[0001] This application claims the benefit of and priority to
U.S. Provisional Application No. 62/531,123, filed July 11, 2017. This application also claims the benefit of and priority to
International PCT Application No. PCT/US18/24409, filed March 26, 2018, which claims the benefit of and priority to
U.S. Provisional Application No's. 62/476,080, filed March 24, 2017, and
62/588,662, filed November 20, 2017, and
62/621,166, filed January 21, 2018. The entire specifications and figures of the above-referenced applications are hereby
incorporated, in their entirety by reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically
in ASCII format and is hereby incorporated by reference in its entirety.
TECHNICAL FIELD
[0003] The field of the present invention relates generally to systems and methods for the
generation of water-soluble cannabinoids in yeast, and other plant cell suspension
cultures. The field of the present invention also relates generally to compositions
of matter that may contain one or more water-soluble cannabinoids.
BACKGROUND
[0004] Cannabinoids are a class of specialized compounds synthesized by
Cannabis. They are formed by condensation of terpene and phenol precursors. They include these
more abundant forms: Delta-9-tetrahydrocannabinol (THC), cannabidiol (CBD), cannabichromene
(CBC), and cannabigerol (CBG). Another cannabinoid, cannabinol (CBN), is formed from
THC as a degradation product and can be detected in some plant strains Typically,
THC, CBD, CBC, and CBG occur together in different ratios in the various plant strains.
[0005] Cannabinoids are generally classified into two types, neutral cannabinoids and cannabinoid
acids, based on whether they contain a carboxyl group or not. It is known that, in
fresh plants, the concentrations of neutral cannabinoids are much lower than those
of cannabinoid acids. One strain
Cannabis sativa contains approximately 61 compounds belonging to the general class of cannabinoids.
These cannabinoids are generally lipophilic, nitrogen-free, mostly phenolic compounds,
and are derived biogenetically from a monoterpene and phenol, the acid cannabinoids
from a monoterpene and phenol carboxylic acid, and have a C21 to base material.
[0006] Cannabinoids also find their corresponding carboxylic acids in plant products. In
general, the carboxylic acids have the function of a biosynthetic precursor. For example,
these compounds arise
in vivo from the THC carboxylic acids by decarboxylation the tetrahydrocannabinols Δ9- and
Δ8-THC and CBD from the associated cannabidiol. As generally shown in Fig. 28, THC
and CBD may be derived artificially from their acidic precursor's tetrahydrocannabinolic
acid (THCA) and cannabidiolic acid (CBDA) by non-enzymatic decarboxylation.
[0007] Cannabinoids are widely consumed, in a variety of forms around the world. Cannabinoid-rich
preparations of
Cannabis, either in herb (i.e. marijuana) or resin form (i.e., hash oil), are used by an estimated
2.6-5.0% of the world population (UNODC, 2012). Cannabinoid containing pharmaceutical
products, either containing natural cannabis extracts (Sativex®) or the synthetic
cannabinoids dronabinol or nabilone, are available for medical use in several countries
[0008] As noted above, Δ-9-tetrahydrocannabinol (also known as THC) is one of the main biologically
active components in the
Cannabis plant which has been approved by the Food and Drug Administration (FDA) for the control
of nausea and vomiting associated with chemotherapy and, more recently, for appetite
stimulation of AIDS patients suffering from wasting syndrome. The drug, however, shows
other biological activities which lend themselves to possible therapeutic applications,
such as in the treatment of glaucoma, migraine headaches, spasticity, anxiety, and
as an analgesic.
[0009] Indeed, it is well documented that agents, such as cannabinoids and endocannabinoids
that activate cannabinoid receptors in the body modulate appetite, and alleviate nausea,
vomiting, and pain (
Martin B. R. and Wiley, J. L, Mechanism of action of cannabinoids: how it may lead
to treatment of cachexia, emesis and pain, Journal of Supportive Oncology 2: 1-10,
2004), multiple sclerosis (
Pertwee, R. G., Cannabinoids and multiple sclerosis, Pharmacol. Ther. 95, 165-174,
2002), and epilepsy (
Wallace, M. J., Blair, R. E., Falenski, K. WW., Martin, B. R., and DeLorenzo, R. J.
Journal Pharmacology and Experimental Therapeutics, 307: 129-137, 2003). In addition, CB2 receptor agonists have been shown to be effective in treating
pain (
Clayton N., Marshall F. H., Bountra C., O'Shaughnessy C. T., 2002. CB1 and CB2 cannabinoid
receptors are implicated in inflammatory pain. 96, 253-260;
Malan T. P., Ibrahim M. M., Vanderah T. W., Makriyannis A., Porreca F., 2002. Inhibition
of pain responses by activation of CB(2) cannabinoid receptors. Chemistry and Physics
of Lipids 121, 191-200;
Malan T. P., Jr., Ibrahim M. M., Deng H., Liu Q., Mata H. P., Vanderah T., Porreca
F., Makriyannis A., 2001. CB2 cannabinoid receptor-mediated peripheral antinociception.
93, 239-245.;
Quartilho A., Mata H. P., Ibrahim M. M., Vanderah T. W., Porreca F., Makriyannis A.,
Malan T. P., Jr., 2003. Inhibition of inflammatory hyperalgesia by activation of peripheral
CB2 cannabinoid receptors. Anesthesiology 99, 955-960) and multiple sclerosis (
Pertwee, R. G., Cannabinoids and multiple sclerosis, Pharmacol. Ther. 95, 165-174,
2002) in animal models.
[0010] More recently, several states have approved use of
Cannabis and cannabinoid infused products for both recreational and medical uses. As these
new medical and commercial markets have developed, there has grown a need to develop
more efficient production and isolation of cannabinoid compounds. Traditional methods
of cannabinoid production typically focus on extraction and purification of cannabinoids
from raw harvested
Cannabis. However, traditional cannabinoid extraction and purification methods have a number
of technical and practical problems that limits its usefulness.
Limitations of Traditional Cannabinoid Production and Extraction Methods
[0011] For example, in
US Pat. No. 6,403,126 (Webster et al.), cannabinoids, and other related compounds are isolated from raw harvested
Cannabis and treated with an organic solvent, typically a petroleum derived hydrocarbon, or
a low molecular-weight alcohol to solubilize the cannabinoids for later isolation.
This traditional method is limited in that it relies on naturally grown plant matter
that may have been exposed to various toxic pesticides, herbicides and the like. In
addition, such traditional extraction methods are imprecise resulting in unreliable
and varied concentrations of extracted THC. In addition, many
Cannabis strains are grown in hydroponic environments which are also not regulated and can
results in the widespread contamination of such strains with chemical and other undesired
compounds.
[0012] In another example,
US Pat. App. No. 20160326130 (Lekhram et al.), cannabinoids, and other related compounds are isolated from raw harvested
Cannabis using, again, a series of organic solvents to convert the cannabinoids cannabinoids
into a salt, and then back to its original carboxylic acid form. Similar to Webster,
this traditional method is limited in that is relies on naturally grown plant matter
that may have been exposed to various toxic pesticides, herbicides and the like. In
addition, the multiple organic solvents used in this traditional process must be recovered
and either recycled and/or properly disposed of.
[0013] Another traditional method of cannabinoid extraction involves the generation of hash
oils utilizing supercritical carbon-dioxide (sCO
2). Under this traditional method, again the dried plant matter is ground and subjected
to a sCO
2 extraction environment. The primary extract being initially obtained and further
separated. For example, as generally described by
CA2424356 (Muller et al.) cannabinoids are extracted with the aid of sCO
2 under supercritical pressure and temperature conditions and by the addition of accessory
solvents (modifiers) such as alcohols. Under this process, this supercritical CO
2 evaporates and dissolves into the cannabinoids. However, this traditional process
also has certain limiting disadvantages. For example, due to the low solubility in
supercritical sCO
2, recovery of the cannabinoids of interest is inconsistent. Additionally, any solvents
used must be recycled and pumped back to the extractor, in order to minimize operating
costs.
[0014] Another method utilizes butane to extract cannabinoids, in particular high concentrations
of THC, from raw harvested
Cannabis. Because butane is non-polar, this process does not extract water soluble by-products
such as chlorophyll and plant alkaloids. That said, this process may take up to 48
hours and as such is limited in its ability to scale-up for maximum commercial viability.
The other major drawback of traditional butane-based extraction processes is the potential
dangers of using flammable solvents, as well as the need to ensure all of the butane
is fully removed from the extracted cannabinoids.
[0015] Another limiting factor in the viability of these traditional methods of cannabinoid
extraction methods is the inability to maintain
Cannabis strain integrity. For example, cannabinoids used in medical and research applications,
or that are subject to controlled clinical trials, are tightly regulated by various
government agencies in the United States and elsewhere. These regulatory agencies
require that the
Cannabis strains remain chemically consistent over time. Unfortunately, the genetic/chemical
compositions of the
Cannabis strains change over generations such that they cannot satisfy regulatory mandates
present in most clinical trials or certified for use in other pharmaceutical applications.
[0016] Several attempts have been made to address these concerns. For example, efforts have
been made to produce cannabinoids in genetically engineered organisms. For example,
in
US Pat. App. 14/795,816 (Poulos, et al.) Here, the applicant claims to have generated a genetically modified strain of yeast
capable of producing a cannabinoid by inserting genes that produce the appropriate
enzymes for its metabolic production. However, such application is limited in its
ability to produce only a single or very limited number of cannabinoid compounds.
This limitation is clinically significant. Recent clinical studies have found that
the use of a single isolated cannabinoid as a therapeutic agent is not as effective
as treatment with the naturally-occurring "entourage" of primary and secondary cannabinoids
associated with various select strains. The system in Poulos is further limited in
the ability to account for toxic by-products of cannabinoid synthesis, as well as
the directly toxic effects of the insoluble, and/or only lipid-soluble, cannabinoid
compounds themselves.
[0017] Additional attempts have been made to chemically synthesize cannabinoids, such as
THC. However, the chemical synthesis of various cannabinoids is a costly process when
compared to the extraction of cannabinoids from naturally occurring plants. The chemical
synthesis of cannabinoids also involves the use of chemicals that are not environmentally
friendly, which can be considered as an additional cost to their production. Furthermore,
the synthetic chemical production of various cannabinoids has been classified as less
pharmacologically active as those extracted from plants such as
Cannabis sativa.
[0018] Efforts to generate large-scale
Cannabis cell cultures have also raised a number of technical problems. Chief among them is
the fact that cannabinoids are cytotoxic. Under natural conditions cannabinoids are
generated and then stored extracellularly in small glandular structures called trichomes.
Trichomes can be visualized as small hairs or other outgrowths from the epidermis
of a
Cannabis plant. As a result, in
Cannabis cell cultures, the inability to store cannabinoids extracellularly means any accumulation
of cannabinoids would be toxic to the cultured cells. Such limitations impair the
ability of
Cannabis cell cultures to be scaled-up for industrial levels of production.
Cannabinoid Biosynthesis Toxicity Limits In Vivo Production Systems
[0019] Efforts to generate
Cannabis strains/cell cultures that produce or accumulate high-levels of cannabinoids have
raised a number of technical problems. Chief among them is the fact that cannabinoid
synthesis produces toxic by-products. Notably, both CBDA and THCA synthases require
molecular oxygen, in conjunction with a molecule of FAD, to oxidize Cannabigerolic
acid (CBGA). Specifically, as shown in Fig. 29, two electrons from the substrate are
accepted by an enzyme-bound FAD, and then transferred to molecular oxygen to re-oxidize
FAD. CBDA and THCA are synthesized from the ionic intermediates via stereoselective
cyclization by the enzymes. The hydride ion is transferred from the reduced flavin
to molecular oxygen, resulting in the formation of hydrogen peroxide and re-activation
of the flavin for the next cycle. As a result, in addition to producing CBDA and THCA
respectively, this reaction produces hydrogen peroxide (H
2O
2) which is naturally toxic to the host cell. Due to this production of a toxic hydrogen
peroxide byproduct, cannabinoid synthesis generates a self-limiting feed-back loop
preventing high-level production and/or accumulation of cannabinoids in
in vivo systems. One way that
Cannabis plants deal with these cellular cytotoxic effects is through the use of trichomes
for Cannabinoid production and accumulations.
[0020] Cannabis plants deal with this toxicity by sequestering cannabinoid biosynthesis
and storage extracellularly in small glandular structures called trichomes as note
above. For example, THCA synthase is a water soluble enzyme that is responsible for
the production of THC. For example, THC biosynthesis occurs in glandular trichomes
and begins with condensation of geranyl pyrophosphate with olivetolic acid to produce
cannabigerolic acid (CBGA); the reaction is catalyzed by an enzyme called geranylpyrophosphate:olivatolate
geranyltransferase. CBGA then undergoes oxidative cyclization to generate tetrahydrocannabinolic
acid (THCA) in the presence of THCA synthase. THCA is then transformed into THC by
non-enzymatic decarboxylation. Sub-cellular localization studies using RT-PCR and
enzymatic activity analyses demonstrate that THCA synthase is expressed in the secretory
cells of glandular trichomes, and then is translocated into the secretory cavity where
the end product THCA accumulates. THCA synthase present in the secretory cavity is
functional, indicating that the storage cavity is the site for THCA biosynthesis and
storage. In this way, the
Cannabis is able to produce cannabinoids extracellularly and thereby avoid the cytotoxic effects
of these compounds. However, as a result, the ability to access and chemically alter
cannabinoids
in vivo is impeded by this cellular compartmentalization.
[0021] To address these concerns, some have proposed chemically modifying cannabinoid compounds
to reduce their cytotoxic effects. For example, Zipp, et al., have proposed utilizing
an
in vitro method to produce cannabinoid glycosides. However, this application is limited to
in vitro systems only. Specifically, as noted above, cannabinoid synthase enzymes, such as
THCA synthase, are water soluble proteins that are exported out of the basal trichome
cells into the storage compartment where it is active and catalyzes the synthesis
of THCA. Specifically, in order to effectively mediate the cellular export of such
cannabinoid synthase, this enzyme contains a 28 amino acid signal peptide that directs
its export out of the cell and into the extracellular trichrome where cannabinoid
synthesis occurs.
[0022] The foregoing problems regarding the production, detoxification and isolation of
cannabinoids may represent a long-felt need for an effective -- and economical --
solution to the same. While implementing elements may have been available, actual
attempts to meet this need may have been lacking to some degree. This may have been
due to a failure of those having ordinary skill in the art to fully appreciate or
understand the nature of the problems and challenges involved.
[0023] As a result of this lack of understanding, attempts to meet these long-felt needs
may have failed to effectively solve one or more of the problems or challenges here
identified. These attempts may even have led away from the technical directions taken
by the present inventive technology and may even result in the achievements of the
present inventive technology being considered to some degree an unexpected result
of the approach taken by some in the field.
[0024] As will be discussed in more detail below, the current inventive technology overcomes
the limitations of traditional cannabinoid production systems while meeting the objectives
of a truly effective and scalable cannabinoid production, modification and isolation
system.
SUMMARY OF THE INVENTION(S)
[0025] Generally, the inventive technology relates to the field of chemical modification
and isolation in yeast suspension cultures. The present inventive technology further
relates to improved systems and methods for the modification and isolation of pharmaceutically
active components from plant materials. In one embodiment, the inventive technology
may encompass a novel system for the generation of chemically modified-cannabinoid
compounds in a yeast suspension culture. The inventive technology may include systems
and methods for high-efficiency chemical modification and isolation of cannabinoid
compounds from yeast suspension cultures. In this embodiment, various select cannabinoid
compounds may be chemically modified into soluble and non-toxic configurations.
[0026] One aim of the current inventive technology includes improved systems and methods
for the modification of cannabinoids in a sterile yeast and/or plant culture system.
In one embodiment, the inventive technology may include the production of a sterile
yeast and/or plant cell suspension culture. The inventive technology may allow for
certain transgenes to be introduced into these yeast strains and/or plant to transiently
modify the chemical structure of the cannabinoid compounds. This transient modification
may render the cannabinoids soluble in water. Such modifications may also alter the
rate at which the cannabinoids are metabolized generating a modified cannabinoid with
enhanced kinetics that may be used in certain therapeutic applications or as a prodrug.
These transiently modified cannabinoids, aided by their modified chemical structure,
may be allowed to accumulate at higher than native levels without having a deleterious
effect on the cultured yeast and/or plant cells. Being soluble, they may also be secreted
through endogenous and/or exogenous ABC or other trans-membrane protein transporters
into the culture medium for later harvesting and isolation. It is noted that naturally
occurring cannabinoids are strong inhibitors of ABC transporters. These transiently
modified cannabinoids may be harvested and isolated from the aforementioned culture
systems, and then enzymatically restored to their original chemical structure. Other
embodiments may allow for the regulation of cannabinoid modification and isolation.
In such embodiment, discreet and known amounts of cannabinoids may be introduced into
a yeast and/or plant suspension culture and transiently modified. Later, the modified
cannabinoids may be extracted from the cell culture and isolated such that the quantity
and relative ratios of the various cannabinoids is known and quantifiable. In this
manner the isolated cannabinoid extract may be chemically consistent and as such,
easily dosable for both pharmaceutical and/or recreational applications.
[0027] Additional aims of the inventive technology may include the transient modification
of cannabinoid compounds to render them water-soluble in yeast cell culture systems.
In a preferred embodiment, such soluble cannabinoids may have reduced cytotoxicity
to yeast cells in culture and may further be actively transported out of the cell
and allowed to accumulate at levels that would normally have a deleterious effect
on the cell culture. Additional embodiments may include the isolation of these transiently
modified cannabinoids followed by enzymatic conversion or reconstitution to their
original and/or partially modified structure.
[0028] Another aim of the current invention may include the systems, methods and compositions
for the generation of water-soluble cannabinoid compounds. Another aim of the current
inventive technology includes the generation of various compositions of matter containing
water-soluble cannabinoids. In one preferred embodiment, such compositions of matter
may contain water-soluble cannabinoids generated in an
in vitro and/or
in vivo system.
[0029] Additional aims of the invention may include delivery systems and compositions that
include water-soluble cannabinoids, preferably glycosylated and/or acetylated cannabinoids.
Additional embodiments may further include methods and systems for the production
of compositions that include water-soluble cannabinoids, preferably glycosylated and/or
acetylated cannabinoids.
[0030] Another aim of the current invention may include systems, methods and compositions
for the delivery of water-soluble cannabinoids, preferably glycosylated and/or acetylated
cannabinoids as a prodrug. Included in this invention may include novel prodrug compositions.
[0031] One aim of the invention may include systems, methods and compositions for the
in vivo production, modification and isolation of cannabinoid compounds from
Cannabis plants. In particular, the invention provides systems and methods for high level
in vivo biosynthesis of water-soluble cannabinoids in yeast. In one preferred embodiment,
the suspension culture may include the biotransformation of one or more cannabinoids
in yeast, or other plant cells into a water-soluble form.
[0032] One aim of the invention may include systems, methods and compositions for the
in vivo production, modification and isolation of cannabinoid compounds from
Cannabis plants. In particular, the invention provides systems and methods for high level
in vivo biosynthesis of water-soluble cannabinoids in cell suspension cultures. In one preferred
embodiment, the suspension culture may include a yeast suspension culture, a tobacco
or other plant cell suspension culture or a cannabis plant cell suspension culture.
[0033] The current inventive technology includes systems and methods for enhanced production
and/or accumulation of cannabinoids. In one embodiment, the invention may include
systems and methods for enhanced production and/or accumulation of cannabinoids in
an
in vivo system, such as a yeast, or plant cell suspension culture.
[0034] Another aim of the current invention may include the generation of genetically modified
plants cells that may further be in a suspension culture that may overexpress certain
endogenous/exogenous genes that result in the over-production and/or accumulation
of cannabinoids above wild-type levels. In one preferred embodiment, such transgenic
plant cell cultures may exhibit enhanced production and accumulation of cannabinoid
precursor compounds, such as THCA (tetrahydrocannabinolic acid), CBCA (cannabichromenic
acid), and CBDA (cannabidiolic acid). Such transgenic plant cells in culture may additionally
exhibit enhanced production and localized accumulation of cannabinoids, such as THCs,
CBCs and CBDs.
[0035] An additional aim of the current invention may include the generation of genetically
modified plant cells in culture expressing certain endogenous/exogenous that result
in the enhanced biomodification of cannabinoids. In one preferred embodiment, such
cultured transgenic plant cells may exhibit enhanced modification of cannabinoids
including hydroxylation, and/or acetylation, and/or glycosylation. In additional preferred
embodiments, such transgenic plants may exhibit enhanced modification of cannabinoids
including acetylation and glycosylation, such as an O acetylated glycoside form. For
example, acetylation adds an acetyl group (-CH
3OOH) to a cannabinoid such that the carboxylate group is acidic and charged at neutral
pH making it highly water-soluble.
[0036] Another aim of the current invention may include the generation of genetically modified
yeast strains overexpressing certain endogenous/exogenous genes that result in the
over-production and/or accumulation of cannabinoids above wild-type levels. In one
preferred embodiment, such transgenic yeast may exhibit enhanced production and localized
accumulation of cannabinoid precursor compounds, such as THCA (tetrahydrocannabinolic
acid), CBCA (cannabichromenic acid), and CBDA (cannabidiolic acid). Such transgenic
plants may additionally exhibit enhanced production and localized accumulation of
cannabinoids, such as THCs, CBCs and CBDs.
[0037] An additional aim of the current invention may include the generation of genetically
modified plants expressing certain genes that result in the modification of cannabinoids
into water-soluble forms. In one preferred embodiment, such transgenic yeast may exhibit
enhanced modification of cannabinoids including hydroxylation, and/or acetylation,
and/or glycosylation. In additional preferred embodiments, such transgenic plants
may exhibit enhanced modification of cannabinoids including acetylation and glycosylation,
such as an O acetyl glycoside form. For example, acetylation adds an acetate group
(-CH
3COOH) to a cannabinoid such that the carboxylate group is acidic and charged at neutral
pH making it highly water-soluble.
[0038] One aim of the current inventive technology may be to generate genetically modified,
or transgenic plant cells in a suspension culture that overexpresses one or more transcription
factors, such as myb, that enhance metabolite flux through the cannabinoid biosynthetic
pathway. In one preferred embodiment, these transcription factors may include various
analogues. In certain preferred embodiments, one or more of these transgenes may be
operably-linked to one or more promoters.
[0039] One aim of the current inventive technology may be to generate genetically modified
or transgenic
Cannabis plant cells in a suspension culture that overexpresses one or more transcription
factors, such as myb, that enhance metabolite flux through the cannabinoid biosynthetic
pathway. In one preferred embodiment, these transcription factors may include various
analogues. In certain preferred embodiment, one or more of these transgenes may be
operably-linked to one or more promoters.
[0040] Another aim of the current inventive technology may be to generate a genetically
modified or transgenic tobacco cell culture that overexpresses one or more transcription
factors that enhance metabolite flux through the cannabinoid biosynthetic pathway.
In one preferred embodiment, these transgenes may be operably linked to one or more
promoters.
[0041] Yet, another aim of the current inventive technology may be to generate a genetically
modified or transgenic plant cell that expresses an enzyme that is configured to be
capable of reducing hydrogen peroxide (H
2O
2) levels that may be generated during cannabinoid synthesis. In one preferred embodiment,
the current inventive technology may be to generate a genetically modified or transgenic
tobacco and/or
Cannabis plant cell in a suspension culture that expresses a catalase protein. In this embodiment,
this catalase protein may reduce hydrogen peroxide (H
2O
2) levels generated during cannabinoid synthesis.
[0042] Yet, another aim of the current inventive technology may be to generate genetically
modified plants, plant cells and/or yeast cells that expresses an enzyme that is configured
to be capable of reducing hydrogen peroxide (H
2O
2) levels that may be generated during cannabinoid synthesis. In one preferred embodiment,
the current inventive technology may be to generate a genetically modified or transgenic
yeast cell in a suspension culture that expresses a catalase protein. In this embodiment,
this catalase protein may reduce hydrogen peroxide (H
2O
2) levels generated during cannabinoid synthesis.
[0043] Another aim of the current invention may include the introduction of one or more
compounds to facilitate the chemical decomposition of hydrogen peroxide resulting
from cannabinoids biosynthesis. In one preferred embodiment, one or more chemicals,
metal ions, and/or catalysts may be introduced into a growth media to detoxify hydrogen
peroxide (H
2O
2) in both yeast and plant cell cultures. It should be noted that additional cell cultures
and cell lines may be contemplated in the invention. For example, CHO cells, HeLa
cells and insect cell lines, like SF-9 cells may be genetically modified as generally
described herein to generate water-soluble cannabinoids.
[0044] Additional embodiments of the inventive technology may include the transient modification
of cannabinoid compounds to reduce and/or eliminate their cytotoxicity in plants or
plant cell culture systems. In a preferred embodiment, such transiently modified cannabinoids
may be allowed to accumulate at levels that would normally have a deleterious effect
on the cell. Additional embodiments may include the isolation of these transiently
modified cannabinoids followed by enzymatic conversion or reconstitution to their
original and/or partially modified structure.
[0045] Another aim of the invention may include the generation of a transgenic plant and
or plant cell cultures that may over express endogenous genes that may be configured
to modify cannabinoids. Additional aim may include the co-expression of heterologous
transcription factors that may increase cannabinoid production. Another aim of the
invention may include the co-expression of heterologous genes that detoxify the hydrogen
peroxide byproducts generated through cannabinoid biosynthesis. Co-expression of such
genes may be additive with the co-expression of genes configured to modify and/or
localize cannabinoid biomodifications.
[0046] Another aim of the invention may include systems, methods and compositions for the
generation of a yeast cannabinoid production system coupled with systems, methods
and compositions for the reducing hydrogen peroxide toxicity resulting from cannabinoid
synthesis. Another aim of the invention may include systems, methods and compositions
for the generation of a yeast cannabinoid production system coupled with systems,
methods and compositions for the biomodification of such yeast generated cannabinoids
into functionalized as well as water-soluble forms as generally described herein.
[0047] Another aim of the invention includes compositions of novel water-soluble cannabinoids
and their method or manufacture. Still other aims of the current invention include
additional compositions of matter that incorporate one or more water-soluble cannabinoids.
BRIEF DESCRIPTION OF THE FIGURES
[0048] The above and other aspects, features, and advantages of the present disclosure will
be better understood from the following detailed descriptions taken in conjunction
with the accompanying figures, all of which are given by way of illustration only,
and are not limiting the presently disclosed embodiments, in which:
Fig. 1. Representative Chromatographic Elution profile of CBGA Glycosides found in
in vitro Assays. Chromatograms A, B, and C represent respective extracted ion chromatograms
for each glycoside product. Chromatogram D is representative of the total ion chromatogram.
Peak Intensities are illustrated as relative abundance to most abundant peak in each
respective chromatogram.
Fig. 2. Representative Chromatographic Elution profiles of Functionalized CBGA and
Glycosides found in in vitro assays. Chromatograms A, B, and C represent respective extract rated ion chromatograms
for each product. Chromatogram D is representative of the total ion chromatogram.
Peak Intensities are illustrated as relative abundance to most abundant peak in each
respective chromatogram.
Fig. 3. Representative Chromatographic Elution profile of CBDA Glycosides profiles
found in Leaf Extracts. Chromatograms A, B, C, and D represent respective extract
rated ion chromatograms for each glycoside product. Chromatogram E is representative
of the total ion chromatogram. Peak Intensities are illustrated as relative abundance
to most abundant peak in each respective chromatogram.
Fig. 4. Chromatographic Elution of Functionalized CBDA and Functionalized Glycosides
in Leaf Extracts. Chromatograms A, B, and C represent respective extract rated ion
chromatograms for each product. Chromatogram D is representative of the total ion
chromatogram. Peak Intensities are illustrated as relative abundance to most abundant
peak in each respective chromatogram.
Fig. 5. Gene construct for expression of cytochrome P450 (CYP3A4) gene, (SEQ ID NO.
1), expressing the cytochrome P450 (CYP3A4) protein (SEQ ID NO. 2) and P450 oxidoreductase
gene (oxred) (SEQ ID NO. 3) expressing the P450 oxidoreductase protein (SEQ ID NO.
4), in plants. Both genes were driven by the constitutive 35S promoter (35S) and featured
5' untranslated regions from Arabidopsis thaliana alcohol dehydrogenase (AtADH) as translational enhancers.
Fig. 6. Confirmation of expression of CYP3A4 and P450 oxidoreductase in tobacco leaves.
CB1-CB5, biological replicates of leaves infiltrated with the CYP3A4/P450 oxidoreductase;
WT = wild type tobacco leaves with no infiltration. L= 1kb plus ladder (Thermo Fisher
Scientific, USA). The arrows show the expected (500bp) band indicating expression
of the transgene.
Fig. 7. Enhanced glycosylation of cannabinoids in P450-over expressing N. benthamiana plants. CB1-CB5 are biological reps overexpressing CYP3A4+P450 oxidoreductase, P_control
is the P19 silencing suppressor ('empty vector' control). Vertical axis shows relative
amounts expressed as peak area per g fresh weight.
Fig. 8. Gene construct for the cytosol and suspension culture cannabinoid production
system. 35S, Cauliflower mosaic 35S promoter; HSPt, HSP terminator; 35PPDK, hybrid
promoter consisting of the cauliflower mosaic virus 35S enhancer fused to the maize
C4PPDK basal promoter (Yoo et al. 2007); 76G1, UDP glycosyltransferase from Stevia rebaudiana; ABCG2, human multi-drug transporter.
Fig. 9. Demonstrates RT-PCR confirmation of expression of CBDA synthase (a), UDP glycosyltransferase
(b) and ABCG2 (c) in tobacco leaf cells. L is the 1kb plus ladder (Thermo Fisher Scientific,
USA).Numbers on the lanes represent independent transgenic lines. The arrows point
to the expected band that shows expression of the transgene.
Fig. 10. Hydroxylation and glycosylation of cannabinoids in transgenic tobacco (SUS,
numbered) overexpressing CBDA synthase, UDP glycosyltransferase and ABC transporter.
WTS1 and 2 are wild type fed with substrate for endogenous reactions. There was some
endogenous glycosylation of CBGA, as well as evidence for enhanced transgenic glycosyltransferase
activity (e.g. SUS2, SUS3 and SUS4). The data has been corrected to peak area per
g fresh weight.
Fig. 11. Enhanced modification of cannabinoids in transgenic N. benthamiana plants co-infected with constructs for glycosylation, P450-mediated functionalization
(hydroxylation) and detoxification of hydrogen peroxide by catalase. SUS = construct
for overexpressing CBDA synthase, UDP glycosyltransferase and ABC transporter; M3S=
construct for overexpressing CBDA synthase, UDP glycosyltransferase and ABC transporter
with Cannabis MYB12-like and Arabidopsis thaliana catalase.
Fig. 12. Increased glycosylation activity in transgenic N. benthamiana plants (TSA, TSB, TSC, SUS, SUS/P450) overexpressing a glycosyltransferase compared
to wild type in 14-hour transient expression assays.
Fig. 13. Exemplary monooxygenase reaction, catalyzed by cytochromes P450.
Fig. 14. Gene construct 1 for the trichome cannabinoid production system. Cauliflower
mosaic 35S promoter; AtADH 5'-UTR, translation enhancer element (Matsui et al. 2012);
tsCBDAs, cannabidiolic acid synthase with its original trichome target sequence; HSP
terminator; tsUGT76G1, UDP glycosyltransferase from Stevia rebaudiana with CBDAs trichome target sequence.
Fig. 15. Gene construct 2 for the trichome cannabinoid production system. Cauliflower
mosaic 35S promoter; AtADH 5'-UTR, enhancer element; PM-UTR1, Arabidopsis thaliana UDP-glucose/galactose transporter targeted to the plasma membrane; HSP terminator.
Fig. 16. Trichome-targeted CBDA synthase RT-PCR (top), Trichome-targeted UDP glycosyltransferase
(76G1) UGT RT-PCR (bottom). A, B, and C are biological replicates collected after
2DPI.
Fig. 17. PM-UTR1 RT-PCR. A, B, and C are biological replicates collected after 2DPI.
Fig. 18. Gene construct for the cytosolic cannabinoid production system. Cauliflower
mosaic 35S promoter; AtADH 5'-UTR, enhancer element; cytCBDAs, cannabidiolic acid
synthase with the trichome target sequence removed; HSP terminator; cytUGT76G1, UDP
glycosyltransferase from Stevia rebaudiana.
Fig. 19. SUS-A to SUS-C are biological replicates for the cell suspension (201-SUS)
transformation after 1DPI.
Fig. 20. cytUGT RT-PCR (top), cytCBDAs RT-PCR (bottom). A, B, and C are biological
replicates for cytosolic construct infiltration after 2DPI.
Fig. 21. Cannabinoid detection in leaves infiltrated with trichome or cell suspension
constructs and fed with CBGA 2.7mM. The color code refers to the target compartment
for CBDAs and UGT76G1 protein accumulation, either trichome or cell suspension cytostol.
Y-axis: CBGA and CBDA expressed as parts per million (ppm). Primary, secondary, and
acetylated glycosides expressed as peak area.
Fig. 22. Cannabinoid detection in leaves infiltrated with cytosolic or cell suspension
construct and fed with CBGA 2.7mM and UDP-glucose 4mM. The color code refers to the
target compartment for CBDAs and UGT76G1 protein accumulation. Y-axis: CBGA expressed
as parts per million (ppm). All other cannabinoid derivatives expressed as peak area
(no standards available).
Fig. 23. Extracted Ion Chromatograms of R-OH Functionalized 1 x Glycosylated CBDA
Analog. (A) Chromatographic trace, ion m/z, calculated elemental composition, confirming
presence of trace levels of CBDA analog (B) Absence of CBDA analog in control extract
(C) Absence of CBDA analog in biological duplicate control extract.
Fig. 24. Direct Infusion Mass Spectrum of Cannabis sativa extract. Spectral insets represent CBDA with a single glycosylation (519.2546 m/z),
and CBDA functionalized with R-OH and a single glycosylation (535.2543 m/z). Peak
Intensities are illustrated as relative abundance to most intense ion.
Fig. 25. Relative abundance of CBDA in extracts of various Cannabis sativa strains infiltrated with Agrobacterium cultures harboring CBDA synthase (CBDAs) and UGT plasmid combinations. Normalized
relative abundance data is presented as the ion intensity of each compound divided
by the ion intensity of the internal standard 7-hydroxycoumarin (20 ppm).
Fig. 26. Relative abundance of modified CBDA (glycosylated and/or hydroxylated) in
extracts of various Cannabis sativa strains infiltrated with Agrobacterium cultures harboring CBDAs and UGT plasmid combinations. Normalized relative abundance
data is presented as the ion intensity of each compound divided by the ion intensity
of the internal standard 7-hydroxycoumarin (20 ppm).
Fig. 27. Gene construct used to boost cannabinoid production and mitigate toxicity.
CsMYB12, predicted Cannabis sativa MYB transcription factor for enhancing flavonol biosynthesis; HSPt, efficient transcription
terminator from the Arabidopsis thaliana heat shock protein 18.2 gene; 35S, constitutive promoter from cauliflower mosaic
virus; Catalase, Arabidopsis thaliana catalase gene.
Fig. 28. Synthesis of THC and CBD from common precursor CBGA.
Fig. 29. Generation of hydrogen peroxide during cannabinoid biosynthesis.
Fig. 30. Hydroxylation followed by oxidation of THC by CYP2C9/
Fig. 31. Transfer of a glucuronic acid component to a cannabinoid substrate by UGT.
Fig. 32. Synthesis Olivetolic Acid a precursor of CBGA
Fig. 33. Amino Acid sequence comparison of exemplary Arabidopsis catalase protein
sequences.
Fig. 34. Schematic diagram of increase cannabinoid production coupled with reduced
oxidative damage system in one embodiment thereof.
Fig. 35. Part of the pPINK-αHC (A) and pPINK-HC (B) vectors showing the α-factor secretion
signal, the ADE2 gene (PpADE2) which produces phosphoribosylaminoimidazole carboxylase
in Pichia pastoris, utilized for adenine biosynthesis and the multiple cloning site (MSC) for cloning
genes of interest. All the genes were cloned in the MCS for both vectors.
Fig. 36. CBGA Glycoside Structures with Physiochemical and Constitutional Properties.
A) CBGA, B) O Acetyl Glycoside, C) 1 x Glycoside, D) 1 x Glycoside
Fig. 37. CBDA Glycoside Structures with Physiochemical and Constitutional Properties.
A) CBDA, B) 1 X Glycoside, C) 2 x Glycoside, D) O Acetyl Glycoside, E) 1 x Glycoside,
F) 2 x Glycoside, the disaccharide moiety can also be located on the opposite R-OH
of CBDA as illustrated with the single glycoside product found in panels B & E.
Fig. 38. Representative Chromatographic Elution Profile of CBDA Glycosides found in
yeast cell extracts. Chromatograms A, and B represent respective extract rated ion
chromatograms for the parent and glycoside molecules. Chromatogram C is representative
of the total ion chromatogram. Peak Intensities are illustrated as relative abundance
to most abundant peak in each respective chromatogram.
Fig. 39. Representative chromatographic elution profile of CBGA glycosides found in
yeast cell supernatants. Chromatograms A, and B represent respective extract rated
ion chromatograms for parent and glycoside molecules. Panel B also illustrates a 13C
isotope of the CBDA glycoside also found in the same analysis. Chromatogram C is representative
of the total ion chromatogram. Peak Intensities are illustrated as relative abundance
to most abundant peak in each respective chromatogram.
Fig. 40. Representative chromatographic elution profile of CBDA glycosides found in
tobacco cell extracts. Chromatograms A, B, C, and D represent respective extract rated
ion chromatograms for each glycoside product. Chromatogram E is representative of
the total ion chromatogram. Peak Intensities are illustrated as relative abundance
to most abundant peak in each respective chromatogram.
Fig. 41. Demonstration of expression of glycosyltransferases and Kat-E in Pichia pastoris.
Fig. 42. Gene construct for intracellular expression of NtGT4 in Pichia pastoris. Expression was driven by the AOX1 promoter and terminated by the cytochrome C1 (CYC1)
terminator. Other exemplary glycosyltransferases were cloned in the manner shown.
Fig. 43. Post-harvest glycosylation of CBDA in yeast. Glycosides are measured in normalized
arbitrary units (AU) based on LC-MS peak area. Asterisks show significant difference
(a greater number of asterisks means a lower P value) from the wild type at P=0.05.
(A) CBDA 1x glycosides in NtGT1, NtGT4 and NtGT5 detected in the supernatant. (B)
CBDA 1x glycosides in NtGT1, NtGT4 and NtGT5 detected in the pellet. (C) CBDA 2x glycoside
(NtGT5) in the supernatant. (D) CBDA 1x glycoside on a different position mainly detected
in NtGT5 transgenic lines in the pellet.
Fig. 44. Representative chromatographic elution profile of CBDA 1 x glycosides found
in yeast cell pellets for the intracellular expression of NtGT5. Chromatogram represents
extraction ion chromatograms of the 519.259 m/z 1 x glycoside ion. Peak Intensities
are illustrated as relative abundance to most abundant peak in each respective chromatogram.
