sequences of the above-described seven kinds of markers (DMTLR-1 to DMTLR-7) were
specified (SEQ ID NO. 1 to SEQ ID NO. 7, respectively) (Fig. 8). In the specification
of the sequences, the sequences of SEQ ID NO. 22 to 28 were specified first, and these
sequences had the sequences of SEQ ID NO. 1 to 7 sandwiched between SCAR primers (including
the sequence of the SCAR primer). In Fig. 8, the sequence indicated with an underline
is the SCAR primer, and the sequences sandwiched between SCAR primers (including the
SCAR primer) correspond to SEQ ID NO. 1 to 7, respectively.
[0094] For the cloning, pBluescriptII SK(-) (obtained from Stratagene) was used as the vector,
and JM109 (E.coli JM109, obtained from Toyobo Co., Ltd.) was used as the competent
cell. The analysis of the nucleotide sequences used DNA sequencer ABI3130 (Applied
Biosystems).
[0095] For the markers whose nucleotide sequences were decoded, in order to amplify the
target sequences specifically, the primers (SEQ ID NO. 8 to 21) were designed by using
"Primer 3" software (a design supporting software for polymerase chain reaction (PCR),
open source software) (Table 2).
[0096] Additionally, the results of the electrophoresis test on these primers (markers)
(electrophoretic patterns) are shown in Fig. 2.
[0097] The markers thus developed are herein referred to as "DMTLR markers".
[Table 2]
| Marker Name |
Sequence |
PCR condition (annealing temperature/cycle) |
Restriction enzyme |
Marker type |
Sequence No. |
| DMTLR-1-Fw |
CGGTCTTAGTTGATTTCTCAAG |
55°C, 30cycle |
TaqI |
co-dominant |
SEQ ID NO. 8 |
| DMTLR-1-Rv |
GATCACCCTGTACTAGCAATC |
SEQ ID NO. 9 |
| DMTLR-2-Fw |
AGTAGGGAGTAAACCAACGAG |
55°C, 30cycle |
- |
dominant |
SEQ ID NO. 10 |
| DMTLR-2-Rv |
CCACGAGTGCATATTAGGTTG |
SEQ ID NO. 11 |
| DMTLR-3-Fw |
GTGCTCCGTCAAGATTCGAC |
55°C, 30cycle |
XbaI |
co-dominant |
SEQ ID NO. 12 |
| DMTLR-3-Rv |
GGACCTAATGAATCGAGAGCTAC |
SEQ ID NO. 13 |
| DMTLR-4-Fw |
GCATCACTAAGTCAAGCAACT |
55°C, 30cycle |
- |
dominant |
SEQ ID NO. 14 |
| DMTLR-4-Rv |
CAATGAGGTTGTGCTTTCCTC |
SEQ ID NO. 15 |
| DMTLR-5-Fw |
CTCTGCAATATTGTCCTTGATG |
55°C, 30cycle |
FokI |
dominant |
SEQ ID NO. 16 |
| DMTLR-5-Rv |
GCAATTCAGTACACCAACCT |
SEQ ID NO. 17 |
| DMTLR-6-Fw |
CGATCTCACACTAACTACGCT |
55°C, 30cycle |
MboI |
co-dominant |
SEQ ID NO. 18 |
| DMTLR-6-Rv |
AATCTGAGATCTCGTTTCGTCA |
SEQ ID NO. 19 |
| DMTLR-7-Fw |
TTATAGAAGGCCTGTGTACGAC |
55°C, 30cycle |
HpaI |
co-dominant |
SEQ ID NO. 20 |
| DMTLR-7-Rv |
GTGGCTTGGCTGGATATAGAA |
SEQ ID NO. 21 |
Example 3:
[0098] By using the same F2 population as the mapping population-2 used in Example 2, resistance
reaction to the downy mildew isolate Dm-A was also examined.
[0099] The size of the F2 population was 240 individuals (the mapping population-5), and
the reaction of the individuals to Dm-A was examined; the segregation as given in
Table 3 was exhibited. The inoculation test on the isolate Dm-A was carried out and
evaluated in the same manner as in the inoculation test of Example 1.
