DOWNY MILDEW RESISTANT CABBAGE AND CULTIVATION METHOD THEREFOR

Abstract

 The present application discloses a cabbage having resistance against downy mildew or its progeny. The present application further discloses a method for breeding downy mildew resistant cabbage, including introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage. One embodiment of the present invention provides a novel cabbage line showing high resistance against downy mildew and having a high commercial value as cabbage, and enables breeding such cabbage.

Description

[CROSS-REFERENCE TO RELATED APPLICATIONS]

[0001] The present application is based upon and claims the benefit of the priority from prior Japanese Patent Application No. 2017-173823, filed on September 11, 2017; the entire contents of which are incorporated herein by reference.

[Technical Field]

[0002] The present invention relates to cabbage endowed with downy mildew resistance and a method for breeding the same. More specifically, the present invention relates to cabbage having a downy mildew resistant gene positioned in the vicinity of the loci represented by SEQ ID NO. 1 to SEQ ID NO. 7, and the method for breeding the same.

[Background Art]

[0003] Downy mildew in Brassicaceae plants is a disease caused by Hyaloperonospora brassicae, which belongs to the oomycetes, and brings about damages on many crops such as Brassica oleracea species including cabbage, Brussels sprouts, cauliflower, broccoli, kohlrabi, Brassica rapa species including Chinese cabbage, turnip, and Komatsuna, and Brassica napus species including rapeseed.

[0004] The symptoms of this disease are mainly found in leaves; yellow to pale brown blotches with unclear borders are formed and gradually enlarged, and the leaves wither, whereby the growth is adversely influenced (Fig. 1). If the curds of broccoli and cauliflower, or the roots of turnip or Japanese radish are infected, brown or black discoloration occurs inside and outside the tissues, this greatly decreases their commercial values. Especially in a highly humid environment, the disease quickly spreads and causes a severe damage, so that chemical control with fungicides is usually carried out.

[0005] Cabbage (B. oleracea var. capitata), which is one of the most important crops of Brassica oleracea, has abundant varieties, and the varieties suitable to the domestic soils and climates are cultivated in many countries in the world.

[0006] However, even though cabbage has some lines that exhibit moderate resistance against downy mildew in an unknown heredity manner and likely due to quantitative factors, but the presence of downy mildew resistant varieties having single, dominant resistant factor is unknown.

[0007] Therefore, in the areas where downy mildew frequently occurs, disease control by fungicides must be carried out for reducing the disease, and this requires much labor and cost. Therefore, development of resistant breeding materials and resistant varieties have been desired.

[0008] However, in spite of such strong demands, downy mildew resistant varieties of cabbage have not been produced as far as the inventors know. The reason for this is likely that the genetic resources of cabbage include no useful downy mildew resistant factor.

[0009] Meanwhile, for broccoli (B. oleracea var. italica) which is a related species of cabbage, there are some reports on the heredity analysis of downy mildew resistant factors (for example, J. Amer Soc Hort Sci (2001), vol. 126, p. 727 (Non Patent Document 1), Euphytica (2002), vol. 128, p. 405 (Non Patent Document 2), and Euphytica (2003), vol. 131, p. 65 (Non Patent Document 3)).

[0010] However, these resistant factors in broccoli have not been used in breeding of cabbage. The reason for this is likely that the morphological characters of cabbage and broccoli are totally different. Broccoli can be hybridized with cabbage because both of them belong to Brassica oleracea, but broccoli has many characters which are unnecessary for cabbage, so that broccoli is very difficult to handle as a breeding material.

[Prior Art List]

Non Patent Document

[0011] 

Non Patent Document 1: M. Wang et al., J. Amer Soc Hort Sci (2001), vol. 126, pp. 727-, "Inheritance of True Leaf Stage Downy Mildew Resistance in Broccoli"

Non Patent Document 2: M. W. Farnham et al., Euphytica (2002) vol. 128, pp. 405-, "A single dominant gene for downy mildew resistance in broccoli".

Non Patent Document 3: P. S. Coelho et al., Euphytica (2003) vol. 131, pp. 65-, "Inheritance of downy mildew resistance in mature broccoli plants"

[SUMMARY OF THE INVENTION]

[Problems to be solved by the Invention]

[0012] The present invention is intended to provide a novel cabbage having marked resistance against downy mildew, and a method for breeding the cabbage.

[Means for Solving Problems]

[0013] The inventors have developed markers linked to downy mildew resistant factors, and used them in the combination of broccoli and cabbage, and succeeded in breeding a cabbage line which has a downy mildew resistant factor and also has a high commercial value.

[0014] The Brassica oleracea plant obtained by hybridization of broccoli and cabbage by the inventors had a figure of a wild species in the original hybrid and the first backcross generation. Thereafter, the inventors repeated backcrossing for replacing the genome region irrelevant to downy mildew with the genotype of cabbage type through the selection of markers linked to downy mildew resistance and the application of genome-wide markers, thereby succeeding breeding cabbage which shows high resistance against downy mildew.

[0015] More specifically, the inventors have found a broccoli line which has downy mildew resistance applicable to a wide range of varieties, and developed markers linked to the downy mildew resistant factors held by the line, and proved that the use of them allows breeding a cabbage line with a high industrial value. The use of the downy mildew resistant cabbage or the method for breeding a downy mildew resistant cabbage provided by the present invention allows imparting downy mildew resistance to cabbage which has been susceptible to downy mildew.

[0016] The present invention is based on these findings.

[0017] More specifically, the present invention provides the following inventions.

<1> Cabbage or its progeny having resistance against downy mildew.

<2> The downy mildew resistant cabbage or its progeny according to <1>, having a downy mildew resistant gene which is positioned in the vicinity of the locus represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7.

<3> The downy mildew resistant cabbage or its progeny according to <1> or <2>, having a downy mildew resistant gene which is detectable by any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

<4> The downy mildew resistant cabbage or its progeny according to any one of <1> to <3>, wherein the downy mildew is a disease caused by Hyaloperonospora brassicae.