Fig. 45. Postharvest glycosylation of CBD oil in yeast. Glycosides are measured in
normalized arbitrary units (AU) based on LC-MS peak area. Asterisks show significant
difference (a higher number of asterisks means a lower P value) from the wild type
at P=0.05. WT= wild type Pichia pastoris Strain 4, Empty vec = yeast transformed with the empty vector pPINK-HC.
Fig. 46. (A) Confirmation of transgene expression in yeast from secretion expression
constructs NtGT1, NtGT4 and UGT76G1. αHC-empty is the empty vector control. (B) CBDA
glycosides in the supernatant of yeast cultures secreting recombinant glycosyltransferases
into the media. Asterisks show significant difference from the wild type at P=0.05.
Fig. 47. Time course analysis of CBDA glycosylation in transgenic yeast. Depletion
of CBDA was quantified along with accumulation of CBDA glycosides in the supernatant
(A) and the pellet (B).
Fig. 48. Confirmation of transgene expression in BY2 cell cultures. The cell culture
line 319C overexpresses the ABC transporter (ABCG2) and the glycosyltransferase UGT76G1.
(B-F). Glycosylated CBDA compounds produced from wild type (WT) and transgenic (319C)
BY2 cells. 319C overexpresses UGT76G1 and ABCG2. Glycosylated CBDA compounds were
detected mainly in the pellet (D, E and F) and to a lesser extent in the supernatant
(B and C).
Fig. 49. Relative glycosylated cannabinoid yields for tobacco BY2 (319C) and yeast
(NtGT4 and NtGT5) cell extracts, normalized to fresh weight. Asterisks show significant
difference (a greater number of asterisks means a lower P value) from BY2 cell extracts
at P=0.05.
MODE(S) FOR CARRYING OUT THE INVENTION(S)
[0049] The present invention includes a variety of aspects, which may be combined in different
ways. The following descriptions are provided to list elements and describe some of
the embodiments of the present invention. These elements are listed with initial embodiments,
however it should be understood that they may be combined in any manner and in any
number to create additional embodiments. The variously described examples and preferred
embodiments should not be construed to limit the present invention to only the explicitly
described systems, techniques, and applications. Further, this description should
be understood to support and encompass descriptions and claims of all the various
embodiments, systems, techniques, methods, devices, and applications with any number
of the disclosed elements, with each element alone, and also with any and all various
permutations and combinations of all elements in this or any subsequent application.
[0050] The inventive technology may include systems and methods for the chemical modification
of cannabinoid compounds. In one embodiment, a suspension culture of one or more yeast
strains may be established. In one preferred embodiment, culture, and more preferably
a suspension culture of
Saccharomyces cerevisiae and/or
Pichia pastoris or other suitable yeast species may be established in a fermenter or other similar
apparatus. It should be noted that the use of the above identified example in this
embodiment is exemplary only, as various yeast strains, mixes of strains, hybrids
of different strains or clones may be used to generate a suspension culture. For example,
Pichia pastoris or any other appropriate yeast strain, including but not limited to all strains of
yeast deposited with the ATCC. (The yeast strain deposit database(s) being incorporated
by reference in its entirety.) In certain cases, such fermenters may include large
industrial-scale fermenters allowing for a large quantity of yeast cells to be grown.
In this embodiment, it may be possible to culture a large quantity of cells from a
single-strain of, for example,
P. pastoris or
K. marxianus, which may establish a cell culture having a consistent rate of cannabinoid modification.
Such cultured growth may be continuously sustained with the continual addition of
nutrient and other growth factors being added to the culture. Such features may be
automated or accomplished manually.
[0051] As noted above, cannabinoid producing strains of
Cannabis, as well as other plants may be utilized with the inventive technology. In certain
preferred embodiments,
Cannabis plant material may be harvested and undergo cannabinoid extraction through one or
more of the methods generally described above. These extracted cannabinoids may be
introduced into a genetically modified yeast suspension cell culture to be further
modified as described below.
[0052] As noted above, accumulation of high-levels of cannabinoids may be toxic for the
yeast cell. As such, the inventive technology may transiently modify the cannabinoids
produced in the yeast cell culture
in vivo. In one preferred embodiment, cytochrome P450's (CYP) monooxygenases may be utilized
to transiently modify or functionalize the chemical structure of the cannabinoids
to produce water-soluble forms. CYPs constitute a major enzyme family capable of catalyzing
the oxidative biotransformation of many pharmacologically active chemical compounds
and other lipophilic xenobiotics. For example, the most common reaction catalyzed
by cytochromes P450 is a monooxygenase reaction, e.g., insertion of one atom of oxygen
into the aliphatic position of an organic substrate (RH) while the other oxygen atom
is reduced to water:
RH + O
2 + NADPH + H
+ → ROH + H
2O + NADP
+
[0053] Several cannabinoids, including THC, have been shown to serve as a substrate for
human CYPs (CYP2C9 and CYP3A4). Similarly, CYPs have been identified that metabolize
cannabidiol (CYPs 2C19, 3A4); cannabinol (CYPs 2C9, 3A4); JWH-018 (CYPs 1A2, 2C9);
and AM2201 (CYPs 1A2, 2C9). For example, as shown generally below, in one exemplary
system, CYP2C9 may hydroxylate a THC molecule resulting in a hydroxyl form of THC.
Further oxidation of the hydroxyl form of THC by CYP2C9 may convert it into a carboxylic
acid form, which loses its psychoactive capabilities rendering it an inactive metabolite.
[0054] In one embodiment, yeast cells may be transformed with artificially created genetic
constructs encoding one or more CYPs. In one preferred embodiment, genes encoding
one or more non-human isoforms and/or analogs, as well as possibly other CYPs that
may functionalize cannabinoids may be expressed in transgenic yeast grown in a suspension
culture. Additional embodiments may include genetic control elements such as promotors
and/or enhancers as well as post-transcriptional regulatory elements that may also
be expressed in transgenic yeast such that the presence, quantity and activity of
any CYPs present in the suspension culture may be modified and/or calibrated.
[0055] In this preferred embodiment, NADPH-cytochrome P450 oxidoreductase (CPR) may be used
to assist in the activity/function of one or more of the CYPs expressed within a genetically
modified yeast cell. In this embodiment, CPR may serve as an electron donor to eukaryotic
CYPs facilitating their enzymatic function within the transgenic yeast strain(s) described
above. In one preferred embodiment, genes encoding CPR, or one or more non-human isoforms
and/or analogs of CPR that may act as an electron donor to CYPs may be expressed in
transgenic yeast grown in a suspension culture. Additional embodiments may include
genetic control elements such as promotors and/or enhancers as well as post-transcriptional
regulatory elements that may also be expressed in transgenic yeast such that the presence,
quantity and activity of CPR present in the suspension culture may be modified and/or
calibrated. For example, downregulation of the expression of CPR may decrease or stop
the functionalization of cannabinoids by preventing the enzymatic action of the CYPs
in the yeast cell.
[0056] Additional steps may be taken to further modify the functionalized cannabinoids.
In a preferred embodiment, glycosylation of functionalized cannabinoids may covert
to them into a water-soluble form. In an exemplary embodiment shown below, the inventive
technology may utilize one or more UDP-glucuronosyltransferases (UGT) to catalyze
the glucuronosylation or glucuronidation of both primary (CBD, CBN) and secondary
cannabinoids (THC, JWH-018, JWH-073). In this embodiment, glucuronidation may consist
of the transfer of a glucuronic acid component of uridine diphosphate glucuronic acid
to a cannabinoid substrate by any of several types of UGTs as described above. Glucuronic
acid is a sugar acid derived from glucose, with its sixth carbon atom oxidized to
a carboxylic acid.
[0057] The conversion of a functionalized cannabinoid, in this example a carboxylic acid
form of THC, to a glycosylated form of THC may generate a transiently modified cannabinoid
that may be both soluble, and non-toxic to the cells in a suspension culture. These
chemical modifications may allow for greater levels of cannabinoid accumulation within
a yeast cell and/or in the surrounding cell culture media without the deleterious
cytotoxic effects that may be seen with unmodified cannabinoids.
[0058] The inventive technology may include the generation of transgenic yeast strains having
artificial genetic constructs that that may express one or more glycosyltransferases,
or other enzymes capable of glycosylating functionalized cannabinoid compounds. In
one preferred embodiment, artificial genetic constructs having genes encoding one
or more UDP- and/or ADP-glycosyltransferases, including non-human analogues of those
described above, as well as other isoforms, may be expressed in transgenic yeast cells
and grown in suspension or other cell cultures. Additional embodiments may include
genetic control elements such as promotors and/or enhancers as well as post-transcriptional
regulatory control elements that may also be expressed in a transgenic yeast strain
such that the presence, quantity and activity of any glycosyltransferases present
in the suspension culture may be regulated. Additional embodiments may include artificial
genetic constructs having one or more genes encoding one or more UDP- and/or ADP-glycosyltransferases
having tags that may assist in the movement of the gene product to a certain portion
of the cell, such as the cellular locations were cannabinoids and/or functionalized
cannabinoids may be stored, and/or excreted from the cell.
[0059] In one embodiment of the inventive technology, the water-soluble, glycosylated cannabinoids,
generally being referred to as transiently modified cannabinoids, may be transported
into and harvested from the yeast cell culture media. In one embodiment, transiently
modified cannabinoids may accumulate within the yeast cell itself. In this example,
the yeast cell culture may be allowed to grow to a desired level of cell or optical
density, or in other instances until a desired level of transiently modified cannabinoids
have accumulated in the cultured cells and/or media. All, or a portion of the yeast
cells containing the accumulated transiently modified cannabinoids may then be harvested
from the culture and/or media, which in a preferred embodiment may be an industrial-scale
fermenter or other apparatus suitable for the large-scale culturing of yeast or other
microorganisms. The harvested yeast cells may be lysed such that the accumulated transiently
modified cannabinoids may be released to the surrounding lysate. Additional steps
may include treating this lysate. Examples of such treatment may include filtering,
centrifugation or screening to remove extraneous cellular material as well as chemical
treatments to improve later cannabinoid yields.
[0060] The transiently modified cannabinoids may be further isolated and purified. In one
preferred embodiment, the yeast lysate may be processed utilizing affinity chromatography
or other purification methods. In this preferred embodiment, an affinity column having
a ligand configured to bind with one or more of the transiently modified cannabinoids,
for example, through association with the glucuronic acid functional group, among
others, may be immobilized or coupled to a solid support. The lysate may then be passed
over the column such that the transiently modified cannabinoids, having specific binding
affinity to the ligand become bound and immobilized. In some embodiments, non-binding
and non-specific binding proteins that may have been present in the lysate may be
removed. Finally, the transiently modified cannabinoids may be eluted or displaced
from the affinity column by, for example, a corresponding sugar or other compound
that may displace or disrupt the cannabinoid-ligand bond. The eluted transiently modified
cannabinoids may be collected and further purified or processed.
[0061] In yet another separate embodiment, the now soluble transiently modified cannabinoids
may be passively and/or actively excreted from the cell. In one exemplary model, an
ATP-binding cassette transporter (ABC transporters) or other similar molecular structure
may recognize the glucuronic acid functional group (conjugate) on the transiently
modified cannabinoid and actively transport it into the surrounding media. In this
embodiment, a yeast cell culture may be allowed to grow until an output parameter
is reached. In one example, an output parameter may include allowing the yeast cell
culture to grow until a desired cell/optical density is reached, or a desired level
of transiently modified cannabinoids is reached. In this embodiment, the culture media
containing the transiently modified cannabinoid may be harvested for later cannabinoid
extraction. In some embodiments, this harvested media may be treated in a manner similar
to the lysate generally described above. Additionally, the transiently modified cannabinoids
present in the raw and/or treated media may be isolated and purified, for example,
through affinity chromatography in a manner similar to that described above.
[0062] In certain embodiments, this purified cannabinoid isolate may contain a mixture of
primary and secondary glycosylated cannabinoids. As noted above, such purified glycosylated
cannabinoids may be water-soluble and metabolized slower than unmodified cannabinoids
providing a slow-release capability that may be desirable in certain pharmaceutical
applications, such as for use in tissue-specific applications or as a prodrug. In
this embodiment, purified glycosylated cannabinoids may be incorporated into a variety
of pharmaceutical and/or nutraceutical applications. For example, the purified glycosylated
cannabinoids may be incorporated into various solid and/or liquid delivery vectors
for use in pharmaceutical applications. As noted above, absent modification, these
transiently modified cannabinoids no longer possess their psychoactive component,
making their application in research, therapeutic and pharmaceutical applications
especially advantageous. Additional therapeutic applications may include the administration
of a therapeutic dose of an "entourage" of isolated and purified transiently modified
cannabinoids.
[0063] The inventive technology may also include a system to convert or reconstitute transiently
modified cannabinoids. In one preferred embodiment, glycosylated cannabinoids may
be converted into non-glycosylated cannabinoids through their treatment with one or
more generalized or specific glycosidases. In this embodiment, these glycosidase enzymes
may remove a sugar moiety. Specifically, these glycosidases may remove the glucuronic
acid moiety reconstituting the cannabinoid compound to a form exhibiting psychoactive
activity. This reconstitution process may generate a highly purified "entourage" of
primary and secondary cannabinoids. These reconstituted cannabinoid compounds may
also be incorporated into various solid and/or liquid delivery vectors for use in
a variety of pharmaceutical and other commercial applications. In certain embodiments,
transiently modified cannabinoids may be reconstituted through incubation with one
or more generalized or specific glycosidases in an
in vitro system.
[0064] As noted above, cannabinoid producing strains of
Cannabis, as well as other plants may be utilized with the inventive technology. In certain
preferred embodiments,
Cannabis plant material may be harvested and undergo cannabinoid extraction. These traditionally
extracted cannabinoids may then be modified from their native forms through the
in vitro application of one or more CYP's that may generate hydroxyl and carboxylic acid forms
of these cannabinoids respectively. These functionalized cannabinoids may be further
modified through the
in vitro application of one or more UGTs as generally described below. In this embodiment,
the new transiently modified cannabinoids may be isolated and purified through a process
of affinity chromatography and then applied to various commercial and other therapeutic
uses. In other embodiments, the transiently modified cannabinoids may be restored
and reconstituted through the
in vitro application of one or more glycosidase enzymes. These restored cannabinoids may also
be applied to various commercial and other therapeutic uses.
[0065] The inventive technology includes systems and methods for high-level production of
cannabinoid compounds in cell culture systems. As used herein, the term "high level"
in this instance may mean higher than wild-type biosynthesis or accumulation of one
or more cannabinoids in a yeast or plant cell culture. In one embodiment, a suspension
or hairy root or cell suspension culture of one or more plant strains may be established.
In one preferred embodiment, a suspension or hairy root or cell suspension culture
of a tobacco plant may be established. It should be noted that the term strain may
refer to a plant strain, as well as a cell culture, or cell line derived from a plant,
such as
tobacco. In another preferred embodiment, a suspension or hairy root or cell suspension culture
of one or more yeast strains may be established.
[0066] Another embodiment of the inventive technology may include systems and methods for
high level production of modified cannabinoid compounds. In one embodiment, a suspension
or hairy root culture of one or more tobacco plant strains may be established. It
should be noted that the term strain may refer to a plant strain, as well as a cell
culture, or cell line derived from a tobacco plant. In one preferred embodiment, a
suspension or hairy root culture of
BY2 tobacco cells may be established in a fermenter or other similar apparatus. In an alternative embodiment,
a suspension or hairy root culture of
Nicotiana tabacum and/
or Nicotiana benthamiana plant may be established in a fermenter or other similar apparatus. It should be
noted that the use of N.
tabacum and N. benthamiana in these embodiments is exemplary only. For example, in certain other embodiments,
various
Nicotiana strains, mixes of strains, hybrids of different strains or clones, as well as different
varieties may be used to generate a cell suspension or hairy root culture.
[0067] In certain cases, such fermenters may include large industrial-scale fermenters allowing
for a large quantity of
tobacco cells to be cultured. In this embodiment, harvested cannabinoids may be introduced
to this suspension culture, and modified as generally described herein. Similarly,
such cultured growth of tobacco cells may be continuously sustained with the continual
addition of nutrient and other growth factors being added to the culture. Such features
may be automated or accomplished manually.
[0068] Another embodiment of the invention may include the production of genetically modified
yeast and/or tobacco cells to express varying exogenous and/or endogenous genes that
may modify the chemical structure of cannabinoid compounds. Such transgenic strains
may be configured to produce and/or modify large quantities of cannabinoid compounds
generally, as well as targeted increases in the production of specific cannabinoids
such as THC, Cannabidiol (CBD) or Cannabinol (CBN) and the like.
[0069] Additional embodiments of the inventive technology may include novel systems, methods
and compositions for the production and
in vivo modification of cannabinoid compounds in a plant and/or yeast suspension culture
system. In certain embodiments, these
in vivo modifications may lead to the production of different forms of cannabinoids with
special properties, e.g. water-soluble, slow-release cannabinoids or prodrugs. In
one preferred embodiment, the inventive technology may include novel systems, methods
and compositions for the hydroxylation, acetylation and/or glycosylation. Modified
cannabinoids can be made water-soluble, for example by glycosylation.
[0070] As noted above, production and/or accumulation of high-levels of cannabinoids would
be toxic for a plant cell host. As such, one embodiment of the inventive technology
may include systems and methods to transiently modify cannabinoids
in vivo. One aim of the current invention may include the use of cytochrome P450's (CYP) monooxygenases
to transiently modify or functionalize the chemical structure of the cannabinoids.
CYPs constitute a major enzyme family capable of catalyzing the oxidative biotransformation
of many pharmacologically active chemical compounds and other lipophilic xenobiotics.
For example, as shown in Fig. 13, the most common reaction catalyzed by cytochromes
P450 is a monooxygenase reaction, e.g., insertion of one atom of oxygen into the aliphatic
position of an organic substrate (RH) while the other oxygen atom is reduced to water.
[0071] Several cannabinoids, including THC, have been shown to serve as a substrate for
human CYPs (CYP2C9 and CYP3A4). Similarly, CYPs have been identified that metabolize
cannabidiol (CYPs 2C19, 3A4); cannabinol (CYPs 2C9, 3A4); JWH-018 (CYPs 1A2, 2C9);
and AM2201 (CYPs 1A2, 2C9). For example, as shown generally in Fig. 30, in one exemplary
system, CYP2C9 may "functionalize" or hydroxylate a THC molecule resulting in a hydroxyl-form
of THC. Further oxidation of the hydroxyl form of THC by CYP2C9 may convert it into
a carboxylic-acid form which loses its psychoactive capabilities, rendering it an
inactive metabolite.
[0072] As such, another embodiment of the invention may include the creation of a
yeast or plant cell culture that may be transformed with artificially created genetic constructs
encoding one or more exogenous CYPs. In one preferred embodiment, genes encoding one
or more non-human isoforms and/or analogs, as well as possibly other CYPs that may
functionalize cannabinoids, may be expressed in transgenic yeast or tobacco cells.
In another preferred embodiment, genes encoding one or more non-human isoforms and/or
analogs, as well as possibly other CYPs that may functionalize cannabinoids, may be
expressed in transgenic yeast tobacco strains grown in a suspension culture. Additional
embodiments may include genetic control elements such as promotors and/or enhancers
as well as post-transcriptional regulatory elements that may also be expressed such
that the presence, quantity and activity of any CYPs present in the suspension culture
may be modified and/or calibrated.
[0073] Another embodiment of the invention may include the creation of a tobacco or yeast
cells may be transformed with artificially created genetic constructs encoding one
or more exogenous CYPs. In one preferred embodiment, genes encoding one or more non-human
isoforms and/or analogs, as well as possibly other CYPs that may functionalize cannabinoids
introduced to a transgenic tobacco cell and/or yeast suspension culture..
[0074] Another aim of the invention may be to further modify,
in vivo, cannabinoids and/or already functionalized cannabinoids. In a preferred embodiment,
glycosylation of cannabinoids and/or functionalized cannabinoids may covert to them
into a water-soluble form. In an exemplary embodiment shown in Fig. 31, the inventive
technology may utilize one or more glycosyltransferase enzymes, such as UDP-glycosyltransferase
(UGT), to catalyze,
in vivo the glucuronosylation or glucuronidation of cannabinoids, such as primary (CBD, CBN)
and secondary cannabinoids (THC, JWH-018, JWH-073). In this embodiment, glucuronidation
may consist of the transfer of a glucuronic acid component of uridine diphosphate
glucuronic acid to a cannabinoid substrate by any of several types of glycosyltransferases
as described herein. Glucuronic acid is a sugar acid derived from glucose, with its
sixth carbon atom oxidized to a carboxylic acid.
[0075] Yet another embodiment of the current invention may include the
in vivo conversion of a functionalized cannabinoid, in this example a carboxylic acid form
of the cannabinoid, to a glycosylated form of cannabinoid that may be both water-soluble
and non-toxic to the cell host. These chemical modifications may allow for greater
levels of cannabinoid accumulation in a plant or yeast cell culture without the deleterious
cytotoxic effects that would be seen with unmodified cannabinoids due to this water-solubility.
[0076] Another embodiment of the invention may include the generation of transgenic or genetically
modified strains/cells of yeast and/or tobacco, having artificial genetic constructs
that may express one or more genes that may increase cannabinoids solubility and/or
decrease cannabinoid cytotoxicity. For example, the inventive technology may include
the generation of transgenic plant and/or yeast cell lines having artificial genetic
constructs that may express one or more endogenous/or exogenous glycosyltransferases
or other enzymes capable of glycosylating cannabinoid compounds. For example, in one
embodiment one or more exogenous glycosyltransferases from tobacco or other non-cannabis
plants may be introduced into a cannabis plant or cell culture and configured to glycosylate
cannabinoids
in vivo.
[0077] In an additional embodiment, of the inventive technology may include the generation
of artificial genetic constructs having genes encoding one or more glycosyltransferases,
including non-human analogues of those described herein as well as other isoforms,
that may further may be expressed in transgenic plant and/or yeast cells which may
further be grown in a suspension culture. Additional embodiments may include genetic
control elements such as promotors and/or enhancers as well as post-transcriptional
regulatory control elements that may also be expressed in such transgenic cell systems
such that the presence, quantity and activity of any glycosyltransferases present
in the suspension culture may be regulated.
[0078] An additional embodiment of the invention may include artificial genetic constructs
having one or more genes encoding one or more UDP- and/or ADP-glycosyltransferases
having localization sequences or domains that may assist in the movement of the protein
to a certain portion of the cell, such as the cellular locations were cannabinoids
and/or functionalized cannabinoids may be modified, produced, stored, and/or excreted
from the cell.
[0079] An additional embodiment of the invention may include artificial genetic constructs
having one or more genes encoding one or more UDP- and/or ADP-glycosyltransferases
being co-expressed with one or more exogenous genes that may assist in the movement
of the protein to a certain portion of the cell, such as the cellular locations were
cannabinoids and/or functionalized cannabinoids may be stored, and/or excreted from
the cell.
[0080] One preferred embodiment of the inventive technology may include the high level
in vivo production of water-soluble, glycosylated cannabinoids, generally being referred
to as transiently modified cannabinoids that may be harvested from a plant and/or
yeast cell culture. In one embodiment, transiently modified cannabinoids may accumulate
within the cell that is part of a suspension culture. In this example, the cell culture
may be allowed to grow to a desired level of cell or optical density, or in other
instances until a desired level of transiently modified cannabinoids have accumulated
in the cultured plant or yeast cells. Such exogenous genes may be localized, for example
to the cytosol as generally described herein, and may further be co-expressed with
other exogenous genes that may reduce cannabinoid biosynthesis toxicity and/or facilitate
cannabinoid transport through, or out of the cell.
[0081] All or a portion of the cultured plant and/or yeast cells containing the accumulated
transiently modified cannabinoids may then be harvested from the culture, which in
a preferred embodiment may be an industrial-scale fermenter or other apparatus suitable
for the large-scale culturing of plant cells. The harvested
Cannabis cells may be lysed such that the accumulated transiently modified cannabinoids may
be released to the surrounding lysate. Additional steps may include treating this
lysate. Examples of such treatment may include filtering or screening this lysate
to remove extraneous plant material as well as chemical treatments to improve later
cannabinoid yields.
[0082] Another embodiment of inventive technology may include the high level
in vivo generation of water-soluble, glycosylated cannabinoids, generally being referred
to as transiently modified cannabinoids that may be harvested from a plant and/or
yeast cell culture. In one embodiment, cannabinoids may be introduced to a non-cannabinoid
producing plant and/or yeast cell culture, such as BY2 tobacco cells. In this preferred
embodiment, the non-cannabinoid producing cell culture may be genetically modified
to express one or more endogenous or exogenous genes that may modify the cannabinoids,
for example through hydroxylation, acetylation and/or glycosylation. Such endogenous
or exogenous genes may be localized, as generally described herein, and may further
be co-expressed with other exogenous genes that may reduce cannabinoid biosynthesis
toxicity and/or facilitate cannabinoid transport through, or out of the cell into
a surrounding media.
[0083] This non-cannabinoid producing the cell culture may be allowed to grow to a desired
level of cell or optical density, or in other instances until a desired level of transiently
modified cannabinoids have accumulated in the cultured cells. In one embodiment, all
or a portion of the BY2 and/or yeast cells containing the accumulated cannabinoids
may then be harvested from the culture, which in a preferred embodiment may be an
industrial-scale fermenter or other apparatus suitable for the large-scale culturing
of cells. The harvested cells may be lysed such that the accumulated transiently modified
cannabinoids may be released to the surrounding lysate. Additional steps may include
treating this lysate. Examples of such treatment may include filtering or screening
this lysate to remove extraneous material as well as chemical treatments to improve
later cannabinoid yields.
[0084] Another embodiment of the inventive technology may include methods to isolate and
purified transiently modified cannabinoids from a plant or suspension culture. In
one preferred embodiment, a plant and/or yeast cell culture lysate may be generated
and processed utilizing affinity chromatography or other purification methods. In
this preferred embodiment, an affinity column having a ligand or protein receptor
configured to bind with the transiently modified cannabinoids, for example through
association with a glycosyl or glucuronic acid functional group among others, may
be immobilized or coupled to a solid support. The lysate may then be passed over the
column such that the transiently modified cannabinoids, having specific binding affinity
to the ligand become bound and immobilized. In some embodiments, non-binding and non-specific
binding proteins that may have been present in the lysate may be removed. Finally,
the transiently modified cannabinoids may be eluted or displaced from the affinity
column by, for example, a corresponding sugar or other compound that may displace
or disrupt the cannabinoid-ligand bond. The eluted transiently modified cannabinoids
may be collected and further purified or processed.
[0085] One embodiment of the invention may include the generation of transiently modified
cannabinoids that may be passively and/or actively excreted from a cultured plant
and/or yeast cell. In one exemplary model, an exogenous ATP-binding cassette transporter
(ABC transporters) or other similar molecular structure may recognize the glycosyl
or glucuronic acid functional group (conjugate) on the transiently modified cannabinoid
and actively transport it across the cell wall/membrane and into the surrounding media.
In this embodiment, the cell culture may be allowed to grow until an output parameter
is reached. In one example, an output parameter may include allowing the cell culture
to grow until a desired cell/optical density is reach, or a desired concentration
of transiently modified cannabinoid is reached. In this embodiment, the culture media
containing the transiently modified cannabinoids may be harvested for later cannabinoid
extraction. In some embodiments, this harvested media may be treated in a manner similar
to the lysate generally described above. Additionally, the transiently modified cannabinoids
present in the raw and/or treated media may be isolated and purified, for example,
through affinity chromatography in a manner similar to that described above.
[0086] In certain embodiments, this purified cannabinoid isolate may contain a mixture of
primary and secondary glycosylated cannabinoids. As noted above, such purified glycosylated
cannabinoids may be water-soluble and metabolized slower than unmodified cannabinoids
providing a slow-release capability that may be desirable in certain pharmaceutical
applications, such as for use in tissue-specific applications, or as a prodrug. As
such, in one embodiment of the invention, isolated glycosylated cannabinoids may be
incorporated into a variety of pharmaceutical and/or nutraceutical applications as
well as other compositions of matter outline herein.
[0087] For example, the purified glycosylated cannabinoids may be incorporated into various
solid and/or liquid delivery vectors for use in pharmaceutical applications. As noted
above, these transiently modified cannabinoids may no longer possess their psychoactive
component, making their application in research, therapeutic and pharmaceutical applications
especially advantageous. For example, the treatment of children may be accomplished
through administration of a therapeutic dose of isolated and purified transiently
modified cannabinoids, without the undesired psychoactive effect. Additional therapeutic
applications may include the harvesting and later administration of a therapeutic
dose of an "entourage" of isolated and purified transiently modified cannabinoids.
[0088] Another embodiment of the invention may include a system to convert or reconstitute
transiently modified cannabinoids. In one preferred embodiment, glycosylated cannabinoids
may be converted into non-glycosylated cannabinoids through their treatment with one
or more generalized or specific glycosidases. The use and availability of glycosidase
enzymes would be recognized by those in the art without requiring undue experimentation.
In this embodiment, these glycosidase enzymes may remove a sugar moiety. Specifically,
these glycosidases may remove the glycosyl or glucuronic acid moiety reconstituting
the cannabinoid compound to a form exhibiting psychoactive activity. This reconstitution
process may generate a highly purified "entourage" of primary and secondary cannabinoids.
These reconstituted cannabinoid compounds may also be incorporated into various solid
and/or liquid delivery vectors for use in a variety of pharmaceutical and other commercial
applications.
[0089] As noted above, in one embodiment of the invention, cannabinoid producing strains
of
Cannabis, as well as other plants may be utilized with the inventive technology. In certain
preferred embodiments,
in lieu of growing the target cannabinoid producing plant in a cell culture, the raw plant
material may be harvested and undergo cannabinoid extraction utilizing one or more
of the methods described herein. These traditionally extracted cannabinoids may then
be modified from their native forms through the
in vitro application of one or more CYP's that may generate hydroxyl and carboxylic acid forms
of these cannabinoids respectively. These functionalized cannabinoids may be further
modified through the
in vitro application of one or more glycosyltransferases as generally described herein. In
this embodiment, the new transiently modified cannabinoids may be isolated and purified
through a process of affinity chromatography, or other extraction protocol, and then
applied to various commercial and other therapeutic uses. In other embodiments, the
transiently modified cannabinoids may be restored and reconstituted through the
in vitro application of one or more glycosidase enzymes. These restored cannabinoids may also
be applied to various commercial and other therapeutic uses.
[0090] Another embodiment of the invention may include the use of other non-cannabinoid
producing plants
in lieu of growing a cannabinoid producing plant in a cell culture. Here, cannabinoid may
be introduced to genetically modified plants, or plant cell cultures that express
one or more CYP's that may generate hydroxyl and carboxylic acid forms of these cannabinoids
respectively. These functionalized cannabinoids may be further modified through the
action of one or more glycosidases that may also be expressed in the non-cannabinoid
producing plant or cell culture. In one preferred embodiment, a non-cannabinoid producing
cell culture may include tobacco plant or tobacco cell cultures. Additional embodiments
may similarly use genetically modified yeast cells grown in culture to generate biomodified
cannabinoid compounds.
[0091] One embodiment of the invention may include an
in vivo method of trichome-targeted cannabinoid accumulation and modification. One preferred
embodiment of this
in vivo system may include the creation of a recombinant protein that may allow the translocation
of a CYP or glycosyltransferases to a site of extracellular cannabinoid synthesis
in a whole plant. More specifically, in this preferred embodiment, one or more CYPs
or glycosyltransferases may either be engineered to express all or part of the N-terminal
extracellular targeting sequence as present in cannabinoid synthase protein, such
as THCA synthase or CBDA synthase.
[0092] One another embodiment of the invention may include an
in vivo method of high-level trichome-targeted cannabinoid biosynthesis, accumulation and/or
modification. One preferred embodiment of this
in vivo system may include the creation of a recombinant protein that may allow the translocation
of a catalase to a site of extracellular cannabinoid synthesis in a whole plant. More
specifically, in this preferred embodiment, one or more catalase enzymes may either
be engineered to express all or part of the N-terminal extracellular targeting sequence
as present in cannabinoid synthase protein, such as THCA synthase or CBDA synthase.
In this embodiment, the catalase may be targeted to the site of cannabinoid biosynthesis
allowing it to more efficiently neutralize hydrogen peroxide byproducts.
[0093] Another aim of the current invention may include the introduction of one or more
compounds to facilitate the chemical decomposition of hydrogen peroxide resulting
from cannabinoids biosynthesis. In one embodiment, one or more chemicals, metal ions,
and/or catalysts may be introduced into a growth media to detoxify hydrogen peroxide
(H
2O
2) in both yeast and plant cell cultures. Examples may include magnesium dioxide (MnO
2), permanganate ionMnO
4, and silver ion (Ag
+), iron oxide, (Fe
2O
3), lead dioxide (PbO
2), cupric oxide (CuO), Hafnium(IV) oxide (HfO
2), ceric dioxide (CeO
2), Gadolinium trioxide (Gd
2O
3), Sodium Phosphate, Tribasic (NaPO
4), iodide ions, manganese metal, iron(III) Chloride Solution(FeCl
3). Such chemicals, ions, and/or catalyst may be added directly, or in solution to
a cell culture. The amount may be dependent on the amount of hydrogen peroxide present
which may be determined through a variety of established assays. As such, determinations
of the optimal amounts are within the skill of those in the art.
[0094] In this preferred embodiment, this N-terminal trichome targeting sequence or domain
may generally include the first 28 amino acid residues of a generalized synthase.
An exemplary trichome targeting sequence for THCA synthase is identified SEQ ID NO.
40, while trichome targeting sequence for CBDA synthase is identified SEQ ID NO. 41.
This extracellular targeting sequence may be recognized by the plant cell and cause
the transport of the glycosyltransferase from the cytoplasm to the plant's trichrome,
and in particular the storage compartment of the plant trichrome where extracellular
cannabinoid glycosylation may occur. More specifically, in this preferred embodiment,
one or more glycosyltransferases, such as UDP glycosyltransferase may either be engineered
to express all or part of the N-terminal extracellular targeting sequence as present
in an exemplary synthase enzyme.
[0095] Another embodiment of the invention may include an
in vivo method of cytosolic-targeted cannabinoid production, accumulation and/or modification.
One preferred embodiment of this
in vivo system may include the creation of a recombinant protein that may allow the localization
of cannabinoid synthases and/or glycosyltransferases to the cytosol.
[0096] More specifically, in this preferred embodiment, one or more cannabinoid synthases
may be modified to remove all or part of the N-terminal extracellular targeting sequence.
An exemplary trichome targeting sequence for THCA synthase is identified SEQ ID NO.
40, while trichome targeting sequence for CBDA synthase is identified SEQ ID NO. 41.
Co-expression with this cytosolic-targeted synthase with a cytosolic-targeted CYP
or glycosyltransferase, may allow the localization of cannabinoid synthesis, accumulation
and modification to the cytosol. Such cytosolic target enzymes may be co-expressed
with catalase, ABC transporter or other genes that may reduce cannabinoid biosynthesis
toxicity and or facilitate transport through or out of the cell.
[0097] Another embodiment of the invention may include the generation of an expression vector
comprising this polynucleotide, namely a cannabinoid synthase N-terminal extracellular
targeting sequence and glycosyltransferase genes, operably linked to a promoter. A
genetically altered plant or parts thereof and its progeny comprising this polynucleotide
operably linked to a promoter, wherein said plant or parts thereof and its progeny
produce said chimeric protein, is yet another embodiment. For example, seeds and pollen
contain this polynucleotide sequence or a homologue thereof, a genetically altered
plant cell comprising this polynucleotide operably linked to a promoter such that
said plant cell produces said chimeric protein. Another embodiment comprises a tissue
culture comprising a plurality of the genetically altered plant cells.
[0098] Another embodiment of the invention provides for a genetically altered plant or cell
expressing a chimeric or fusion protein having a cannabinoid synthase N-terminal extracellular
targeting sequence (see i.e., SEQ ID: 40-41; see also SEQ ID NO. 42 for full amino
acid sequence of THCA synthase) coupled with a UDP glycosyltransferase genes, operably
linked to a promoter. Another embodiment provides a method for constructing a genetically
altered plant or part thereof having glycosylation of cannabinoids in the extracellular
storage compartment of the plant's trichrome compared to a non-genetically altered
plant or part thereof, the method comprising the steps of: introducing a polynucleotide
encoding the above protein into a plant or part thereof to provide a genetically altered
plant or part thereof, wherein said chimeric protein comprising a first domain, a
second domain, and wherein said first domain comprises a cannabinoid synthase N-terminal
extracellular targeting sequence, and a second domain comprises a glycosyltransferase
sequence. These domains may be separated by a third domain or linker. This linker
may be any nucleotide sequence that may separate a first domain from a second domain
such that the first domain and the second domain can each fold into its appropriate
three-dimensional shape and retain its activity.
[0099] One preferred embodiment of the invention may include a genetically altered plant
or cell expressing a cytosolic-targeted cannabinoid synthase protein having a cannabinoid
synthase N-terminal extracellular targeting sequence (SEQ IDs. 40-41) inactivated
or removed. In one embodiment, a cytosolic targeted THCA synthase (ctTHCAs) may be
identified as SEQ ID NO. 46, while in another embodiment cytosolic targeted CBDA synthase
(cytCBDAs) is identified as SEQ ID NO. 22-23). Such cytosolic-targeted cannabinoid
synthase protein may be operably linked to a promoter. Another embodiment provides
a method for constructing a genetically altered plant or part thereof having glycosylation
of cannabinoids in the plant's cytosol compared to a non-genetically altered plant
or part thereof, the method comprising the steps of: introducing a polynucleotide
encoding the above protein into a plant or part thereof to provide a genetically altered
plant or part thereof, wherein said a cannabinoid synthase N-terminal extracellular
targeting sequence has been disrupted or removed.
[0100] Yet another embodiment of the invention may include an
in vivo method of cannabinoid glycosylation in a
cannabis cell culture. In one preferred embodiment, to facilitate glycosylation of cannabinoids
in
cannabis cell culture, which would lack an extracellular trichrome structure, a cannabinoid
synthase gene may be genetically modified to remove or disrupt, for example through
a directed mutation, the extra-cellular N-terminal targeting domain which may then
be used to transform a
Cannabis plant cell in a cell culture. In this embodiment, without this targeting domain the
cannabinoid synthase, for example THCA or CBDA synthases, may remain within the plant
cell, as opposed to being actively transported out of the cell, where it may be expressed
with one or more glycosyltransferases, such as UDP glycosyltransferase in the cytoplasm.
[0101] Another embodiment of the inventive technology may include systems and methods for
enhanced production and/or accumulation of cannabinoid compounds in an
in vivo system. In one preferred embodiment, the invention may include the generation of
a genetically modified or transgenic
Cannabis plant that may produce and/or accumulate one or more cannabinoids at higher than
wild-type levels. In one embodiment, a transgenic
Cannabis plant may be generated to express one or more
Cannabis sativa transcription factors that may enhance the cannabinoid metabolic pathway(s). In one
preferred embodiment, a polynucleotide may be generated that encodes for one or more
Cannabis sativa myb transcription factors genes, and/or one or more exogenous ortholog genes that
enhance the metabolite flux through the cannabinoid biosynthetic pathway.
[0102] In this preferred embodiment, a polynucleotide may be generated that encodes for
one or more
Cannabis sativa myb transcription factors genes, such as CAN833 and/or CAN738 that. As shown in Fig.