[Table 3]
| Genetic analysis using broccoli "BR-23" (large population) |
| Line |
Generation |
Expected value |
Number of examined individuals |
Number of individuals by disease severity |
mapping population |
| 0 |
1 |
2 |
3 |
4 |
| BR-23 |
Resistant parent |
R:S = 1:0 |
15 |
11 |
4 |
0 |
0 |
0 |
|
| BR-24 |
Susceptible parent |
R:S = 0:1 |
15 |
0 |
0 |
1 |
10 |
4 |
|
| (BR-23 x BR-24) self |
F2 |
R:S = 3:1 |
240 |
123 |
54 |
3 |
52 |
8 |
mapping population-5 |
| BR-24 x (BR-23 x BR-24) |
BC1F1 |
R:S = 1:1 |
165 |
70 |
15 |
8 |
66 |
6 |
|
[0100] As a result of comparison with the genotype by the SCAR marker made in Example 2,
high correlation with the phenotype was confirmed. As a result of this, the downy
mildew resistant factor of the line "BR-23" was estimated to show resistant reaction
against two isolates with a single gene.
[0101] On the basis of the analysis result above, the linkage relationship between the phenotypes
in the population and the markers was analyzed by using "Mapmaker 2.0" (Whitehead
Institute), which is a software for analyzing the linkage relationship of markers.
[0102] The result is as shown in the linkage map of Fig. 3.
[0103] As indicated by the result, it was estimated that resistant factors are positioned
in the vicinity of SEQ ID NO. 1 to 7, especially in the immediate vicinity of SEQ
ID NO. 4 and SEQ ID NO. 5.
Example 4:
[0104] For the line "BR-35" which is different from the resistant line "BR-23" analyzed
in Example 2, in order to confirm whether it has the same resistant factor as the
line "BR-23", an F2 segregated population with the susceptible line "BR-13" was made,
and an inoculation test using the isolate Dm-A was carried out (Table 4). The inoculation
test using the isolate Dm-A was carried out and evaluated in the same manner as the
inoculation test in Example 1.
[Table 4]
| Variety, line |
Generation |
Number of individuals |
Number of individuals classified by disease severity score |
ma pping population |
| 0 |
1 |
2 |
3 |
4 |
| BR-35 |
Resistant parent |
12 |
5 |
7 |
|
|
|
|
| BR-13 |
Susceptible parent |
12 |
|
|
|
8 |
4 |
|
| BR-35 x BR-13 |
F1 |
12 |
1 |
9 |
2 |
|
|
|
| (BR-35 x BR-13) F2 |
F2 |
180 |
23 |
83 |
30 |
33 |
11 |
mapping population-6 |
[0105] Furthermore, PCR was carried out by using SEQ ID NO. 8 and 9, the genotype of each
individual was examined; all of the 42 individuals in which the locus exhibited resistant
homozygous type and the 83 individuals showed heterozygous hetero type showed resistance
(Table 5).
[Table 5]
| Variety, line |
Generation |
Number of individuals |
Number of individuals classified by disease severity score |
| 0 |
1 |
2 |
3 |
4 |
| Individual whose DMTLR-1 showed R homozygous in mapping population-6 |
F2 |
42 |
10 |
28 |
4 |
0 |
0 |
| Individual whose DMTLR-1 showed heterozygous in mapping population-6 |
F2 |
83 |
13 |
52 |
18 |
0 |
0 |
| Individual whose DMTLR-1 showed S homozygous in mapping population-6 |
F2 |
55 |
0 |
3 |
8 |
33 |
11 |
[0106] Table 5 shows the result of classification of 180 individuals of mapping population-6
in Table 4 according to the genotype of the DNA marker DMTLR-1.
[0107] The polymorphism and phenotype showed by the markers had an extremely high correlation,
so that the two kinds of broccoli downy mildew resistant lines "BR-23" and "BR-35"
were estimated to have an identical resistant factor.
[0108] The downy mildew resistant gene held by "BR-35" can be found in the broccoli F1 variety
"Sawayutaka", derived from "BR-35" as one parent.
Example 5:
[0110] "BR-23" and "BR-35", which are the broccoli lines held by Sakata Seed Corporation,
were used as materials having downy mildew resistance, line "CB-20", line "CB-35",
line "CB-23", or line "CB-97" was selected from the four varieties (Yoshin, Kandama,
spring, and ball types, respectively) as the cabbages to which the resistance is introduced,
and used as the backcross parental lines in a hybridizing test.
[0111] For efficiently pursuing backcross (BC), basically, DNA assay using a developed DMTLR
marker was carried out, individuals including the downy mildew resistant locus as
heterozygous were selected, and the cabbage lines "CB-20", "CB-35", "CB-23", and "CB-97"
were continuously backcrossed while their phenotypes were confirmed.