<5> The downy mildew resistant cabbage or its progeny according to any one of <1> to <4>, wherein the downy mildew resistant gene is found in the broccoli variety specified by Accession Number FERM BP-22343.

<6> The downy mildew resistant cabbage or its progeny according to any one of <1> to <4>, wherein the downy mildew resistant gene is found in the cabbage variety specified by Accession Number FERM BP-22344.

<7> A portion of a plant body of the cabbage or its progeny according to any one of <1> to <6>.

<8> A seed of the cabbage or its progeny according to any one of <1> to <6>.

<9> First filial generation cabbage or its portion having resistance against downy mildew specified by Accession Number FERM BP-22344, or a seed of the cabbage.

<10> A method for breeding downy mildew resistant cabbage, including introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage.

<11> A method for breeding downy mildew resistant cabbage, including introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage, the downy mildew resistance being confirmed by a downy mildew resistant gene positioned in the vicinity of the locus represented by any one of SEQ ID NO. 1 to SEQ ID NO. 7.

<12> A method for breeding the downy mildew resistant cabbage according to <10> or <11>, wherein the Brassica oleracea plant having resistance against downy mildew is a Brassica oleracea plant other than cabbage.

<13> The breeding method according to any one of <10> to <12>, wherein the Brassica oleracea plant having resistance against downy mildew is a broccoli variety specified by Accession Number FERM BP-22343.

<14> The breeding method according to <10> or <11>, wherein the Brassica oleracea plant having resistance against downy mildew is a cabbage variety specified by Accession Number FERM BP-22344.

<15> The breeding method according to any one of <10> to <14>, wherein the introduction of downy mildew resistance into desired cabbage is achieved by continuous backcross of the cabbage.

<16> The breeding method according to any one of <10> to <15>, including assaying the presence of a downy mildew resistant gene using one or more of the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or one or more of the primers or primer pairs which can amplify the DNA sequence.

<17> The breeding method according to <16>, wherein the primer is represented by any one or more of SEQ ID NO. 8 to SEQ ID NO. 21.

<19> A marker having any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, the marker being able to detect a downy mildew resistant locus in a Brassica oleracea plant.

<20> A primer set including any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21, the primer set being able to detect a downy mildew resistant locus in a Brassica oleracea plant.

<21> A method for detecting downy mildew resistance in a Brassica oleracea plant, including using any one or more of markers having the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

Advantageous Effects of Invention

[0018] The downy mildew resistant cabbage of the present invention has marked resistance against downy mildew caused by Hyaloperonospora brassicae. Additionally, the use of the downy mildew resistant cabbage according to the present invention as a material allows further breeding a novel downy mildew resistant cabbage line. Furthermore, the use of a marker linked with downy mildew resistance according to the present invention allows detection or selection of downy mildew resistance even no inoculation test is carried out. The cultivation of a cabbage line bred according to the present invention allows cabbage cultivation even in areas where the cultivation has been difficult because of the occurrence of downy mildew, and reduces the labor and cost of chemical spraying which has been necessary in cultivation. Additionally, the downy mildew resistant cabbage according to the present invention allows shipping of fresh vegetables cultivated with a reduced number of chemical spraying, and further suppresses the occurrence of diseases, this allows harvest of fresh vegetables with a high excellent product rate.

[BRIEF DESCRIPTION OF DRAWINGS]

[0019] 

Fig. 1 illustrates a symptom by a downy mildew inoculation test (the left illustrates a susceptible line, and the right illustrates resistance line). In the figure, for the left susceptible line, formation of yellow to brown lesions is observed on the surface of leaves.

Fig. 2 illustrates an electrophoretic pattern of a DNA marker linked to the vicinity of a downy mildew resistant factor (Example 2).

Fig. 3 illustrates a linkage map in the vicinity of a downy mildew resistant factor (Example 3).

Fig. 4 illustrates an index of disease severity score in field trial production of Example 5.

Fig. 5 illustrates the result of field trial production of a cabbage line bred according to the present invention (Example 5), including the condition of "CB-20" (original parental line) and the isogenic line introduced with a downy mildew resistant factor.

Fig. 6 illustrates the result of field trial production of three cabbage lines bred by the present invention (Example 5).

Fig. 7 illustrates the result of trial production of the first filial generation (F1) variety using the cabbage parental line "DMR-CB-20" bred by the present invention (Example 6).

Fig. 8-1 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).

Fig. 8-2 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).

Fig. 8-3 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).

Fig. 8-4 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).

Fig. 8-5 illustrates the nucleotide sequences of the markers (DMTLR-1 to DMTLR-7).

[EMBODIMENTS FOR CARRYING OUT THE INVENTION]

[0020] The present invention is described below in detail.

Downy mildew resistant cabbage

[0021] The present invention relates to, as described above, cabbage having resistance against downy mildew (downy mildew resistant cabbage), or its progeny.

[0022] In the present description, "progeny" includes hybrids obtained by hybridizing the downy mildew resistant cabbage according to the present invention and a Brassica oleracea plant which can be hybridized with the plant. Accordingly, "progeny" also includes, for example, those obtained by hybridizing the downy mildew resistant cabbage according to the present invention as a pollen parent (male parent) and a Brassica oleracea plant as a seed parent (female parent) which can be hybridized with the plant. Additionally, "progeny" also includes, for example, the plants obtained by cell fusion of the downy mildew resistant cabbage according to the present invention and a plant which can be fused with the cabbage, and interspecific hybrid plants.

[0023] The term "Brassica oleracea plant" means a cruciferous plant, which is a Brassica oleracea plant belonging to genus Brassica, and includes, for example, B. oleracea var. capitata (cabbage), B. oleracea var. italica (broccoli), B. oleracea var. botrytis (cauliflower), B. oleracea var. gemmifera (brussels sprout), B. oleracea var. gongyloides (kohlrabi), B. oleracea var. acephara (ornamental cabbage, kale), and B. oleracea var. albograbra (Chinese kale).

[0024] The "cabbage" herein means a plant species belonging to Brassica oleracea, and is a plant species classified as B. oleracea var. capitata.