32, these transcriptions factors may drive the production of olivetolic acid, which
is a precursor of CBGA, which in turn is a precursor in the biosynthetic pathway of
THCs, CBDs and CBC. In an alternative embodiment, a polynucleotide may be generated
that encodes for one or more
Cannabis sativa myb transcription factors genes orthologs, specifically
cannabis Myb12 (SEQ IDs. 11-12), Myb8 (SEQ ID NO. 43), AtMyb12 (SEQ ID NO.44), and/or MYB112
(SEQ ID NO. 45) that may also drive the production of olivetolic acid, which is a
precursor of CBGA, which in turn is a precursor in the biosynthetic pathway of THCs,
CBDs and CBC.
[0103] In one preferred embodiment, the invention may include methods of generating a polynucleotide
that expresses one or more of the SEQ IDs related to enhanced cannabinoid production
identified herein. In certain preferred embodiments, the proteins of the invention
may be expressed using any of a number of systems, such as in whole plants, as well
as plant cell and/or yeast suspension cultures. Typically, the polynucleotide that
encodes the protein or component thereof is placed under the control of a promoter
that is functional in the desired host cell. An extremely wide variety of promoters
may be available and can be used in the expression vectors of the invention, depending
on the particular application. Ordinarily, the promoter selected depends upon the
cell in which the promoter is to be active. Other expression control sequences such
as ribosome binding sites, transcription termination sites and the like are also optionally
included. Constructs that include one or more of these control sequences are termed
"expression cassettes" or "constructs." Accordingly, the nucleic acids that encode
the joined polypeptides are incorporated for high level expression in a desired host
cell.
[0104] Additional embodiments of the invention may include selecting a genetically altered
plant or part thereof that expresses the cannabinoid production transcription factor
protein, wherein the expressed protein has increased cannabinoid biosynthesis capabilities.
In certain embodiments, a polynucleotide encoding the cannabinoid production transcription
factor protein is introduced via transforming said plant with an expression vector
comprising said polynucleotide operably linked to a promoter. The cannabinoid production
transcription factor protein may comprise a SEQ ID selected from the group consisting
of SEQ ID NO: 11-2 or 43-45, or a homologue thereof.
[0105] As noted above, one embodiment of the invention may include systems and methods for
general and/or localized detoxification of cannabinoid biosynthesis in an
in vivo system. In one preferred embodiment, the invention may include the generation of
a genetically modified or transgenic
Cannabis or other plant that may be configured to be capable of detoxifying hydrogen peroxide
by-products resulting from cannabinoid biosynthesis at higher than wild-type levels.
In addition, this detoxification may be configured to be localized to the cytosol
and/or trichome structure of the
Cannabis plant where cannabinoids are actively being synthesized in a whole plant system.
In this preferred embodiment of the invention, a transgenic plant, such as a
cannabis or tobacco plant or cell, that express one or more genes that may up-regulate hydrogen
peroxide detoxification. In an alternative embodiment, the invention may include the
generation of a genetically modified plant cell and/or yeast cell suspension cultures
that may be configured to be capable of expressing an exogenous catalase, or over
expressing an endogenous catalase or both. In this example, the catalase expressed
in the plant and/or yeast cell culture may act to detoxify hydrogen peroxide by-products
resulting from cannabinoid biosynthesis at higher than wild-type levels. In some embodiment,
the catalase expressed in a plant, and/or plant cell or yeast cell culture may be
heterologous or exogenous, while in other embodiments, it may be an endogenous catalase
that may be operably linked to a promoter to allow constitutive, inducible, and/or
overexpression.
[0106] In one preferred embodiment, a polynucleotide may be generated that encodes for one
or more endogenous and/or exogenous transcription catalase genes, and/or orthologs
that catalyze the reduction of hydrogen peroxide:

[0107] As such, in one embodiment, the invention comprises the generation of a polynucleotide
encoding an exogenous catalase protein that may be expressed within a transformed
plant and/or cell culture. In a preferred embodiment, a catalase enzyme configured
reduce hydrogen peroxide (H
2O
2) generated during cannabinoid synthesis may be used to transform a cannabis or other
plant, such as a tobacco plant. While a number of generic catalase enzymes may be
included in this first domain, as merely one exemplary model, a first domain may include
an exogenous catalase derived from
Arabidopsis (SEQ ID NO. 13-14; see also Fig. 33), or
Escherichia coli (SEQ ID NO. 15-16), or any appropriate catalase ortholog, protein fragment, or catalases
with a homology between about 70% -and approximately 100% as herein defined.
[0108] Another embodiment of the current invention may include localization of the catalase
enzyme to a trichome structure. As generally outlined above, in this embodiment a
trichome targeting sequence from a cannabinoid synthase may be coupled with one or
more catalase enzymes in a fusion or chimera - the terms being generally interchangeable
in this application. This artificial trichome-target catalase gene may be used to
transform a plant having trichome structures, such as Cannabis or tobacco. In a preferred
embodiment, a trichome-targeted catalase from
Arabidopsis thaliana with a THCA synthase trichome targeting domain is identified as SEQ ID NO. 47, while
a trichome-targeted catalase
Arabidopsis thaliana with a CBDA synthase trichome targeting domain is identified as SEQ ID NO. 48. In
another embodiment, a trichome-targeted catalase from
Escherichia coli with a THCA synthase trichome targeting domain is identified as SEQ ID NO. 49, while
a trichome-targeted catalase
Escherichia coli with a CBDA synthase trichome targeting domain is identified as SEQ ID NO. 50.
[0109] Another embodiment of the invention comprises generating a polynucleotide of a nucleic
acid sequence encoding the chimeric/fusion catalase protein. Another embodiment includes
an expression vector comprising this polynucleotide operably linked to a promoter.
A genetically altered plant or parts thereof and its progeny comprising this polynucleotide
operably linked to a promoter, wherein said plant or parts thereof and its progeny
produce said fusion protein is yet another embodiment. For example, seeds and pollen
contain this polynucleotide sequence or a homologue thereof, a genetically altered
plant cell comprising this polynucleotide operably linked to a promoter such that
said plant cell produces said chimeric protein. Another embodiment comprises a tissue
culture comprising a plurality of the genetically altered plant cells.
[0110] In a preferred embodiment, a polynucleotide encoding a trichome-targeted fusion protein
may be operably linked to a promoter that may be appropriate for protein expression
in a
Cannabis, tobacco or other plant. Exemplary promotors may include, but not be limited to: a
non-constitutive promotor; an inducible promotor, a tissue-preferred promotor; a tissue-specific
promotor, a plant-specific promotor, or a constitutive promotor. In a preferred embodiment,
one or more select genes may be operably linked to a leaf-specific gene promotor,
such as Cab1. Additional promoters and operable configurations for expression, as
well as co-expression of one or more of the selected genes are generally known in
the art.
[0111] Another embodiment of the invention may provide for a method for constructing a genetically
altered plant or part thereof having increased resistance to hydrogen peroxide cytotoxicity
generated during cannabinoid synthesis compared to a non-genetically altered plant
or part thereof, the method comprising the steps of: introducing a polynucleotide
encoding a fusion protein into a plant or part thereof to provide a genetically altered
plant or part thereof, wherein said fusion protein comprising a catalase and a trichome-targeting
sequence from a cannabinoid synthase.
[0112] In one embodiment, the invention may encompass a system to increase overall cannabinoid
production and accumulation in trichomes while preventing potential cytotoxicity effects.
As generally shown in Fig. 34, the system may include, in a preferred embodiment,
creating a transgenic
Cannabis, tobacco or other plant or suspension culture plant that overexpresses at least one
Myb transcription factor to increase overall cannabinoid biosynthesis. In further
preferred embodiments, this transgenic plant may co-express a catalase enzyme to reduce
oxidative damage resulting from hydrogen peroxide production associated with cannabinoid
synthesis reducing cell toxicity. In certain preferred embodiments, this catalase
may be fused with an N-terminal synthase trichome targeting domain, for example from
THCA and/or CBDA synthase, helping localize the catalase to the trichome in the case
of whole plant systems, and reduce potentially toxic levels of hydrogen peroxide produced
by THCA, CBCA and/or CBDA synthase activity.
[0113] Another embodiment of the invention may comprise a combination polynucleotide of
a nucleic acid sequence encoding a combination of: 1) a cannabinoid production transcription
factor protein, such as a myb gene; and/or a catalase protein, or any homologue thereof,
which may further include a trichome targeting or localization signal. A genetically
altered plant or parts thereof and its progeny comprising this combination polynucleotide
operably linked to a promoter, wherein said plant or parts thereof and its progeny
produce said protein is yet another embodiment. For example, seeds and pollen contain
this polynucleotide sequence or a homologue thereof, a genetically altered plant cell
comprising this polynucleotide operably linked to a promoter such that said plant
cell produces said proteins. Another embodiment comprises a tissue culture comprising
a plurality of the genetically altered plant cells.
[0114] Another embodiment of the invention may provide for a method for constructing a genetically
altered plant or part thereof having: 1) increased cannabinoid production compared
to a non-genetically altered plant or part thereof; and/or 2) increased resistance
to hydrogen peroxide cytotoxicity generated during cannabinoid synthesis compared
to a non-genetically altered plant or part thereof, the method comprising the steps
of: introducing a combination polynucleotide into a plant or part thereof to provide
a genetically altered plant or part thereof.
[0115] Additional embodiments of the invention may include selecting a genetically altered
plant or part thereof that expresses one or more of the proteins, wherein the expressed
protein(s) may have: 1) increased cannabinoid production capabilities, for example
through overexpression of an endogenous myb gene; and 2) catalase with/or without
a trichome localization capability, or any combination thereof. In certain embodiments,
a combination polynucleotide encoding the proteins is introduced via transforming
said plant with an expression vector comprising said combination polynucleotide operably
linked to a promoter. The cannabinoid production transcription factor protein may
comprise a SEQ ID selected from the sequences identified herein, or homologues thereof.
Naturally, such combinations and expression combination strategies, such identified
in Tables 7-8, 10 below and elsewhere, are exemplary, as multiple combinations of
the elements as herein described is included in the invention.
[0116] In one preferred embodiment, the inventive technology may include systems, methods
and compositions high levels of
in vivo cannabinoid hydroxylation, acetylation and/or glycosylation and/or a combination
of all three. In a preferred embodiment, the
in vivo cannabinoid hydroxylation, acetylation and/or glycosylation and/or a combination
of all three may occur in a cannabinoid-producing plant or cell culture system. While
in alternative embodiments may include a non-cannabinoid producing plant or cell culture
system such as a tobacco plant, like
N. benthamiana, or a yeast cell culture.
[0117] In one embodiment, the invention may include a cannabinoid production, accumulation
and modification system. In one preferred embodiment, a plant, such as
cannabis or tobacco, as well as a yeast cell, may be genetically modified to express one or
more heterologous cytochrome P450 genes. In this preferred embodiment, a heterologous
cytochrome P450 (CYP3A4) SEQ ID NO. 1 may be expressed in a cannabinoid-producing
plant or cell culture system. While in alternative embodiments, a heterologous human
cytochrome P450 (CYP3A4) may be expressed non-cannabinoid producing plant or cell
culture system such as a tobacco plant, like
N. benthamiana or a yeast cell, such a
P. pastoris. In this embodiment, the overexpression of a heterologous human cytochrome P450 protein,
identified as SEQ ID NO. 2, may functionalize endogenously-created cannabinoids so
that they can be more efficiently glycosylated and/or acetylated
in vivo, rendering them water-soluble.
[0118] In an alternative embodiment, the invention may include a cannabinoid production,
accumulation and modification system. In one preferred embodiment, a plant, such as
cannabis or tobacco, may be genetically modified to express one or more heterologous cytochrome
P450 oxidoreductase genes. In this preferred embodiment, a heterologous cytochrome
P450 oxidoreductase (oxred) identified as SEQ ID NO. 3, and SEQ ID NO. 72, identified
as an ortholog, may be expressed in a cannabinoid-producing plant or cell culture
system. While in alternative embodiments a heterologous human heterologous cytochrome
P450 oxidoreductase (oxred) may be expressed non-cannabinoid producing plant or cell
culture system such as a tobacco plant, like BY2 tobacco cells, or yeast cells. In
this embodiment, the overexpression of a heterologous cytochrome P450 oxidoreductase
(oxred) protein, identified as SEQ ID NO. 4, may functionalize endogenously-created
cannabinoids so that they can be more efficiently glycosylated and/or acetylated
in vivo, rendering them water-soluble.
[0119] In one preferred embodiment, a tobacco cell suspension culture may be generated using
BY2 cells. Such BY2 cell may express a heterologous cytochrome P450 oxidoreductase
(oxred) identified as SEQ ID NO. 3, and/or a heterologous glycosyltransferases, such
as GT76G1 (SEQ ID NO. 61). Further, in this embodiment, a BY2 tobacco cell culture
may also be genetically modified to express one or more multi-drug ABC transporters,
such as ABCG2 (SEQ ID NO. 67). In this embodiment, one or more cannabinoids may be
introduced to the genetically modified yeast cells, preferably in in a suspension
culture, and may be functionalize and/or directly glycosylated prior to their active
transport out of the cell into the surrounding media through the action of an ABC
transporter, such as ABCG2. In still further example, a yeast cell may be genetically
modified to express an alpha-factor secretion signal to further facilitate secretion
of the modified cannabinoids, or cannabinoid precursors out of the yeast cell and
into a surrounding media. In this system, one or multiple cannabinoids and/or cannabinoid
precursors may be introduced to the yeast cell culture to be modified, for example
through an cannabinoid oil or other extract.
[0120] It should be noted that in one embodiment, one or more glycosyltransferases may have
an affinity for either of the hydroxy groups located at positions 2,4 on the pentylbenzoate/pentlybenzoic
ring of a cannabinoid, compound, such a CBDA (2,4-dihydroxy-3-[(6R)-3-methyl-6-(prop-1-en-2-yl)cyclohex-2-en-1-yl]-6-pentylbenzoate)
and/or CBGA ((E)-3-(3,7-Dimethyl-2,6-octadienyl)-2,4-dihydroxy-6-pentylbenzoic acid).
[0121] On one embodiment, one or more glycosidase inhibitors may be introduced to a plant
and/or yeast cell culture as well as a whole plant where the production of glycosylated
cannabinoids may be occurring. In one preferred embodiment, one or more of the following
glycosidase inhibitors may be utilized: D,L-1,2-Anhydro-myo-inositol (Conduritol B
Epoxide (CBE)); 6-Epicastanospermine (Castanospermine); 6-bromocyclohex-4-ene-1,2,3-triol
(Bromoconduritol); (+)-1-Deoxynojirimycin (Deoxynojirimycin); 1,5-Dideoxy-1,5-imino-D-sorbitol
hydrochloride (1-Deoxynojirimycin Hydrochloride); 1R,2S,3S,4R)-rel-5-Cyclohexene-1,2,3,4-tetrol
(Conduritol B); (3R,4R,5R)-5-(Hydroxymethyl)-3,4-piperidinediol (2S,3S)-2,3-Dihydroxybutanedioate
(Isofagomine D-Tartrate); O-(D-Glucopyranosylidene)amino N-Phenylcarbamate; and (3S,4S,5R,6R)-3,4,5-Trihydroxy-6-(hydroxymethyl)-2-piperidinone
(D-Manno-γ-lactam). Such glycosidase inhibitors are exemplary only and should not
be seen as limiting on the invention in any way.
[0122] In an alternative embodiment, a heterologous cytochrome P450 gene may be expressed
in a genetically modified yeast strain. For example, heterologous cytochrome P450
(CYP3A4) (SEQ ID NO. 69), and/or CYP oxidoreductase (SEQ ID NO. 71), may be introduced
and expressed in to a yeast cell. In this embodiment, such genes may further be codon
optimized for expression in yeast. Such a heterologous human cytochrome P450 proteins
may functionalize cannabinoids introduced to the yeast cell culture so that they can
be more efficiently glycosylated and/or acetylated
in vivo, rendering them water-soluble. In this embodiment, such yeast cells may further express
one or more heterologous glycosyltransferases, which may further be codon optimized
for expression in yeast cells. In one preferred embodiment, the invention may one
or more codon optimized heterologous glycosyltransferases from tobacco, including
but not limited to: NtGT1 (SEQ ID NO. 51); NtGT2 (SEQ ID NO. 53); NtGT3 (SEQ ID NO.
55); NtGT4 (SEQ ID NO. 57); and NtGT5 (SEQ ID NO. 59).
[0123] In one embodiment, the invention may include a cannabinoid production, accumulation
and modification system in a non-cannabinoid producing plant. In one preferred embodiment,
a plant, such as tobacco, may be genetically modified to express one or more heterologous
cytochrome P450 oxidoreductase genes. In this preferred embodiment, a heterologous
cytochrome P450 oxidoreductase (oxred) identified as SEQ ID NO. 3 may be expressed
in a cannabinoid-producing plant or cell culture system. While in alternative embodiments
a heterologous cytochrome P450 oxidoreductase (oxred) may be expressed non-cannabinoid
producing plant or cell culture system such as a tobacco plant, like
N. benthamiana. In this embodiment, the overexpression of a heterologous cytochrome P450 oxidoreductase
(oxred) protein, identified as SEQ ID NO. 4, may help to functionalize cannabinoids
introduced to the genetically modified plant or plant cell culture system so that
they can be more efficiently glycosylated and/or acetylated,
in vivo, rendering them water-soluble.
[0124] In a preferred embodiment cytochrome 450 and P450 oxidoreductase are co-expressed.
In another embodiment, cytochrome P450 and P450 oxidoreductase may also be expressed
as a fusion protein. It should be noted that any nucleic and or amino acid expressed
in this system may be expressed single or as a fusion protein,
[0125] In another embodiment, the invention may include the expression of one or more exogenous
or heterologous, the terms being generally interchangeable, cannabinoid synthase gene
in a non-cannabinoid producing plant or plant-cell culture system. In one preferred
embodiment, such a gene may include one or more of a CBG, THCA, CBDA or CBCA synthase
genes. For example in one embodiment, a Cannabidiolic acid (CBDA) synthase, identified
as SEQ ID NO. 5 (gene) or SEQ ID NO. 6 (protein) from
Cannabis sativa may use expressed in a non-cannabis-producing plant, such as or plant cell suspension
culture of
N. benthamiana. In another preferred embodiment, a Tetrahydrocannabinolic acid (THCA) synthase, identified
as SEQ ID NO. 42 (gene) from
Cannabis sativa may use expressed in a non-cannabis-producing plant, such as a plant cell suspension
culture of
N. benthamiana.
[0126] In another preferred embodiment, such cannabinoid synthase genes expressed in a cannabinoid
and/or non-cannabinoid plant or plant-cell suspension culture may be target or localized
to certain parts of a cell. For example, in one preferred embodiment, cannabinoid
production may be localized to the cytosol allowing cannabinoids to accumulate in
the cytoplasm. In one exemplary embodiment, an artificially modified cannabinoids
synthase protein may be generated. In this example embodiment, a CBDA synthase may
have the trichome targeting sequence remove forming a cytosolic CBDA synthase (cytCBDAs)
identified as SEQ ID NO. 22, (gene) or 23 (protein). Alternative embodiments would
include generation of other artificial cytosol target synthase genes, such as cytosolic
THCA synthase (cytTHCAs) identified as SEQ ID NO. 46 (gene).
[0127] These preferred embodiments may be particularly suited for cannabinoid cell-suspension
culture cannabinoid expression systems, as such culture systems lack the trichomes
present in whole plants. As such, in one preferred embodiment, a cannabinoid producing
plant may be transformed to one or more of the artificial cytosolic targeted cannabinoid
synthase genes lacking a trichome-targeting signal. In an alternative embodiment,
such artificial cytosolic targeted cannabinoid synthase genes may be expressed in
a cannabinoid producing plant suspension culture where the corresponding endogenous
wild-type synthase gene has been inhibited and/or knocked out.
[0128] In one embodiment, the invention may include a cannabinoid production, accumulation
and modification system that may generate water-soluble cannabinoids. In one preferred
embodiment, a plant, such as
cannabis or tobacco, may be genetically modified to express one or more heterologous glycosyltransferase
genes, such as UDP glycosyltransferase. In this preferred embodiment, UDP glycosyltransferase
(76G1) (SEQ ID NO. 7) (gene) / SEQ ID NO. 8 (protein) from
Stevia rebaudiana may be expressed in cannabinoid producing plant or cell suspension culture. In a
preferred embodiment, the cannabinoid producing plant or cell suspension culture may
be
Cannabis. In another embodiment, one or more glycosyltransferase from
Nicotiana tabacum and/or a homologous glycosyltransferase from
Nicotiana benthamiana, may be expressed in a cannabinoid-producing plant, such as cannabis, or may be over-expressed
in an endogenous plant and/or plant cell culture system. In a preferred embodiment,
a glycosyltransferase gene and/or protein may be selected from the exemplary plant,
such as
Nicotiana tabacum Such glycosyltransferase gene and/or protein may include, but not limited to: Glycosyltransferase
(NtGT5a)
Nicotiana tabacum (SEQ ID NO. 26) (Amino Acid); Glycosyltransferase (NtGT5a)
Nicotiana tabacum (SEQ ID NO. 27) (DNA); Glycosyltransferase (NtGT5b)
Nicotiana tabacum (SEQ ID NO. 28) (Amino Acid); Glycosyltransferase (NtGT5b)
Nicotiana tabacum (SEQ ID NO. 29) (DNA); UDP-glycosyltransferase 73C3 (NtGT4)
Nicotiana tabacum (SEQ ID NO. 30) (Amino Acid); UDP-glycosyltransferase 73C3 (NtGT4)
Nicotiana tabacum (SEQ ID NO. 31) (DNA); Glycosyltransferase (NtGT1b)
Nicotiana tabacum (SEQ ID NO. 32) (Amino Acid); Glycosyltransferase (NtGT1b)
Nicotiana tabacum (SEQ ID NO. 33) (DNA); Glycosyltransferase (NtGT1a)
Nicotiana tabacum (SEQ ID NO. 34) (Amino Acid); Glycosyltransferase (NtGT1a)
Nicotiana tabacum (SEQ ID NO. 35) (DNA); Glycosyltransferase (NtGT3)
Nicotiana tabacum (SEQ ID NO. 36) (Amino Acid); Glycosyltransferase (NtGT3)
Nicotiana tabacum (SEQ ID NO. 37) (DNA); Glycosyltransferase (NtGT2)
Nicotiana tabacum (SEQ ID NO. 38) (Amino Acid); and/or Glycosyltransferase (NtGT2)
Nicotiana tabacum (SEQ ID NO. 39) (DNA). The sequences from
Nicotiana tabacum are exemplary only as other tobacco and non-tobacco glycosyltransferase may be used.
[0129] As noted above, such glycosyltransferases may glycosylate the cannabinoids and/or
functionalized cannabinoids in a plant or plant cell suspension culture as generally
described here. Naturally, other glycosyltransferase genes from alternative sources
may be included in the current invention.
[0130] As noted above, in one embodiment, one or more glycosyltransferases may be targeted
or localized to a portion of the plant cell. For example, in this preferred embodiment,
cannabinoid glycosylation may be localized to the trichome allowing cannabinoids to
accumulate at higher-then wild-type levels in that structure. In one exemplary embodiment,
an artificially modified glycosyltransferase may be generated. In this example embodiment,
a UDP glycosyltransferase (76G1) may be fused with a trichome-targeting sequence at
its N-terminal tail. This trichome targeting sequence may be recognized by the cell
and cause it to be transported to the trichome. This artificial gene construct is
identified as SEQ ID NO. 19 (gene), or SEQ ID NO. 20 (protein). In one embodiment,
a trichome targeting sequence or domain may be derived from any number of synthases.
For example, in one embodiment a THCA Synthase Trichome domain (SEQ ID NO. 40) may
be coupled with a glycosyltransferase as generally described above. Moreover, in another
example, a CBDA Synthase Trichome targeting domain (SEQ ID NO. 41) may be coupled
with a glycosyltransferase as generally described above.
[0131] In another embodiment, invention may include an embodiment where transiently modified
cannabinoids may be passively and/or actively excreted from a cell or into a cell
wall. In one exemplary model, an exogenous ATP-binding cassette transporter (ABC transporters
or ABCt) or other similar molecular structure may recognize the glycosyl or glucuronic
acid or acetyl functional group (conjugate) on the transiently modified cannabinoid
and actively transport it across the cell wall/membrane and into the surrounding media.
[0132] In one embodiment, a plant may be transformed to express a heterologous ABC transporter.
In this embodiment, an ABCt may facilitate cannabinoid transport outside the cells
in suspension cultures, such as a cannabis or tobacco cell suspension culture. In
this preferred embodiment, a human multi-drug transported (ABCG2) may be expressed
in a plant cell suspension culture of the same respectively. ABCG2 is a plasma membrane
directed protein and may further be identified as SEQ ID NO. 9 (gene), or 10 (protein).
[0133] Generally, a trichome structure, such as in
Cannabis or tobacco, will have very little to no substrate for a glycosyltransferase enzyme
to use to effectuate glycosylation. To resolve this problem, in one embodiment, the
invention may include systems, methods and compositions to increase substrates for
glycosyltransferase, namely select sugars in a trichome. In one preferred embodiment,
the invention may include the targeted or localization of sugar transport to the trichome.
In this preferred embodiment, an exogenous or endogenous UDP-glucose/UDP-galactose
transporter (UTR1) may be expressed in a trichome producing plant, such as cannabis
or tobacco and the like. In this embodiment, the UDP-glucose/UDP-galactose transporter
(UTR1) may be modified to include a plasma-membrane targeting sequence and/or domain.
With this targeting domain, the UDP-glucose/UDP-galactose transporter (UTR1) may allow
the artificial fusion protein to be anchored to the plasma membrane. In this configuration,
sugar substrates from the cytosol may pass through the plasma membrane bound UDP-glucose/UDP-galactose
transporter (PM-UTR1) into the trichome. In this embodiment, substrates for glycosyltransferase
may be localized to the trichome and allowed to accumulate further allowing enhanced
glycosylation of cannabinoids in the trichome. In one example, SEQ ID NO. 21 is identified
as the polynucleotide gene sequence for a heterologous UDP-glucose/galactose transporter
(UTR1) from
Arabidopsis thaliana having a plasma-membrane targeting sequence replacing a tonoplast targeting sequence.
The plasma membrane targeting sequence of this exemplary fusion protein may include
the following sequence (see SEQ ID NO 21) TGCTCCATAATGAACTTAATGTGTGGGTCTACCTGCGCCGCT,
or a sequence having 70-99% homology with the sequence.
[0134] It should be noted that a number of combinations and permutations of the genes/proteins
described herein may be co-expressed and thereby accomplish one or more of the goals
of the current invention. Such combinations are exemplary of preferred embodiments
only, and not limiting in any way.
[0135] In one embodiment, a gene, such as a cannabinoid synthase, or a gene fragment corresponding
with, for example a signal domain may be inhibited, downregulated, disrupted, or may
even be knocked-out. One of ordinary skill in the art will recognize the many processes
that can accomplish this without undue experimentation. In other embodiment, a knock-out
may mean overexpression of a modified endo- or exogenous gene compared to the wild-type
version.
[0136] For example, in one embodiment high levels of cannabinoid glycosylation may be generated
by co-expressing CYP3A4 and CYP oxidoreductase (cytochrome P450 with P450 oxidoreductase)
and at least one endogenous glycosyltransferases in
N. benthamiana. In another embodiment, one or more of the endogenous or exogenous gene may be expressed
in a plant or plant cell culture with the co-expression of myb and/or a catalase.
In this configuration, there exists an additive effect of over-expressing a Myb transcription
factor and a catalase, one or more of which may be targeted or localized, in the synthesis
of water-soluble cannabinoids (glycosylated and hydroxylated) in
Cannabis sativa.
[0137] In certain embodiments, endocannabinoids may be functionalized and/or acetylated
and/or glycosylated as generally described herein.
[0138] All sequences described herein include sequences having between 70-99% homology with
the sequence identified.
[0139] The inventive technology may further include novel cannabinoid compounds as well
as their
in vivo generation. As demonstrated in figures 36 and 37 respectively, the invention includes
modified cannabinoid compounds identified as: 36B, 36C, 36D, 37A, 37B, 37C, 37D, 37E
and 37F and/or a physiologically acceptable salt thereof. In one preferred embodiment,
the invention may include a pharmaceutical composition as active ingredient an effective
amount or dose of one or more compounds identified as 36A, 36B, 36C, 36D, 37B, 37C,
37D, 37E and 37F and/or a physiologically acceptable salt thereof, wherein the active
ingredient is provided together with pharmaceutically tolerable adjuvants and/or excipients
in the pharmaceutical composition. Such pharmaceutical composition may optionally
be in combination with one or more further active ingredients. In one embodiment,
one of the aforementioned compositions may act as a prodrug. The term "prodrug" is
taken to mean compounds according to the invention which have been modified by means
of, for example, sugars and which are cleaved in the organism to form the effective
compounds according to the invention. The terms "effective amount" or "effective dose"
or "dose" are interchangeably used herein and denote an amount of the pharmaceutical
compound having a prophylactically or therapeutically relevant effect on a disease
or pathological conditions, i.e. which causes in a tissue, system, animal or human
a biological or medical response which is sought or desired, for example, by a researcher
or physician. Pharmaceutical formulations can be administered in the form of dosage
units which comprise a predetermined amount of active ingredient per dosage unit.
The concentration of the prophylactically or therapeutically active ingredient in
the formulation may vary from about 0.1 to 100 wt %. Preferably, the compound of formula
(I) or the pharmaceutically acceptable salts thereof are administered in doses of
approximately 0.5 to 1000 mg, more preferably between 1 and 700 mg, most preferably
5 and 100 mg per dose unit. Generally, such a dose range is appropriate for total
daily incorporation. In other terms, the daily dose is preferably between approximately
0.02 and 100 mg/kg of body weight. The specific dose for each patient depends, however,
on a wide variety of factors as already described in the present specification (e.g.
depending on the condition treated, the method of administration and the age, weight
and condition of the patient). Preferred dosage unit formulations are those which
comprise a daily dose or part-dose, as indicated above, or a corresponding fraction
thereof of an active ingredient. Furthermore, pharmaceutical formulations of this
type can be prepared using a process which is generally known in the pharmaceutical
art.
[0140] In the meaning of the present invention, the compound is further defined to include
pharmaceutically usable derivatives, solvates, prodrugs, tautomers, enantiomers, racemates
and stereoisomers thereof, including mixtures thereof in all ratios.
[0141] In one embodiment, the current invention may include systems, methods and compositions
for the efficient production of cannabidiolic acid (CBDA) in yeast coupled with a
system of hydrogen peroxide detoxification. In this embodiment, the inventive technology
may include the generation of a genetically modified yeast cell.
[0142] In one embodiment, the inventive system may include: 1) transforming a yeast cell
with a first nucleotide sequence comprising the nucleotide sequence expressing an
acyl-activating enzyme and expressing a mutant prenyltransferase; and 2) transforming
the yeast cell with a second nucleotide sequence comprising the nucleotide sequence
expressing olivetolic synthase, expressing olivetolic acid cyclase and expressing
aromatic prenyltransferase; 3) and transforming a yeast cell with a third nucleotide
sequence expressing a catalase gene.
[0143] In another embodiment, the inventive system may include the step of: 1) transforming
a yeast cell with a first nucleotide sequence expressing an acyl-activating enzyme
and expressing a mutant prenyltransferase; 2) transforming a yeast cell with a second
nucleotide sequence expressing olivetolic synthase and expressing olivetolic acid
cyclase; and transforming a yeast cell with a third nucleotide sequence expressing
aromatic prenyltransferase and expressing cannabidiolic acid synthase; and 3) transforming
a yeast cell with a third nucleotide sequence expressing a catalase gene.
[0144] Additional embodiments of the invention may further include: 1) transforming a yeast
strain with a first nucleotide sequence expressing an acyl-activating enzyme; 2) transforming
the yeast strain with a second nucleotide sequence expressing a mutant prenyltransferase;
3) transforming the yeast strain with a third nucleotide sequence expressing olivetolic
synthase; 4) transforming the yeast strain with a fourth nucleotide sequence expressing
olivetolic acid cyclase; 5) transforming the yeast strain with a fifth nucleotide
sequence expressing aromatic prenyltransferase; 6) transforming the yeast strain with
a sixth nucleotide expressing cannabidiolic acid synthase; and 7) transforming the
yeast strain with a sixth nucleotide expressing a catalase.
[0145] Additional embodiments of the invention may further include: 1) transforming a yeast
cell with a first nucleotide sequence expressing an acyl-activating enzyme and expressing
a mutant prenyltransferase; 2) transforming the yeast cell with a second nucleotide
sequence expressing olivetolic synthase and expressing olivetolic acid cyclase; 3)
and transforming the yeast cell with a third nucleotide sequence expressing aromatic
prenyltransferase and expressing cannabidiolic acid synthase; and 7) transforming
the yeast cell with a fourth nucleotide expressing a catalase.
[0146] Additional embodiments of the invention may further include: 1) transforming a yeast
cell with a first nucleotide sequence expressing an acyl-activating enzyme and expressing
a mutant prenyltransferase; 2) transforming the yeast cell with a second nucleotide
sequence expressing olivetolic synthase and expressing olivetolic acid cyclase; 3)
transforming the yeast cell with a third nucleotide sequence expressing aromatic prenyltransferase
and expressing cannabidiolic acid synthase, and 7) transforming the yeast cell with
a fourth nucleotide expressing a catalase.
[0147] Sequence listings for the above identified sequences can be found in specification
index NOs 1 and 2 filed in application
15/815,651, both of which are incorporated herein by reference. In particular, the following
sequences are specifically incorporated by reference: iSEQ. ID. NO. 1; iSEQ. ID NO.
2; iSEQ. ID. NO. 4; iSEQ. ID. NO. 5; iSEQ. ID. NO. 6; iSEQ. ID. NO. 7; iSEQ ID. NO.
8; iSEQ. ID. NO. 9; iSEQ. ID. NO 10; iSEQ ID. NO. 11; iSEQ. ID. NO. 12; iSEQ ID. NO.
13; iSEQ. ID. NO. 14; iSEQ. ID. NO. 15; iSEQ. ID. NO. 16; iSEQ. ID. NO. 23; iSEQ ID
NO. 24; iSEQ. ID. NO. 22; iSEQ. ID. NO. 25; iSEQ. ID. NO. 26; iSEQ. ID. NO. 27; and
iSEQ. ID. NO. 28. (The above sequences are marked with an "i" to denote their incorporation
by reference.
[0148] In one embodiment, the invention may include systems, methods and compositions for
the expression of exogenous, or heterologous genes in a yeast cell that may allow
the biomodification and/or secretion of cannabinoids generated in a yeast cell. Specifically,
the invention may allow the generation of cannabinoids and/or cannabinoid precursors
in a genetically modified yeast cell, which may further be functionalized and/or modified
into a water-soluble form. This embodiment may include transforming a yeast cell to
express one or more of the following: heterologous cytochrome P450, and/or a heterologous
P450 oxidoreductase, and/or a glycosyltransferase and/or heterologous ABC transporter.
Similar to the above example, the genes may further be codon optimized for expression
in a yeast cell that is configured to produce one or more cannabinoids or cannabinoid
precursors, such as those genetically modified yeast cells described in
US Pat. No. 9822384, and
US Pat. App. No. 15815651. In this embodiment, the exogenous catalase may be capable of generating water-soluble
cannabinoid in one or more of the yeast cells identified in
US Pat. No. 9822384, and
US Pat. App. No. 15815651, both of which are hereby incorporated in their entirety.
[0149] In one embodiment, the current invention may include systems, methods and compositions
for the efficient production of cannabidiolic acid (CBDA) in yeast coupled with a
system of biotransformation of the cannabinoids into a water-soluble form. In this
embodiment, the inventive technology may include the generation of a genetically modified
yeast cell.
[0150] In one embodiment, the inventive system may include: 1) transforming a yeast cell
with a first nucleotide sequence comprising the nucleotide sequence expressing an
acyl-activating enzyme and expressing a mutant prenyltransferase; and 2) transforming
the yeast cell with a second nucleotide sequence comprising the nucleotide sequence
expressing olivetolic synthase, expressing olivetolic acid cyclase and expressing
aromatic prenyltransferase.; 3) and transforming a yeast cell to express one or more
of the following: heterologous cytochrome P450, and/or a heterologous P450 oxidoreductase,
and/or a glycosyltransferase and/or heterologous ABC transporter, and/or a catalase.
In this embodiment, the heterologous cytochrome P450, and/or a heterologous P450 oxidoreductase,
and/or a glycosyltransferase and/or heterologous ABC transporter, and/or a catalase,
the sequences identified herein may further be codon optimized for expression in yeast.
Such codon optimization being generally within the knowledge and ability of one of
ordinary skill in the art.
[0151] In another embodiment, the inventive system may include the step of: 1) transforming
a yeast cell with a first nucleotide sequence expressing an acyl-activating enzyme
and expressing a mutant prenyltransferase; 2) transforming a yeast cell with a second
nucleotide sequence expressing olivetolic synthase and expressing olivetolic acid
cyclase; and transforming a yeast cell with a third nucleotide sequence expressing
aromatic prenyltransferase and expressing cannabidiolic acid synthase; 3) and transforming
a yeast cell to express one or more of the following: heterologous cytochrome P450,
and/or a heterologous P450 oxidoreductase, and/or a glycosyltransferase and/or heterologous
ABC transporter, and/or a catalase.
[0152] Additional embodiments of the invention may further include: 1) transforming a yeast
strain with a first nucleotide sequence expressing an acyl-activating enzyme; 2) transforming
the yeast strain with a second nucleotide sequence expressing a mutant prenyltransferase;
3) transforming the yeast strain with a third nucleotide sequence expressing olivetolic
synthase; 4) transforming the yeast strain with a fourth nucleotide sequence expressing
olivetolic acid cyclase; 5) transforming the yeast strain with a fifth nucleotide
sequence expressing aromatic prenyltransferase; 6) transforming the yeast strain with
a sixth nucleotide expressing cannabidiolic acid synthase; and 7) and transforming
a yeast cell to express one or more of the following: heterologous cytochrome P450,
and/or a heterologous P450 oxidoreductase, and/or a glycosyltransferase and/or heterologous
ABC transporter, and/or a catalase.
[0153] Additional embodiments of the invention may further include: 1) transforming a yeast
cell with a first nucleotide sequence expressing an acyl-activating enzyme and expressing
a mutant prenyltransferase; 2) transforming the yeast cell with a second nucleotide
sequence expressing olivetolic synthase and expressing olivetolic acid cyclase; 3)
and transforming the yeast cell with a third nucleotide sequence expressing aromatic
prenyltransferase and expressing cannabidiolic acid synthase; and 7) and transforming
a yeast cell to express one or more of the following: heterologous cytochrome P450,
and/or a heterologous P450 oxidoreductase, and/or a glycosyltransferase and/or heterologous
ABC transporter, and/or a catalase.