[0112] Firstly, the broccoli lines "BR-23" and "BR-35" were hybridized with the cabbage
lines "CB-20", "CB-35", "CB-23", and "CB-97" to F1 seeds were produced, and the DNA
selection with DMTLR markers and continuous backcross were carried out.
[0113] In order to efficiently carry out the backcross, selection using 20 kinds of RAPD
primers were carried out, followed by selection of the individuals showing the genotypes
close to "CB-20", "CB-35", "CB-23", and "CB-97", which are their backcross parental
lines in their backcross lines.
[0114] As a result of this, the individuals whose RAPDs markers were completely coincident
with their backcross parental lines were selected in the BC2F1 generation in "CB-20",
and the BC3F1 generation in other "CB-35", "CB-23", and "CB-97".
[0115] In the BC2F1 generation or the BC3F1 generation, resistance and susceptibility were
discriminated with a DMTLR marker, and each of these genotypes were prototyped together
with their backcross parental lines in either or both of Kakegawa Research Center
or Kimitsu Breeding Station of Sakata Seed Corporation.
[0116] The results are shown in Table 6 and Figs. 4 to 7.
[0117] Table 6 shows the trial production result of the line made by introducing a downy
mildew resistant factor into the cabbage line "CB-20" in the fields, and the evaluation
result of disease severity of downy mildew. In the segregated generation during backcross,
the individual which had been judged as having a downy mildew resistant factor by
the DMTLR marker showed resistance even it was heterozygous, and the individual judged
as having no downy mildew resistant factor showed susceptibility. Additionally, for
the phenotype, the grass figure markedly close to that of the Yoshin type "CB-20"
as the backcross parental line.
[Table 6]
| Line |
DMTLR marker genotype |
Number of individuals |
Disease severity |
Average disease severity |
| 0 |
1 |
2 |
3 |
| CB-20 |
S |
18 |
|
3 |
3 |
12 |
2.5 |
| isogenic line (R) of CB-20 |
R |
18 |
|
17 |
1 |
|
1.1 |
| isogenic line (S) of CB-20 |
S |
17 |
|
|
5 |
12 |
2.7 |
[0118] The symptoms of the scores listed in Table 6 are given in Fig. 4. As the index of
the disease severity score, the disease severity means the following condition.
Disease severity
[0119]
0: no symptom,
1: few number of lesions,
2: moderate number of lesions,
3: many lesions.
[0120] The photographs of "CB-20" (original parental line) shown in Table 6 and the isogenic
line introduced with a downy mildew resistant factor were given in Fig. 5. As indicated
by the figure, the isogenic line introduced with a downy mildew resistant factor suppressed
the occurrence of downy mildew in comparison with the parental line "CB-20".
[0121] Furthermore, the lines backcrossed with three other cabbage lines "CB-35", "CB-23",
and "CB-97" were also subjected to trial production investigation in the field.
[0122] The result is as shown in Fig. 6.
[0123] As indicated by the result, the line introduced with a resistant locus expressed
resistance in the main leaves and head even it was hetero, and was confirmed to be
equivalent to the parental lines "CB-35", "CB-23", and "CB-97", which are Kandama,
spring, and ball types, respectively. More specifically, as indicated by Fig. 6, the
isogenic line introduced with a downy mildew resistant factor suppressed the occurrence
of downy mildew in comparison with the original parental line.
[0124] Thereafter, the Yoshin type cabbage "CB-20", which is especially vulnerable to downy
mildew, was subjected to several times of backcrossing, 20 individuals were selected
from the lines cultivated in the field of Kakegawa Research Center, a homozygote with
downy mildew resistance was obtained from anther and pollen culture, whereby first
breeding a downy mildew resistant cabbage parental line having practical properties
as the parent of a F1 variety was successfully achieved.
Example 6:
[0125] Further, by using "DMR-CB-20" (the DM cabbage line bred as described above) with
downy mildew resistance as the pollen parent, and the other promising cabbage line
"CB-5" cytoplasm male sterile line as the seed parent, F1 (name of prototype variety:
SK3-005) were produced.
[0126] The F1 line was continuously prototyped in Kimitsu Breeding Station of Sakata Seed
Corporation, and stable expression of downy mildew resistance was confirmed.
[0127] The first breeding of the downy mildew resistant F1 cabbage variety was thus achieved.
[0129] The original F1 variety (the F1 variety obtained by using the original parental line
"CB-20") and the novel F1 variety introduced with downy mildew resistance (F1 variety
having downy mildew resistance) was compared.
[0130] The result is as shown in Fig. 7.