[0025] In the present description, "downy mildew" means a disease caused by an oomycete of the family Peronosporaceae, preferably a disease caused by Hyaloperonospora brassicae. Accordingly, resistance against downy mildew herein means resistance against the diseases caused by these pathogens.

[0026] Accordingly, the downy mildew resistant cabbage according to the present invention shows resistance against downy mildew fungus (preferably Hyaloperonospora brassicae), and gives single, dominant expression. The use of this plant as a material allows breeding a novel cabbage parental line having downy mildew resistance.

[0027] The "parental line" herein means a line bred for producing a hybrid variety and usually a hybrid variety is produced by hybridizing two or more parental lines having different phenotypes.

[0028]  Accordingly, the "downy mildew resistance" in the present invention means resistance against a downy mildew pathogen Hyaloperonospora brassicae, and is more specifically based on the factor positioned in the vicinity of SEQ ID NO. 1 to SEQ ID NO. 7.

[0029] That is, according to a preferred embodiment of the present invention, the downy mildew resistant cabbage or its progeny according to the present invention has a downy mildew resistant gene positioned in the vicinity of the locus represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7.

[0030] Here, the definition "represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7" includes the case where the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7 are within the range of certain sequence identity, or of the range having partial mutation. The sequences of the range which can be handled equally to those of SEQ ID NO. 1 to SEQ ID NO. 7 can be easily understood by those skilled in the art.

[0031] Accordingly, for example, the definition "represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7" is used in the sense of including the case represented by any one or more of the following nucleotide sequences (a) to (c):

(a) any one or more of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.

(b) any one or more of the nucleotide sequence having sequence identity of 95% or more to the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, and

(c) any one or more nucleotide sequences prepared by deletion, substitution, insertion, and/or addition of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.

[0032] Therefore, according to a preferred embodiment of the present invention, the downy mildew resistant cabbage or its progeny according to the present invention is regarded as having a downy mildew resistant gene positioned in the vicinity of the locus represented by any one or more of the nucleotide sequences represented by the above-described (a) to (c).

[0033] In the (b), "having sequence identity of 95% or more to the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7" includes SEQ ID numbers having sequence identity of at least 95%, preferably at least 96%, even more preferably at least 97%, yet even more preferably 98%, and particularly preferably at least 99% to the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7 as calculated by using a known algorithm for homology search such as BLAST and FASTA (for example, using a parameter of default, or initial setting).

[0034] The term "sequence identity" herein means, for example, the percentage (%) of the number of identical nucleotides to the total number of the nucleotides including gaps, when two base (nucleotide) sequences are aligned (where a gap may be introduced or not introduced).

[0035] In the (c), "a plurality of" in "deletion, substitution, insertion, and/or addition of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7" is, for example, about 10, preferably eight, more preferably six, even more preferably five, yet even more preferably four, further yet even more preferably three, and further yet even more preferably two, and particularly preferably one.

[0036] According to a preferred embodiment of the present invention, SEQ ID NO. 1 to SEQ ID NO. 7 may be SEQ ID NO. 22 to 28, respectively. SEQ ID NO. 22 to 28 include the sequences outside the sequences of SEQ ID NO. 1 to 7 between primers (including the sequences of the primers), and were discovered by the inventors in the below-described Example 2.

[0037] Accordingly, the phrase "represented by any one or more of SEQ ID NO. 22 to 28" means that only the parts of SEQ ID NO. 1 to 7 included in these sequences include that represented by any one or more of the above-described nucleotide sequences (a) to (c), and the case in which SEQ ID NO. 22 to 28 are represented by any one or more of the following nucleotide sequences (a') to (c').

(a') any one or more of the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28,

(b') any one or more of the nucleotide sequences having sequence identity of 95% or more to the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28, and

(c') any one or more of the nucleotide sequences prepared by deletion, substitution, insertion, and/or addition of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28.

[0038] In the (b'),"having sequence identity of 95% or more to the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28" includes SEQ ID numbers having sequence identity of at least 95%, preferably at least 96%, even more preferably at least 97%, yet even more preferably 98%, and particularly preferably at least 99% to the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28 as calculated by using a known algorithm for homology search such as BLAST and FASTA (for example, using a parameter of default, or initial setting).

[0039] In the (c'), "a plurality of" in "deletion, substitution, insertion, and/or addition of one or a plurality of the nucleotide sequences represented by SEQ ID NO. 22 to SEQ ID NO. 28" is, for example, about 10, preferably eight, more preferably six, even more preferably five, yet even more preferably four, further yet even more preferably three, and further yet even more preferably two, and particularly preferably one.

[0040] For the "vicinity" referred to in the present invention, the degree of the distance can be easily understood by those skilled in the art from the relationship between the position of the marker and downy mildew resistant genes, and ordinary acquaintance of those skilled in the art. For example, depending on analysis conditions, it may be a distance of about 10 cM or less (for example, 7 cM).

[0041]  Additionally, by using the nucleotide sequence represented by SEQ ID NO. 1 to SEQ ID NO. 7 as markers, the presence of a downy mildew resistant gene positioned in the vicinity of them can be estimated or confirmed from the loci represented by these sequences.

[0042] Accordingly, another embodiment of the invention provides a marker which can detect a downy mildew resistant locus in a Brassica oleracea plant, the marker having any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.

[0043] Also provided is a method for detecting downy mildew resistance in a Brassica oleracea plant, including detecting the presence of a downy mildew resistant gene by using a marker of any one or more of the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.

[0044] The "any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7" may include any one of the nucleotide sequences represented by the above-described (a) to (c), as long as a downy mildew resistant gene can be specified.

[0045] The detection of these markers can be performed according to a method known to those skilled in the art, such as the PCR method, real time PCR method, RFLP method, LAMP method, or SNPs genotyping chip method.

[0046] As described above, the use of these markers and the detection method allows confirmation whether the object is "a downy mildew resistant cabbage or its progeny having a downy mildew resistant gene positioned in the vicinity of the locus represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7".

[0047] A preferred embodiment of the present invention includes a downy mildew resistant gene which can be detected by one or more primers or primer pairs which can amplify the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7.