[0154] Additional embodiments of the invention may further include: 1) transforming a yeast
cell with a first nucleotide sequence expressing an acyl-activating enzyme and expressing
a mutant prenyltransferase; 2) transforming the yeast cell with a second nucleotide
sequence expressing olivetolic synthase and expressing olivetolic acid cyclase; 3)
transforming the yeast cell with a third nucleotide sequence expressing aromatic prenyltransferase
and expressing cannabidiolic acid synthase, and 7) and transforming a yeast cell to
express one or more of the following: heterologous cytochrome P450, and/or a heterologous
P450 oxidoreductase, and/or a glycosyltransferase and/or heterologous ABC transporter,
and/or a catalase.
[0155] Sequence listings for the above identified sequences can be found in specification
index NOs 1 and 2 filed in application
15/815,651, both of which are incorporated herein by reference. In particular, the following
sequences are specifically incorporated by reference: iSEQ. ID. NO. 1; iSEQ. ID. NO.
2; iSEQ. ID. NO. 4; iSEQ. ID. NO. 5; iSEQ. ID. NO. 6; iSEQ. ID. NO. 7; iSEQ ID. NO.
8; iSEQ. ID. NO. 9; iSEQ. ID. NO 10; iSEQ ID. NO. 11; iSEQ. ID. NO. 12; iSEQ ID. NO.
13; iSEQ. ID. NO. 14; iSEQ. ID. NO. 15; iSEQ. ID. NO. 16; iSEQ. ID. NO. 23; iSEQ ID.
NO. 24; iSEQ. ID. NO. 22; iSEQ. ID. NO. 25; iSEQ. ID. NO. 26; iSEQ. ID. NO. 27; and
iSEQ. ID. NO. 28. (The above sequences are marked with an "i" to denote their incorporation
by reference.
[0156] The invention may further include systems, method and compositions for the generation
of water-soluble cannabinoids in a cell culture system expressing an endogenous glycosyltransferase.
In this embodiment, one or more cannabinoids, such as in the form of a cannabinoid
extract, may be introduced to a tobacco cell culture expressing one or more endogenous
glycosyltransferase that may generate water-soluble cannabinoids. In some embodiment,
a tobacco cell culture may be further genetically modified to express an endogenous
glycosyltransferase which may be operably linked to a promoter. In this embodiment,
such a promotor may be an inducible, constitutive or other promotor. In this preferred
embodiment, such an endogenous glycosyltransferase may cause the overexpression of
the protein generating a more robust cannabinoid biotransformation system.
[0157] As noted above, present invention allows the scaled production of water-soluble cannabinoids.
Because of this enhanced solubility, the invention allows for the addition of such
water-soluble cannabinoid to a variety of compositions without requiring oils and
or emulsions that are generally required to maintain the non-modified cannabinoids
in suspension. As a result, the present invention may all for the production of a
variety of compositions for both the food and beverage industry, as well as pharmaceutical
applications that do not required oils and emulsion suspensions and the like.
[0158] In one embodiment the invention may include aqueous compositions containing one or
more water-soluble cannabinoids that may be introduced to a food or beverage. In a
preferred embodiment, the invention may include an aqueous solution containing one
or more dissolved water-soluble cannabinoids. In this embodiment, such water-soluble
cannabinoid may include a glycosylated cannabinoid, and/or an acetylated cannabinoid,
and/or a mixture of both. Here, the glycosylated cannabinoid, and/or said acetylated
cannabinoid were generated
in vivo as generally described herein, or
in vitro. In additional embodiment, the water-soluble cannabinoid may be an isolated non-psychoactive,
such as CBD and the like. Moreover, in this embodiment, the aqueous may contain one
or more of the following: saline, purified water, propylene glycol, deionized water,
and/or an alcohol such as ethanol as well as a pH buffer that may allow the aqueous
solution to be maintained at a pH below 7.4. Additional embodiments may include the
addition an acid of base, such as formic acid, or ammonium hydroxide.
[0159] In another embodiment, the invention may include a consumable food additive having
at least one water-soluble cannabinoid, such as a glycosylated and/or an acetylated
cannabinoid, and/or a mixture of both, where such water-soluble cannabinoids may be
generated
in vivo and/or
in vitro. This consumable food additive may further include one or more a food additive polysaccharides,
such as dextrin and/or maltodextrin, as well as an emulsifier. Example emulisifiers
may include, but not be limited to: gum arabic, modified starch, pectin, xanthan gum,
gum ghatti, gum tragacanth, fenugreek gum, mesquite gum, mono-glycerides and di-glycerides
of long chain fatty acids, sucrose monoesters, sorbitan esters, polyethoxylated glycerols,
stearic acid, palmitic acid, mono-glycerides, di-glycerides, propylene glycol esters,
lecithin, lactylated mono- and di-glycerides, propylene glycol monoesters, polyglycerol
esters, diacetylated tartaric acid esters of mono- and di-glycerides, citric acid
esters of monoglycerides, stearoyl-2-lactylates, polysorbates, succinylated monoglycerides,
acetylated monoglycerides, ethoxylated monoglycerides, quillaia, whey protein isolate,
casein, soy protein, vegetable protein, pullulan, sodium alginate, guar gum, locust
bean gum, tragacanth gum, tamarind gum, carrageenan, furcellaran, Gellan gum, psyllium,
curdlan, konjac mannan, agar, and cellulose derivatives, or combinations thereof.
[0160] The consumable food additive of the invention may be a homogenous composition and
may further comprising a flavoring agent. Exemplary flavoring agents may include:
sucrose (sugar), glucose, fructose, sorbitol, mannitol, corn syrup, high fructose
corn syrup, saccharin, aspartame, sucralose, acesulfame potassium (acesulfame-K),
neotame. The consumable food additive of the invention may also contain one or more
coloring agents. Exemplary coloring agents may include: FD&C Blue Nos. 1 and 2, FD&C
Green No. 3, FD&C Red Nos. 3 and 40, FD&C Yellow Nos. 5 and 6, Orange B, Citrus Red
No. 2, annatto extract, beta-carotene, grape skin extract, cochineal extract or carmine,
paprika oleoresin, caramel color, fruit and vegetable juices, saffron, Monosodium
glutamate (MSG), hydrolyzed soy protein, autolyzed yeast extract, disodium guanylate
or inosinate.
[0161] The consumable food additive of the invention may also contain one or more surfactants,
such as glycerol monostearate and polysorbate 80. The consumable food additive of
the invention may also contain one or more preservatives. Exemplary preservatives
may include ascorbic acid, citric acid, sodium benzoate, calcium propionate, sodium
erythorbate, sodium nitrite, calcium sorbate, potassium sorbate, BHA, BHT, EDTA, tocopherols.
The consumable food additive of the invention may also contain one or more nutrient
supplements, such as: thiamine hydrochloride, riboflavin, niacin, niacinamide, folate
or folic acid, beta carotene, potassium iodide, iron or ferrous sulfate, alpha tocopherols,
ascorbic acid, Vitamin D, amino acids, multi-vitamin, fish oil, co-enzyme Q-10, and
calcium.
[0162] In one embodiment, the invention may include a consumable fluid containing at least
one dissolved water-soluble cannabinoid. In one preferred embodiment, this consumable
fluid may be added to a drink or beverage to infused it with the dissolved water-soluble
cannabinoid generated in an
in vivo system as generally herein described, or through an
in vitro process, for example as identified by Zipp et al. which is incorporated herein by
reference. As noted above, such water-soluble cannabinoid may include a water-soluble
glycosylated cannabinoid and/or a water-soluble acetylated cannabinoid, and/or a mixture
of both. The consumable fluid may include a food additive polysaccharide such as maltodextrin
and/or dextrin, which may further be in an aqueous form and/or solution. For example,
in one embodiment, and aqueous maltodextrin solution may include a quantity of sorbic
acid and an acidifying agent to provide a food grade aqueous solution of maltodextrin
having a pH of 2-4 and a sorbic acid content of 0.02-0.1% by weight.
[0163] In certain embodiments, the consumable fluid may include water, as well as an alcoholic
beverage; a non-alcoholic beverage, a noncarbonated beverage, a carbonated beverage,
a cola, a root beer, a fruit-flavored beverage, a citrus-flavored beverage, a fruit
juice, a fruit-containing beverage, a vegetable juice, a vegetable containing beverage,
a tea, a coffee, a dairy beverage, a protein containing beverage, a shake, a sports
drink, an energy drink, and a flavored water.
The consumable fluid may further include at least one additional ingredients, including
but not limited to: xanthan gum, cellulose gum, whey protein hydrolysate, ascorbic
acid, citric acid, malic acid, sodium benzoate, sodium citrate, sugar, phosphoric
acid, and water.
[0164] In one embodiment, the invention may include a consumable gel having at least one
water-soluble cannabinoid and gelatin in an aqueous solution. In a preferred embodiment,
the consumable gel may include a water-soluble glycosylated cannabinoid and/or a water-soluble
acetylated cannabinoid, or a mixture of both, generated in an in vivo system, such
as a whole plant or cell suspension culture system as generally herein described.
[0165] Additional embodiments may include a liquid composition having at least one water-soluble
cannabinoid solubilized in a first quantity of water; and at least one of: xanthan
gum, cellulose gum, whey protein hydrolysate, ascorbic acid, citric acid, malic acid,
sodium benzoate, sodium citrate, sugar, phosphoric acid, and/or a sugar alcohol. In
this embodiment, a water-soluble cannabinoid may include a glycosylated water-soluble
cannabinoid, an acetylated water-soluble cannabinoid, or a mixture of both. In one
preferred embodiment, the composition may further include a quantity of ethanol. Here,
the amount of water-soluble cannabinoid may include: less than 10 mass% water; more
than 95 mass% water; about 0.1 mg to about 1000 mg of the water-soluble cannabinoid;
about 0.1 mg to about 500 mg of the water-soluble cannabinoid; about 0.1 mg to about
200 mg of the water-soluble cannabinoid; about 0.1 mg to about 100 mg of the water-soluble
cannabinoid; about 0.1 mg to about 100 mg of the water-soluble cannabinoid; about
0.1 mg to about 10 mg of the water-soluble cannabinoid; about 0.5 mg to about 5 mg
of the water-soluble cannabinoid; about 1 mg/kg to 5 mg/kg (body weight) in a human
of the water-soluble cannabinoid.
[0166] In alternative embodiment, the composition may include at least one water-soluble
cannabinoid in the range of 50 mg/L to 300 mg/L; at least one water-soluble cannabinoid
in the range of 50 mg/L to 100 mg/L; at least one water-soluble cannabinoid in the
range of 50 mg/L to 500 mg/L; at least one water-soluble cannabinoid over 500 mg/L;
at least one water-soluble cannabinoid under 50 mg/L. Additional embodiments may include
one or more of the following additional components: a flavoring agent; a coloring
agent; a coloring agent; and/or caffeine.
[0167] In one embodiment, the invention may include a liquid composition having at least
one water-soluble cannabinoid solubilized in said first quantity of water and a first
quantity of ethanol in a liquid state. In a preferred embodiment, a first quantity
of ethanol in a liquid state may be between 1% to 20% weight by volume of the liquid
composition. In this embodiment, a water-soluble cannabinoid may include a glycosylated
water-soluble cannabinoid, an acetylated water-soluble cannabinoid, or a mixture of
both. Such water-soluble cannabinoids may be generated in an
in vivo and/or
in vitro system as herein identified. In a preferred embodiment, the ethanol, or ethyl alcohol
component may be up to about ninety-nine point nine-five percent (99.95%) by weight
and the water-soluble cannabinoid about zero point zero five percent (0.05%) by weight.
In another embodiment,
[0168] Examples of the preferred embodiment may include liquid ethyl alcohol compositions
having one or more water-soluble cannabinoids wherein said ethyl alcohol has a proof
greater than 100, and/or less than 100. Additional examples of a liquid composition
containing ethyl alcohol and at least one water-soluble cannabinoid may include, beer,
wine and/or distilled spirit.
[0169] Additional embodiments of the invention may include a chewing gum composition having
a first quantity of at least one water-soluble cannabinoid. In a preferred embodiment,
a chewing gum composition may further include a gum base comprising a buffering agent
selected from the group consisting of acetates, glycinates, phosphates, carbonates,
glycerophosphates, citrates, borates, and mixtures thereof. Additional components
may include at least one sweetening agent; and at least one flavoring agent. As noted
above, in a preferred embodiment, a water-soluble cannabinoid may include at least
one water-soluble acetylated cannabinoid, and/or at least one water-soluble glycosylated
cannabinoid, or a mixture of the two. In this embodiment, such water soluble glycosylated
cannabinoid, and/or said acetylated cannabinoid may have been glycosylated and/or
acetylated
in vivo respectively.
[0170] In one embodiment, the chewing gum composition described above may include:
- 0.01 to 1% by weight of at least one water-soluble cannabinoid;
- 25 to 85% by weight of a gum base;
- 10 to 35% by weight of at least one sweetening agent; and
- 1 to 10% by weight of a flavoring agent.
[0171] Here, such flavoring agents may include: menthol flavor, eucalyptus, mint flavor
and/or L-menthol. Sweetening agents may include one or more of the following: xylitol,
sorbitol, isomalt, aspartame, sucralose, acesulfame potassium, and saccharin. Additional
preferred embodiment may include a chewing gum having a pharmaceutically acceptable
excipient selected from the group consisting of: fillers, disintegrants, binders,
lubricants, and antioxidants. The chewing gum composition may further be non-disintegrating
and also include one or more coloring and/or flavoring agents.
[0172] The invention may further include a composition for a water-soluble cannabinoid infused
solution comprising essentially of: water and/or purified water, at least one water-soluble
cannabinoid, and at least one flavoring agent. A water-soluble cannabinoid infused
solution of the invention may further include a sweetener selected from the group
consisting of: glucose, sucrose, invert sugar, corn syrup, stevia extract powder,
stevioside, steviol, aspartame, saccharin, saccharin salts, sucralose, potassium acetosulfam,
sorbitol, xylitol, mannitol, erythritol, lactitol, alitame, miraculin, monellin, and
thaumatin or a combination of the same. Additional components of the water-soluble
cannabinoid infused solution may include, but not be limited to: sodium chloride,
sodium chloride solution, glycerin, a coloring agent, and a demulcent. As to this
last potential component, in certain embodiment, a demulcent may include: pectin,
glycerin, honey, methylcellulose, and/or propylene glycol. As noted above, in a preferred
embodiment, a water-soluble cannabinoid may include at least one water-soluble acetylated
cannabinoid, and/or at least one water-soluble glycosylated cannabinoid, or a mixture
of the two. In this embodiment, such water soluble glycosylated cannabinoid, and/or
said acetylated cannabinoid may have been glycosylated and/or acetylated
in vivo respectively.
[0173] The invention may further include a composition for a water-soluble cannabinoid infused
anesthetic solution having water, or purified water, at least one water-soluble cannabinoid,
and at least one oral anesthetic. In a preferred embodiment, an anesthetic may include
benzocaine, and/or phenol in a quantity of between .1% to 15% volume by weight.
[0174] Additional embodiments may include a water-soluble cannabinoid infused anesthetic
solution having a sweetener which may be selected from the group consisting of: glucose,
sucrose, invert sugar, corn syrup, stevia extract powder, stevioside, steviol, aspartame,
saccharin, saccharin salts, sucralose, potassium acetosulfam, sorbitol, xylitol, mannitol,
erythritol, lactitol, alitame, miraculin, monellin, and thaumatin or a combination
of the same. Additional components of the water-soluble cannabinoid infused solution
may include, but not be limited to: sodium chloride, sodium chloride solution, glycerin,
a coloring agent a demulcent. In a preferred embodiment, a demulcent may selected
from the group consisting of: pectin, glycerin, honey, methylcellulose, and propylene
glycol. As noted above, in a preferred embodiment, a water-soluble cannabinoid may
include at least one water-soluble acetylated cannabinoid, and/or at least one water-soluble
glycosylated cannabinoid, or a mixture of the two. In this embodiment, such water
soluble glycosylated cannabinoid, and/or said acetylated cannabinoid may have been
glycosylated and/or acetylated
in vivo respectively.
[0175] The invention may further include a composition for a hard lozenge for rapid delivery
of water-soluble cannabinoids through the oral mucosa. In this embodiment, such a
hard lozenge composition may include: a crystalized sugar base, and at least one water-soluble
cannabinoid, wherein the hard lozenge has a moisture content between .1 to 2%. In
this embodiment, the water-soluble cannabinoid may be added to the sugar based when
it is in a liquefied form and prior to the evaporation of the majority of water content.
Such a hard lozenge may further be referred to as a candy.
[0176] In a preferred embodiment, a crystalized sugar base may be formed from one or more
of the following: sucrose, invert sugar, corn syrup, and isomalt or a combination
of the same. Additional components may include at least one acidulant. Examples of
acidulants may include, but not be limited to: citric acid, tartaric acid, fumaric
acid, and malic acid. Additional components may include at least one pH adjustor.
Examples of pH adjustors may include, but not be limited to: calcium carbonate, sodium
bicarbonate, and magnesium trisilicate.
[0177] In another preferred embodiment, the composition may include at least one anesthetic.
Example of such anesthetics may include benzocaine, and phenol. In this embodiment,
first quantity of anesthetic may be between 1 mg to 15 mg per lozenge. Additional
embodiments may include a quantity of menthol. In this embodiment, such a quantity
of menthol may be between 1 mg to 20 mg. The hard lozenge composition may also include
a demulcent, for example: pectin, glycerin, honey, methylcellulose, propylene glycol,
and glycerin. In this embodiment, a demulcent may be in a quantity between 1 mg to
10 mg. As noted above, in a preferred embodiment, a water-soluble cannabinoid may
include at least one water-soluble acetylated cannabinoid, and/or at least one water-soluble
glycosylated cannabinoid, or a mixture of the two. In this embodiment, such water
soluble glycosylated cannabinoid, and/or said acetylated cannabinoid may have been
glycosylated and/or acetylated
in vivo respectively.
[0178] The invention may include a chewable lozenge for rapid delivery of water-soluble
cannabinoids through the oral mucosa. In a preferred embodiment, the compositions
may include: a glycerinated gelatin base, at least one sweetener; and at least one
water-soluble cannabinoid dissolved in a first quantity of water. In this embodiment,
a sweetener may include sweetener selected from the group consisting of: glucose,
sucrose, invert sugar, corn syrup, stevia extract powder, stevioside, steviol, aspartame,
saccharin, saccharin salts, sucralose, potassium acetosulfam, sorbitol, xylitol, mannitol,
erythritol, lactitol, alitame, miraculin, monellin, and thaumatin or a combination
of the same.
Additional components may include at least one acidulant. Examples of acidulants may
include, but not be limited to: citric acid, tartaric acid, fumaric acid, and malic
acid. Additional components may include at least one pH adjustor. Examples of pH adjustors
may include, but not be limited to: calcium carbonate, sodium bicarbonate, and magnesium
trisilicate.
[0179] In another preferred embodiment, the composition may include at least one anesthetic.
Example of such anesthetics may include benzocaine, and phenol. In this embodiment,
first quantity of anesthetic may be between 1 mg to 15 mg per lozenge. Additional
embodiments may include a quantity of menthol. In this embodiment, such a quantity
of menthol may be between 1 mg to 20 mg. The chewable lozenge composition may also
include a demulcent, for example: pectin, glycerin, honey, methylcellulose, propylene
glycol, and glycerin. In this embodiment, a demulcent may be in a quantity between
1 mg to 10 mg. As noted above, in a preferred embodiment, a water-soluble cannabinoid
may include at least one water-soluble acetylated cannabinoid, and/or at least one
water-soluble glycosylated cannabinoid, or a mixture of the two. In this embodiment,
such water soluble glycosylated cannabinoid, and/or said acetylated cannabinoid may
have been glycosylated and/or acetylated
in vivo respectively.
[0180] The invention may include a soft lozenge for rapid delivery of water-soluble cannabinoids
through the oral mucosa. In a preferred embodiment, the compositions may include:
polyethylene glycol base, at least one sweetener; and at least one water-soluble cannabinoid
dissolved in a first quantity of water. In this embodiment, a sweetener may include
sweetener selected from the group consisting of: glucose, sucrose, invert sugar, corn
syrup, stevia extract powder, stevioside, steviol, aspartame, saccharin, saccharin
salts, sucralose, potassium acetosulfam, sorbitol, xylitol, mannitol, erythritol,
lactitol, alitame, miraculin, monellin, and thaumatin or a combination of the same.
Additional components may include at least one acidulant. Examples of acidulants may
include, but not be limited to: citric acid, tartaric acid, fumaric acid, and malic
acid. Additional components may include at least one pH adjustor. Examples of pH adjustors
may include, but not be limited to: calcium carbonate, sodium bicarbonate, and magnesium
trisilicate.
[0181] In another preferred embodiment, the composition may include at least one anesthetic.
Example of such anesthetics may include benzocaine, and phenol. In this embodiment,
first quantity of anesthetic may be between 1 mg to 15 mg per lozenge. Additional
embodiments may include a quantity of menthol. In this embodiment, such a quantity
of menthol may be between 1 mg to 20 mg. The soft lozenge composition may also include
a demulcent, for example: pectin, glycerin, honey, methylcellulose, propylene glycol,
and glycerin. In this embodiment, a demulcent may be in a quantity between 1 mg to
10 mg. As noted above, in a preferred embodiment, a water-soluble cannabinoid may
include at least one water-soluble acetylated cannabinoid, and/or at least one water-soluble
glycosylated cannabinoid, or a mixture of the two. In this embodiment, such water
soluble glycosylated cannabinoid, and/or said acetylated cannabinoid may have been
glycosylated and/or acetylated
in vivo respectively.
[0182] In another embodiment, the invention may include a tablet or capsule consisting essentially
of a water-soluble glycosylated cannabinoid and a pharmaceutically acceptable excipient.
Example may include solid, semi-solid and aqueous excipients such as: maltodextrin,
whey protein isolate, xanthan gum, guar gum, diglycerides, monoglycerides, carboxymethyl
cellulose, glycerin, gelatin, polyethylene glycol and water-based excipients.
[0183] In a preferred embodiment, a water-soluble cannabinoid may include at least one water-soluble
acetylated cannabinoid, and/or at least one water-soluble glycosylated cannabinoid,
or a mixture of the two. In this embodiment, such water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid may have been glycosylated and/or acetylated
in vivo respectively. Examples of such
in vivo systems being generally described herein, including in plant, as well as cell culture
systems including cannabis cell culture, tobacco cell culture and yeast cell culture
systems. In one embodiment, a tablet or capsule may include an amount of water-soluble
cannabinoid of 5 milligrams or less. Alternative embodiments may include an amount
of water-soluble cannabinoid between 5 milligrams and 200 milligrams. Still other
embodiments may include a tablet or capsule having amount of water-soluble cannabinoid
that is more than 200 milligrams.
[0184] The invention may further include a method of manufacturing and packaging a cannabinoid
dosage, consisting of the following steps: 1) preparing a fill solution with a desired
concentration of a water-soluble cannabinoid in a liquid carrier wherein said cannabinoid
solubilized in said liquid carrier; 2) encapsulating said fill solution in capsules;
3) packaging said capsules in a closed packaging system; and 4) removing atmospheric
air from the capsules. In one embodiment, the step of removing of atmospheric air
consists of purging the packaging system with an inert gas, such as, for example,
nitrogen gas, such that said packaging system provides a room temperature stable product.
In one preferred embodiment, the packaging system may include a plaster package, which
may be constructed of material that minimizes exposure to moisture and air.
[0185] In one embodiment a preferred liquid carrier may include a water-based carrier, such
as for example an aqueous sodium chloride solution. In a preferred embodiment, a water-soluble
cannabinoid may include at least one water-soluble acetylated cannabinoid, and/or
at least one water-soluble glycosylated cannabinoid, or a mixture of the two. In this
embodiment, such water soluble glycosylated cannabinoid, and/or said acetylated cannabinoid
may have been glycosylated and/or acetylated
in vivo respectively. Examples of such
in vivo systems being generally described herein, including in plant, as well as cell culture
systems including cannabis cell culture, tobacco cell culture and yeast cell culture
systems. In one embodiment, a desired cannabinoid concentration may be about 1-10%
w/w, while in other embodiments it may be about 1.5-6.5% w/w. Alternative embodiments
may include an amount of water-soluble cannabinoid between 5 milligrams and 200 milligrams.
Still other embodiments may include a tablet or capsule having amount of water-soluble
cannabinoid that is more than 200 milligrams.
[0186] The invention may include an oral pharmaceutical solution, such as a sub-lingual
spray, consisting essentially of a water-soluble cannabinoid, 30-33% w/w water, about
50% w/w alcohol, 0.01% w/w butylated hydroxylanisole (BHA) or 0.1% w/w ethylenediaminetetraacetic
acid (EDTA) and 5-21% w/w co-solvent, having a combined total of 100%, wherein said
co-solvent is selected from the group consisting of propylene glycol, polyethylene
glycol and combinations thereof, and wherein said water-soluble cannabinoid is a glycosylated
cannabinoid, an acetylated cannabinoid or a mixture of the two. In an alternative
embodiment, such a oral pharmaceutical solution may consist essentially of 0.1 to
5% w/w of said water-soluble cannabinoid, about 50% w/w alcohol, 5.5% w/w propylene
glycol, 12% w/w polyethylene glycol and 30-33% w/w water. In a preferred composition,
the alcohol component may be ethanol.
[0187] The invention may include an oral pharmaceutical solution, such as a sublingual spray,
consisting essentially of about 0.1% to 1% w/w water-soluble cannabinoid, about 50%
w/w alcohol, 5.5% w/w propylene glycol, 12% w/w polyethylene glycol, 30-33% w/w water,
0.01% w/w butylated hydroxyanisole, having a combined total of 100%, and wherein said
water-soluble cannabinoid is a glycosylated cannabinoid, an acetylated cannabinoid
or a mixture of the two wherein that were generated
in vivo. In an alternative embodiment, such a oral pharmaceutical solution may consist essentially
of 0.54% w/w water-soluble cannabinoid, 31.9% w/w water, 12% w/w polyethylene glycol
400, 5.5% w/w propylene glycol, 0.01% w/w butylated hydroxyanisole, 0.05% w/w sucralose,
and 50% w/w alcohol, wherein the a the alcohol components may be ethanol.
[0188] The invention may include a solution for nasal and/or sublingual administration of
a cannabinoid including: 1) an excipient of propylene glycol, ethanol anhydrous, or
a mixture of both; and 2) a water-soluble cannabinoid which may include glycosylated
cannabinoid an acetylated cannabinoid or a mixture of the two generated
in vivo and/or
in vitro. In a preferred embodiment, the composition may further include a topical decongestant,
which may include phenylephrine hydrochloride, Oxymetazoline hydrochloride, and Xylometazoline
in certain preferred embodiments. The composition may further include an antihistamine,
and/or a steroid. Preferably, the steroid component is a corticosteroid selected from
the group consisting of: neclomethasone dipropionate, budesonide, ciclesonide, flunisolide,
fluticasone furoate, fluticasone propionate, mometasone, triamcinolone acetonide.
In alternative embodiment, the solution for nasal and/or sublingual administration
of a cannabinoid may further comprise at least one of the following: benzalkonium
chloride solution, benzyl alcohol, boric acid, purified water, sodium borate, polysorbate
80, phenylethyl alcohol, microcrystalline cellulose, carboxymethylcellulose sodium,
dextrose, dipasic, sodium phosphate, edetate disodium, monobasic sodium phosphate,
propylene glycol.
[0189] The invention may further include an aqueous solution for nasal and/or sublingual
administration of a cannabinoid comprising: a water and/or saline solution; and a
water-soluble cannabinoid which may include a glycosylated cannabinoid, an acetylated
cannabinoid or a mixture of the two generated
in vivo and/or
in vitro. In a preferred embodiment, the composition may further include a topical decongestant,
which may include phenylephrine hydrochloride, Oxymetazoline hydrochloride, and Xylometazoline
in certain preferred embodiments. The composition may further include an antihistamine,
and/or a steroid. Preferably, the steroid component is a corticosteroid selected from
the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide, flunisolide,
fluticasone furoate, fluticasone propionate, mometasone, triamcinolone acetonide.
In alternative embodiment, the aqueous solution may further comprise at least one
of the following: benzalkonium chloride solution, benzyl alcohol, boric acid, purified
water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline cellulose,
carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate disodium,
monobasic sodium phosphate, propylene glycol.
[0190] The invention may include a topical formulation for the transdermal delivery of water-soluble
cannabinoid. In a preferred embodiment, a topical formulation for the transdermal
delivery of water-soluble cannabinoid may include a water-soluble glycosylated cannabinoid,
and/or water-soluble acetylated cannabinoid, or a mixture of both, and a pharmaceutically
acceptable excipient. Here, a glycosylated cannabinoid and/or acetylated cannabinoid
may be generated
in vivo and/or
in vitro. Preferably a pharmaceutically acceptable excipient may include one or more: gels,
ointments, cataplasms, poultices, pastes, creams, lotions, plasters and jellies or
even polyethylene glycol. Additional embodiments may further include one or more of
the following components: a quantity of capsaicin; a quantity of benzocaine; a quantity
of lidocaine; a quantity of camphor; a quantity of benzoin resin; a quantity of methylsalicilate;
a quantity of triethanolamine salicylate; a quantity of hydrocortisone; a quantity
of salicylic acid.
[0191] The invention may include a gel for transdermal administration of a water soluble-cannabinoid
which may be generated in vitro and/or in vivo. In this embodiment, the mixture preferably
contains from 15% to about 90% ethanol, about 10% to about 60% buffered aqueous solution
or water, about 0.1 to about 25% propylene glycol, from about 0.1 to about 20% of
a gelling agent, from about 0.1 to about 20% of a base, from about 0.1 to about 20%
of an absorption enhancer and from about 1% to about 25% polyethylene glycol and a
water-soluble cannabinoid such as a glycosylated cannabinoid, and/or acetylated cannabinoid,
and/or a mixture of the two.
[0192] In another embodiment, the invention may further include a transdermal composition
having a pharmaceutically effective amount of a water-soluble cannabinoid for delivery
of the cannabinoid to the bloodstream of a user. This transdermal composition may
include a pharmaceutically acceptable excipient and at least one water-soluble cannabinoid,
such as a glycosylated cannabinoid, an acetylated cannabinoid, and a mixture of both,
wherein the cannabinoid is capable of diffusing from the composition into the bloodstream
of the user. In a preferred embodiment, a pharmaceutically acceptable excipient to
create a transdermal dosage form selected from the group consisting of: gels, ointments,
cataplasms, poultices, pastes, creams, lotions, plasters and jellies. The transdermal
composition may further include one or more surfactants. In one preferred embodiment,
the surfactant may include a surfactant-lecithin organogel, which may further be present
in an amount of between about between about 95% and about 98% w/w. In an alternative
embodiment, a surfactant-lecithin organogel comprises lecithin and PPG-2 myristyl
ether propionate and/or high molecular weight polyacrylic acid polymers. The transdermal
composition may further include a quantity of isopropyl myristate.
[0193] The invention may further include transdermal composition having one or more permeation
enhancers to facilitate transfer of the water-soluble cannabinoid across a dermal
layer. In a preferred embodiment, a permeation enhancer may include one or more of
the following: propylene glycol monolaurate, diethylene glycol monoethyl ether, an
oleoyl macrogolglyceride, a caprylocaproyl macrogolglyceride, and an oleyl alcohol,
[0194] The invention may also include a liquid cannabinoid liniment composition consisting
of water, isopropyl alcohol solution and a water-soluble cannabinoid, such as glycosylated
cannabinoid, and/or said acetylated cannabinoid which may further have been generated
in vivo. This liquid cannabinoid liniment composition may further include approximately 97.5%
to about 99.5% by weight of 70% isopropyl alcohol solution and from about 0.5% to
about 2.5% by weight of a water-soluble cannabinoid mixture.
[0195] Based on te improved solubility and other physical properties, as well as cost advantage
and scalability of the invention's in vivo water-soluble production platform, the
invention may include one or more commercial infusions. For example, commercially
available products, such a lip balm, soap, shampoos, lotions, creams and cosmetics
may be infused with one or more water-soluble cannabinoids.
[0196] As generally described herein, the invention may include one or more plants, such
as a tobacco plant and/or cell culture that may be genetically modified to produce,
for example water-soluble glycosylated cannabinoids
in vivo. As such, in one preferred embodiment, the invention may include a tobacco plant and
or cell that contain at least one water-soluble cannabinoid. In a preferred embodiment,
a tobacco plant containing a quantity of water-soluble cannabinoids may be used to
generate a water-soluble cannabinoid infused tobacco product such as a cigarette,
pipe tobacco, chewing tobacco, cigar, and smokeless tobacco. In one embodiment, the
tobacco plant may be treated with one or more glycosidase inhibitors. In a preferred
embodiment, since the cannabinoid being introduced to the tobacco plant may be controlled,
the inventive tobacco plant may generate one or more selected water-cannabinoids.
For example, in one embodiment, the genetically modified tobacco plant may be introduced
to a single cannabinoid, such as a non-psychoactive CBD compound, while in other embodiment,
the genetically modified tobacco plant may be introduced to a cannabinoid extract
containing a full and/or partial entourage of cannabinoid compounds.
[0197] The invention may further include a novel composition that may be used to supplement
a cigarette, or other tobacco-based product. In this embodiment, the composition may
include at least one water-soluble cannabinoid dissolved in an aqueous solution. This
aqueous solution may be wherein said composition may be introduced to a tobacco product,
such as a cigarette and/or a tobacco leaf such that the aqueous solution may evaporate
generating a cigarette and/or a tobacco leaf that contains the aforementioned water-soluble
cannabinoid(s), which may further have been generated
in vivo as generally described herein.
[0198] On one embodiment the invention may include one or more method of treating a medical
condition in a mammal. In this embodiment, the novel method may include of administering
a therapeutically effective amount of a water-soluble cannabinoid, such as an
in vivo generated glycosylated cannabinoid, and/or an acetylated cannabinoid, and/or a mixture
of both or a pharmaceutically acceptable salt thereof, wherein the medical condition
is selected from the group consisting of: obesity, post-traumatic stress syndrome,
anorexia, nausea, emesis, pain, wasting syndrome, HIV-wasting, chemotherapy induced
nausea and vomiting, alcohol use disorders, anti-tumor, amyotrophic lateral sclerosis,
glioblastoma multiforme, glioma, increased intraocular pressure, glaucoma, cannabis
use disorders, Tourette's syndrome, dystonia, multiple sclerosis, inflammatory bowel
disorders, arthritis, dermatitis, Rheumatoid arthritis, systemic lupus erythematosus,
anti-inflammatory, anti-convulsant, anti-psychotic, anti-oxidant, neuroprotective,
anti-cancer, immunomodulatory effects, peripheral neuropathic pain, neuropathic pain
associated with post-herpetic neuralgia, diabetic neuropathy, shingles, burns, actinic
keratosis, oral cavity sores and ulcers, post-episiotomy pain, psoriasis, pruritis,
contact dermatitis, eczema, bullous dermatitis herpetiformis, exfoliative dermatitis,
mycosis fungoides, pemphigus, severe erythema multiforme (e.g., Stevens-Johnson syndrome),
seborrheic dermatitis, ankylosing spondylitis, psoriatic arthritis, Reiter's syndrome,
gout, chondrocalcinosis, joint pain secondary to dysmenorrhea, fibromyalgia, musculoskeletal
pain, neuropathic-postoperative complications, polymyositis, acute nonspecific tenosynovitis,
bursitis, epicondylitis, post-traumatic osteoarthritis, synovitis, and juvenile rheumatoid
arthritis. In a preferred embodiment, the pharmaceutical composition may be administered
by a route selected from the group consisting of: transdermal, topical, oral, buccal,
sublingual, intra-venous, intramuscular, vaginal, rectal, ocular, nasal and follicular.
The amount of water-soluble cannabinoids may be a therapeutically effective amount,
which may be determined by the patient's age, weight, medical condition cannabinoid-delivered,
route of delivery and the like. In one embodiment, a therapeutically effective amount
may be 50 mg or less of a water-soluble cannabinoid. In another embodiment, a therapeutically
effective amount may be 50 mg or more of a water-soluble cannabinoid.
[0199] It should be noted that for any of the above composition, unless otherwise stated,
an effective amount of water-soluble cannabinoids may include amounts between: .01mg
to .1 mg; .01mg to .5 mg; .01mg to 1 mg; .01mg to 5 mg; .01mg to 10 mg; .01mg to 25
mg; .01mg to 50 mg; .01mg to 75 mg; .01mg to 100 mg; .01mg to 125 mg; .01mg to 150
mg; .01mg to 175 mg; .01mg to 200 mg; .01mg to 225 mg; .01mg to 250 mg; .01mg to 275
mg; .01mg to 300 mg; .01mg to 225 mg; .01mg to 350 mg; .01mg to 375 mg; .01mg to 400
mg; .01mg to 425 mg; .01mg to 450 mg; .01mg to 475 mg; .01mg to 500 mg, .01mg to 525
mg; .01mg to 550 mg; .01mg to 575 mg; .01mg to 600 mg; .01mg to 625 mg; .01mg to 650
mg; .01mg to 675 mg; .01mg to 700 mg; .01mg to 725 mg; .01mg to 750 mg; .01mg to 775
mg; .01mg to 800 mg; .01mg to 825 mg; .01mg to 950 mg; .01mg to 875 mg; .01mg to 900
mg; .01mg to 925 mg; .01mg to 950 mg; .01mg to 975 mg; .01mg to 1000 mg; .01mg to
2000 mg; .01mg to 3000 mg; .01mg to 4000 mg; 01mg to 5000 mg; .01mg to .1 mg/kg.;
.01mg to .5 mg/kg; Olmg to 1 mg/kg; .01mg to 5 mg/kg; .01mg to 10 mg/kg; .01mg to
25 mg/kg; .01mg to 50 mg/kg; .01mg to 75 mg/kg; and .01mg to 100 mg/kg.
[0200] The modified cannabinoids compounds of the present invention are useful for a variety
of therapeutic applications. For example, the compounds are useful for treating or
alleviating symptoms of diseases and disorders involving CB1 and CB2 receptors, including
appetite loss, nausea and vomiting, pain, multiple sclerosis and epilepsy. For example,
they may be used to treat pain (i.e. as analgesics) in a variety of applications including
but not limited to pain management. In additional embodiments, such modified cannabinoids
compounds may be used as an appetite suppressant. Additional embodiment may include
administering the modified cannabinoids compounds.
[0201] By "treating" the present inventors mean that the compound is administered in order
to alleviate symptoms of the disease or disorder being treated. Those of skill in
the art will recognize that the symptoms of the disease or disorder that is treated
may be completely eliminated, or may simply be lessened. Further, the compounds may
be administered in combination with other drugs or treatment modalities, such as with
chemotherapy or other cancer-fighting drugs
[0202] Implementation may generally involve identifying patients suffering from the indicated
disorders and administering the compounds of the present invention in an acceptable
form by an appropriate route. The exact dosage to be administered may vary depending
on the age, gender, weight and overall health status of the individual patient, as
well as the precise etiology of the disease. However, in general, for administration
in mammals (e.g. humans), dosages in the range of from about 0.01 to about 300 mg
of compound per kg of body weight per 24 hr., and more preferably about 0.01 to about
100 mg of compound per kg of body weight per 24 hr., are effective.
[0203] Administration may be oral or parenteral, including intravenously, intramuscularly,
subcutaneously, intradermal injection, intraperitoneal injection, etc., or by other
routes (e.g. transdermal, sublingual, oral, rectal and buccal delivery, inhalation
of an aerosol, etc.). In a preferred embodiment of the invention, the water-soluble
cannabinoid analogs are provided orally or intravenously.
[0204] In particular, the phenolic esters of the invention are preferentially administered
systemically in order to afford an opportunity for metabolic activation via
in vivo cleavage of the ester. In addition, the water soluble compounds with azole moieties
at the pentyl side chain do not require
in vivo activation and may be suitable for direct administration (e.g. site specific injection).
[0205] The compounds may be administered in the pure form or in a pharmaceutically acceptable
formulation including suitable elixirs, binders, and the like (generally referred
to a "carriers") or as pharmaceutically acceptable salts (e.g. alkali metal salts
such as sodium, potassium, calcium or lithium salts, ammonium, etc.) or other complexes.
It should be understood that the pharmaceutically acceptable formulations include
liquid and solid materials conventionally utilized to prepare both injectable dosage
forms and solid dosage forms such as tablets and capsules and aerosolized dosage forms.
In addition, the compounds may be formulated with aqueous or oil based vehicles. Water
may be used as the carrier for the preparation of compositions (e.g. injectable compositions),
which may also include conventional buffers and agents to render the composition isotonic.
Other potential additives and other materials (preferably those which are generally
regarded as safe [GRAS]) include: colorants; flavorings; surfactants (TWEEN, oleic
acid, etc.); solvents, stabilizers, elixirs, and binders or encapsulants (lactose,
liposomes, etc). Solid diluents and excipients include lactose, starch, conventional
disintergrating agents, coatings and the like. Preservatives such as methyl paraben
or benzalkium chloride may also be used. Depending on the formulation, it is expected
that the active composition will consist of about 1% to about 99% of the composition
and the vehicular "carrier" will constitute about 1% to about 99% of the composition.
The pharmaceutical compositions of the present invention may include any suitable
pharmaceutically acceptable additives or adjuncts to the extent that they do not hinder
or interfere with the therapeutic effect of the active compound.
[0206] The administration of the compounds of the present invention may be intermittent,
bolus dose, or at a gradual or continuous, constant or controlled rate to a patient.
In addition, the time of day and the number of times per day that the pharmaceutical
formulation is administered may vary are and best determined by a skilled practitioner
such as a physician. Further, the effective dose can vary depending upon factors such
as the mode of delivery, gender, age, and other conditions of the patient, as well
as the extent or progression of the disease. The compounds may be provided alone,
in a mixture containing two or more of the compounds, or in combination with other
medications or treatment modalities. The compounds may also be added to blood ex vivo
and then be provided to the patient.
[0207] Genes encoding by a combination polynucleotide and/or a homologue thereof, may be
introduced into
a plant, and/or plant cell using several types of transformation approaches developed
for the generation of transgenic plants. Standard transformation techniques, such
as Ti-plasmid Agrobacterium-mediated transformation, particle bombardment, microinjection,
and electroporation may be utilized to construct stably transformed transgenic plants.
[0208] As used herein, a "cannabinoid" is a chemical compound (such as cannabinol, THC or
cannabidiol) that is found in the plant species
Cannabis among others like Echinacea; Acmella Oleracea; Helichrysum Umbraculigerum; Radula
Marginata (Liverwort) and Theobroma Cacao, and metabolites and synthetic analogues
thereof that may or may not have psychoactive properties. Cannabinoids therefore include
(without limitation) compounds (such as THC) that have high affinity for the cannabinoid
receptor (for example Ki<250 nM), and compounds that do not have significant affinity
for the cannabinoid receptor (such as cannabidiol, CBD). Cannabinoids also include
compounds that have a characteristic dibenzopyran ring structure (of the type seen
in THC) and cannabinoids which do not possess a pyran ring (such as cannabidiol).
Hence a partial list of cannabinoids includes THC, CBD, dimethyl heptylpentyl cannabidiol
(DMHP-CBD), 6,12-dihydro-6-hydroxy-cannabidiol (described in
U.S. Pat. No. 5,227,537, incorporated by reference); (3S,4R)-7-hydroxy-Δ6-tetrahydrocannabinol homologs and
derivatives described in
U.S. Pat. No. 4,876,276, incorporated by reference; (+)-4-[4-DMH-2,6-diacetoxy-phenyl]-2-carboxy-6,6-dimethylbicyclo[3.1.1]hept-2-en,
and other 4-phenylpinene derivatives disclosed in
U.S. Pat. No. 5,434,295, which is incorporated by reference; and cannabidiol (-)(CBD) analogs such as (-)CBD-monomethylether,
(-)CBD dimethyl ether; (-)CBD diacetate; (-)3'-acetyl-CBD monoacetate; and ±AF11,
all of which are disclosed in
Consroe et al., J. Clin. Phannacol. 21:428S-436S, 1981, which is also incorporated by reference. Many other cannabinoids are similarly disclosed
in
Agurell et al., Pharmacol. Rev. 38:31-43, 1986, which is also incorporated by reference.
[0209] As claimed herein, the term "cannabinoid" may also include different modified forms
of a cannabinoid such as a hydroxylated cannabinoid or cannabinoid carboxylic acid.
For example, if a glycosyltransferase were to be capable of glycosylating a cannabinoid,
it would include the term cannabinoid as defined elsewhere, as well as the aforementioned
modified forms. It may further include multiple glycosylation moieties.
[0210] Examples of cannabinoids are tetrahydrocannabinol, cannabidiol, cannabigerol, cannabichromene,
cannabicyclol, cannabivarin, cannabielsoin, cannabicitran, cannabigerolic acid, cannabigerolic
acid monomethylether, cannabigerol monomethylether, cannabigerovarinic acid, cannabigerovarin,
cannabichromenic acid, cannabichromevarinic acid, cannabichromevarin, cannabidolic
acid, cannabidiol monomethylether, cannabidiol-C4, cannabidivarinic acid, cannabidiorcol,
delta-9-tetrahydrocannabinolic acid A, delta-9-tetrahydrocannabinolic acid B, delta-9-tetrahydrocannabinolic
acid-C4, delta-9-tetrahydrocannabivarinic acid,delta-9-tetrahydrocannabivarin, delta-9-
tetrahydrocannabiorcolic acid, delta-9-tetrahydrocannabiorcol,delta-7-cis-iso- tetrahydrocannabivarin,
delta-8-tetrahydrocannabiniolic acid, delta-8- tetrahydrocannabinol, cannabicyclolic
acid, cannabicylovarin, cannabielsoic acid A, cannabielsoic acid B, cannabinolic acid,
cannabinol methylether, cannabinol-C4, cannabinol-C2, cannabiorcol, 10-ethoxy-9-hydroxy-delta-6a-tetrahydrocannabinol,
8,9-dihydroxy-delta-6a-tetrahydrocannabinol, cannabitriolvarin, ethoxy-cannabitriolvarin,
dehydrocannabifuran, cannabifuran, cannabichromanon, cannabicitran, 10-oxo-delta-6a-tetrahydrocannabinol,
delta-9-cis- tetrahydrocannabinol, 3, 4, 5, 6-tetrahydro-7-hydroxy-alpha-alpha-2-trimethyl-9-n-
propyl-2, 6-methano-2H-1-benzoxocin-5-methanol-cannabiripsol, trihydroxy-delta-9-tetrahydrocannabinol,
and cannabinol. Examples of cannabinoids within the context of this disclosure include
tetrahydrocannabinol and cannabidiol.
[0211] The term "endocannabinoid" refer to compounds including arachidonoyl ethanolamide
(anandamide, AEA), 2-arachidonoyl ethanolamide (2-AG), 1 -arachidonoyl ethanolamide
(1 - AG), and docosahexaenoyl ethanolamide (DHEA, synaptamide), oleoyl ethanolamide
(OEA), eicsapentaenoyl ethanolamide, prostaglandin ethanolamide, docosahexaenoyl ethanolamide,
linolenoyl ethanolamide, 5(Z),8(Z),1 1 (Z)- eicosatrienoic acid ethanolamide (mead
acid ethanolamide), heptadecanoul ethanolamide, stearoyl ethanolamide, docosaenoyl
ethanolamide, nervonoyl ethanolamide, tricosanoyl ethanolamide, lignoceroyl ethanolamide,
myristoyl ethanolamide, pentadecanoyl ethanolamide, palmitoleoyl ethanolamide, docosahexaenoic
acid (DHA). Particularly preferred endocannabinoids are AEA, 2-AG, 1-AG, and DHEA.
[0212] Hydroxylation is a chemical process that introduces a hydroxyl group (-OH) into an
organic compound. Acetylation is a chemical reaction that adds an acetyl chemical
group. Glycosylation is the coupling of a glycosyl donor, to a glycosyl acceptor forming
a glycoside.
[0213] The term "prodrug" refers to a precursor of a biologically active pharmaceutical
agent (drug). Prodrugs must undergo a chemical or a metabolic conversion to become
a biologically active pharmaceutical agent. A prodrug can be converted ex vivo to
the biologically active pharmaceutical agent by chemical transformative processes.
In vivo, a prodrug is converted to the biologically active pharmaceutical agent by
the action of a metabolic process, an enzymatic process or a degradative process that
removes the prodrug moiety to form the biologically active pharmaceutical agent.
[0214] The term "glycosidase inhibitor" and as used in the present invention is used to
mean a compound, which can inhibit glycosidase enzymes which catalyst the hydrolysis
of glycosidic bonds. Techniques for determining whether a compound acts as a glycosidase
inhibitor will be well known to the skilled person, but may include, for example use
of substrates such as p-nitrophenyl-glycosides, where the presence of an inhibitor
will reduce the release of the colored p-nitrophenol when an appropriate glycosidase
is present.
[0215] As used herein, the term "homologous" with regard to a contiguous nucleic acid sequence,
refers to contiguous nucleotide sequences that hybridize under appropriate conditions
to the reference nucleic acid sequence. For example, homologous sequences may have
from about 70%-100, or more generally 80% to 100% sequence identity, such as about
81%; about 82%; about 83%; about 84%; about 85%; about 86%; about 87%; about 88%;
about 89%; about 90%; about 91%; about 92%; about 93%; about 94% about 95%; about
96%; about 97%; about 98%; about 98.5%; about 99%; about 99.5%; and about 100%. The
property of substantial homology is closely related to specific hybridization. For
example, a nucleic acid molecule is specifically hybridizable when there is a sufficient
degree of complementarity to avoid nonspecific binding of the nucleic acid to non-target
sequences under conditions where specific binding is desired, for example, under stringent
hybridization conditions.
[0216] The term, "operably linked," when used in reference to a regulatory sequence and
a coding sequence, means that the regulatory sequence affects the expression of the
linked coding sequence. "Regulatory sequences," or "control elements," refer to nucleotide
sequences that influence the timing and level/amount of transcription, RNA processing
or stability, or translation of the associated coding sequence. Regulatory sequences
may include promoters; translation leader sequences; introns; enhancers; stem-loop
structures; repressor binding sequences; termination sequences; polyadenylation recognition
sequences; etc. Particular regulatory sequences may be located upstream and/or downstream
of a coding sequence operably linked thereto. Also, particular regulatory sequences
operably linked to a coding sequence may be located on the associated complementary
strand of a double-stranded nucleic acid molecule.
[0217] As used herein, the term "promoter" refers to a region of DNA that may be upstream
from the start of transcription, and that may be involved in recognition and binding
of RNA polymerase and other proteins to initiate transcription. A promoter may be
operably linked to a coding sequence for expression in a cell, or a promoter may be
operably linked to a nucleotide sequence encoding a signal sequence which may be operably
linked to a coding sequence for expression in a cell. A "plant promoter" may be a
promoter capable of initiating transcription in plant cells. Examples of promoters
under developmental control include promoters that preferentially initiate transcription
in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids,
or sclerenchyma. Such promoters are referred to as "tissue-preferred." Promoters which
initiate transcription only in certain tissues are referred to as "tissue-specific."
[0218] A "cell type-specific" promoter primarily drives expression in certain cell types
in one or more organs, for example, vascular cells in roots or leaves. An "inducible"
promoter may be a promoter which may be under environmental control. Examples of environmental
conditions that may initiate transcription by inducible promoters include anaerobic
conditions and the presence of light. Tissue-specific, tissue-preferred, cell type
specific, and inducible promoters constitute the class of "non-constitutive" promoters.
A "constitutive" promoter is a promoter which may be active under most environmental
conditions or in most cell or tissue types.
[0219] Any inducible promoter can be used in some embodiments of the invention.
See Ward et al. (1993) Plant Mol. Biol. 22:361-366. With an inducible promoter, the rate of transcription increases in response to an
inducing agent. Exemplary inducible promoters include, but are not limited to: Promoters
from the ACEI system that responds to copper; In2 gene from maize that responds to
benzenesulfonamide herbicide safeners; Tet repressor from Tn10; and the inducible
promoter from a steroid hormone gene, the transcriptional activity of which may be
induced by a glucocorticosteroid hormone are general examples (
Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:0421).
[0220] As used herein, the term "transformation" or "genetically modified" refers to the
transfer of one or more nucleic acid molecule(s) into a cell. A plant is "transformed"
or "genetically modified" by a nucleic acid molecule transduced into the plant when
the nucleic acid molecule becomes stably replicated by the plant. As used herein,
the term "transformation" or "genetically modified" encompasses all techniques by
which a nucleic acid molecule can be introduced into, such as a plant.
[0221] The term "vector" refers to some means by which DNA, RNA, a protein, or polypeptide
can be introduced into a host. The polynucleotides, protein, and polypeptide which
are to be introduced into a host can be therapeutic or prophylactic in nature; can
encode or be an antigen; can be regulatory in nature, etc. There are various types
of vectors including virus, plasmid, bacteriophages, cosmids, and bacteria.
[0222] As is known in the art, different organisms preferentially utilize different codons
for generating polypeptides. Such "codon usage" preferences may be used in the design
of nucleic acid molecules encoding the proteins and chimeras of the invention in order
to optimize expression in a particular host cell system.
[0223] An "expression vector" is nucleic acid capable of replicating in a selected host
cell or organism. An expression vector can replicate as an autonomous structure, or
alternatively can integrate, in whole or in part, into the host cell chromosomes or
the nucleic acids of an organelle, or it is used as a shuttle for delivering foreign
DNA to cells, and thus replicate along with the host cell genome. Thus, an expression
vector are polynucleotides capable of replicating in a selected host cell, organelle,
or organism, e.g., a plasmid, virus, artificial chromosome, nucleic acid fragment,
and for which certain genes on the expression vector (including genes of interest)
are transcribed and translated into a polypeptide or protein within the cell, organelle
or organism; or any suitable construct known in the art, which comprises an "expression
cassette." In contrast, as described in the examples herein, a "cassette" is a polynucleotide
containing a section of an expression vector of this invention. The use of the cassettes
assists in the assembly of the expression vectors. An expression vector is a replicon,
such as plasmid, phage, virus, chimeric virus, or cosmid, and which contains the desired
polynucleotide sequence operably linked to the expression control sequence(s).
[0224] A polynucleotide sequence is operably linked to an expression control sequence(s)
(e.g., a promoter and, optionally, an enhancer) when the expression control sequence
controls and regulates the transcription and/or translation of that polynucleotide
sequence.
[0225] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses
conservatively modified variants thereof (e.g., degenerate codon substitutions), the
complementary (or complement) sequence, and the reverse complement sequence, as well
as the sequence explicitly indicated. Specifically, degenerate codon substitutions
may be achieved by generating sequences in which the third position of one or more
selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues
(see e.g.,
Batzer et al., Nucleic Acid Res. 19:5081 (1991);
Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and
Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). Because of the degeneracy of nucleic acid codons, one can use various different
polynucleotides to encode identical polypeptides. Table 1a, infra, contains information
about which nucleic acid codons encode which amino acids.
TABLE 4 Amino acid Nucleic acid codons
Amino Acid |
Nucleic Acid Codons |
Ala/A |
GCT, GCC, GCA, GCG |
Arg/R |
 |
Asn/N |
AAT, AAC |
Asp/D |
GAT, GAC |
Cys/C |
TGT, TGC |
Gln/Q |
CAA, CAG |
Glu/E |
GAA, GAG |
Gly/G |
GGT, GGC, GGA, GGG |
His/H |
CAT, CAC |
Ile/I |
ATT, ATC, ATA |
Leu/L |
TTA, TTG, CTT, CTC, CTA, CTG |
Lys/K |
AAA, AAG |
Met/M |
ATG |
Phe/F |
TTT, TTC |
Pro/P |
CCT, CCC, CCA, CCG |
Ser/S |
TCT, TCC, TCA, TCG, AGT, AGC |
Thr/T |
ACT, ACC, ACA, ACG |
Trp/W |
TGG |
Tyr/Y |
TAT, TAC |
Val/V |
GTT, GTC, GTA, GTG |
[0226] The term "plant" or "plant system" includes whole plants, plant organs, progeny of
whole plants or plant organs, embryos, somatic embryos, embryo-like structures, protocorms,
protocorm-like bodies (PLBs), and culture and/or suspensions of plant cells. Plant
organs comprise, e.g., shoot vegetative organs/structures (e.g., leaves, stems and
tubers), roots, flowers and floral organs/structures (e.g., bracts, sepals, petals,
stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed
coat) and fruit (the mature ovary), plant tissue (e.g., vascular tissue, ground tissue,
and the like) and cells (e.g., guard cells, egg cells, trichomes and the like). The
invention may also include Cannabaceae and other
Cannabis strains, such as
C. sativa generally.
[0227] The term "expression," as used herein, or "expression of a coding sequence" (for
example, a gene or a transgene) refers to the process by which the coded information
of a nucleic acid transcriptional unit (including, e.g., genomic DNA or cDNA) is converted
into an operational, non-operational, or structural part of a cell, often including
the synthesis of a protein. Gene expression can be influenced by external signals;
for example, exposure of a cell, tissue, or organism to an agent that increases or
decreases gene expression. Expression of a gene can also be regulated anywhere in
the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for
example, through controls acting on transcription, translation, RNA transport and
processing, degradation of intermediary molecules such as mRNA, or through activation,
inactivation, compartmentalization, or degradation of specific protein molecules after
they have been made, or by combinations thereof. Gene expression can be measured at
the RNA level or the protein level by any method known in the art, including, without
limitation, Northern blot, RT-PCR, Western blot, or
in vitro, in situ, or
in vivo protein activity assay(s).
[0228] The term "nucleic acid" or "nucleic acid molecules" include single- and double-stranded
forms of DNA; single-stranded forms of RNA; and double-stranded forms of RNA (dsRNA).
The term "nucleotide sequence" or "nucleic acid sequence" refers to both the sense
and antisense strands of a nucleic acid as either individual single strands or in
the duplex. The term "ribonucleic acid" (RNA) is inclusive of iRNA (inhibitory RNA),
dsRNA (double stranded RNA), siRNA (small interfering RNA), mRNA (messenger RNA),
miRNA (micro-RNA), hpRNA (hairpin RNA), tRNA (transfer RNA), whether charged or discharged
with a corresponding acetylated amino acid), and cRNA (complementary RNA). The term
"deoxyribonucleic acid" (DNA) is inclusive of cDNA, genomic DNA, and DNA-RNA hybrids.
The terms "nucleic acid segment" and "nucleotide sequence segment," or more generally
"segment," will be understood by those in the art as a functional term that includes
both genomic sequences, ribosomal RNA sequences, transfer RNA sequences, messenger
RNA sequences, operon sequences, and smaller engineered nucleotide sequences that
encoded or may be adapted to encode, peptides, polypeptides, or proteins.
[0229] The term "gene" or "sequence" refers to a coding region operably joined to appropriate
regulatory sequences capable of regulating the expression of the gene product (e.g.,
a polypeptide or a functional RNA) in some manner. A gene includes untranslated regulatory
regions of DNA (e.g., promoters, enhancers, repressors, etc.) preceding (up-stream)
and following (down-stream) the coding region (open reading frame, ORF) as well as,
where applicable, intervening sequences (i.e., introns) between individual coding
regions (i.e., exons). The term "structural gene" as used herein is intended to mean
a DNA sequence that is transcribed into mRNA which is then translated into a sequence
of amino acids characteristic of a specific polypeptide.
[0230] A nucleic acid molecule may include either or both naturally occurring and modified
nucleotides linked together by naturally occurring and/or non-naturally occurring
nucleotide linkages. Nucleic acid molecules may be modified chemically or biochemically,
or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated
by those of skill in the art. Such modifications include, for example, labels, methylation,
substitution of one or more of the naturally occurring nucleotides with an analog,
internucleotide modifications (e.g., uncharged linkages: for example, methyl phosphonates,
phosphotriesters, phosphoramidates, carbamates, etc.; charged linkages: for example,
phosphorothioates, phosphorodithioates, etc.; pendent moieties: for example, peptides;
intercalators: for example, acridine, psoralen, etc.; chelators; alkylators; and modified
linkages: for example, alpha anomeric nucleic acids, etc.). The term "nucleic acid
molecule" also includes any topological conformation, including single-stranded, double-stranded,
partially duplexed, triplexed, hair-pinned, circular, and padlocked conformations.
[0231] As used herein with respect to DNA, the term "coding sequence," "structural nucleotide
sequence," or "structural nucleic acid molecule" refers to a nucleotide sequence that
is ultimately translated into a polypeptide, via transcription and mRNA, when placed
under the control of appropriate regulatory sequences. With respect to RNA, the term
"coding sequence" refers to a nucleotide sequence that is translated into a peptide,
polypeptide, or protein. The boundaries of a coding sequence are determined by a translation
start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. Coding
sequences include, but are not limited to: genomic DNA; cDNA; EST; and recombinant
nucleotide sequences.
[0232] The term "sequence identity" or "identity," as used herein in the context of two
nucleic acid or polypeptide sequences, refers to the residues in the two sequences
that are the same when aligned for maximum correspondence over a specified comparison
window.
[0233] The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid,
protein, or vector, indicates that the cell, organism, nucleic acid, protein or vector,
has been modified by the introduction of a heterologous nucleic acid or protein, or
the alteration of a native nucleic acid or protein, or that the cell is derived from
a cell so modified. Thus, for example, recombinant cells may express genes that are
not found within the native (nonrecombinant or wild-type) form of the cell or express
native genes that are otherwise abnormally expressedover-expressed, under expressed
or not expressed at all.
[0234] The terms "approximately" and "about" refer to a quantity, level, value or amount
that varies by as much as 30%, or in another embodiment by as much as 20%, and in
a third embodiment by as much as 10% to a reference quantity, level, value or amount.
As used herein, the singular form "a," "an," and "the" include plural references unless
the context clearly dictates otherwise.
[0235] As used herein, "heterologous" or "exogenous" in reference to a nucleic acid is a
nucleic acid that originates from a foreign species, or is synthetically designed,
or, if from the same species, is substantially modified from its native form in composition
and/or genomic locus by deliberate human intervention. A heterologous protein may
originate from a foreign species or, if from the same species, is substantially modified
from its original form by deliberate human intervention. By "host cell" is meant a
cell which contains an introduced nucleic acid construct and supports the replication
and/or expression of the construct. Host cells may be prokaryotic cells such as
E.
coli, or eukaryotic cells such as fungi, yeast, insect, amphibian, nematode, or mammalian
cells. Alternatively, the host cells are monocotyledonous or dicotyledonous plant
cells. An example of a monocotyledonous host cell is a maize host cell.
EXAMPLES
Example 1: Functionalization of cannabinoids by cytochrome P450s.
[0236] The present inventors have demonstrated that cannabinoids can be functionalized in
an
in vivo plant system. Specifically, the present inventors utilized cytochrome P450 monooxygenases
(CYP) to modify or functionalize the chemical structure of cannabinoids. As shown
below, CYPs do this by inserting an oxygen atom into hydrophobic molecules to make
them more reactive and hydrophilic. A representative reaction may include the generalized
reaction in Fig. 13.
[0237] The P450 enzyme system involves several cytochrome P450 species and nonspecific cytochrome
P450 oxidoreductases. As shown in Fig. 5, the present inventors used a human cytochrome
P450 (CYP3A4) in a double construct with an exemplary human cytochrome P450 oxidoreductase,
both expressed under the control of the constitutive CaMV 35S promoter with 5' untranslated
regions to enhance translation. Protein and DNA sequences for the functionalization
of cannabinoids (CYP3A4 and P450 oxidoreductase) are identified as SEQ ID NO's. 1-4.
Expression was confirmed using RT-PCR utilizing the forward and reverse primers identified
in Table 3 below. As noted above, the present inventors demonstrated that overexpressing
of P450s generated functionalized cannabinoids which could then be glycosylated, rendering
them water-soluble.
Example 2: P450 overexpression enhances in vivo hydroxylation and glycosylation of cannabinoids in plant systems.
[0238] The present inventors have demonstrated that overexpression enhanced
in vivo hydroxylation and glycosylation of CBDA in an exemplary plant system. Specifically,
as generally shown in Fig. 6, the present inventors demonstrate that infiltration
of tobacco leaves with
Agrobacterium carrying CYP3A4 and P450 oxidoreductase was accomplished as described in herein.
Confirmation of expression was done using RT-PCR 2-3 days after infiltration (Fig.
6).
[0239] As generally shown in Fig. 7, the present inventors demonstrate that overexpression
of the CYP3A4+P450 oxidoreductase construct and subsequent feeding of at least one
cannabinoid, in this case CBDA, upon confirmation of expression resulted in
in vivo glycosylation of CBDA in tobacco leaves (Fig. 7). On average, glycosylation increased
3-fold in transgenic
N.
benthamiana plants compared to the control while hydroxylation increased up to 13-fold. As such,
in certain embodiment, tobacco glycosyltransferases may be utilized as key targets
in the current inventive technology for glycosylation of cannabinoids.
Example 3: Identification of modified water-soluble cannabinoids by mass spectrometry
[0240] The present inventors demonstrated the biosynthesis of modified functionalized as
well as water-soluble cannabinoids in both
in vitro as well as
in vivo plant system. Specifically, the present inventors identified the cannabinoid biotransformations
associated with the gene constructs in both
in vitro assays and transient leaf expression. Through the use of accurate mass spectrometry
measurements, the present inventors were able to identify and confirm the biosynthesis
of modified water-soluble cannabinoids.
[0241] Specifically, as generally shown in Figs. 1-4, the present inventors were able to
identify the glycosylated water-soluble cannabinoids in the chromatographic analysis
and were able to produce extracted ion chromatograms for peak integration. For example,
Fig. 1 panel B, illustrates the identification of multiple constitutional cannabinoid
isomers of a single glycoside moiety, while in Fig. 2 panel B, an example of multiple
constitutional isomers of the cytochrome P450 oxidation are illustrated. Peak areas
for each identified molecule were used for relative quantification between treatments.
Based on these results we confirmed biosynthesis of modified cannabinoid molecules
containing up to two glycosides moieties, O acetyl glycoside, as well as hydroxylation
(R-OH) biotransformations. Summaries of those identifications are presented in Figures
36 and 37 for CBGA and CBDA respectively.
[0242] Tables 1 and 2 are provided below further demonstrating the production of the select
modified cannabinoid molecules. Generally referring to Tables 1-2 below, the present
inventors demonstrated that based on the reduced retention time in the water: acetonitrile
HPLC gradient, the glycosylated and hydroxylated cannabinoids, which eluted earlier
than their non-modified forms, are demonstrated to be more water soluble than their
non-modified forms.
Example 4: Generation of heterologous cytosolic synthesis and glycosylation gene constructs
for expressions in tobacco leaves and cell suspensions.
[0243] As shown in Fig. 8, the present inventors generated a triple gene construct for expression
of cannabidiolic acid (CBDA) synthase in which the trichome targeting sequence had
been removed, and the glycosyltransferase 76G1 from
Stevia rebaudiana. In this construct the multi-drug ABC transporter ABCG2 was also included.
[0244] In one embodiment of the present inventive technology, the gene construct may be
used to transform a plant cell that may further be configured to be cultured in a
suspension culture. In one preferred embodiment, a cannabis cell may be transformed
with the construct generally outline in Fig. 8. In this preferred embodiment, cannabinoids
produced by the cannabis cells in the cell culture may be functionalize through the
overexpression of the CYP3A4+P450 oxidoreductase as described above, and further glycosylated
by the expression and action of the heterologous UDP glycosyltransferase (76G1) from
Stevia rebaudiana referend above. Moreover, as generally outline herein, the cannabinoids may be modified
so as to be functionalized and/or glycosylated, or generally water-soluble, and may
then be secreted into the cell wall area, in the case of a whole plant, or the surrounding
media in suspension cultures, with the aid of the ABC transporter. In one embodiment,
this construct may be used for synthesis and modification of cannabinoids in cell
suspension cultures, utilizing tobacco bright yellow cells or cannabis cells.
[0245] As generally shown in Fig. 9,
in vivo expression of CBDA synthase, UDP glycosyltransferase 76G1 and ABCG2 was confirmed.
Reverse and forward primers used in the RT-PCR reactions are provided below in Table
4 below.
[0246] The gene and protein sequence identifications for CBDA synthase are provided as SEQ
ID NO's 5 and 6 respectively. It should be noted that a variety of cannabinoid synthase
genes/proteins may be used with the current inventive technology, CBDA synthase being
exemplary only. Indeed, it is specifically contemplated that the synthase enzyme associated
with any of the cannabinoids identified herein may be incorporated into the current
invention without undue experimentation. In one embodiment, one or more of such exogenous
or endogenous synthase enzyme may further have the trichome targeting sequence excised,
again, a step that can be readily accomplished without undue experimentation. Example
may THCA synthase, CBG synthase, THCA synthase, CBDA synthase or CBCA synthase, which
may in this embodiment have their trichome targeting sequence had been removed.
[0247] The gene and protein sequence identifications for glycosyltransferase 76G1 from
Stevia rebaudiana are provided as SEQ ID NO's. 7, and 8 respectively. The gene and protein sequence
identifications for the multi-drug ABC transporter ABCG2 are provided as SEQ ID NO's
9 and 10 respectively.
Example 5: In vivo cytosolic synthesis and glycosylation of cannabinoids in N. benthamiana leaves and cell suspensions.
[0248] As shown in Fig. 10, the present inventors demonstrate that in plants, in this embodiment
N. benthamiana, expressing the above referenced cytosolic construct, glycosylation of CBGA occurred
as well as formation of modified or hydroxylated CBDA. The glycosylation of CBGA evidences
in vivo glycosylation of cannabinoids by overexpressing a glycosyltransferase in
N. benthamiana plants. The presence of glycosylated cannabinoids in wild type plants suggests the
presence of a strong glycosyltransferase in tobacco. As such, in one embodiment, over
expression of a heterologous or homologous tobacco glycosyltransferase may expressed
or overexpressed resulting in the enhanced
in vivo biosynthesis of water-soluble cannabinoids in whole plants, as well as in suspension
cultures. For example, in one embodiment, a heterologous tobacco glycosyltransferase
may be expressed in a cannabis plant or cell culture resulting in the
in vivo biosynthesis of water-soluble cannabinoids in the
Cannabis plant and/or a
Cannabis suspension cultures.
Example 6: Water Soluble cannabinoid production systems utilizing MTB transcription
factor and/or catalase.
[0249] The present inventors have developed a plurality of systems for the biosynthesis
and modification of cannabinoids based on cellular location using novel methods of
protein targeting. As shown in Table 10, the present inventors designed such novel
systems and methods to enhance production and modification (glycosylation, acetylation
and functionalization) of cannabinoids as well as to mitigate toxicity resulting from
cannabinoid accumulation. Certain embodiments, included the expression of a MYB transcription
factor and a catalase (Fig. 27) to degrade hydrogen peroxide resulting from CBDA synthase
activity. In one preferred embodiment, the present inventors used
Arabidopsis thaliana or an
E.
coli catalase gene and a predicted
Cannabis MYB transcription factor involved in elevating genes involved in cannabinoid biosynthesis.
DNA and protein sequences for
Cannabis predicted MYB transcription factor (SEQ ID NOs. 11-12, DNA and amino acid sequences
respectively),
Arabidopsis thaliana catalase SEQ ID NOs. 13-14, DNA and amino acid sequences respectively) and/or
E.
coli catalase (SEQ ID NO. 15-16, DNA and amino acid sequences).
Example 7: Enhanced in vivo cytosolic synthesis and glycosylation of cannabinoids in tobacco leaves and cell
suspensions.
[0250] The present inventors have demonstrated the enhanced
in vivo modification of cannabinoids in transgenic plants co-infected with constructs for
glycosylation, P450-mediated functionalization (hydroxylation) and detoxification
of hydrogen peroxide by catalase._As further shown in Fig. 11, functionalization and
glycosylation, mainly of the substrate CBGA was observed in transgenic tobacco plants
overexpressing CBDA synthase, UDP glycosyltransferase and ABC transporter but increased
when overexpression of this construct was coupled with cytochrome P450, MYB transcription
factor and catalase. As previously noted, overexpression of a cytochrome P450 enhanced
glycosylation of cannabinoids. As such, the present inventor demonstrated the formation
and glycosylation of CBDA
in vivo in transiently transformed tobacco leaves fed with the precursor CBGA.
[0251] The present inventors also compared the activities of endogenous and transgenic glycosyltransferase
activities in tobacco. Specifically, as shown in Fig. 12, the present inventor performed
in vitro assays of UDP glycosyltransferase and CBDA synthase. Short assays of 3 hours at 30°C
did not reveal any difference in glycosylation of CBGA between the wild type and transgenic
N. benthamiana plants, suggesting endogenous glycosylation. In extended assays (14 hours), there
was a significant difference in the detection of glycosylated CBGA in transgenic plants
compared to the wild type demonstrating increased glycosylation activity in transgenic
plants.
[0252] In certain embodiment, glycosyltransferases from tobacco, or other plants may be
used as herein described. In one embodiment, one or more heterologous or homologous
glycosyltransferases may be expressed or over expressed in a plant, such as tobacco
or
Cannabis. Gene and protein sequences for exemplary glycosyltransferases are identified below
in Table 9.
Example 8: Generation of trichome-targeted cannabinoid synthesis and glycosylation
constructs of cannabidiolic acid (CBDA).
[0253] As shown in Figs. 14-15, the present inventors demonstrated a system of trichome-targeted
synthesis and synthesis and glycosylation of cannabinoid compounds, such as CBDA.
By targeting CBDA synthase, a UDP-glucose/UDP-galactose transporter (PM-UTR1) targeted
to the plasma, and a
Stevia UDP-glycosyltransferase 76G1 (tsUGT) to the trichomes, these genes may produce and
accumulate, in this case CBDA and its glycosylated derivatives (primary, secondary
glycoside), as well as novel CBDA derivatives, in the trichomes.
[0254] SEQ ID NO. 17 is identified as the polynucleotide gene sequence for a CBDA synthase
having a trichome targeting sequence. SEQ ID NO. 18 is identified as the corresponding
protein sequence for a CBDA synthase having a trichome targeting domain.
[0255] SEQ ID NO. 19 is identified as the polynucleotide gene sequence for a trichome-targeted
UDP-glycosyltransferase (76G1) coding sequence, in this instance being optimized for
Arabidopsis thaliana expression, although other codon optimized versions fall within the scope of this
invention. SEQ ID NO. 20 is identified as the corresponding protein sequence for a
UDP-glycosyltransferase (76G1) having a trichome targeting domain.
[0256] SEQ ID NO. 21 is identified as the polynucleotide gene sequence for a UDP-glucose/galactose
transporter (UTR1) having a plasma-membrane targeting sequence.
Example 9: Trichome-targeted synthesis and glycosylation of cannabidiolic acid (CBDA).
[0257] As shown in Figs. 16-17, gene expression of CBDA synthase, tsUGT and PM-UTR1 in
N. benthamiana infiltrated leaves was confirmed 2DPI (Days Post Infiltration of Agrobacterium Ti-plasmid
constructs) via RT-PCR (Figs. 19 and 20). As expected, CBGA substrate was detected
in all infiltrated leaves and wild type control (no
Agrobacterium infiltration). CBGA primary and secondary glycosides were also detected in all infiltrated
leaves and wild-type control, further demonstrating an endogenous glycosyltransferase
activity acting upon CBGA. Moreover, CBGA acetylated primary glycoside was detected
in all samples, including WT control, providing evidence of endogenous acetylation.
CBDA was detected at marginal levels in samples infiltrated with both trichome and
cell suspension constructs, but not in wild type plants.
Example 10: Cytosolic-targeted synthesis and glycosylation of cannabidiolic acid (CBDA).
[0258] The present inventors have demonstrated a system of cytosolic-targeted cannabinoid
synthesis and glycosylation. By targeting or localizing, CBDA synthase (CBDAs) and
UDP-glycosyltransferase 76G1 (UGT) to the cytosol, the present inventors demonstrated
that plants expressing these heterologous genes produce and accumulate, in this embodiment,
CBDA and its glycosylated derivatives (primary, secondary glycoside), as well as other
CBDA derivatives, in the cytosol. As shown in Fig. 18, a gene expression vector for
the cytosolic cannabinoid production system was generated. This construct included
a cauliflower mosaic 35S promoter; AtADH 5'-UTR, enhancer element; cytCBDAs, cannabidiolic
acid synthase with the trichome target sequence removed; HSP terminator; cytUGT76G1,
UDP glycosyltransferase from
Stevia rebaudiana.
[0259] SEQ ID NO. 22 is identified as the polynucleotide gene sequence for a, cannabidiolic
acid synthase with the trichome target sequence removed (cytCBDAs). SEQ ID NO. 23
is identified as the corresponding protein sequence of cytCBDAs.
[0260] SEQ ID NO. 24 is identified as the polynucleotide gene sequence for a, Cytosolic-targeted
UDP-glycosyltransferase (UGT76G1) coding sequence (optimized for
Arabidopsis thaliana expression) (cytUGT76G1 or cytUTG). SEQ ID NO. 25 is identified as the corresponding
protein sequence of cytUGT76G1 or cytUTG.
[0261] As an exemplary plant model,
N. benthamiana plants were grown from seed and after 4 weeks of vegetative growth, leaves were co-infiltrated
with
Agrobacterium tumefaciens GV3101 carrying the following constructs: Cytosolic CBDAs + Cytosolic UGT in pRI201-AN
or cell suspension construct, Myb/catalase in pRI201-AN, and p19 silencing suppressor
in pDGB3alpha2.
Agrobacterium density was normalized to 2 at absorbance of 600nm using a spectrophotometer and
cultures co-infiltrated in same ratio (1:1:1). After 2 and 4 days post-Agrobacterium
infiltration (DPI), 1mL CBGA (2.7mM) dissolved in 0.1% Tween 20 (Sigma-Aldrich) or
0.1% Triton X-100 (Sigma-Aldrich) was infiltrated to each leaf. In a second embodiment
using the cytosolic construct, 4mM UDP-glucose was added to the CBGA media before
feeding. Three biological replicates were used. RT-PCR primers are outlined in Table
5 below.