[0048] According to a more preferred embodiment of the present invention, the downy mildew resistant cabbage or its progeny according to the present invention has a downy mildew resistant gene which can be detected by any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21. These primers may be hereinafter referred to as "DMTLR markers".

[0049] Here, when a DNA marker "has" a nucleotide sequence, it means that the marker has the nucleotide sequence. For the DNA marker in the present invention, any one or several (for example, one, two or three, preferably one or two, more preferably one) of the nucleotides within the corresponding nucleotide sequence may be substituted, deleted, added, or deleted, or, the sequence may include a portion of the corresponding nucleotide sequence and have certain properties. In these cases, the word "has" may be replaced with "includes". Additionally, when the substitution, deletion, addition, or deletion of one nucleotide is acceptable, "has" may be replaced with "substantially includes".

[0050] The downy mildew resistance herein can be detected and confirmed by carrying out PCR by using the primers represented by the nucleotide sequences 8 to 21.

[0051] Another embodiment of the invention provides a primer set which can detect a downy mildew resistant locus in a Brassica oleracea plant, the primer set including any one or more of the primes having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

[0052] Another embodiment of the invention provides a method for detecting downy mildew resistance in a Brassica oleracea plant, including using any one or more of the markers having the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

[0053] The use of these DNA markers allows efficient breeding a novel cabbage line having downy mildew resistance, without selection by an inoculation test.

[0054] The downy mildew resistant cabbage according to the present invention has the following characteristics.

(1) Specifically, it is a plant having any of the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7 in the vicinity of a downy mildew resistant locus, and shows downy mildew resistance owing to the inclusion of the allele.

(2) The use of a line having the above-described sequence as a hybridizing material allows breeding a novel cabbage parental line having downy mildew resistance. The introduction of downy mildew resistance can be confirmed by an inoculation test. Alternatively, new markers may be designed from the DNA markers made based on SEQ ID NO. 1 to SEQ ID NO. 7, and the DNA sequences positioned in the vicinity of the SEQ ID NO. 1 to SEQ ID NO. 7 based on official information, and used for the selection of resistant plants. Furthermore, the use of markers in the vicinity of a downy mildew resistant locus also allows selection of individuals from which the non-target character linked to the downy mildew resistant locus has been separated.

(3) The cabbage of the present invention thus developed has resistance against a downy mildew pathogen, Hyaloperonospora brassicae, and thus allows reduction of labor and cost of fungicide spraying for disease control during the cultivation period.

[0055] According to a preferred embodiment of the present invention, the downy mildew resistant cabbage or its progeny according to the present invention may be any of the followings:

1) a downy mildew resistant cabbage or its progeny, where a downy mildew resistant gene is found in a broccoli variety specified by Accession Number FERM BP-22343;

2) a downy mildew resistant cabbage or its progeny, where a downy mildew resistant gene is found in a cabbage variety specified by Accession Number FERM BP-22344; and

3) a first filial generation cabbage having resistance against downy mildew, which is specified by Accession Number FERM BP-22344.

[0056]  Here, the downy mildew resistant gene is "found" means that the gene existing in the specific variety is included in downy mildew resistant cabbage or its progeny. More specifically, the downy mildew resistant cabbage or its progeny having a downy mildew resistant gene found in the broccoli variety specified by Accession Number FERM BP-22343 includes the broccoli variety specified by Accession Number FERM BP-22343 and any one as long as they have the downy mildew resistant gene found in the broccoli variety specified by Accession Number FERM BP-22343.

[0057] According to another embodiment of the invention, the present invention also relates to a portion of the plant body of the downy mildew resistant cabbage or its progeny according to the present invention, or seeds of them.

[0058] The "a portion of the plant body" includes organs such as flower, leaf, stem, and root, or a part or tissues of them, or cells or cell aggregates from these organs or tissues.

Method for breeding downy mildew resistant cabbage

[0059] The method for breeding the downy mildew resistant cabbage according to the present invention includes, as described above, introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage.

[0060] The "Brassica oleracea plant having resistance against downy mildew" means a Brassica oleracea plant which has ability to restrict the growth and development of downy mildew pathogen (preferably Hyaloperonospora brassicae) or the damage it causes, and can be obtained by, for example, carrying out an inoculation test using the provided downy mildew pathogen (preferably Hyaloperonospora brassicae), and judging whether the plant has resistance against it. More preferably, in this inoculation test, the resistant factor held by the plant is a Brassica oleracea plant showing single dominant expression. More specifically, for example, an inoculation test is carried out according to the below-described Example 1, and this allows confirmation whether the object is "a Brassica oleracea plant having resistance against downy mildew" which can be used in the breeding method of the present invention.

[0061] Preferably, the "Brassica oleracea plant having resistance against downy mildew" is a Brassica oleracea plant other than cabbage.

[0062] More preferably, the "Brassica oleracea plant having resistance against downy mildew" is a broccoli variety specified by Accession Number FERM BP-22343, or a cabbage variety specified by Accession Number FERM BP-22344.

[0063] In the breeding method of the present invention, "introducing downy mildew resistance into desired cabbage" means introducing the factor of downy mildew resistance" of the "Brassica oleracea plant having resistance against downy mildew" into desired cabbage so as to impart downy mildew resistance to the cabbage.

[0064] The "desired cabbage" means cabbage which has no downy mildew resistance, and cabbage which can be hybridized with a "Brassica oleracea plant having resistance against downy mildew" and wants the introduction of downy mildew resistance. This cabbage has a useful character as cabbage.

[0065] The "downy mildew resistance" referred to herein can be confirmed by a known means such as an inoculation test of downy mildew, more specifically, a downy mildew resistant gene positioned in the vicinity of the locus represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7.

[0066] The introduction of downy mildew resistance means the introduction of a gene which can express downy mildew resistance into desired cabbage. In the present invention, typically, this introduction can be achieved the "Brassica oleracea plant having resistance against downy mildew" and the desired cabbage, selecting that having desired downy mildew resistance from the hybrid progenies thus obtained, and carrying out backcrossing using the cabbage as the backcross parent.

[0067] The means of confirming downy mildew resistance in the hybrid progeny after hybridizing may be an inoculation test of downy mildew (for example, Example 1 may be referred to), or the selection of a resistant plant may use the DNA markers made based on SEQ ID NO. 1 to SEQ ID NO. 7, and the markers newly designed from the DNA sequences positioned in the vicinity of the SEQ ID NO. 1 to SEQ ID NO. 7, which are selected based on official information. These markers include the marker having any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7 and the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21. These confirmation means may be used in the process of backcross in the same manner, thereby selecting the progeny of downy mildew resistance.

[0068] According to a preferred embodiment of the present invention, the breeding method of the present invention includes the assay of the presence of a downy mildew resistant gene using any one or more of the markers of the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or one or more of the primers or primer pairs which can amplify the DNA sequences. Yet more preferably, the primers are represented by any one or more of SEQ ID NO. 8 to SEQ ID NO. 21.

[0069] According to a preferred embodiment of the present invention, the breeding method of the present invention is carried out by introducing downy mildew resistance into desired cabbage by continuous backcross of the cabbage. More specifically, the breeding method of the present invention includes hybridizing a Brassica oleracea plant having resistance against downy mildew and desired cabbage, selecting a hybrid progeny having downy mildew resistance, and continuous backcrossing it by using the desired cabbage as backcross parent.

[0070] When backcross is carried out, generally, the number of backcrossing is preferably about five to seven.

[0071] When efficient backcross is carried out, a genome-wide DNA marker may be used to bring the object close to the backcross parent in the early stage.

[0072] For example, the first backcross generation (BC1F1) is a segregated generation, the genome substitutional rates of these individuals are different, and the enlargement of the size of the population allows the acquisition of individuals in which 90% or more of the genome region shows the same genotype as the backcross parent. The selection of these individuals allows conformance of the region other than the downy mildew resistant locus to the same genotype as the backcross parent with a few number of generations.

[0073] As a specific means useful as a genome-wide DNA marker, when the genome sequence information of the backcross parent is available, the DNA markers based on the information may be made for genotyping each locus.

[0074] Even when there is no genome sequence information of the backcross parent, the individual having a genotype close to that of the backcross parent can be selected from the segregated generation using random PCR method such as RAPD (random amplified polymorphic DNA), SRAP (sequence-related amplified polymorphism), or AFLP (amplified fragment length polymorphism). Alternatively, if SNPs genotyping chips (for example, the products of Affymetrix or Illumina), which are designed for exhaustively analyzing many SNPs scattered in a genome, are available, such means may be used for the analysis.

[0075] The downy mildew resistant line thus bred can be used not only as a direct variety, but also as parents or one parent in an F1 seed producing system.

[0076] Accordingly, another embodiment of the invention also provides a method of producing a F1 line using the downy mildew resistant line, which is obtained by the breeding method of the present invention, as the line of parents or one parent, and a method for producing the seeds of the F1 line.

[EXAMPLES]

[0077] The present invention is specifically described below with reference to the following examples, but the present invention will not be limited by these examples.

Example 1:

[0078] By using genetic resources of broccoli held by Sakata Seed Corporation as materials, two lines of broccoli ("BR-23" and "BR-35") that show resistance against both of two downy mildew isolates (isolates Dm-A and Dm-B (where the isolate Dm-B has a wider spectrum of virulence to different varieties than Dm-A)) were found.

[0079] In order to identify the downy mildew resistant locus held by these resistant lines, firstly, by using the "BR-23" line as the material, the two lines ("BR-4" and "BR-24") showing susceptibility to the above-described two isolates were hybridized, thus making the F2 population and the BC1F1 population shown in Table 1.

[0080] As the indication of generation, F1 means the first filial generation, and BC1 means the generation subjected to backcross once. More specifically, "BC1F1" means the generation subjected to backcross once after passing the stage of the first filial generation.

[0081] These populations thus obtained were subjected to an inoculation test using an isolate with a wider spectrum of virulence, Dm-B.

[0082] In the inoculation test, the degree of occurrence of disease (disease severity) was evaluated for the first to third true leaves of each individual according to the following disease severity score:

0: no symptom,

1: brown blotches are formed, no spore formation,

2: slight spore formation on brown blotches,

3: moderate spore formation, and

4: a large amount of spore formation.

[0083] The result is as shown in Table 1.

[0084] As indicated by the result, in the F2 population, the ratio of resistance : susceptibility was 3 : 1, while in the BC1F1 hybridized with a susceptible line, the ratio was 1 : 1. These findings revealed that the present disease resistant factor works in a single dominant manner.

[Table 1]

Genetic analysis using broccoli "BR-23" (small population)
Line	Generation	Expected value	Number of individuals	Disease severity					mapping population
				0	1	2	3	4
BR-23	Resistant parent	R:S = 1:0	39		29	10
BR-4	Susceptible parent	R:S = 0:1	20					20
BR-24	Susceptible parent	R:S = 0:1	20					20
(BR-23 x BR-4) self	F2	R:S = 3:1	60		3	35	1	21	mapping population-1
(BR-23 x BR-24) self	F2	R:S = 3:1	65		2	49	3	11	mapping population-2
BR-23 x (BR-23 x BR-4)	BC1F1	R:S = 1:0	40		16	24
BR-23 x (BR-23 x BR-24)	BC1F1	R:S = 1:0	39		7	32
(BR-23 x BR-4) x BR-4	BC1F1	R:S=1:1	39		3	19		17	mapping population-3
BR-24 x (BR-23 x BR-24)	BC1F1	R:S =1:1	40		1	19		20	mapping population-4

Example 2:

[0085] In Table 1, by using the F2 population that showed segregation of resistance and susceptibility (the mapping population-1 and -2) and the BC1F1 population (the mapping population-3 and -4) as the materials, the RAPD markers were searched by the bulked segregant analysis method (BSA method).