[0262] As shown in Figs. 19-20, gene expression of cytCBDAs and cytUGT was confirmed via
RT-PCR after 1 and 2DPI. No expression of ABC transporter (ABCt) was observed after
1DPI in leaves infiltrated cells suspension construct. This does not impact this experiment
as the role of ABCt was to facilitate cannabinoid transport outside the cells in suspension
cultures. As shown in Fig. 21, CBGA and its glycosylated and acetylated derivatives
were detected in concentrations higher than in the trichome construct infiltrated
leaves, except for secondary glycosides. Moreover, CBDA was detected in higher concentrations
(up to 34 ppm) in leaves infiltrated with the cell suspension construct, compared
to the trichome construct experiments (up to 2.6 ppm). As shown in Fig. 22, when UDP-glucose
4mM (substrate for UGT) was provided together with CBGA (substrate for CBDAs), the
present inventors detected low levels of glycosylated and hydroxylated CBDA in leaves
infiltrated with both the cytosolic and cell suspension construct, but not in the
WT control. This result demonstrates the novel in plant synthesis, glycosylation and
hydroxylation of CBDA in the surrogate plant
N. benthamiana, as demonstrated by the Extracted Ion Chromatograms shown in Fig. 23.
Example 11: Hydroxylation and glycosylation of cannabinoids in Cannabis Sativa.
[0263] The present inventors demonstrate the glycosylation and hydroxylation of cannabinoids
in
Cannabis sativa. To further confirm our findings using
N. benthamiana as a plant model, we performed
Agrobacterium infiltration of the same plasmid constructs described in the section above in various
strains of
Cannabis sativa (see Fig. 24 Sample IDs). As shown in Figs. 24-26, expression of the select genetic
constructs in
C.
sativa, as in
N. benthamiana, demonstrate synthesis and accumulation of hydroxylated and/or glycosylated cannabinoids,
in this case CBDA. A comparison of the results using different
Agrobacterium genetic constructs is presented in Table 8 below.
[0264] As the present inventors have demonstrated, in one embodiment, where the cytosolic
construct was con-transformed with the Myb/catalase (MYBCAT) expression vector, yielded
the highest detection of CBDA and CBDA glycoside, demonstrating the role of these
genes in mitigating toxicity effects due to hydrogen peroxide accumulation (catalase)
and overall increase in cannabinoid synthesis (Myb transcription factor).
Example 12: Intracellular expression of glycosyltransferases in yeast cells.
[0265] Four glycosyltransferases from
Nicotiana tabacum (NtGT1, NtGT2, NtGT4, NtGT5), one from
Stevia rebaudiana (UGT76G1), and
Escherichia coli catalase E (Kat-E) encoding sequences were codon-optimized for expression in
Pichia pastoris, synthesized by Genewiz, and cloned into pPink-HC or pPINK-αHC vector as described
in the PichiaPink expression system manual (Invitrogen). The assembled constructs
were verified by restriction enzyme digestion and DNA sequencing. Each of the constructs
was used to transform the wild-type strain (strain 4). Transgene expression in transgenic
yeast and expression was verified by RT-PCR (Figure 41). The list of primers used
in PCR verification of transgene expression is shown in Table 13. Codon optimized
DNA and corresponding amino acid sequence identities are as follows: NtGT1 (SEQ ID
NO. 51, and SEQ ID NO. 52 respectively); NtGT2 (SEQ ID NO. 53, and SEQ ID NO. 54 respectively);
NtGT3 (SEQ ID NO. 55, and SEQ ID NO. 56 respectively); NtGT4 (SEQ ID NO. 57, and SEQ
ID NO. 58 respectively); NtGT5 (SEQ ID NO. 59, and SEQ ID NO. 60 respectively); UGT76G1
(SEQ ID NO. 61, and SEQ ID NO. 62 respectively); Kat-E (SEQ ID NO. 65, and SEQ ID
NO. 66 respectively). Additional codon optimized exogenous glycosyltransferases that
may be used with the current invention may include, but not be limited to: UGT73A10
(SEQ ID NO. 63, and SEQ ID NO. 64 respectively);
Example 13: Introducing CBDA to yeast cells in acetonitrile.
[0266] The present inventors demonstrated that after transformation of vectors into the
wild type yeast strain, white colonies were selected and transferred into 250mL flasks
containing 50mL YPG media (yeast extract, peptone, glycerol). After overnight growth
(the cultures reached an OD
600∼1), 100% methanol was added at 5% v/v to induce gene expression overnight. The following
morning, cultures were aliquoted into 3x 10mL cultures, centrifuged and resuspended
in fresh YPG media with 2.5% v/v methanol, and 50uL of CBDA in acetonitrile (1mg/mL,
Cayman Chem) was added to a final concentration of 14uM. After 72hs, the samples were
centrifuged down and the cell pellet and supernatant were separately frozen in liquid
nitrogen and stored at -80°C for further LC/MS analysis of cannabinoids.
Example 14: Glycosylation of CBDA by NtGT4.
[0267] The present inventors demonstrate that intracellular expression of NtGT4 (construct
outlined in Figure 42), the UGT 73-like glycosyltransferase from
Nicotiana tabacum, led to the highest level of glycosylation of CBDA (Figure 43 A and B). The CBDA glycoside
was detected in the pellet (Figure 43B) as well as in the supernatant (Figure 9A)
suggesting that the yeast is secreting the product into the media, presumably by an
endogenous ABC transporter. Overall, glycosylation by NtGT4 was significantly higher
than by any other glycosyltransferase tested. NTGT1, NtGT2 and the Stevia UGT76G1
had only trace levels of CBDA glycosides that were not significantly different in
yield from the untransformed wild-type strain.
Example 15: Glycosylation of CBDA by NtGT5.
[0268] The present inventors demonstrate that intracellular expression of NtGT5, the 7-deoxyloganetin
glycosyltransferase-like from
Nicotiana tabacum, led to glycosylation of CBDA (Figures 43 and 44). The present inventors further demonstrate
that NtGT5 is not only capable of catalyzing the same R-OH position as NtGT4 but preferentially
glycosylates a different and less water-soluble position than NtGT4. (Generally panels
B &E of figure 37)
Example 16: Introducing CBD oil extract to yeast cells.
[0269] 50mL cultures of transgenic yeast were induced with methanol after 24 hours of growth
in YPG and fed with 227 uM cannabidiol (CBD) in the form of a commercial diluted CBD
oil (Minnerva Canna). After 72hs, the samples were centrifuged down and pellet and
supernatant were separately frozen in liquid nitrogen and stored at -80°C for LC/MS
analysis of cannabinoids. As in the CBDA feeding experiments, the present inventors
demonstrate that NtGT4 and NtGT5 yielded the highest levels of glycosylation in different
positions on CBD oil feeding experiments (Figure 44). CBDA glycosides were detected
in both supernatant (Figure 45A, D and F) and pellet (Figure 45 B, C and E). Oil extract
feeding allowed the present inventors to investigate glycosylation of other cannabinoids.
NtGT5 glycosylated the cannabinoid precursor CBGA (Figure 45).
Example 17: Extracellular glycosylation of cannabinoids.
[0270] As described above, in one exemplary embodiment, an expression vector was used by
the present inventors to secrete proteins into the media for an extracellular glycosylation
of cannabinoids. Transgenic yeast lines expressing glycosyltransferases with the α-factor
secretion signal (Figure 35A) were fed CBD oil extract as previously described and
analyzed for glycosylated cannabinoids. There was no glycosylation in the pellets
as expected since the enzymes were secreted into the media. There was only minimal
glycosylation in the supernatant (Figure 46) in comparison with the intracellular
system.
Example 18: Time course analysis of intracellular cannabinoid glycosylation.
[0271] To determine the optimum time for cannabinoid glycosylation in yeast, the present
inventors set up a time course experiment. Transgenic yeast expressing NtGT4 intracellularly
were fed with CBDA (27µM) and incubated for up to 96 hours. Samples were collected
at different time points during the incubation and analyzed for the formation of CBDA
glycosides (
See Figure 47). In both pellet and supernatant, a reciprocal relationship was observed
by the present inventors between CBDA loss and CBDA glycoside production. For the
supernatant (media), CBDA depletion was most likely due to uptake by the yeast. In
the pellet, CBDA depletion can be explained by its glycosylation into CBDA glycosides.
The optimal time for CBDA glycosylation was 48 hours, after which CBDA levels increased
and CBDA glycosides dropped, suggesting that there is possibly an inducible and competing
glycosidase activity present in the yeast that is turning over the CBDA glycoside.
To prevent this glycosidase, the present inventors may introduce glycosidase inhibitors
to preserve CBDA glycosides or suppress the expression of the endogenous glycosidases.
In additional embodiment, the present inventors may overexpress an ABC transporter
to speed up secretion of CBDA glycosides into the media. One example may include the
expression of a multi-drug resistant transporter ABCG2 (SEQ ID No. 67 and SEQ ID No.
67) in tobacco. Through transcriptomics may also be employed by to identify possible
candidates in yeast overexpressing glycosyltransferases.
Example 17: Glycosylation of cannabinoids in tobacco Bright Yellow Cells
[0272] Similar to yeast suspension cultures, plant cell cultures are a viable platform for
the production of recombinant proteins because they can be cultivated under sterile
conditions and can be scaled up in fermenters for industrial level production. One
of the most widely used cell lines in plant biology is the tobacco Bright Yellow 2
(BY2) cell line developed in 1968 at the Hatano Tobacco Experimental Station, Japan
Tobacco Company. BY2 cells have a doubling time of 16-24 hours, multiplying up to
a 100-fold in 7 days t al., 2016), can be easily transformed by
Agrobacterium mediated transformation and require basic plant growth media for maintenance. As
described above, the prevent inventors demonstrated endogenous glycosylation in tobacco
leading to the possibility of using tobacco suspension cultures as a postharvest glycosylation
platform. In this embodiment, the present inventors introduced wild-type and transgenic
BY2 cells expressing the
Stevia glycosyltransferase UGT76G1 (SEQ ID NO. 61 and SEQ ID NO. 62) and the multidrug resistance
transporter ABCG2 (319C) (SEQ ID NO. 67 and SEQ ID NO. 67) with 5µM CBDA in acetonitrile
and grew the cultures for 3 days. Confirmation of transgene expression in BY2 cells
was done by RT-PCR with primers amplifying a ≈0.5kb region of the transgene (Figure
48).
[0273] For the CBDA 1x O acetyl glycoside, glycosylation was observed in the wild type more
than in transgenic lines. For all other forms of glycosylated CBDA, the transgenic
line 319C had increased glycosylation compared to the wild type. The present inventors
ran a comparison between glycosylation in yeast and tobacco yields, normalizing with
pellet mass (Figure 49).
[0274] As demonstrated in the figures, in general, a more diverse range of glycosylated
products were obtained in tobacco compared to yeast (see chromatograms in Figures
38, 39 and 40). The common compounds produced were the CBDA 1x glycoside and the CBDA
2x glycoside. For the 1x glycoside, glycosylation in yeast lines overexpressing NtGT4
was significantly higher than in the BY2 cells overexpressing the
Stevia UGT76G1. However, for the 2x glycoside (predicted to be more water-soluble than 1x
glycoside), BY2 cells demonstrated higher glycosylation rate than the yeast (Figure
49B). However, in BY2 cell cultures, low amounts of CBDA glycosides (<6 arbitrary
units, normalized to fresh weight) compared to yeast cells (50-200 normalized arbitrary
units) were detected in the supernatant, suggesting lower secretion in tobacco suspension
cultures. In certain embodiments, co-expressing the tobacco NtGT4 and NtGT5 with an
ABC transporter, such as ABCG2, under constitutive promoters in BY2 cells may increase
glycosylation in tobacco and make BY2 cell cultures providing an alternative platform
for production of water-soluble cannabinoids.
[0275] Additional embodiments of the current invention may include the transformation of
tobacco, yeast or plant cells, such as Cannabis, with one or more exogenous P450 genes.
In one preferred embodiment, this may include Cytochrome P450 (CYP3A4)
from Mus musculus (SEQ ID NO. 69 and 70) as well as P450 oxidoreductase gene (CYP oxidoreductase) from
Mus musculus (SEQ ID NO. 71 and 72). In some embodiment, the aforementioned gene may be codon
optimized for expression in yeast cells.
MATERIALS AND METHODS
Materials and Methods Example 1: Use of a tobacco as an exemplary plant system for
the in vivo functionalization and glycosylation of cannabinoids.
[0276] The present inventors demonstrated the
in vivo functionalization and glycosylation of cannabinoids in a model plant system. Specifically,
the present inventors used
N. benthamiana (tobacco) as a model system to demonstrate
in vivo functionalization and glycosylation of cannabinoids. In this embodiment, transient
transformation through
Agrobacterium infiltration was performed in
N. benthamiana. The present inventors demonstrated expression of heterologous genes that were expressed
in transformed
N. benthamiana using a number of heterologous gene expression vectors (described below). In this
exemplary embodiment, upon confirmation of expression of the heterologous genes that
would functionalize and glycosylate cannabinoid molecules, the present inventors introduced
to the plants select cannabinoid compounds. In this embodiment, the present inventors
introduced to the transgenic
N.
benthamiana plants cannabigerolic acid (CBGA) and/or cannabidiolic acid (CBDA). The present inventors
also demonstrated the
in vivo functionalization and glycosylation of cannabinoids in a cell suspension culture.
Specifically, the inventors used exemplary tobacco bright yellow (BY2) cells as a
cell suspension system for studies of cannabinoid production, functionalization and/or
glycosylation.
Materials and Methods Example 2: Transient transformation of the exemplary plant model
Nicotiana benthamiana.
[0277] The present inventors used
Agrobacterium tumefaciens Ti-plasmid-mediated transformation with the plant expression vector pRI201-AN (Takara
Bio USA), a binary vector for high-level expression of a foreign gene in dicotyledonous
plants carrying the constitutive 35S promoter and an
Arabidopsis thaliana Alcohol dehydrogenase (AtAdh) as a translational enhancer (Matsui et al. 2012).
N. benthamiana was transiently transformed according to the method described by Sparkes et al. 2006.
Overnight cultures of
Agrobacterium strain GV3101 were transferred to a 250mL flask with 50 mL LB medium supplemented
with 50mg/L of Kanamycin, 50mg/L of Gentamycin and 10mg/L of Rifampicin and grown
for 4-8 hours until the optical density at 600nm (OD600) reached approximately between
0.75 and 1. The cells were pelleted in a centrifuge at room temperature and resuspended
in 45mL of infiltration medium containing 5g/L D-glucose, 10mM MES, 10mM MgCl2 and
100 µM acetosyringone. 1ml of the solution was used to infiltrate the leaves using
a 1mL syringe. Expression of the transgene(s) was confirmed 2-4 days after infiltration
by RT-PCR. For RT-PCR analysis, 100 mg of leaf tissue were frozen in liquid nitrogen
and ground in a TissueLyser (QIAGEN Inc, USA). RNA was extracted following the EZNA
plant RNA extraction kit (Omega Bio-tek Inc, USA). Up to a microgram of total RNA
was used to synthesize cDNA using the superscript III cDNA synthesis kit (Thermo Fisher
Scientific, USA). The cDNA was used to check for the expression of transgene(s) by
RT-PCR.
Materials and Methods Example 3: Introduction of select cannabinoid substrate(s) to
the transgenic N. benthamiana strain.
[0278] Select enzyme substrates were introduced to the transgenic or genetically modified
N.
benthamiana strain two days after
Agrobacterium infiltration and upon confirmation of transgene expression by RT-PCR. In this example,
approximately 277 µM cannabigerolic acid (CBGA) and/or cannabidiolic acid (CBDA) was
dissolved in 1mL of buffer containing 10mM MES, 10mM MgCl
2 and 0.1% Triton X100 or 0.1% Tween20 and applied to the transformed leaves either
by infiltration or by dabbing with a cotton applicator. Plants were harvested after
1-4 days, weighed for fresh weight and frozen at -80°C before conducting LC-MS analysis
for the presence of modified cannabinoids.
Materials and Methods Example 4: In vitro assays for CBDA synthase and glycosyltransferase activity.
[0279] CBDA synthase is generally active in the pH range 4-6 (Taura et al. 1996) while glycosyltransferases
are typically active in the pH range 5.0 to 7.0 (Rini and Esko, 2017). Based on this
difference in optimal pH for enzyme activity, the present inventors generated a single
extraction buffer for a combined assay of CBDA synthase and UDP glycosyltransferase
at pH 6 and 30°C in
in vitro assays (Priest et al., 2006). The present inventors ground the transformed leaf tissue
in liquid nitrogen. A grinding buffer was added consisting of 50mM MES, pH 6, 1mM
EDTA, 5 mM β-mercaptoethanol and 0.1% Triton X-100 was added at 5:1 ratio of buffer
to fresh weight of plant using a mortar and pestle. The extract was filtered on ice
through 2 layers of cheesecloth to remove debris and centrifuged at 21000 g for 5
minutes at 4°C. The supernatant was used in subsequent assays. Protein concentration
of the supernatant was quantified by the Bradford assay, using bovine serum albumin
as the standard. To start the reaction, 100-200 µg of crude total protein was used.
The assay was carried out with and without UDP-glucose to check if glycosylation of
cannabinoid substrate was preventing downstream reactions or transport of CBGA. Wild
type plants were used as controls to separate endogenous from overexpressed UDP glycosyltransferase
activity. The reaction was started by adding 100 µg of protein, and 8 mM uridine diphosphate
glucose (UDPG) as the sugar-nucleotide donor to a reaction mixture consisting of approximately
277 µM CBGA, 0.1% (w/v) Triton X-100, 3mM MgCl
2 and 50mM MES (pH 6.0). The reaction was incubated at 30 °C for 3h or overnight for
14 hours. The reaction was terminated by freezing in liquid nitrogen and the samples
were stored at -80°C before LC-MS analysis.
Materials and Methods Example 5: Trichome-targeted synthesis and glycosylation.
[0280] As an exemplary plant model,
N. benthamiana plants were grown from seed and, after 4 weeks of vegetative growth, the leaves were
co-infiltrated with
Agrobacterium tumefaciens GV3101 carrying the following constructs: Trichome CBDAs + trichome UGT in pRI201-AN
(trichome construct), PM-UTR1 in pRI201-AN, and p19 silencing suppressor in pDGB3alpha2.
In a second experiment, leaves were also infiltrated with the
Agrobacterium expressing a Ti-plasmid with the Myb/catalase genes.
Agrobacterium density was normalized to 1 or 2 at absorbance of 600nm using a spectrophotometer
and cultures co-infiltrated in same ratio (1:1:1). After 1 and 4 days
post-Agrobacterium infiltration (DPI), 1mL CBGA (277 µM) dissolved in 0.1% Tween20 (Sigma-Aldrich) or
3% DMSO (Sigma-Aldrich) was infiltrated to each leaf. Three biological replicates
were used. The experiment was repeated twice. After preliminary results,
Agrobacterium densities of 2 at OD
600 were selected for all following infiltration experiments. Moreover, 0.1% Tween20
was chosen over DMSO 3% due to better solubilizing CBGA substrate.
[0281] In this embodiment, leaf samples were collected at 2DPI and immediately frozen in
liquid nitrogen. RNA extraction was done using RNA plant mini-kit as described by
manufacturer (Qiagen). cDNA was synthesized using RNA to cDNA Ecodry Premix as described
by manufacturer (Takara). Template cDNA was normalized to 50ng of corresponding total
RNA per reaction. Annealing temperature in Celsius: 60. Extension time: 15s. 35 cycles.
Q5 DNA polymerase kit used as described by manufacturer (New England Biolabs). RT-PCR
primers are outlined in Table 5 below.
Materials and Methods Example 6: Transient transformation of Cannabis sativa.
[0282] The present inventors performed
Agrobacterium tumefaciens-mediated transient transformation of
Cannabis sativa. The experimental groups consisted of young leaves of high CBD variety (∼10% in dried
flowers) and trichome leaves of high THC variety (∼20% dried flowers).
[0283] To transform leaves of high CBD varieties, the present inventors germinated 100 seeds
three times; this was done to ensure that a sufficient number of plants would be available
for all 9 independent transformation events. To transform trichome leaves, the present
inventors used small trichome-containing leaves of several varieties known to be high
THC varieties. Experimental set up consisted of 2 different
Agrobacterium tumefaciens strains. For transient transformation of
Agrobacterium strain EHA 105, the present inventors grew cells in 10 ml of LB medium supplemented
with 100mg/L of Rifampicin and 50mg/L of Kanamycin and for
Agrobacterium strain GV3101::6000 cells were grown with 50mg/L of Kanamycin, 25mg/L of Gentamycin
and 50mg/L of Rifampicin. A single
Agrobacterium colony was used for inoculation and grown overnight. Then, 1 ml of this culture was
inoculated into 500 ml of aforementioned LB medium supplemented with 20 µM acetosyringone.
Agrobacteria were grown to OD
600 of approximately between 1 and 1.5. The cells were pelleted in a centrifuge at room
temperature and resuspended in infiltration medium containing 10mM MES, 10mM MgCl
2 and 200 µM acetosyringone to an OD
600 of 0.5.
[0284] Bacterial culture was then used for three different types of
Cannabis Sativa transformations. In all cases, transformation was done in the form of co-transformation,
mixing all relevant strains (plasmids) in equal proportion of cell numbers. First,
for the present inventors infiltrated young (two weeks old) fully expended
Cannabis sativa plants using 1 ml syringe. Prior to transformation, plants were kept under plastic
cover, to ensure maximum softness of the leaves. Infiltration was performed from abaxial
side, ensuring that the entire surface of the leaf is infiltrated at 12/h/12h day/night
at 22° C.
[0285] Second, the present inventors vacuum infiltrated detached young (two weeks old) fully
expended
Cannabis sativa leaves. Prior to transformation, plants were kept under plastic cover, to ensure
maximum softness of the leaves. Leaves were then placed on half-strength Murashige
and Skoog (1962) (½ MS) agar supplemented with 61.8 mM ammonium nitrate and incubated
for 5 days at 12/h/12h day/night at 22° C.
[0286] Third, trichome leaves were detached, placed into 50 ml Falcon tubes and vacuum infiltrated
with aforementioned bacterial solution 2 x for 10 min each. Leaves were then placed
on ½ MS agar supplemented with 61.8 mM ammonium nitrate and incubated for 5 days.
[0287] All experiments were done in triplicates, with the fourth replicate done for collection
of DNA/RNA and staining X-gluc for measuring the activity of beta-glucuronidase (GUS)
after co-infiltration with
Agrobacterium-containing GUS gene. In all cases, leaves were harvested after 5 days of transformation, frozen
in liquid nitrogen and stored at -80°C.
Materials and Methods Example 7: Extraction of water-soluble cannabinoids from N. benthamiana.
[0288] Fresh transformed plant material was harvested from greenhouse experiments in 15
or 50 mL polypropylene centrifuge tubes and flash frozen in liquid N
2. The frozen plant material was enzymatically quenched by submersing the plant material
in boiling methanol for 2 min. The methanol-quenched material was homogenised using
a P-10-35 homogenizer (Kinematica, Bohemia NY). The homogenate was extracted by brief
agitation in a final volume of 10 mL or 30 mL 70% methanol (v/v) respective to tube
size. The resulting extracts were clarified by centrifugation at 2,500 rpm at 4°C
for 15 minutes in a Beckman J-6B floor centrifuge (Beckman Coulter, Indianapolis IN).
The supernatant was transferred into a polypropylene tube and evaporated under a stream
of N
2 at 45°C until dried. The extracts were reconstituted in methanol containing 20 µg/mL
of the internal standard 7-Hydroxyoumarin (Sigma-Aldrich, H24003). The reconstituted
extracts were placed into 1.5 mL microfuge tubes and clarified in a microcentrifuge
at 10,000g for 15 min. 500 µL of the supernatant was transferred to a 2 mL auto sampler
vial and kept at 4°C until analysis.
In vitro assays sample preparation: samples were syringed filtered through 0.45µm PVDF membrane
into a 2 mL auto sampler vial.
Materials and Methods Example 8: Extraction of water-soluble cannabinoids from Cannabis sativa.
[0289] Fresh plant material was harvested from plants grown in chamber in 1.5 mL polypropylene
centrifuge tubes and flash frozen in liquid N
2. The frozen plant material was homogenized using pestle and mortar and enzymatically
quenched by submersing the plant material in boiling 100% ethanol for 2 min. Homogenized
solution was diluted to 70% ethanol. The resulting extracts were clarified by centrifugation
at 2,500 rpm at 4°C for 15 minutes in Eppendorf centrifuge (Centrifuge 5415 R). The
supernatant was transferred into a polypropylene tube and concentrated three times
using vacuum centrifuge (Speedvac SC110, Savant). 2 µl of 20 µg/mL of the internal
standard Umbelliferone (Sigma-Aldrich, H24003) was added to 98 µl of concentrated
extract and taken for analysis.
Materials and Methods Example 9: Liquid chromatography mass spectrometry used to confirm
functionalization and glycosylation of cannabinoids.
[0290] The present inventor used liquid chromatography mass spectrometry to confirm functionalization
and glycosylation of cannabinoids in the exemplary plant systems described herein.
Specifically, mass spectrometry was performed on a quadrupole time-of-flight (QTOF)
mass spectrometer (QTOF Micro, Waters, Manchester, UK) equipped with a lockspray™
electrospray ion source coupled to a Waters Acquity UPLC system (Waters, Manchester,
UK). Mass spectra were collected in the negative electrospray ionization mode (ESI-).
The nebulization gas was set to 400 L/h at a temperature of 350°C, the cone gas was
set to 15 L/H and the source temperature was set to 110°C. A capillary voltage and
cone voltage were set to 2500 and 35 V, respectively. The MCP detector voltage was
set to 2500 V. The Q-TOF micro MS acquisition rate was set to 1.0 s with a 0.1 s interscan
delay. The scan range was from 100 to 1500 m/z. Data was collected in continuum mode.
A lockmass solution of 50 ppm raffinose (503.1612 m/z) in 50:50 water:methanol was
delivered at 20 µL /min through an auxiliary pump and acquired every 10 s during the
MS acquisition. Separations were performed on a Waters HSS T3 C18 column (2.1 x 100
mm, particle size 1.8 µm) using a Waters ACQUITY UPLC System, equipped with an ACQUITY
Binary Solvent Manager, ACQUITY Column Manager and ACQUITY Sample Manager (10 µL sample
loop, partial loop injection mode, 5 µL injection volume, 4°C). Eluents A and B were
water and acetonitrile, respectively, both containing 0.1% formic acid. Elution was
performed isocratically for 0.5 min at 10% eluent B and then linear gradient 100%
eluent B in 14.5 min, and isocratically for 3 min at 100% eluent B. The column was
re-equilibrated for 6 min. The flow rate was set to 250 µL/min and the column temperature
was maintained at 30°C.
Materials and Methods Example 10: Data processing.
[0291] Identification of individual cannabinoid analogs was performed by the present inventors,
by their corresponding accurate mass shifts by Metabolynx (Waters Corp., Milford,
USA). The method parameters for data processing were set as follows: retention time
range 0.1-18 min, mass range 100-1500 Da, retention time tolerance 0.2 min, mass tolerance
0.05 Da, peak intensity threshold 14. Accurate mass measure of the continuum data
was performed using the raffinose lock mass. Raw chromatographic data were additionally
processed for extracted ion chromatogram sand peak area integration using Masslynx
4.1 (Waters Corp., Milford, USA). The select cannabinoids, CBGA and CBDA were identified
and quantitated using certified reference materials (Cerilliant, Round Rock, TX).
All chemical structures and physiochemical and constitutional properties were generated
using ChemDoodle version 8.1.0 (IChemLabs™, Chesterfield, VA).
Materials and Methods Example 11: Yeast cell gene expression system.
[0292] The present inventors generated an exemplary yeast-cell expression system based on
the methylotrophic yeast
Pichia pastoris (Komagataella phaffii) was used in this work. The PichiapinkT
M system includes protease-deficient host strains and allows both intracellular as
well as secreted protein production. In addition, the use of the inducible promoter
alcohol oxidase (AOX1) uncouples growth from production of desired proteins, so that
cells are not stressed by the accumulation of recombinant protein during growth phase
yeast strain 4 (herein referred to as wild-type, WT), a double knockout for proteases
prb1, pep4 (to avoid degradation of desired protein), was the background strain in
the present inventor's yeast transformations. For secretion of proteins into the media,
genes of interest were cloned in frame into the vector pPINK-αHC which contains the
Saccharomyces cerevisiae α-mating factor pre-sequence for secreted expression of recombinant proteins. For
intracellular production of proteins, the vector pPINK-HC was used. Both vectors contained
the ADE2 marker for selection on minimal media lacking adenine (Figure 35). Transformation
and selection of transformants was conducted according to the manufacturer's instructions
(Invitrogen). Such example is non-limiting, as a variety of expression vectors may
be used with the current invention.
Materials and Methods Example 12: Analysis of yeast system transgene expression.
[0293] Expression analysis for introduced transgenes was carried out by RT-PCR. For yeast,
2mL of a 2-day old culture induced by methanol was centrifuged in a microfuge tube.
The pellet was ground in a TissueLyser (QIAGEN Inc, USA). RNA was extracted following
the EZNA plant RNA extraction kit (Omega Bio-tek Inc, USA). Up to a microgram of total
RNA was used to synthesize cDNA using the superscript III cDNA synthesis kit (Thermo
Fisher Scientific, USA). The cDNA was used to check for the expression of transgenes
by RT-PCR.
Materials and Methods Example 13: Transformation of tobacco BY2 cells for cell suspension
expression system.
[0294] The present inventors used Agrobacterium Ti-plasmid mediated transformation with
the plant expression vector pRI201-AN (Takara Bio USA), a binary vector for high-level
expression of a foreign gene in dicotyledonous plants carrying the constitutive 35S
promoter and an Arabidopsis Alcohol dehydrogenase (AtAdh) as a translational enhancer.
5mL of LB containing 50mg/L kanamycin was inoculated with a single colony of
Agrobacterium tumefaciens strain GV3101 carrying a binary vector for the expression of the glycosyltransferase
76G1 from
Stevia rebaudiana (SEQ ID NO. 61 and SEQ ID NO. 62) and the multi-drug ABC transporter ABCG2 (SEQ ID
NO. 67 and SEQ ID NO. 68). The
Agrobacterium culture was grown overnight at 180 rpm and 28°C to an OD600 of 0.6 to 0.8. For transformation,
10ml of 3-day old BY2 cell cultures was incubated with 500ul of the
Agrobacterium culture and 10µl of 100mM acetosyringone for 48 hours in the dark at room temperature
in sterile 50mL falcon tubes. After 48 hours, the cells were washed twice in Murashige
and Skoog medium supplemented with 500 mg/L carbenicillin before plating on selective
media (Murashige and Skoog supplemented with 500 mg/L carbenicillin and 50 mg/L kanamycin).
Calli were picked at 4 weeks and re-plated for further screening for transgene expression.
Materials and Methods Example 14: Statistical Analysis of yeast and tobacco expressions
systems.
[0295] All experimental treatments were carried out in triplicates. Data were analyzed using
GraphPad Prism software package (http://www.graphpad.com/prism/Prism.htm). Student's
t-test and one-way analysis of variance (ANOVA) with Dunnett's Multiple Comparison
test for comparing multiple lines with the control were used. All analyses for significant
differences were performed at P ≤ 0.05.
Materials and Methods Example 15: Yeast and/or tobacco cell suspension sample preparation
for the analysis of water-soluble cannabinoids.
[0296] Cell suspension cultures were harvested by centrifugation in 15 or 50 mL polypropylene
centrifuge tubes. The supernatants were transferred to a new centrifuge tube and both
the cell pellet and supernatant was flash frozen in liquid N2. Cell pellets were freeze
dried and ∼100mg of material was extracted by bead milling with 250uL volume of 0.1mm
zirconia beads in 1 mL of 70% methanol: water (v/v) containing 20 µg/mL of the internal
standard 7-hydroxyoumarin (Sigma-Aldrich, H24003). The resulting extracts were clarified
by centrifugation at 13,000 rcf for 10 minutes. The clarified supernatant was transferred
into a 2 mL autosampler. Supernatants were concentrated by freeze drying 2-fold and
spiked at 20 µg/mL of the internal standard 7-hydroxyoumarin final concentration.
A 1 mL aliquot was transferred to a 2 mL autosampler.
Materials and Methods Example 16: Liquid Chromatography Mass Spectrometry for yeast
and tobacco suspension culture systems.
[0297] Mass spectrometry was performed on a quadrupole time-of-flight (QTOF) mass spectrometer
(QTOF Ultima, Waters, Manchester, UK) equipped with a lockspray™ electrospray ion
source coupled to a Waters Acquity UPLC system (Waters, Manchester, UK). Mass spectra
were collected in the negative electrospray ionization mode (ESI-). The nebulization
gas was set to 650 L/h at a temperature of 500°C, the cone gas was set to 15 L/H and
the source temperature was set to 110°C. A capillary voltage and cone voltage were
set to 2500 and 35 V, respectively. The MCP detector voltage was set to 2200 V. The
Q-TOF Ultima MS acquisition rate was set to 0.25 s with a 0.1 s interscan delay. The
scan range was from 100 to 1500 m/z. Data was collected in continuum mode. A lockmass
solution of 50 ppm raffinose (503.1612 m/z) in 50:50 water: methanol was delivered
at 20 µL /min through an auxiliary pump and acquired every 10 s during the MS acquisition.
Separations were performed on a Waters BEH C18 column (2.1 x 50 mm, particle size
1.8 µm) using a Waters ACQUITY UPLC System, equipped with an ACQUITY Binary Solvent
Manager, and ACQUITY Sample Manager (20 µL sample loop, partial loop injection mode,
5 µL (Cell extracts) or 10 µL (Supernatant) injection volume, 4°C). Eluents A and
B were water and acetonitrile, respectively, both containing 0.1% formic acid. Elution
was performed isocratically for 0.1 min at 8% eluent B and then linear gradient 100%
eluent B in 6.0 min, and isocratically for 1 min at 100% eluent B. The column was
re-equilibrated for 1.5 min. The flow rate was set to 500 µL/min and the column temperature
was maintained at 40°C.
Materials and Methods Example 17: Data processing for individual cannabinoid analogs
in yeast and tobacco suspension culture systems.
[0298] Identification of individual cannabinoid analogs was performed, by their corresponding
accurate mass shifts by Metabolynx (Waters Corp., Milford, USA). The method parameters
for data processing were set as follows: retention time range 0.1-7.5 min, mass range
100-1500 Da, retention time tolerance 0.2 min, mass tolerance 0.05 Da, peak intensity
threshold 14. Accurate mass measure of the continuum data was performed using the
raffinose lock mass. Raw chromatographic data were additionally processed for extracted
ion chromatogram sand peak area integration using Masslynx 4.1 (Waters Corp., Milford,
USA). CBGA and CBDA were identified and quantitated using certified reference materials
(Cerilliant, Round Rock, TX). All chemical structures and physiochemical and constitutional
properties were generated using ChemDoodle version 8.1.0 (IChemLabs™, Chesterfield,
VA).
Materials and Methods Example 18: Spectral Analysis of Water Soluble Cannabinoids
Identification of modified cannabinoids by mass spectrometry.
[0299] The present inventors identified the cannabinoid bio-transformations associated with
the gene constructs expressed in tobacco cell suspension and yeast cultures. Based
on the predicted glycosylation reactions and empirical information from the chromatographic
assays, we predicted the most likely glycosylation events that would occur to the
parent molecules CBGA and CBDA along with their physiochemical and constitutional
properties (Figures 36 and 37, respectively). With this information and through the
use of accurate mass measurements, we were able to identify the molecules in the chromatographic
analysis and produce extracted ion chromatograms for peak integration as illustrated
in Figures 38-40. Peak areas for each identified molecule were used for relative quantification
between treatments. Based on these results we identified cannabinoid molecules containing
up to two glycosides moieties and an O-acetyl glycoside. Summaries of those identifications
are presented in Tables 11 and 12 for exemplary cannabinoids CBGA and CBDA respectively.
[0300] Those skilled in the art will appreciate, or be able to ascertain using no more than
routine experimentation, further features and advantages of the invention based on
the above-described embodiments. Accordingly, the invention is not to be limited by
what has been particularly shown and described. All publications and references are
herein expressly incorporated by reference in their entirety.
TABLES
[0301]
Table 1. CBGA Biotransformed Products
Product |
RRT to Parent |
Expected m/z |
Found m/z |
Error (mDa) |
Error (ppm) |
Molecular Formula [M-H]- |
R-OH 1 x Glycoside |
0.58 |
537.2700 |
537.2703 |
-0.30 |
0.6 |
C28H41O10 |
2 x Glycoside |
0.59 |
683.3279 |
683.3258 |
2.10 |
-3.1 |
C34H51O14 |
1 x O acetyl Glycoside |
0.73 |
563.2856 |
563.2844 |
1.20 |
-2.1 |
C30H43O10 |
1 x Glycoside #1 |
0.74 |
521.2751 |
521.2734 |
1.70 |
-3.3 |
C28H41O9 |
R-OH #1 |
0.80 |
375.2171 |
375.2224 |
-5.30 |
14.1 |
C22H31O5 |
1 x Glycoside #2 |
0.81 |
521.2751 |
521.2727 |
2.40 |
-4.6 |
C28H41O9 |
R-OH #2 |
0.81 |
375.2171 |
375.2237 |
-6.60 |
17.6 |
C22H31O5 |
R-OH #3 |
0.94 |
375.2171 |
375.2192 |
-2.10 |
5.6 |
C22H31O5 |
CBGA |
1.00 |
359.2222 |
359.2245 |
-2.30 |
6.4 |
C22H31O4 |
RRT Relative Retention Time to Parent Molecule
R-OH Functionalized by addition of O atom |
Table 2. CBDA Biotransformed Products
Product |
RRT to Parent |
Expected m/z |
Found m/z |
Error (mDa) |
Error (ppm) |
Molecular Formula [M-H]- |
2 x Glycoside |
0.56 |
681.3122 |
681.3097 |
2.50 |
-3.7 |
C34H49O14 |
R-OH 1 x Glycoside |
0.61 |
535.2543 |
535.2599 |
-5.60 |
10.5 |
C28H39O10 |
1 x Glycoside |
0.71 |
519.2601 |
519.2594 |
0.70 |
1.3 |
C28H39O9 |
1 x O acetyl Glycoside |
0.71 |
561.2700 |
561.2700 |
0.00 |
0 |
C30H41O10 |
R-OH #1 |
0.84 |
373.2015 |
373.2074 |
-5.90 |
15.8 |
C22H29O5 |
R-OH #2 |
0.87 |
373.2015 |
373.2034 |
-1.90 |
5.1 |
C22H29O5 |
R-OH #3 |
0.96 |
373.2015 |
373.2040 |
-2.50 |
-8 |
C22H29O5 |
CBDA |
1.00 |
357.2066 |
357.2122 |
-5.60 |
15.7 |
C22H29O4 |
RRT Relative Retention Time to Parent Molecule
R-OH Functionalized by addition of O atom' |
Table 3. Forward and reverse primers for RT-PCR of CYP3A4 and P450 oxidoreductase
Sequence |
CYP3A4 |
P450 oxidoreductase |
Primers for RT-PCR |
Forward TGCCTAATAAAGCTCCTCCTACT Reverse GCTCCTGAAACAGTTCCATCTC |
Forward GGAAGAGCTTTGGTTCCTATGT Reverse GCTCCCAATTCAGCAACAATATC |
Table 6. Cytosolic-targeted CBDA synthase (cytCBDAs), Cytosolic-targeted UGT (cytUGT)
Sequence |
Cytosolic-targeted CBDA synthase |
Cytosolic-targeted UGT |
Primers for RT-PCR |
Forward primer: |
Forward primer: |
AAAGATCAAAAGCAAGTTCTTCACTGT |
AGAACTGGAAGAATCCGAACTGGAA |
Reverse primer: |
Reverse primer: |
ATAAACTTCTCCAAGGGTAGCTCCG |
AAATCATCGGGACACCTTCACAAAC |
Table 7. Summary of results from glycosylation and functionalization experiments in
N. benthamiana leaves.
Agrobacterium Constructs |
Substrate fed |
CBGA (relative amount) |
CBGA glycoside (relative amount) |
CBGA glycoside + acetylated (relative amount) |
CBDA (relative amount) |
CBDA glycoside (relative amount) |
CBDA Hydroxyl amount) |
Trichome CBDA synthase +trichome glycosy ltransferase + PM-UTR1) + Myb/catalase* +
P19 silencing supressor* |
CBGA |
+ |
+ |
+ |
+ |
ND |
ND |
Cytosolic CBDA synthase, glycosyltransferase and plasma membrane ABC transporter)
+ Myb/catalase+ P19 silencing suppressor |
CBGA |
+ |
+++ |
+++ |
+++ |
ND |
ND |
201-SUS (cytosolic CBDA synthase, glycosyltransferase and plasma membrane ABC transporter) |
CBGA |
+ |
+++ |
++++ |
+ |
+ |
+ |
CYP3 A4+oxidoreductase (cytochrome P450 with P450 oxidoreductase) |
CBDA |
ND |
+ |
ND |
+++ |
+++++ |
+++++ |
Cytosolic CBDA synthase + cytosolic glycosyltransferase + Myb/catalase* + P19 silencing
suppressor* |
CBGA |
++++ |
+++++ |
+++++ |
ND |
++ |
++ |
P450 /MYBcatalase/cytosolic CBDA synthase, glycosyltransferase and plasma membrane
ABC transporter |
CBGA |
+ |
++++ |
+ |
ND |
++ |
++ |
No agrobacterium (negative control) |
CBGA |
+ |
+ |
+ |
ND |
ND |
ND |
*Co-infiltration with and without construct was tested in different replicates |
Table 8. Summary of results from glycosylation and functionalization experiments in
Cannabis sativa leaves.