[0086] As the RAPD primers, 1180 kinds of 10mer primers designed by Operon Technologies, Inc. and 460 kinds of 12mer primers designed by BEX Co., Ltd. were used.

[0087] As the bulk DNA, four resistant individuals and four susceptible individuals were selected from the mapping population-4, and their DNAs were used to make a bulk DNA of resistant individuals and a bulk DNA of susceptible individuals were made.

[0088] As the primary screening of the RAPD markers, the two kinds of bulk DNAs were subjected to RAPD (randomly amplified polymorphic DNA) by using 1640 kinds of primers, thereby selecting 245 kinds of markers that showed polymorphism.

[0089] In the secondary screening, two individuals that showed resistance and two individuals that showed susceptibility were selected from the mapping population-4, and used as templates to select 36 kinds of markers that showed the similar patterns to the polymorphism shown in the primary screening.

[0090] In the tertiary screening, four individuals that showed resistance and four individuals that showed susceptibility were selected from the mapping population-4, and used as templates to select 11 kinds of markers that showed the similar patterns to the polymorphism shown in the secondary screening.

[0091] In this state, those showed the almost same segregation pattern of the markers as the phenotype were applied to all the individuals of the mapping population-1 to the mapping population-4, and the degree of contradiction between these markers and the score of the phenotype was confirmed, and the markers having a strong correlation with the phenotype were selected.

[0092] In the above-described test, seven kinds of markers of the 11 kinds of markers which had been confirmed to be linked with the downy mildew resistant factor were analyzed for the nucleotide sequences of the amplified DNA fragments, and sequence-specific primers were designed, thus attempting conversion to SCAR (sequence characterized amplified region).

[0093] Firstly, the DNA fragments amplified by RAPD were cut out from an agarose gel, cloned, and then their nucleotide sequences were analyzed. As a result of this, the nucleotide sequences of the above-described seven kinds of markers (DMTLR-1 to DMTLR-7) were specified (SEQ ID NO. 1 to SEQ ID NO. 7, respectively) (Fig. 8). In the specification of the sequences, the sequences of SEQ ID NO. 22 to 28 were specified first, and these sequences had the sequences of SEQ ID NO. 1 to 7 sandwiched between SCAR primers (including the sequence of the SCAR primer). In Fig. 8, the sequence indicated with an underline is the SCAR primer, and the sequences sandwiched between SCAR primers (including the SCAR primer) correspond to SEQ ID NO. 1 to 7, respectively.

[0094] For the cloning, pBluescriptII SK(-) (obtained from Stratagene) was used as the vector, and JM109 (E.coli JM109, obtained from Toyobo Co., Ltd.) was used as the competent cell. The analysis of the nucleotide sequences used DNA sequencer ABI3130 (Applied Biosystems).

[0095] For the markers whose nucleotide sequences were decoded, in order to amplify the target sequences specifically, the primers (SEQ ID NO. 8 to 21) were designed by using "Primer 3" software (a design supporting software for polymerase chain reaction (PCR), open source software) (Table 2).

[0096] Additionally, the results of the electrophoresis test on these primers (markers) (electrophoretic patterns) are shown in Fig. 2.

[0097] The markers thus developed are herein referred to as "DMTLR markers".

[Table 2]

Marker Name	Sequence	PCR condition (annealing temperature/cycle)	Restriction enzyme	Marker type	Sequence No.
DMTLR-1-Fw	CGGTCTTAGTTGATTTCTCAAG	55°C, 30cycle	TaqI	co-dominant	SEQ ID NO. 8
DMTLR-1-Rv	GATCACCCTGTACTAGCAATC				SEQ ID NO. 9
DMTLR-2-Fw	AGTAGGGAGTAAACCAACGAG	55°C, 30cycle	-	dominant	SEQ ID NO. 10
DMTLR-2-Rv	CCACGAGTGCATATTAGGTTG				SEQ ID NO. 11
DMTLR-3-Fw	GTGCTCCGTCAAGATTCGAC	55°C, 30cycle	XbaI	co-dominant	SEQ ID NO. 12
DMTLR-3-Rv	GGACCTAATGAATCGAGAGCTAC				SEQ ID NO. 13
DMTLR-4-Fw	GCATCACTAAGTCAAGCAACT	55°C, 30cycle	-	dominant	SEQ ID NO. 14
DMTLR-4-Rv	CAATGAGGTTGTGCTTTCCTC				SEQ ID NO. 15
DMTLR-5-Fw	CTCTGCAATATTGTCCTTGATG	55°C, 30cycle	FokI	dominant	SEQ ID NO. 16
DMTLR-5-Rv	GCAATTCAGTACACCAACCT				SEQ ID NO. 17
DMTLR-6-Fw	CGATCTCACACTAACTACGCT	55°C, 30cycle	MboI	co-dominant	SEQ ID NO. 18
DMTLR-6-Rv	AATCTGAGATCTCGTTTCGTCA				SEQ ID NO. 19
DMTLR-7-Fw	TTATAGAAGGCCTGTGTACGAC	55°C, 30cycle	HpaI	co-dominant	SEQ ID NO. 20
DMTLR-7-Rv	GTGGCTTGGCTGGATATAGAA				SEQ ID NO. 21

Example 3:

[0098] By using the same F2 population as the mapping population-2 used in Example 2, resistance reaction to the downy mildew isolate Dm-A was also examined.

[0099] The size of the F2 population was 240 individuals (the mapping population-5), and the reaction of the individuals to Dm-A was examined; the segregation as given in Table 3 was exhibited. The inoculation test on the isolate Dm-A was carried out and evaluated in the same manner as in the inoculation test of Example 1.

[Table 3]

Genetic analysis using broccoli "BR-23" (large population)
Line	Generation	Expected value	Number of examined individuals	Number of individuals by disease severity					mapping population
				0	1	2	3	4
BR-23	Resistant parent	R:S = 1:0	15	11	4	0	0	0
BR-24	Susceptible parent	R:S = 0:1	15	0	0	1	10	4
(BR-23 x BR-24) self	F2	R:S = 3:1	240	123	54	3	52	8	mapping population-5
BR-24 x (BR-23 x BR-24)	BC1F1	R:S = 1:1	165	70	15	8	66	6

[0100] As a result of comparison with the genotype by the SCAR marker made in Example 2, high correlation with the phenotype was confirmed. As a result of this, the downy mildew resistant factor of the line "BR-23" was estimated to show resistant reaction against two isolates with a single gene.