Agrobacterium Constructs |
CBDA (relative amount) |
CBDA glycoside (relative amount) |
CBDA Hydroxyl (relative amount) |
Trichome CBDA synthase +trichome glycosyltransferase + plasma membrane-targeted sugar
transporter) + Myb/catalase |
++ |
trace |
trace |
cytosolic CBDA synthase, cytosolic glycosyltransferase + Myb/catalase |
+++ |
++++ |
+++++ |
201-SUS (cytosolic CBDA synthase, glycosyltransferase and plasma membrane ABC transporter) |
++ |
++ |
++ |
Table 9. Exemplary Glycosyltransferase sequence identification
SEQ ID NO. |
Name |
Organism |
Type |
SEQ ID NO. 26 |
NtGT5a |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 27 |
NtGT5a |
Nicotiana tabacum |
DNA |
SEQ ID NO. 28 |
NtGT5b |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 29 |
NtGT5b |
Nicotiana tabacum |
DNA |
SEQ ID NO. 30 |
NtGT4 |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 31 |
NtGT4 |
Nicotiana tabacum |
DNA |
SEQ ID NO. 32 |
NtGT1b |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 33 |
NtGT1b |
Nicotiana tabacum |
DNA |
SEQ ID NO. 34 |
NtGT1a |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 35 |
NtGT1a |
Nicotiana tabacum |
DNA |
SEQ ID NO. 36 |
NtGT3 |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 37 |
NtGT3 |
Nicotiana tabacum |
DNA |
SEQ ID NO. 38 |
NtGT2 |
Nicotiana tabacum |
Amino Acid |
SEQ ID NO. 39 |
NtGT2 |
Nicotiana tabacum |
DNA |
Table 10. Cannabinoid production cellular compartmentalization models. Different shaded
columns and rows correspond to different exemplary expression constructs used.
Cannabinoid production/ accumulation system |
CBDA Synthase |
UDP glycosyl transferase |
Cannabinoid ABC transporter |
UDP glucose transporter |
Myb transcription factor for cannabinoids |
Catalase to degrade H2O2 from CBDA Synthase |
Cytoplasmic accumulation |
Minus trichome target sequence |
Required but no targeting change |
No gene required |
No gene required |
Express |
Express |
Trichome (low pH) synthesis |
No change |
Add trichome target sequence |
No gene required |
Target to plasma membrane |
Express |
Express |
Cell suspension cultures |
Minus trichome target sequence |
Required but no targeting change |
Target to plasma membrane (PM) |
No gene required |
Express |
Express |
Table 11. CBGA Biotransformed Products
Product |
RRT to Parent |
Expected m/z |
Found m/z |
Error (mDa) |
Error (ppm) |
Molecular Formula [M-H]- |
1 x Glycoside |
0.72 |
521.2751 |
521.2700 |
-5.1 |
-9.8 |
C28H41O9 |
CBGA |
1.00 |
359.2222 |
359.2190 |
-3.2 |
-8.9 |
C22H31O4 |
RRT Relative Retention Time to Parent Molecule |
Table 12. CBDA Biotransformed Products
Product |
RRT to Parent |
Expected m/z |
Found m/z |
Error (mDa) |
Error (ppm) |
Molecular Formula [M-H]- |
2 x Glycoside |
0.52 |
681.3122 |
681.3076 |
-4.76 |
-6.8 |
C34H49O14 |
1 x Glycoside #1 |
0.67 |
519.2594 |
519.2583 |
-1.1 |
-2.1 |
C28H39O9 |
1 x O acetyl |
|
|
|
|
|
|
Glycoside |
0.68 |
561.2700 |
561.2653 |
-4.7 |
-8.4 |
C30H41O10 |
1 x Glycoside #2 |
0.80 |
519.2594 |
519.2681 |
8.8 |
16.7 |
C28H39O9 |
CBDA |
1.00 |
357.2066 |
357.2091 |
2.5 |
7.0 |
C22H29O4 |
RRT Relative Retention Time to Parent Molecule |
Based on the reduced retention time in the HPLC gradient. The glycosylated cannabinoids,
which eluted earlier than their non-modified forms, are demonstrated to be more water-soluble
than their non-modified forms.
Table 13. RT-PCR primers for confirmation of gene expression in transgenic intracellular
Pichia and tobacco cultures.
Target gene |
Forward primer |
Reverse primer |
NtGT1 |
ATGAAAACAACAGAACTTGTCTTCA |
TGAAGTTGTAGGCCTAGCATGG |
NtGT2 |
ATGGTTCAACCACACGTCTTACTGG |
TTGAATACACCAGTTGGGGTCG |
NtGT3 |
ATGAAAGAGACTAAAAAAATTGAGT |
CATCACGCAGATTTTGAATATGG |
NtGT4 |
ATGGCTACTCAGGTGCATAAATTGC |
GGCCTTAGTTAGCTCGACACGG |
NtGT5 |
ATGGGCTCTATCGGTGCAGAACTAA |
CGGGGATGAAGTCCAAGGTTGT |
Kat-E |
ATGTCTCAACATAACGAGAAAAACC |
CGTAGCAAATCCCCTGATGTCT |
UGT76G1 |
ATGGAGAACAAAACCGAGACAACCG |
CCTTTAGCATGGGAAAACCGGA |
UGT76G1 (for tobacco BY2 cells) |
GATTGGAAGAACAAGCTTCAGGATTTCC |
CCATCCTGAATGAGTCCAAAAAGCTC |
ABCG2 (for tobacco BY2 cells) |
CCTTCAGGATTGTCAGGAGATG |
GCAGGTCCATGAAACATCAATC |
PRESERVED CLAUSES
[0302] Each of the below clauses is specifically incorporated into the specification of
the current application. Each of the below clauses may be amended and presented as
a formal claim and further represents an independent invention.
1. A composition comprising:
- an aqueous solution;
- water-soluble cannabinoid dissolved in said aqueous solution wherein said water-soluble
cannabinoid comprises a glycosylated cannabinoid, and/or an acetylated cannabinoid,
and/or a mixture of both;
wherein said composition may be introduced to a food or beverage.
2. The composition of clause 1, wherein said glycosylated cannabinoid, and/or said
acetylated cannabinoid were generated in vivo.
3. The composition of clause 1, wherein said glycosylated cannabinoid, and/or said
acetylated cannabinoid were generated in vitro.
4. The composition of clause 1, wherein said water-soluble cannabinoid is non-psychoactive.
5. The composition of clause 1, wherein said aqueous solution comprises an aqueous
solution selected from the group consisting of: saline, purified water, ethanol,.
6. The composition of clause 1, wherein said aqueous solution comprises propylene
glycol, deionized water, an alcohol.
7. The composition of clause 1, wherein said alcohol comprises ethanol.
8. The composition of clause 7, further comprising a buffer.
9. The composition of clause 8, wherein said buffer maintains said aqueous solution
at a pH below 7.4.
10. The composition of clause 7, further comprising formic acid, or ammonium hydroxide.
11. A consumable food additive comprising at least one water-soluble glycosylated
cannabinoid.
12. A consumable food additive as described in clause 11 and further comprising a
food additive polysaccharide.
13. A consumable food additive as described in clause 12 wherein said food additive
polysaccharide comprises dextrin and/or maltodextrin.
14. A consumable food additive as described in clause 11 and further comprising a
emulsifier.
15. A consumable food additive as described in clause 14 wherein said emulsifier is
selected from the group consisting of: gum arabic, modified starch, pectin, xanthan
gum, gum ghatti, gum tragacanth, fenugreek gum, mesquite gum, mono-glycerides and
di-glycerides of long chain fatty acids, sucrose monoesters, sorbitan esters, polyethoxylated
glycerols, stearic acid, palmitic acid, mono-glycerides, di-glycerides, propylene
glycol esters, lecithin, lactylated mono- and di-glycerides, propylene glycol monoesters,
polyglycerol esters, diacetylated tartaric acid esters of mono- and di-glycerides,
citric acid esters of monoglycerides, stearoyl-2-lactylates, polysorbates, succinylated
monoglycerides, acetylated monoglycerides, ethoxylated monoglycerides, quillaia, whey
protein isolate, casein, soy protein, vegetable protein, pullulan, sodium alginate,
guar gum, locust bean gum, tragacanth gum, tamarind gum, carrageenan, furcellaran,
Gellan gum, psyllium, curdlan, konjac mannan, agar, and cellulose derivatives, or
combinations thereof.
16. A consumable food additive as described in clause 11, wherein said water-soluble
glycosylated cannabinoid is a non-psychoactive cannabinoid.
17. A consumable food additive as described in clause 11, wherein said water-soluble
glycosylated cannabinoid is generated in vivo.
18. A consumable food additive as described in clause 11, wherein said water-soluble
glycosylated cannabinoid is generated in vitro.
19. A consumable food additive as described in clause 13, wherein said consumable
food additive is a homogenous composition.
20. A consumable food additive as described in clause 11, and further comprising a
flavoring agent.
21. A consumable food additive as described in clause 20 wherein said flavoring agent
comprises a flavoring agent selected from the group consisting of: Sucrose (sugar),
glucose, fructose, sorbitol, mannitol, corn syrup, high fructose corn syrup, saccharin,
aspartame, sucralose, acesulfame potassium (acesulfame-K), neotame.
22. A consumable food additive as described in clause 11, and further comprising a
coloring agent.
23. A consumable food additive as described in clause 22 wherein said coloring agent
comprises a coloring agent selected from the group consisting of: FD&C Blue Nos. 1
and 2, FD&C Green No. 3, FD&C Red Nos. 3 and 40, FD&C Yellow Nos. 5 and 6, Orange
B, Citrus Red No. 2, annatto extract, beta-carotene, grape skin extract, cochineal
extract or carmine, paprika oleoresin, caramel color, fruit and vegetable juices,
saffron, Monosodium glutamate (MSG), hydrolyzed soy protein, autolyzed yeast extract,
disodium guanylate or inosinate
24. A consumable food additive as described in clause 11, and further comprising a
surfactant.
25. A consumable food additive as described in clause 24 wherein said surfactant comprises
a surfactant selected from the group consisting of glycerol monostearate and polysorbate
80.
26. A consumable food additive as described in clause 11, and further comprising a
preservative.
27. A consumable food additive as described in clause 26, wherein said preservative
comprises a preservative selected from the group consisting of: ascorbic acid, citric
acid, sodium benzoate, calcium propionate, sodium erythorbate, sodium nitrite, calcium
sorbate, potassium sorbate, BHA, BHT, EDTA, tocopherols.
28. A consumable food additive as described in clause 11 and further comprising a
nutrient supplement.
29. A consumable food additive as described in clause 28, wherein said nutrient supplement
comprises a nutrient supplement selected from the group consisting of: thiamine hydrochloride,
riboflavin, niacin, niacinamide, folate or folic acid, beta carotene, potassium iodide,
iron or ferrous sulfate, alpha tocopherols, ascorbic acid, Vitamin D, amino acids,
multi-vitamin, fish oil, co-enzyme Q-10, and calcium.
30. A consumable food additive as described in clause 11 and further comprising at
least one water-soluble acetylated cannabinoid.
31. A consumable food additive comprising at least one water-soluble acetylated cannabinoid.
32. A consumable food additive as described in clause 31 and further comprising a
food additive polysaccharide.
33. A consumable food additive as described in clause 32 wherein said food additive
polysaccharide comprises dextrin and/or maltodextrin.
34. A consumable food additive as described in clause 32 and further comprising a
emulsifier.
35. A consumable food additive as described in clause 34 wherein said emulsifier is
selected from the group consisting of: gum arabic, modified starch, pectin, xanthan
gum, gum ghatti, gum tragacanth, fenugreek gum, mesquite gum, mono-glycerides and
di-glycerides of long chain fatty acids, sucrose monoesters, sorbitan esters, polyethoxylated
glycerols, stearic acid, palmitic acid, mono-glycerides, di-glycerides, propylene
glycol esters, lecithin, lactylated mono- and di-glycerides, propylene glycol monoesters,
polyglycerol esters, diacetylated tartaric acid esters of mono- and di-glycerides,
citric acid esters of monoglycerides, stearoyl-2-lactylates, polysorbates, succinylated
monoglycerides, acetylated monoglycerides, ethoxylated monoglycerides, quillaia, whey
protein isolate, casein, soy protein, vegetable protein, pullulan, sodium alginate,
guar gum, locust bean gum, tragacanth gum, tamarind gum, carrageenan, furcellaran,
Gellan gum, psyllium, curdlan, konjac mannan, agar, and cellulose derivatives, or
combinations thereof.
36. A consumable food additive as described in clause 31, wherein said water-soluble
acetylated cannabinoid is a non-psychoactive cannabinoid.
37. A consumable food additive as described in clause 31, wherein said water-soluble
acetylated cannabinoid is generated in vivo.
38. A consumable food additive as described in clause 31, wherein said water-soluble
acetylated cannabinoid is generated in vitro.
39. A consumable food additive as described in clause 31, wherein said consumable
food additive is a homogenous composition.
40. A consumable food additive as described in clause 31, and further comprising a
flavoring agent.
41. A consumable food additive as described in clause 40 wherein said flavoring agent
comprises a flavoring agent selected from the group consisting of: Sucrose (sugar),
glucose, fructose, sorbitol, mannitol, corn syrup, high fructose corn syrup, saccharin,
aspartame, sucralose, acesulfame potassium (acesulfame-K), neotame.
42. A consumable food additive as described in clause 31, and further comprising a
coloring agent.
43. A consumable food additive as described in clause 42 wherein said coloring agent
comprises a coloring agent selected from the group consisting of: FD&C Blue Nos. 1
and 2, FD&C Green No. 3, FD&C Red Nos. 3 and 40, FD&C Yellow Nos. 5 and 6, Orange
B, Citrus Red No. 2, annatto extract, beta-carotene, grape skin extract, cochineal
extract or carmine, paprika oleoresin, caramel color, fruit and vegetable juices,
saffron, Monosodium glutamate (MSG), hydrolyzed soy protein, autolyzed yeast extract,
disodium guanylate or inosinate
44. A consumable food additive as described in clause 31, and further comprising a
surfactant.
45. A consumable food additive as described in clause 44 wherein said surfactant comprises
a surfactant selected from the group consisting of glycerol monostearate and polysorbate
80.
46. A consumable food additive as described in clause 31, and further comprising a
preservative.
47. A consumable food additive as described in clause 46, wherein said preservative
comprises a preservative selected from the group consisting of: ascorbic acid, citric
acid, sodium benzoate, calcium propionate, sodium erythorbate, sodium nitrite, calcium
sorbate, potassium sorbate, BHA, BHT, EDTA, tocopherols
48. A consumable food additive as described in clause 31 and further comprising a
nutrient supplement.
49. A consumable food additive as described in clause 48, wherein said nutrient supplement
comprises a nutrient supplement selected from the group consisting of: thiamine hydrochloride,
riboflavin, niacin, niacinamide, folate or folic acid, beta carotene, potassium iodide,
iron or ferrous sulfate, alpha tocopherols, ascorbic acid, Vitamin D, amino acids,
multi-vitamin, fish oil, co-enzyme Q-10, and calcium.
50. A consumable food additive as described in clause 31 and further comprising at
least one water-soluble glycosylated cannabinoid.
51. A consumable food additive comprising a mixture of at least one water-soluble
glycosylated cannabinoid and at least one water-soluble acetylated cannabinoid.
52. A consumable food additive as described in clause 51 and further comprising a
food additive polysaccharide.
53. A consumable food additive as described in clause 52 wherein said food additive
polysaccharide comprises dextrin and/or maltodextrin.
54. A consumable food additive as described in clause 51 and further comprising a
emulsifier.
55. A consumable food additive as described in clause 54 wherein said emulsifier is
selected from the group consisting of: gum arabic, modified starch, pectin, xanthan
gum, gum ghatti, gum tragacanth, fenugreek gum, mesquite gum, mono-glycerides and
di-glycerides of long chain fatty acids, sucrose monoesters, sorbitan esters, polyethoxylated
glycerols, stearic acid, palmitic acid, mono-glycerides, di-glycerides, propylene
glycol esters, lecithin, lactylated mono- and di-glycerides, propylene glycol monoesters,
polyglycerol esters, diacetylated tartaric acid esters of mono- and di-glycerides,
citric acid esters of monoglycerides, stearoyl-2-lactylates, polysorbates, succinylated
monoglycerides, acetylated monoglycerides, ethoxylated monoglycerides, quillaia, whey
protein isolate, casein, soy protein, vegetable protein, pullulan, sodium alginate,
guar gum, locust bean gum, tragacanth gum, tamarind gum, carrageenan, furcellaran,
Gellan gum, psyllium, curdlan, konjac mannan, agar, and cellulose derivatives, or
combinations thereof.
56. A consumable food additive as described in clause 51, wherein said water-soluble
acetylated cannabinoid and said water-soluble glycosylated cannabinoid are non-psychoactive
cannabinoids.
57. A consumable food additive as described in clause 51, wherein said water-soluble
acetylated cannabinoid and said water-soluble glycosylated cannabinoid are generated
in vivo.
58. A consumable food additive as described in clause 51, wherein said water-soluble
acetylated cannabinoid and said water-soluble glycosylated cannabinoid are generated
in vitro.
59. A consumable food additive as described in clause 51, wherein said consumable
food additive is a homogenous composition.
60. A consumable food additive as described in clause 51, and further comprising a
flavoring agent.
61. A consumable food additive as described in clause 60 wherein said flavoring agent
comprises a flavoring agent selected from the group consisting of: Sucrose (sugar),
glucose, fructose, sorbitol, mannitol, corn syrup, high fructose corn syrup, saccharin,
aspartame, sucralose, acesulfame potassium (acesulfame-K), neotame.
62. A consumable food additive as described in clause 51, and further comprising a
coloring agent.
63. A consumable food additive as described in clause 62 wherein said coloring agent
comprises a coloring agent selected from the group consisting of: FD&C Blue Nos. 1
and 2, FD&C Green No. 3, FD&C Red Nos. 3 and 40, FD&C Yellow Nos. 5 and 6, Orange
B, Citrus Red No. 2, annatto extract, beta-carotene, grape skin extract, cochineal
extract or carmine, paprika oleoresin, caramel color, fruit and vegetable juices,
saffron, Monosodium glutamate (MSG), hydrolyzed soy protein, autolyzed yeast extract,
disodium guanylate or inosinate
64. A consumable food additive as described in clause 51, and further comprising a
surfactant.
65. A consumable food additive as described in clause 64 wherein said surfactant comprises
a surfactant selected from the group consisting of glycerol monostearate and polysorbate
80.
66. A consumable food additive as described in clause 51, and further comprising a
preservative.
67. A consumable food additive as described in clause 66, wherein said preservative
comprises a preservative selected from the group consisting of: ascorbic acid, citric
acid, sodium benzoate, calcium propionate, sodium erythorbate, sodium nitrite, calcium
sorbate, potassium sorbate, BHA, BHT, EDTA, tocopherols
68 A consumable food additive as described in clause 51 and further comprising a nutrient
supplement.
69. A consumable food additive as described in clause 68, wherein said nutrient supplement
comprises a nutrient supplement selected from the group consisting of: thiamine hydrochloride,
riboflavin, niacin, niacinamide, folate or folic acid, beta carotene, potassium iodide,
iron or ferrous sulfate, alpha tocopherols, ascorbic acid, Vitamin D, amino acids,
multi-vitamin, fish oil, co-enzyme Q-10, and calcium.
70. A consumable fluid comprising at least one water-soluble glycosylated cannabinoid.
71. A consumable fluid as described in clause 70, further comprising a food additive
polysaccharide.
72. A consumable fluid as described in clause 70, wherein said food additive polysaccharide
comprises maltodextrin and/or dextrin.
73. A consumable fluid as described in clause 73, wherein said maltodextrin is an
aqueous maltodextrin solution.
74. A consumable fluid as described in clause 73, wherein said aqueous maltodextrin
solution further comprises sorbic acid and an acidifying agent to provide a food grade
aqueous solution of maltodextrin having a pH of 2-4 and a sorbic acid content of 0.02-0.1%
by weight.
75. A consumable fluid as described in clause 70, wherein said consumable fluid is
water.
76. A consumable fluid as described in clause 75, wherein said consumable fluid is
selected from the group consisting of: an alcoholic beverage; a non-alcoholic beverage,
a noncarbonated beverage, a carbonated beverage, a cola, a root beer, a fruit-flavored
beverage, a citrus-flavored beverage, a fruit juice, a fruit-containing beverage,
a vegetable juice, a vegetable containing beverage, a tea, a coffee, a dairy beverage,
a protein containing beverage, a shake, a sports drink, an energy drink, and a flavored
water.
77. A consumable fluid as described in clause 70, wherein said water-soluble glycosylated
cannabinoid is a non-psychoactive cannabinoid.
78. A consumable fluid as described in clause 70, wherein said water-soluble glycosylated
cannabinoid is generated in vivo.
79 A consumable fluid as described in clause 70, wherein said water-soluble glycosylated
cannabinoid is generated in vitro.
80. A consumable fluid as described in clause 70 further comprising at least one of:
xanthan gum, cellulose gum, whey protein hydrolysate, ascorbic acid, citric acid,
malic acid, sodium benzoate, sodium citrate, sugar, phosphoric acid, and water.
81. A consumable fluid comprising at least one water-soluble acetylated cannabinoid.
82. A consumable fluid as described in clause 81 further comprising a food additive
polysaccharide.
83. A consumable fluid as described in clause 81 wherein said food additive polysaccharide
comprises maltodextrin and/or dextrin.
84. A consumable fluid as described in clause 83, wherein said maltodextrin is an
aqueous maltodextrin solution.
85. A consumable fluid as described in clause 84, wherein said aqueous maltodextrin
solution further comprises sorbic acid and an acidifying agent to provide a food grade
aqueous solution of maltodextrin having a pH of 2-4 and a sorbic acid content of 0.02-0.1%
by weight.
86. A consumable fluid as described in clause 81, wherein said consumable fluid is
water.
87. A consumable fluid as described in clause 81, wherein said consumable fluid is
selected from the group consisting of: an alcoholic beverage; a non-alcoholic beverage,
a noncarbonated beverage, a carbonated beverage, a cola, a root beer, a fruit-flavored
beverage, a citrus-flavored beverage, a fruit juice, a fruit-containing beverage,
a vegetable juice, a vegetable containing beverage, a tea, a coffee, a dairy beverage,
a protein containing beverage, a shake, a sports drink, an energy drink, and a flavored
water.
88. A consumable fluid as described in clause 81, wherein said water-soluble acetylated
cannabinoid is a non-psychoactive cannabinoid.
89. A consumable fluid as described in clause 81, wherein said water-soluble acetylated
cannabinoid is generated in vivo.
90. A consumable fluid as described in clause 81, wherein said water-soluble acetylated
cannabinoid is generated in vitro.
91. A consumable fluid as described in clause 81 further comprising at least one of:
xanthan gum, cellulose gum, whey protein hydrolysate, ascorbic acid, citric acid,
malic acid, sodium benzoate, sodium citrate, sugar, phosphoric acid, and water.
92. A consumable gel comprising at least one water-soluble glycosylated cannabinoid
and gelatin in an aqueous solution.
93. A consumable gel as described in clause 92 wherein said water-soluble glycosylated
cannabinoid is generated in vivo.
94. A consumable gel as described in clause 92 wherein said water-soluble glycosylated
cannabinoid is generated in vitro.
95. A consumable gel comprising at least one water-soluble acetylated cannabinoid
and gelatin in an aqueous solution.
96. A consumable gel as described in clause 95 wherein said water-soluble acetylated
cannabinoid is generated in vivo.
97. A consumable gel as described in clause 95 wherein said water-soluble acetylated
cannabinoid is generated in vitro.
98. A consumable gel comprising at least one water-soluble acetylated cannabinoid,
at least one water-soluble glycosylated cannabinoid and gelatin in an aqueous solution.
99. A consumable gel as described in clause 98 wherein said water-soluble acetylated
cannabinoid and said water-soluble acetylated cannabinoid are generated in vivo.
100. A consumable gel as described in clause 99 wherein said water-soluble acetylated
cannabinoid and said water-soluble acetylated cannabinoid are generated in vitro.
101. A method of making a consumable fluid additive comprising the steps:
- solubilizing a water-soluble glycosylated cannabinoid with a food additive polysaccharide
to provide an aqueous solution containing said water-soluble glycosylated cannabinoid
and said food additive polysaccharide; and
- adding said water-soluble glycosylated cannabinoid and food additive polysaccharide
aqueous solution to a consumable fluid.
102. The method of clause 101, wherein said food additive polysaccharide is selected
from the group consisting of: maltodextrin and/or dextrin.
103. The method of clause 102, wherein said food additive polysaccharide is maltodextrin.
104. The method of clause 103, wherein said maltodextrin is an aqueous maltodextrin
solution.
105. The method of clause 104, wherein said aqueous maltodextrin solution further
comprises sorbic acid and an acidifying agent to provide a food grade aqueous solution
of maltodextrin having a pH of 2-4 and a sorbic acid content of 0.02-0.1% by weight.
106. The method of clause 104, wherein said consumable fluid is water.
107. The method of clause 106, wherein said consumable fluid is selected from the
group consisting of: an alcoholic beverage; a non-alcoholic beverage, a noncarbonated
beverage, a carbonated beverage, a cola, a root beer, a fruit-flavored beverage, a
citrus-flavored beverage, a fruit juice, a fruit-containing beverage, a vegetable
juice, a vegetable containing beverage, a tea, a coffee, a dairy beverage, a protein
containing beverage, a shake, a sports drink, an energy drink, and a flavored water.
108. The method of clause 101, wherein said water-soluble glycosylated cannabinoid
is a non-psychoactive cannabinoid.
109. The method of clause 101, wherein said water-soluble glycosylated cannabinoid
is generated in vivo.
110. The method of clause 101, wherein said water-soluble glycosylated cannabinoid
is generated in vitro.
110. The method of clause 101, and further comprising the step of adding a flavor
to said consumable fluid.
111. The method of clause 101, further comprising the step of adding at least one
of: xanthan gum, cellulose gum, whey protein hydrolysate, ascorbic acid, citric acid,
malic acid, sodium benzoate, sodium citrate, sugar, phosphoric acid, and water.
112. A composition comprising:
- a first quantity of water;
- a water-soluble cannabinoid solubilized in said first quantity of water; and
- at least one of: xanthan gum, cellulose gum, whey protein hydrolysate, ascorbic acid,
citric acid, malic acid, sodium benzoate, sodium citrate, sugar, phosphoric acid,
and/or a sugar alcohol.
113. The composition of clause 112, wherein said water-soluble cannabinoid comprises
a glycosylated water-soluble cannabinoid, an acetylated water-soluble cannabinoid
or a mixture of both.
114.The composition of clause 113, wherein said water-soluble cannabinoid is non-psychoactive.
115. The composition of clause 112, and further comprising ethanol.
116. The composition of clause 112, comprising less than 10 mass% water.
117. The composition of clause 112, comprising more than 95 mass% water.
118. The composition of clause 113, comprising about 0.1 mg to about 1000 mg of the
water-soluble cannabinoid.
119. The composition of clause 113, comprising about 0.1 mg to about 500 mg of the
water-soluble cannabinoid.
120. The composition of clause 113, comprising about 0.1 mg to about 200 mg of the
water-soluble cannabinoid.
121. The composition of clause 113, comprising about 0.1 mg to about 100 mg of the
water-soluble cannabinoid.
122. The composition of clause 113, comprising about 0.1 mg to about 100 mg of the
water-soluble cannabinoid.
123. The composition of clause 113, comprising about 0.1 mg to about 10 mg of the
water-soluble cannabinoid.
124. The composition of clause 113, comprising about 0.5 mg to about 5 mg of the water-soluble
cannabinoid.
125. The composition of clause 113, comprising about 1 mg/kg to 5 mg/kg (body weight)
in a human of the water-soluble cannabinoid.
126. The composition of clause 113, comprising water-soluble cannabinoid in the range
of 50 mg/L to 300 mg/L.
127. The composition of clause 113, comprising water-soluble cannabinoid in the range
of 50 mg/L to 100 mg/L.
128. The composition of clause 113, comprising water-soluble cannabinoid in the range
of 50 mg/L to 500 mg/L.
129. The composition of clause 113, comprising water-soluble cannabinoid over 500
mg/L.
130. The composition of clause 113, comprising water-soluble cannabinoid under 50
mg/L.
131. The composition of clause 112, wherein the composition is homogeneous.
132. The composition of clause 112, comprising a flavoring agent.
133. The composition of clause 112, comprising a coloring agent.
134. The composition of clause 112, comprising caffeine.
135. The composition of clause 112, comprising a coloring agent.
136. A composition comprising:
- a first quantity of water;
- a water-soluble cannabinoid solubilized in said first quantity of water; and
- a first quantity of ethanol in a liquid state.
137. A composition according to clause 136 wherein said water-soluble cannabinoid
is a glycosylated cannabinoid.
138. A composition according to clause 136 wherein said water-soluble cannabinoid
is an acetylated cannabinoid.
139. A composition according to clause 136 wherein said water-soluble cannabinoid
is a mixture of glycosylated cannabinoids and acetylated cannabinoid.
140. A composition according to clause 137 wherein said glycosylated cannabinoid is
glycosylated in vivo.
141. A composition according to clause 137 wherein said glycosylated cannabinoid is
glycosylated in vitro.
142. A composition according to clause 138 wherein said acetylated cannabinoid is
acetylated in vivo.
143. A composition according to clause 138 wherein said acetylated cannabinoid is
acetylated in vitro.
144. A composition according to clause 139 wherein said acetylated cannabinoid is
acetylated in vivo and glycosylated cannabinoid is glycosylated in vivo.
145. A composition according to clause 139 wherein said acetylated cannabinoid is
acetylated in vitro and glycosylated cannabinoid is glycosylated in vitro.
146. A composition according to clause 136 wherein said ethanol can be up to about
ninety-nine point nine-five percent (99.95%) by weight and said water-soluble cannabinoid
about zero point zero five percent (0.05%) by weight.
147. A composition according to clause 136, wherein said water-soluble cannabinoid
is non-psychoactive.
148. A composition according to clause 136, wherein said ethanol is an ethyl alcohol.
149. A cannabinoid enriched alcohol composition according to clause 148, wherein said
ethyl alcohol has a proof greater than 100.
150. A composition according to clause 148, wherein said ethyl alcohol has a proof
less than 100.
151. A composition according to clause 148, wherein said ethyl alcohol is a spirit.
152. A composition according to clause 148, wherein said ethyl alcohol is beer, and/or
wine.
153. A cannabinoid enriched alcohol composition for human consumption, said composition
comprising by weight about:
- a first quantity of water;
- a water-soluble cannabinoid solubilized in said first quantity of water; and
- a first quantity of ethanol in a liquid state wherein said first quantity of ethanol
is between 1% to 20% weight by volume.
154. A cannabinoid enriched alcohol composition according to clause 153 wherein said
water-soluble cannabinoid is a glycosylated cannabinoid.
155. A cannabinoid enriched alcohol composition according to clause 153 wherein said
water-soluble cannabinoid is an acetylated cannabinoid.
156. A cannabinoid enriched alcohol composition according to clause 153 wherein said
water-soluble cannabinoid is a mixture of glycosylated cannabinoids and acetylated
cannabinoid.
157. A cannabinoid enriched alcohol composition according to clause 154 wherein said
glycosylated cannabinoid is glycosylated in vivo.
158. A cannabinoid enriched alcohol composition according to clause 154 wherein said
glycosylated cannabinoid is glycosylated in vitro.
159. A cannabinoid enriched alcohol composition according to clause 155 wherein said
acetylated cannabinoid is acetylated in vivo.
160. A cannabinoid enriched alcohol composition according to clause 155 wherein said
acetylated cannabinoid is acetylated in vitro.
161. A cannabinoid enriched alcohol composition according to clause 156 wherein said
acetylated cannabinoid is acetylated in vivo and glycosylated cannabinoid is glycosylated in vivo.
162. A cannabinoid enriched alcohol composition according to clause 156 wherein said
acetylated cannabinoid is acetylated in vitro and glycosylated cannabinoid is glycosylated in vitro.
163. A cannabinoid enriched alcohol composition according to clause 153, wherein said
water-soluble cannabinoid is non-psychoactive.
164. A cannabinoid enriched alcohol composition according to clause 153, wherein said
ethanol is an ethyl alcohol.
165. A cannabinoid enriched alcohol composition according to clause 164, wherein said
ethyl alcohol has a proof greater than 100.
166. A cannabinoid enriched alcohol composition according to clause 164, wherein said
ethyl alcohol is beer.
167. A cannabinoid enriched alcohol composition according to clause 164, wherein said
ethyl alcohol is wine.
168. A cannabinoid enriched alcohol composition according to clause 164, wherein said
ethyl alcohol is a distilled spirit.
169. A chewing gum composition comprising:
- a first quantity of at least one water-soluble cannabinoid;
- a gum base comprising a buffering agent selected from the group consisting of acetates,
glycinates, phosphates, carbonates, glycerophosphates, citrates, borates, and mixtures
thereof;
- at least one sweetening agent; and
- at least one flavoring agent.
170. The chewing gum composition of clause 169, wherein said water-soluble cannabinoid
comprises at least one water-soluble glycosylated cannabinoid.
171. The chewing gum composition of clause 169, wherein said water-soluble cannabinoid
comprises at least one water-soluble acetylated cannabinoid.
172. The chewing gum composition of clause 169, wherein said water-soluble cannabinoid
comprises at least one water-soluble acetylated cannabinoid, and at least one water-soluble
glycosylated cannabinoid.
173. The chewing gum composition of clause 172, wherein said water soluble glycosylated
cannabinoid, and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively
174. The chewing gum composition of clause 169, comprising
- 0.01 to 1% by weight of said water-soluble cannabinoid;
- 25 to 85% by weight of said gum base;
- 10 to 35% by weight of said at least one sweetening agent; and
- 1 to 10% by weight of said flavoring agent.
175. The chewing gum composition of clause 174, wherein said flavoring agents comprise
a flavoring agent selected from the group consisting of menthol flavor, eucalyptus,
mint flavor and/or L-menthol.
176. The chewing gum composition of clause 174, wherein said sweetening agent comprises
a sweetening agent selected from the group consisting of xylitol, sorbitol, isomalt,
aspartame, sucralose, acesulfame potassium, and saccharin.
177. The chewing gum composition according to clause 169, wherein the chewing gum
composition comprises an antioxidant.
178. The chewing gum composition according to clause 169, wherein the chewing gum
composition comprises a pharmaceutically acceptable excipient selected from the group
consisting of fillers, disintegrants, binders, lubricants, and antioxidants.
179. The chewing gum composition according to clause 169, wherein the chewing gum
composition is non-disintegrating.
180. The chewing gum composition according to clause 169, wherein the chewing gum
comprises natural flavors.
181. The chewing gum composition according to clause 169, and further comprising a
coloring agent.
182. The chewing gum composition according to clause 169, and further comprising a
flavoring agent.
183. The chewing gum composition according to clause 169, wherein said water-soluble
cannabinoid is non-psychoactive.
184. A composition for a water-soluble cannabinoid infused solution comprising:
- purified water;
- at least one water-soluble cannabinoid;
- at least one flavoring agent.
185. The composition of clause 1, and further comprising a sweetener selected from
the group consisting of: glucose, sucrose, invert sugar, corn syrup, stevia extract
powder, stevioside, steviol, aspartame, saccharin, saccharin salts, sucralose, potassium
acetosulfam, sorbitol, xylitol, mannitol, erythritol, lactitol, alitame, miraculin,
monellin, and thaumatin or a combination of the same.
186. The composition of clause 184, and further comprising sodium chloride.
187. The composition of clause 184, and further comprising glycerin.
188. The composition of clause 184, and further comprising a coloring agent.
189. The composition of clause 184, and further comprising a first quantity of a demulcent.
190. The composition of clause 184, wherein said demulcent is selected from the group
consisting of: pectin, glycerin, honey, methylcellulose, and propylene glycol.
191. The composition of clause 184, wherein said water-soluble cannabinoid is selected
from the group consisting of: a water soluble glycosylated cannabinoid, a water soluble
acetylated cannabinoid, or a mixture of both.
192. The composition of clause 191, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively.
193. The composition of clause 184, wherein said water-soluble cannabinoid is non-psychoactive.
194. A composition for a water-soluble cannabinoid infused anesthetic solution comprising:
- purified water;
- at least one water-soluble cannabinoid;
- at least one oral anesthetic.
195. The composition of clause 194, and further comprising a sweetener selected from
the group consisting of: glucose, sucrose, invert sugar, corn syrup, stevia extract
powder, stevioside, steviol, aspartame, saccharin, saccharin salts, sucralose, potassium
acetosulfam, sorbitol, xylitol, mannitol, erythritol, lactitol, alitame, miraculin,
monellin, and thaumatin or a combination of the same.