[0101] On the basis of the analysis result above, the linkage relationship between the phenotypes in the population and the markers was analyzed by using "Mapmaker 2.0" (Whitehead Institute), which is a software for analyzing the linkage relationship of markers.

[0102] The result is as shown in the linkage map of Fig. 3.

[0103] As indicated by the result, it was estimated that resistant factors are positioned in the vicinity of SEQ ID NO. 1 to 7, especially in the immediate vicinity of SEQ ID NO. 4 and SEQ ID NO. 5.

Example 4:

[0104] For the line "BR-35" which is different from the resistant line "BR-23" analyzed in Example 2, in order to confirm whether it has the same resistant factor as the line "BR-23", an F2 segregated population with the susceptible line "BR-13" was made, and an inoculation test using the isolate Dm-A was carried out (Table 4). The inoculation test using the isolate Dm-A was carried out and evaluated in the same manner as the inoculation test in Example 1.

[Table 4]

Variety, line	Generation	Number of individuals	Number of individuals classified by disease severity score					ma pping population
			0	1	2	3	4
BR-35	Resistant parent	12	5	7
BR-13	Susceptible parent	12				8	4
BR-35 x BR-13	F1	12	1	9	2
(BR-35 x BR-13) F2	F2	180	23	83	30	33	11	mapping population-6

[0105] Furthermore, PCR was carried out by using SEQ ID NO. 8 and 9, the genotype of each individual was examined; all of the 42 individuals in which the locus exhibited resistant homozygous type and the 83 individuals showed heterozygous hetero type showed resistance (Table 5).

[Table 5]

Variety, line	Generation	Number of individuals	Number of individuals classified by disease severity score
			0	1	2	3	4
Individual whose DMTLR-1 showed R homozygous in mapping population-6	F2	42	10	28	4	0	0
Individual whose DMTLR-1 showed heterozygous in mapping population-6	F2	83	13	52	18	0	0
Individual whose DMTLR-1 showed S homozygous in mapping population-6	F2	55	0	3	8	33	11

[0106] Table 5 shows the result of classification of 180 individuals of mapping population-6 in Table 4 according to the genotype of the DNA marker DMTLR-1.

[0107] The polymorphism and phenotype showed by the markers had an extremely high correlation, so that the two kinds of broccoli downy mildew resistant lines "BR-23" and "BR-35" were estimated to have an identical resistant factor.

[0108] The downy mildew resistant gene held by "BR-35" can be found in the broccoli F1 variety "Sawayutaka", derived from "BR-35" as one parent.

[0109] The seeds of the broccoli F1 variety "Sawayutaka" are internationally deposited (originally deposited) in NITE-IPOD (Room 120, 2-5-8 Kazusakamatari, Kisarazu, Chiba) on August 18, 2017 (index for identification attached by the depositor: SSC-BRO-17-001, Accession Number: FERM BP-22343).

Example 5:

[0110] "BR-23" and "BR-35", which are the broccoli lines held by Sakata Seed Corporation, were used as materials having downy mildew resistance, line "CB-20", line "CB-35", line "CB-23", or line "CB-97" was selected from the four varieties (Yoshin, Kandama, spring, and ball types, respectively) as the cabbages to which the resistance is introduced, and used as the backcross parental lines in a hybridizing test.

[0111] For efficiently pursuing backcross (BC), basically, DNA assay using a developed DMTLR marker was carried out, individuals including the downy mildew resistant locus as heterozygous were selected, and the cabbage lines "CB-20", "CB-35", "CB-23", and "CB-97" were continuously backcrossed while their phenotypes were confirmed.

[0112] Firstly, the broccoli lines "BR-23" and "BR-35" were hybridized with the cabbage lines "CB-20", "CB-35", "CB-23", and "CB-97" to F1 seeds were produced, and the DNA selection with DMTLR markers and continuous backcross were carried out.

[0113] In order to efficiently carry out the backcross, selection using 20 kinds of RAPD primers were carried out, followed by selection of the individuals showing the genotypes close to "CB-20", "CB-35", "CB-23", and "CB-97", which are their backcross parental lines in their backcross lines.

[0114] As a result of this, the individuals whose RAPDs markers were completely coincident with their backcross parental lines were selected in the BC2F1 generation in "CB-20", and the BC3F1 generation in other "CB-35", "CB-23", and "CB-97".

[0115] In the BC2F1 generation or the BC3F1 generation, resistance and susceptibility were discriminated with a DMTLR marker, and each of these genotypes were prototyped together with their backcross parental lines in either or both of Kakegawa Research Center or Kimitsu Breeding Station of Sakata Seed Corporation.

[0116] The results are shown in Table 6 and Figs. 4 to 7.

[0117] Table 6 shows the trial production result of the line made by introducing a downy mildew resistant factor into the cabbage line "CB-20" in the fields, and the evaluation result of disease severity of downy mildew. In the segregated generation during backcross, the individual which had been judged as having a downy mildew resistant factor by the DMTLR marker showed resistance even it was heterozygous, and the individual judged as having no downy mildew resistant factor showed susceptibility. Additionally, for the phenotype, the grass figure markedly close to that of the Yoshin type "CB-20" as the backcross parental line.

[Table 6]

Line	DMTLR marker genotype	Number of individuals	Disease severity				Average disease severity
			0	1	2	3
CB-20	S	18		3	3	12	2.5
isogenic line (R) of CB-20	R	18		17	1		1.1
isogenic line (S) of CB-20	S	17			5	12	2.7

[0118] The symptoms of the scores listed in Table 6 are given in Fig. 4. As the index of the disease severity score, the disease severity means the following condition.

Disease severity

[0119] 

0: no symptom,

1: few number of lesions,

2: moderate number of lesions,

3: many lesions.

[0120] The photographs of "CB-20" (original parental line) shown in Table 6 and the isogenic line introduced with a downy mildew resistant factor were given in Fig. 5. As indicated by the figure, the isogenic line introduced with a downy mildew resistant factor suppressed the occurrence of downy mildew in comparison with the parental line "CB-20".

[0121] Furthermore, the lines backcrossed with three other cabbage lines "CB-35", "CB-23", and "CB-97" were also subjected to trial production investigation in the field.

[0122] The result is as shown in Fig. 6.

[0123] As indicated by the result, the line introduced with a resistant locus expressed resistance in the main leaves and head even it was hetero, and was confirmed to be equivalent to the parental lines "CB-35", "CB-23", and "CB-97", which are Kandama, spring, and ball types, respectively. More specifically, as indicated by Fig. 6, the isogenic line introduced with a downy mildew resistant factor suppressed the occurrence of downy mildew in comparison with the original parental line.

[0124] Thereafter, the Yoshin type cabbage "CB-20", which is especially vulnerable to downy mildew, was subjected to several times of backcrossing, 20 individuals were selected from the lines cultivated in the field of Kakegawa Research Center, a homozygote with downy mildew resistance was obtained from anther and pollen culture, whereby first breeding a downy mildew resistant cabbage parental line having practical properties as the parent of a F1 variety was successfully achieved.

Example 6:

[0125] Further, by using "DMR-CB-20" (the DM cabbage line bred as described above) with downy mildew resistance as the pollen parent, and the other promising cabbage line "CB-5" cytoplasm male sterile line as the seed parent, F1 (name of prototype variety: SK3-005) were produced.

[0126] The F1 line was continuously prototyped in Kimitsu Breeding Station of Sakata Seed Corporation, and stable expression of downy mildew resistance was confirmed.

[0127] The first breeding of the downy mildew resistant F1 cabbage variety was thus achieved.

[0128] The seeds produced from the bred downy mildew resistant F1 cabbage variety are internationally deposited (originally deposited) in NITE-IPOD (Room 120, 2-5-8 Kazusakamatari, Kisarazu, Chiba) on August 18, 2017 (index for identification attached by the depositor: SSC-CSB-17-001, Accession Number: FERM BP-22344).

[0129] The original F1 variety (the F1 variety obtained by using the original parental line "CB-20") and the novel F1 variety introduced with downy mildew resistance (F1 variety having downy mildew resistance) was compared.

[0130] The result is as shown in Fig. 7.

[0131] As indicated in Fig. 7, the F1 variety (left photograph) to which downy mildew resistance had been imparted suppressed the occurrence of downy mildew in comparison with the original F1 variety.

Claims

1. Cabbage having resistance against downy mildew, or its progeny.

2. The downy mildew resistant cabbage or its progeny according to claim 1, having a downy mildew resistant gene which is positioned in the vicinity of the locus represented by any one or more of SEQ ID NO. 1 to SEQ ID NO. 7.

3. The downy mildew resistant cabbage or its progeny according to claim 1 or 2, having a downy mildew resistant gene which is detectable by any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

4. The downy mildew resistant cabbage or its progeny according to any one of claims 1 to 3, wherein the downy mildew is a disease caused by Hyaloperonospora brassicae.

5. The downy mildew resistant cabbage or its progeny according to any one of claims 1 to 4, wherein the downy mildew resistant gene is found in the broccoli variety specified by Accession Number FERM BP-22343.

6. The downy mildew resistant cabbage or its progeny according to any one of claims 1 to 4, wherein the downy mildew resistant gene is found in the cabbage variety specified by Accession Number FERM BP-22344.

7. A portion of a plant body of the cabbage or its progeny according to any one of claims 1 to 6.

8. A seed of the cabbage or its progeny according to any one of claims 1 to 6.

9. First filial generation cabbage or its portion having resistance against downy mildew specified by Accession Number FERM BP-22344, or a seed of the cabbage.

10. A method for breeding downy mildew resistant cabbage, comprising introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage.

11. A method for breeding downy mildew resistant cabbage, comprising introducing downy mildew resistance from a Brassica oleracea plant having resistance against downy mildew into desired cabbage, the downy mildew resistance being confirmed by a downy mildew resistant gene positioned in the vicinity of the locus represented by any one of SEQ ID NO. 1 to SEQ ID NO. 7.

12. A method for breeding the downy mildew resistant cabbage according to claim 10 or 11, wherein the Brassica oleracea plant having resistance against downy mildew is a Brassica oleracea plant other than cabbage.

13. The breeding method according to any one of claims 10 to 12, wherein the Brassica oleracea plant having resistance against downy mildew is a broccoli variety specified by Accession Number FERM BP-22343.

14. The breeding method according to claim 10 or 11, wherein the Brassica oleracea plant having resistance against downy mildew is a cabbage variety specified by Accession Number FERM BP-22344.

15. The breeding method according to any one of claims 10 to 14, wherein the introduction of downy mildew resistance into desired cabbage is achieved by continuous backcross of the cabbage.

16. The breeding method according to any one of claims 10 to 15, comprising assaying the presence of a downy mildew resistant gene using one or more of the DNA sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or one or more of the primers or primer pairs which can amplify the DNA sequence.

17. The breeding method according to claim 16, wherein the primer is represented by any one or more of SEQ ID NO. 8 to SEQ ID NO. 21.

18. The breeding method according to any one of claims 10 to 15, comprising assaying the presence of a downy mildew resistant gene using any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

19. A marker having any one of the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, the marker being able to detect a downy mildew resistant locus in a Brassica oleracea plant.

20. A primer set comprising any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21, the primer set being able to detect a downy mildew resistant locus in a Brassica oleracea plant.

21. A method for detecting downy mildew resistance in a Brassica oleracea plant, comprising using any one or more of markers having the nucleotide sequences represented by SEQ ID NO. 1 to SEQ ID NO. 7, or any one or more of the primers having the nucleotide sequences represented by SEQ ID NO. 8 to SEQ ID NO. 21.

Drawing