196. The composition of clause 194, and further comprising sodium chloride.
197. The composition of clause 194, and further comprising glycerin.
198. The composition of clause 194, and further comprising a coloring agent.
199. The composition of clause 194, wherein said anesthetic is selected from the group
consisting of: benzocaine, and phenol.
200. The composition of clause 199, wherein said first quantity of anesthetic is between
.1% to 15 % volume by weight.
201. The composition of clause 194, and further comprising a first quantity of a demulcent.
202. The composition of clause 201, wherein said demulcent is selected from the group
consisting of: pectin, glycerin, honey, methylcellulose, and propylene glycol.
203. The composition of clause 194, wherein said water-soluble cannabinoid is selected
from the group consisting of: a water soluble glycosylated cannabinoid, a water soluble
acetylated cannabinoid, or a mixture of both.
204. The composition of clause 203, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively.
205. The composition of clause 203, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vitro respectively.
206. The composition of clause 194, wherein said water-soluble cannabinoid is non-psychoactive.
207. A composition for a hard lozenge for rapid delivery of water-soluble cannabinoids
through the oral mucosa, the lozenge comprising:
- a crystalized sugar base;
- at least one water-soluble cannabinoid;
- wherein said hard lozenge has a moisture content between .1 to 2%.
208. The composition of clause 207, wherein said crystalized sugar base comprises
a crystalized sugar base selected from the group consisting of: sucrose, invert sugar,
corn syrup, and isomalt or a combination of the same.
209. The composition of clause 207, and further comprising at least one acidulant.
210. The composition of clause 209, wherein said acidulant is selected from the group
consisting of: citric acid, tartaric acid, fumaric acid, and malic acid.
211. The composition of clause 209, and further comprising at least one pH adjustor.
212. The composition of clause 211, wherein said pH adjustor is selected from the
group consisting of: calcium carbonate, sodium bicarbonate, and magnesium trisilicate.
213. The composition of clause 207, and further comprising at least one anesthetic.
214. The composition of clause 213, wherein said anesthetic is selected from the group
consisting of: benzocaine, and phenol.
215. The composition of clause 213, wherein said first quantity of anesthetic is between
1 mg to 15 mg.
216. The composition of clause 1207, and further comprising a first quantity of menthol.
217. The composition of clause 216, wherein said first quantity of menthol is between
1 mg to 20 mg.
218. The composition of clause 207, and further comprising a first quantity of a demulcent.
219. The composition of clause 218, wherein said demulcent is selected from the group
consisting of: pectin, glycerin, honey, methylcellulose, propylene glycol, and glycerine.
220. The composition of clause 218, wherein said first quantity of demulcent is between
1 mg to 10 mg.
221. The composition of clause 207, wherein said water-soluble cannabinoid is selected
from the group consisting of: a water soluble glycosylated cannabinoid, an acetylated
cannabinoid, or a mixture of both.
222. The composition of clause 221, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively
223. The composition of clause 221, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vitro respectively
224. The composition of clause 221, wherein the water-soluble cannabinoid is below
50mg.
225. The composition of clause 221, wherein the water-soluble cannabinoid is above
50mg.
226. The composition of clause 221, wherein said water-soluble cannabinoid is non-psychoactive.
227. A chewable lozenge for rapid delivery of water-soluble cannabinoids through the
oral mucosa, the lozenge comprising:
- a glycerinated gelatin base;
- at least one sweetener; and
- at least one water-soluble cannabinoid dissolved in a first quantity of water.
228. The composition of clause 227, wherein said sweetener comprises a sweetener selected
from the group consisting of: glucose, sucrose, invert sugar, corn syrup, stevia extract
powder, stevioside, steviol, aspartame, saccharin, saccharin salts, sucralose, potassium
acetosulfam, sorbitol, xylitol, mannitol, erythritol, lactitol, alitame, miraculin,
monellin, and thaumatin or a combination of the same.
229. The composition of clause 227, and further comprising at least one acidulant.
230. The composition of clause 229, wherein said acidulant is selected from the group
consisting of: citric acid, tartaric acid, fumaric acid, and malic acid.
231. The composition of clause 229, and further comprising at least one pH adjustor.
232. The composition of clause 231, wherein said pH adjustor is selected from the
group consisting of: calcium carbonate, sodium bicarbonate, and magnesium trisilicate.
233. The composition of clause 227, and further comprising at least one anesthetic.
234. The composition of clause 233, wherein said anesthetic is selected from the group
consisting of: benzocaine, and phenol.
235. The composition of clause 233, wherein said first quantity of anesthetic is between
1 mg to 15 mg.
236. The composition of clause 227, and further comprising a first quantity of menthol.
237. The composition of clause 236, wherein said first quantity of menthol is between
1 mg to 20 mg.
238. The composition of clause 227, and further comprising a first quantity of a demulcent.
239. The composition of clause 238, wherein said demulcent is selected from the group
consisting of: pectin, glycerin, honey, methylcellulose, propylene glycol, and glycerine.
240. The composition of clause 238, wherein said first quantity of demulcent is between
1 mg to 10 mg.
241. The composition of clause 227, wherein said water-soluble cannabinoid is selected
from the group consisting of: a water soluble glycosylated cannabinoid, an acetylated
cannabinoid, or a mixture of both.
242. The composition of clause 241, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively
243. The composition of clause 241, wherein the water-soluble cannabinoid is below
50mg.
244. The composition of clause 241, wherein the water-soluble cannabinoid is above
50mg.
245. The composition of clause 227, wherein said water-soluble cannabinoid is non-psychoactive.
246. A soft lozenge for rapid delivery of cannabinoids through the oral mucosa, the
lozenge comprising:
- a polyethylene glycol base;
- at least one sweetener; and
- at least one water-soluble cannabinoid.
247. The composition of clause 246, wherein said sweetener comprises a crystalized
sugar base selected from the group consisting of: glucose, sucrose, invert sugar,
corn syrup, stevia extract powder, stevioside, steviol, aspartame, saccharin, saccharin
salts, sucralose, potassium acetosulfam, sorbitol, xylitol, mannitol, erythritol,
lactitol, alitame, miraculin, monellin, and thaumatin or a combination of the same.
248. The composition of clause 246, and further comprising at least one acidulant.
249. The composition of clause 248, wherein said acidulant is selected from the group
consisting of: citric acid, tartaric acid, fumaric acid, and malic acid.
250. The composition of clause 248, and further comprising at least one pH adjustor.
251. The composition of clause 250, wherein said pH adjustor is selected from the
group consisting of: calcium carbonate, sodium bicarbonate, and magnesium trisilicate.
252. The composition of clause 247, and further comprising at least one anesthetic.
253. The composition of clause 252, wherein said anesthetic is selected from the group
consisting of: benzocaine, and phenol.
254. The composition of clause 252, wherein said first quantity of anesthetic is between
1 mg to 15 mg.
255. The composition of clause 246, and further comprising a first quantity of menthol.
256. The composition of clause 255, wherein said first quantity of menthol is between
1 mg to 20 mg.
257. The composition of clause 246, and further comprising a first quantity of a demulcent.
258. The composition of clause 257, wherein said demulcent is selected from the group
consisting of: pectin, glycerin, honey, methylcellulose, propylene glycol, and glycerine.
259. The composition of clause 2258, wherein said first quantity of demulcent is between
1 mg to 10 mg.
260. The composition of clause 246, wherein said water-soluble cannabinoid is selected
from the group consisting of: a water soluble glycosylated cannabinoid, an acetylated
cannabinoid, or a mixture of both.
261. The composition of clause 260, wherein said water soluble glycosylated cannabinoid,
and/or said acetylated cannabinoid were glycosylated and acetylated in vivo respectively 262 The composition of clause 260, wherein the water-soluble cannabinoid
is below 50mg.
263. The composition of clause 260, wherein the water-soluble cannabinoid is above
50mg.
264. The composition of clause 246, wherein said water-soluble cannabinoid is non-psychoactive.
265. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and maltodextrin.
266. The tablet or capsule of clause 265, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
267. The tablet or capsule of clause 265, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
268. The tablet or capsule of clause 265, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
269. The tablet or capsule of clause 265, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
270. The tablet or capsule of clause 265, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
271. The tablet or capsule of clause 265, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
272. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and whey protein isolate.
273. The tablet or capsule of clause 272, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
274. The tablet or capsule of clause 272, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
274. The tablet or capsule of clause 272, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
275. The tablet or capsule of clause 272, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
276. The tablet or capsule of clause 272, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
277. The tablet or capsule of clause 272, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
278. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and xanthan gum.
279. The tablet or capsule of clause 278, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
280. The tablet or capsule of clause 278, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
281. The tablet or capsule of clause 278, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
282. The tablet or capsule of clause 278, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
283. The tablet or capsule of clause 278, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
284. The tablet or capsule of clause 278, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
285. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and guar gum.
286. The tablet or capsule of clause 285, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
287. The tablet or capsule of clause 285, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
288. The tablet or capsule of clause 285, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
289. The tablet or capsule of clause 285, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
290. The tablet or capsule of clause 285, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
291. The tablet or capsule of clause 285, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
292. A tablet or capsule consisting essentially of water-soluble glycosylated cannabinoid
and diglycerides.
293. The tablet or capsule of clause 292 wherein the diglycerides are in a mix with
monoglycerides.
294. The tablet or capsule of clause 292, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
295. The tablet or capsule of clause 292, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
296. The tablet or capsule of clause 292, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
297. The tablet or capsule of clause 292, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
298. The tablet or capsule of clause 292, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
299. The tablet or capsule of clause 292, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
300. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and guar gum.
301. The tablet or capsule of clause 300, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
302. The tablet or capsule of clause 300, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
303. The tablet or capsule of clause 300, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
304. The tablet or capsule of clause 300, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
305. The tablet or capsule of clause 300, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
306. The tablet or capsule of clause 300, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
307. A tablet or capsule consisting essentially of water-soluble glycosylated cannabinoid
and carboxymethyl cellulose.
308. The tablet or capsule of clause 307, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
309. The tablet or capsule of clause 307, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
310. The tablet or capsule of clause 307, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
311. The tablet or capsule of clause 307, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
312. The tablet or capsule of clause 307, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
313. The tablet or capsule of clause 307, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
314. A tablet or capsule consisting essentially a water-soluble glycosylated cannabinoid
and glycerin.
315. The tablet or capsule of clause 314, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
316. The tablet or capsule of clause 314, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
317. The tablet or capsule of clause 314, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
318. The tablet or capsule of clause 314, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
319. The tablet or capsule of clause 314, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
320. The tablet or capsule of clause 314, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
321. A tablet or capsule consisting essentially of a water-soluble glycosylated cannabinoid
and gelatin.
322. The tablet or capsule of clause 321, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
323. The tablet or capsule of clause 321, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
324. The tablet or capsule of clause 321, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
325. The tablet or capsule of clause 321, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
326. The tablet or capsule of clause 321, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
327. The tablet or capsule of clause 321, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
328. A tablet or capsule consisting essentially of water-soluble glycosylated cannabinoid
and polyethylene glycol.
329. The tablet or capsule of clause 328, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vivo.
330. The tablet or capsule of clause 328, wherein said water-soluble glycosylated
cannabinoid comprises a water-soluble glycosylated cannabinoid generated in vitro.
331. The tablet or capsule of clause 328, wherein said water-soluble glycosylated
cannabinoid comprises a non-psychoactive water-soluble glycosylated cannabinoid.
332. The tablet or capsule of clause 328, wherein the amount of water-soluble glycosylated
cannabinoid is 5 milligrams or less.
333. The tablet or capsule of clause 328, wherein the amount of water-soluble glycosylated
cannabinoid 5 milligrams and 200 milligrams.
334. The tablet or capsule of clause 328, wherein the wherein the amount of water-soluble
glycosylated cannabinoid is more than 200 milligrams.
335. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and maltodextrin.
336. The tablet or capsule of clause 335, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
337. The tablet or capsule of clause 335, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
338. The tablet or capsule of clause 335, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
339. The tablet or capsule of clause 335, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
340. The tablet or capsule of clause 335, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
340. The tablet or capsule of clause 335, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
341. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and whey protein isolate.
342. The tablet or capsule of clause 341, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
343. The tablet or capsule of clause 341, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
344. The tablet or capsule of clause 341, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
345. The tablet or capsule of clause 341, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
346. The tablet or capsule of clause 341, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
347. The tablet or capsule of clause 341, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
348. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and xanthan gum.
349. The tablet or capsule of clause 348, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
350. The tablet or capsule of clause 348, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
351. The tablet or capsule of clause 348, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
352. The tablet or capsule of clause 348, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
353. The tablet or capsule of clause 348, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
354. The tablet or capsule of clause 348, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
355. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and guar gum.
356. The tablet or capsule of clause 355, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
357. The tablet or capsule of clause 355, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
358. The tablet or capsule of clause 355, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
359. The tablet or capsule of clause 355, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
360. The tablet or capsule of clause 355, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
361. The tablet or capsule of clause 355, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
362. A tablet or capsule consisting essentially of water-soluble acetylated cannabinoid
and diglycerides.
363. The tablet or capsule of clause 362 wherein the diglycerides are in a mix with
monoglycerides.
364. The tablet or capsule of clause 362, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
365. The tablet or capsule of clause 362, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
366. The tablet or capsule of clause 362, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
367. The tablet or capsule of clause 362, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
368. The tablet or capsule of clause 362, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
369. The tablet or capsule of clause 362, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
370. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and guar gum.
371. The tablet or capsule of clause 370, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
372. The tablet or capsule of clause 370, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
373. The tablet or capsule of clause 370, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
374. The tablet or capsule of clause 370, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
375. The tablet or capsule of clause 370, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
376. The tablet or capsule of clause 370, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
377. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and carboxymethyl cellulose.
378. The tablet or capsule of clause 377, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
379. The tablet or capsule of clause 377, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
380. The tablet or capsule of clause 377, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
390. The tablet or capsule of clause 377, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
391. The tablet or capsule of clause 377, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
392. The tablet or capsule of clause 377, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
393. A tablet or capsule consisting essentially a water-soluble acetylated cannabinoid
and glycerin.
394. The tablet or capsule of clause 393, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
395. The tablet or capsule of clause 393, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
396. The tablet or capsule of clause 393, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
397. The tablet or capsule of clause 393, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
398. The tablet or capsule of clause 393, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
399. The tablet or capsule of clause 393, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
400. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and gelatin.
401. The tablet or capsule of clause 400, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
402. The tablet or capsule of clause 400, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
403. The tablet or capsule of clause 400, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
404. The tablet or capsule of clause 400, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
405. The tablet or capsule of clause 400, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
406. The tablet or capsule of clause 400, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
407. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and polyethylene glycol.
408. The tablet or capsule of clause 407, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vivo.
409. The tablet or capsule of clause 407, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid generated in vitro.
410. The tablet or capsule of clause 407, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
411. The tablet or capsule of clause 407, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
412. The tablet or capsule of clause 407, wherein the amount of water-soluble acetylated
cannabinoid is between 5 milligrams and 200 milligrams.
413. The tablet or capsule of clause 407, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
414. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and maltodextrin.
415. The tablet or capsule of clause 414, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
416. The tablet or capsule of clause 414, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
417. The tablet or capsule of clause 414, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
418. The tablet or capsule of clause 414, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
419. The tablet or capsule of clause 414, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
420. The tablet or capsule of clause 414, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
421. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and whey protein isolate.
422. The tablet or capsule of clause 421, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
423. The tablet or capsule of clause 421, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
424. The tablet or capsule of clause 421, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
425. The tablet or capsule of clause 421, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
426. The tablet or capsule of clause 421, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
427. The tablet or capsule of clause 421, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
428. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and xanthan gum.
429. The tablet or capsule of clause 428, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
430. The tablet or capsule of clause 428, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
431. The tablet or capsule of clause 428, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
432. The tablet or capsule of clause 428, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
433. The tablet or capsule of clause 428, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
432. The tablet or capsule of clause 428, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
433. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and guar gum.
434. The tablet or capsule of clause 433, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
435. The tablet or capsule of clause 433, wherein said water-soluble acetylated cannabinoid
comprises a water-soluble acetylated cannabinoid and a water-soluble glycosylated
cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
436. The tablet or capsule of clause 433, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
437. The tablet or capsule of clause 433, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
438. The tablet or capsule of clause 433, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
439. The tablet or capsule of clause 433, wherein the wherein the amount of water-soluble
acetylated cannabinoid is more than 200 milligrams.
440. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and diglycerides.
441. The tablet or capsule of clause 440 wherein the diglycerides are in a mix with
monoglycerides.
442. The tablet or capsule of clause 440, wherein said water-soluble cannabinoid comprises
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid
and a water-soluble glycosylated cannabinoid generated in vivo.
443. The tablet or capsule of clause 440, wherein said water-soluble cannabinoid comprises
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid
and a water-soluble glycosylated cannabinoid generated in vitro.
444. The tablet or capsule of clause 440, wherein said water-soluble acetylated cannabinoid
comprises a non-psychoactive water-soluble acetylated cannabinoid.
445. The tablet or capsule of clause 440, wherein the amount of water-soluble acetylated
cannabinoid is 5 milligrams or less.
446. The tablet or capsule of clause 440, wherein the amount of water-soluble acetylated
cannabinoid 5 milligrams and 200 milligrams.
447. The tablet or capsule of clause 440, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
448. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and guar gum.
449. The tablet or capsule of clause 448, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
450. The tablet or capsule of clause 448, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
451. The tablet or capsule of clause 448, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a non-psychoactive
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
452. The tablet or capsule of clause 448, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is 5 milligrams or less.
453. The tablet or capsule of clause 448, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid 5 milligrams and 200 milligrams.
454. The tablet or capsule of clause 448, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
455. A tablet or capsule consisting essentially of comprises a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated
cannabinoid and carboxymethyl cellulose.
456. The tablet or capsule of clause 455, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
457. The tablet or capsule of clause 455, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
458. The tablet or capsule of clause 455, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a non-psychoactive
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
459. The tablet or capsule of clause 455, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is 5 milligrams or less.
460. The tablet or capsule of clause 455, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid 5 milligrams and 200 milligrams.
461. The tablet or capsule of clause 455, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
462. A tablet or capsule consisting essentially a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and glycerin.
463. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
464. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
465. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a non-psychoactive
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
466. The tablet or capsule of clause 462, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is 5 milligrams or less.
467. The tablet or capsule of clause 462, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid 5 milligrams and 200 milligrams.
468. The tablet or capsule of clause 462, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
462. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and gelatin.
470. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
471. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
472. The tablet or capsule of clause 462, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a non-psychoactive
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
473. The tablet or capsule of clause 462, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is 5 milligrams or less.
474. The tablet or capsule of clause 462, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid 5 milligrams and 200 milligrams.
475. The tablet or capsule of clause 462, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
476. A tablet or capsule consisting essentially of a water-soluble acetylated cannabinoid
and a water-soluble glycosylated cannabinoid and a water-soluble glycosylated cannabinoid
and polyethylene glycol.
477. The tablet or capsule of clause 476, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vivo.
478. The tablet or capsule of clause 476, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid generated in vitro.
479. The tablet or capsule of clause 476, wherein said a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid comprises a non-psychoactive
a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
480. The tablet or capsule of clause 476, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is 5 milligrams or less.
481. The tablet or capsule of clause 476, wherein the amount of a water-soluble acetylated
cannabinoid and a water-soluble glycosylated cannabinoid is between 5 milligrams and
200 milligrams.
482. The tablet or capsule of clause 476, wherein the wherein the amount of a water-soluble
acetylated cannabinoid and a water-soluble glycosylated cannabinoid is more than 200
milligrams.
483. A method of manufacturing and packaging a cannabinoid dosage, consisting of the
following steps:
- preparing a fill solution with a desired concentration of a water-soluble cannabinoid
in a liquid carrier wherein said cannabinoid solubilized in said liquid carrier;
- encapsulating said fill solution in capsules;
- packaging said capsules in a closed packaging system; and
- removing atmospheric air from the capsules,
wherein the removing of atmospheric air consists solely of purging said packaging
system with an inert gas, and wherein said packaging system provides a room temperature
stable product.
484. The method of clause 483, wherein the packaging system is a blister package.
485. The method of clause 484 wherein the blister package is constructed of material
that minimizes exposure to moisture and air.
486. The method of clause 483, wherein the cannabinoid is a glycosylated cannabinoid,
a acetylated cannabinoid or a mixture of the two.
487. The method of clause 486, wherein said glycosylated cannabinoid and/or said acetylated
cannabinoid are generated in vivo.
488. The method of clause 486, wherein said glycosylated cannabinoid and/or said acetylated
cannabinoid are generated in vitro.
489. The method of clause 483, wherein the liquid carrier is water-based carrier.
490. The method of clause 487, wherein the water-based carrier is an aqueous sodium
chloride solution.
491. The method of clause 483, wherein the capsules are soft gelatin capsules.
492. The method of clause 483, wherein the inert gas is nitrogen.
493. The method of clause 483, wherein the desired cannabinoid concentration is about
1-10% w/w.
494. The method of clause 493 wherein the desired concentration is about 1.5-6.5%
w/w.
495. An oral pharmaceutical solution consisting essentially of a water-soluble cannabinoid,
30-33% w/w water, about 50% w/w alcohol, 0.01% w/w butylated hydroxylanisole (BHA)
or 0.1% w/w ethylenediaminetetraacetic acid (EDTA) and 5-21% w/w co-solvent, having
a combined total of 100%, wherein said co-solvent is selected from the group consisting
of propylene glycol, polyethylene glycol and combinations thereof, and wherein said
water-soluble cannabinoid is a glycosylated cannabinoid, an acetylated cannabinoid
or a mixture of the two.
496. The oral pharmaceutical solution of clause 495 consisting essentially of 0.1
to 5% w/w of said water-soluble cannabinoid, about 50% w/w alcohol, 5.5% w/w propylene
glycol, 12% w/w polyethylene glycol and 30-33% w/w water.
497. The oral pharmaceutical solution of clause 496, wherein said alcohol is ethanol.
498. An oral pharmaceutical solution consisting essentially of about 0.1% to 1% w/w
water-soluble cannabinoid, about 50% w/w alcohol, 5.5% w/w propylene glycol, 12% w/w
polyethylene glycol, 30-33% w/w water, 0.01% w/w butylated hydroxyanisole, having
a combined total of 100%, and wherein said water-soluble cannabinoid is a glycosylated
cannabinoid, an acetylated cannabinoid or a mixture of the two wherein that were generated
in vivo.
499. The oral pharmaceutical solution of clause 498 in sublingual spray form.
500. An oral pharmaceutical solution comprising 0.54% w/w water-soluble cannabinoid,
31.9% w/w water, 12% w/w polyethylene glycol 400, 5.5% w/w propylene glycol, 0.01%
w/w butylated hydroxyanisole, 0.05% w/w sucralose, and 50% w/w alcohol.
501. An solution for nasal and/or sublingual administration of a composition comprising:
- an excipient of propylene glycol, ethanol anhydrous, or a mixture of both;
- a water-soluble glycosylated cannabinoid;
502. The solution of clause 501, wherein said glycosylated cannabinoid is generated
in vivo.
503. The solution of clause 501, wherein said glycosylated cannabinoid is generated
in vitro.
504. The solution of clause 501, wherein said glycosylated cannabinoid is non-psychoactive.
505. The aqueous solution of clause 501, and further comprising a topical decongestant.
506. The aqueous solution of clause 505, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
507. The aqueous solution of clause 501, and further comprising an antihistamine.
508. The aqueous solution of clause 501, and further comprising a steroid.
509. The aqueous solution of clause 509, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
510. The aqueous solution of clause 501, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
511. An solution for nasal and/or sublingual administration of a composition comprising:
- an excipient of propylene glycol, ethanol anhydrous or a mixture of both; and
- an water-soluble acetylated cannabinoid.
512. The solution of clause 511, wherein said acetylated cannabinoid is generated
in vivo.
513. The solution of clause 511, wherein said acetylated cannabinoid is generated
in vitro.
514. The solution of clause 511, wherein said acetylated cannabinoid is non-psychoactive.
515. The aqueous solution of clause 511, and further comprising a topical decongestant.
516. The aqueous solution of clause 515, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
517. The aqueous solution of clause 511, and further comprising an antihistamine.
518. The aqueous solution of clause 511, and further comprising a steroid.
519. The aqueous solution of clause 518, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
520. The aqueous solution of clause 519, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
521. A solution for nasal and/or sublingual administration of a composition comprising:
- an excipient of propylene glycol, ethanol anhydrous or a mixture of both; and
- a water-soluble glycosylated cannabinoid and an water-soluble acetylated cannabinoid.
522. The solution of clause 521, wherein said acetylated cannabinoid and said glycosylated
cannabinoid is generated in vivo.
523. The solution of clause 521, wherein said acetylated cannabinoid and said glycosylated
cannabinoid is generated in vitro.
524. The solution of clause 521, wherein said acetylated cannabinoid and said glycosylated
cannabinoid are non-psychoactive.
525. The aqueous solution of clause 521, and further comprising a topical decongestant.
526. The aqueous solution of clause 525, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
527. The aqueous solution of clause 521, and further comprising an antihistamine.
528. The aqueous solution of clause 521, and further comprising a steroid.
529. The aqueous solution of clause 528, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
530. The aqueous solution of clause 529, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
531. An aqueous solution for nasal and/or sublingual administration of a compositions
comprising:
- a saline solution; and
- a water-soluble glycosylated cannabinoid.
532. The aqueous solution of clause 531, wherein said glycosylated cannabinoid is
generated in vivo.
533. The aqueous solution of clause 531, wherein said glycosylated cannabinoid is
generated in vitro.
534. The aqueous solution of clause 531, wherein said glycosylated cannabinoid is
non-psychoactive.
535. The aqueous solution of clause aqueous 531, and further comprising a topical
decongestant.
536. The aqueous solution of clause 535, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
537. The aqueous solution of clause 531, and further comprising an antihistamine.
538. The aqueous solution of clause 531, and further comprising a steroid.
539. The aqueous solution of clause 539, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
540. The aqueous solution of clause 531, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
541. An aqueous solution for nasal and/or sublingual administration of a composition
comprising:
- a saline solution; and
- a water-soluble acetylated cannabinoid.
542. The aqueous solution of clause 541, wherein said acetylated cannabinoid is generated
in vivo.
543. The aqueous solution of clause 541, wherein said acetylated cannabinoid is generated
in vitro.
544. The aqueous solution of clause 541, wherein said acetylated cannabinoid is non-psychoactive.
545. The aqueous solution of clause 541, and further comprising a topical decongestant.
546. The aqueous solution of clause 545, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
547. The aqueous solution of clause 546, and further comprising an antihistamine.
548. The aqueous solution of clause 545, and further comprising a steroid.
549. The aqueous solution of clause 548, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
550. The aqueous solution of clause 549, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
551. An aqueous solution for nasal and/or sublingual administration of a composition
comprising:
- a saline solution; and
- a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
552. The aqueous solution of clause 551, wherein said acetylated cannabinoid and said
glycosylated cannabinoid is generated in vivo.
553. The aqueous solution of clause 551, wherein said acetylated cannabinoid and said
glycosylated cannabinoid is generated in vitro.
554. The aqueous solution of clause 551, wherein said acetylated cannabinoid and said
glycosylated cannabinoid are non-psychoactive.
555. The aqueous solution of clause 551, and further comprising a topical decongestant.
556. The aqueous solution of clause 555, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
557. The aqueous solution of clause 551, and further comprising an antihistamine.
558. The aqueous solution of clause 551, and further comprising a steroid.
559. The aqueous solution of clause 557, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
560. The aqueous solution of clause 551, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
561. An aqueous solution for nasal and/or sublingual administration of a compositions
comprising:
- purified water; and
- a water-soluble glycosylated cannabinoid.
562. The aqueous solution of clause 561, wherein said glycosylated cannabinoid is
generated in vivo.
563. The aqueous solution of clause 561, wherein said glycosylated cannabinoid is
generated in vitro.
564. The solution of clause 561, wherein said glycosylated cannabinoid is non-psychoactive.
565. The aqueous solution of clause 561, and further comprising a topical decongestant.
566. The aqueous solution of clause 565, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
567. The aqueous solution of clause 561, and further comprising an antihistamine.
568. The aqueous solution of clause 561, and further comprising a steroid.
569. The aqueous solution of clause 568, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
570. The aqueous solution of clause 561, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
571. An aqueous solution for nasal and/or sublingual administration of a composition
comprising:
- purified water; and
- a water-soluble acetylated cannabinoid.
572. The aqueous solution of clause 571, wherein said acetylated cannabinoid is generated
in vivo.
573. The aqueous solution of clause 571, wherein said acetylated cannabinoid is generated
in vitro.
574. The solution of clause 571, wherein said acetylated cannabinoid is non-psychoactive.
575. The aqueous solution of clause 571, and further comprising a topical decongestant.
576. The aqueous solution of clause 575, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
577. The aqueous solution of clause 571, and further comprising an antihistamine.
578. The aqueous solution of clause 571, and further comprising a steroid.
579. The aqueous solution of clause 578, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
580. The aqueous solution of clause 579, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
581. An aqueous solution for nasal and/or sublingual administration of a composition
comprising:
- purified water; and
- a water-soluble acetylated cannabinoid and a water-soluble glycosylated cannabinoid.
582. The aqueous solution of clause 581, wherein said acetylated cannabinoid and said
glycosylated cannabinoid is generated in vivo.
583. The aqueous solution of clause 581, wherein said acetylated cannabinoid and said
glycosylated cannabinoid is generated in vitro.
584. The aqueous solution of clause 581, wherein said acetylated cannabinoid and said
glycosylated cannabinoid are non-psychoactive.
585. The aqueous solution of clause 581, and further comprising a topical decongestant.
586. The aqueous solution of clause 585, wherein said topical decongestant is selected
from the group consisting of: phenylephrine hydrochloride, Oxymetazoline hydrochloride,
and Xylometazoline.
587. The aqueous solution of clause 581, and further comprising an antihistamine.
588.The aqueous solution of clause 581, and further comprising a steroid.
589. The aqueous solution of clause 588, wherein said steroid is a corticosteroid
selected from the group consisting of: neclomethasone dipropionate,budesonide, ciclesonide,
flunisolide, fluticasone furoate, fluticasone propionate, mometasone, triamcinolone
acetonide.
590. The aqueous solution of clause 581, the solution further comprising at least
one of the following: benzalkonium chloride solution, benzyl alcohol, boric acid,
purified water, sodium borate, polysorbate 80, phenylethyl alcohol, microcrystalline
cellulose, carboxymethylcellulose sodium, dextrose, dipasic, sodium phosphate, edetate
disodium, monobasic sodium phosphate, propylene glycol.
591. A topical formulation consisting of a water-soluble glycosylated cannabinoid,
and/or water-soluble acetylated cannabinoid, or a mixture of both, and a pharmaceutically
acceptable excipient.
592. The topical formulation according to clause 591, and further comprising a quantity
of capsaicin.
593. The topical formulation according to clause 591, and further comprising a quantity
of benzocaine.
594. The topical formulation according to clause 591, and further comprising a quantity
of lidocaine.
595. The topical formulation according to clause 591, and further comprising a quantity
of camphor.
596. The topical formulation according to clause 591, and further comprising a quantity
of benzoin resin.
597. The topical formulation according to clause 591, and further comprising a quantity
of methylsalicilate.
598. The topical formulation according to clause 591, and further comprising a quantity
of triethanolamine salicylate.
599. The topical formulation according to clause 591, and further comprising a quantity
of hydrocortisone.
600. The topical formulation according to clause 591, and further comprising a quantity
of salicylic acid.
601. The topical formulation according to clause 591, and further comprising a wherein
the pharmaceutically acceptable excipient is selected from the group consisting of:
gels, ointments, cataplasms, poultices, pastes, creams, lotions, plasters and jellies
602. The topical formulation according to clause 591, and further comprising a polyethylene
glycol.
603. A gel for transdermal administration, the mixture preferably contains from 15%
to about 90% ethanol, from about 10% to about 60% buffered aqueous solution or water,
from about 0.1 to about 25% propylene glycol, from about 0.1 to about 20% of a gelling
agent, from about 0.1 to about 20% of a base, from about 0.1 to about 20% of an absorption
enhancer and from about 1% to about 25% polyethylene glycol and a water-soluble cannabinoid.
604. The gel of clause 603, wherein said water-soluble cannabinoid comprises a water-soluble
glycosylated cannabinoid, and/or water-soluble acetylated cannabinoid, or a mixture
of both
605. The gel of clause 604, wherein said glycosylated cannabinoid, and/or said acetylated
cannabinoid were generated in vivo.
606. The gel of clause 604, wherein said glycosylated cannabinoid, and/or said acetylated
cannabinoid were generated in vitro.
607. A formulation comprising the following volumetric amounts: (i) from about 15%
to about 90% ethanol, (ii) a glycol selected from the group consisting of (a) propylene
glycol from about 0.1% to about 25%, (b) polyethylene glycol from about 1 to about
30%, and (c) a combination of (a) and (b), (iii) from about 0.1 to about 20% of a
gelling agent, (iv) from about 0.1 to about 20% of a base and (v) from about 0.1 to
about 20% of an absorption enhancer, and a water-soluble cannabinoid, said formulation
being suitable for transdermal administration.
608. The formulation of clause 607, wherein said water-soluble cannabinoid comprises
a water-soluble glycosylated cannabinoid, and/or water-soluble acetylated cannabinoid,
or a mixture of both.
609. The formulation of clause 608, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
610. The formulation of clause 608, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vitro.
611. A transdermal composition comprising a pharmaceutically effective amount of a
water-soluble cannabinoid for delivery of the cannabinoid to the bloodstream of a
user, said composition comprising:
- a pharmaceutically acceptable excipient;
- at least one water-soluble cannabinoid;
wherein the cannabinoid is capable of diffusing from the composition into the bloodstream
of the user.
612. The composition of clause 611, wherein the water-soluble cannabinoid is selected
from the group consisting of: a glycosylated cannabinoid, an acetylated cannabinoid,
and a mixture of both.
613. The composition of clause 612, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
614. The composition of clause 611, wherein the transdermal composition further comprises
one or more pharmaceutically acceptable excipients to create a transdermal dosage
form selected from the group consisting of: gels, ointments, cataplasms, poultices,
pastes, creams, lotions, plasters and jellies.
615. The composition of clause 611, and further comprising a surfactant.
616. The composition of clause 611, wherein the surfactant is a surfactant-lecithin
organogel.
617. The composition of clause 611, wherein the surfactant-lecithin organogel is present
in an amount of between about between about 95% and about 98% w/w.
618. The composition of clause 611, wherein the surfactant-lecithin organogel comprises
lecithin and PPG-2 myristyl ether propionate.
619. The composition of clause 611, wherein the surfactant-lecithin organogel comprises
a surfactant comprising high molecular weight polyacrylic acid polymers.
622. The composition of clause 611, wherein the composition further comprises isopropyl
myristate.
623. The composition of clause 611, wherein the water-soluble cannabinoid is non-psychoactive.
624. The composition of clause 611, wherein the pharmaceutically acceptable excipients
is selected from the group consisting of: gels, ointments, cataplasms, poultices,
pastes, creams, lotions, plasters and jellies
625. A transdermal composition comprising a pharmaceutically effective amount of a
water-soluble cannabinoid for delivery of the cannabinoid to the bloodstream of a
user, said composition comprising:
- a permeation enhancer;
- at least one water-soluble cannabinoid;
wherein the cannabinoid is capable of diffusing from the composition into the bloodstream
of the user.
626. The composition of clause 625, wherein the water-soluble cannabinoid is selected
from the group consisting of: a glycosylated cannabinoid, an acetylated cannabinoid,
and a mixture of both.
627. The composition of clause 626, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
628. The composition of clause 625, wherein the permeation enhancer is selected from
the group consisting of: propylene glycol monolaurate, diethylene glycol monoethyl
ether, an oleoyl macrogolglyceride, a caprylocaproyl macrogolglyceride, and an oleyl
alcohol.
629. The composition of clause 625, herein the transdermal composition further comprises
one or more pharmaceutically acceptable excipients to create a transdermal dosage
form selected from the group consisting of: gels, ointments, cataplasms, poultices,
pastes, creams, lotions, plasters and jellies.
630. A liquid cannabinoid liniment composition consisting of water, isopropyl alcohol
solution and a water-soluble cannabinoid.
631. The composition of clause 630, wherein said water-soluble cannabinoid is selected
from the group consisting of: a glycosylated cannabinoid, an acetylated cannabinoid,
and a mixture of both.
632. The composition of clause 632, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
633. The composition of clause 630, consisting of from about 97.5% to about 99.5%
by weight of 70% isopropyl alcohol solution and from about 0.5% to about 2.5% by weight
of a cannabinoid mixture
634. A commercially available topical creme composition infused with a glycosylated
cannabinoid, an acetylated cannabinoid, and a mixture of both.
635. The composition of clause 634, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
636. A commercially available lip balm composition supplemented with a water-soluble
cannabinoid wherein said comprises a glycosylated cannabinoid, and/or an acetylated
cannabinoid, and/or a mixture of both.
637. The composition of clause 636, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
638. A commercially available cosmetic composition supplemented with a water-soluble
cannabinoid wherein said comprises a glycosylated cannabinoid, and/or an acetylated
cannabinoid, and/or a mixture of both.
639. The composition of clause 638, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
640. A tobacco plant containing at least one water-soluble cannabinoids.
641. The tobacco plant in clause 640, wherein said water-soluble cannabinoid comprises
a glycosylated cannabinoid, and/or an acetylated cannabinoid, and/or a mixture of
both.
642. The tobacco plant of clause 641, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
643. The tobacco plant of clause 641, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vitro.
644. The tobacco plant of clause 640, wherein said water-soluble cannabinoid is non-psychoactive.
645. The tobacco plant of clause 640, wherein said tobacco plant is used to generate
a water-soluble cannabinoid infused tobacco product.
646. The tobacco plant of clause 645, wherein said cannabinoid infused tobacco product
is a cigarette, pipe tobacco, chewing tobacco, cigar, smokeless tobacco.
646. A composition comprising:
- an aqueous solution;
- water-soluble cannabinoid dissolved in said aqueous solution wherein said water-soluble
cannabinoid comprises a glycosylated cannabinoid, and/or an acetylated cannabinoid,
and/or a mixture of both;
wherein said composition may be introduced to a cigarette and/or a tobacco leaf such
that said aqueous solution may evaporate generating a cigarette and/or a tobacco leaf
that contains said water-soluble cannabinoid.
647. The composition of clause 646, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
648. The composition of clause 646, wherein said glycosylated cannabinoid, and/or
said acetylated cannabinoid were generated in vivo.
649. The composition of clause 646, wherein said water-soluble cannabinoid is non-psychoactive.
650. The composition of clause 646, wherein said aqueous solution comprises purified
water.
651. A method of treating a medical condition in a mammal comprising the step of administering
a therapeutically effective amount of a glycosylated cannabinoid, and/or an acetylated
cannabinoid, and/or a mixture of both or a pharmaceutically acceptable salt thereof,
wherein the medical condition is selected from the group consisting of: obesity, post-traumatic
stress syndrome, anorexia, nausea, emesis, pain, wasting syndrome, HIV-wasting, chemotherapy
induced nausea and vomiting, alcohol use disorders, anti-tumor, amyotrophic lateral
sclerosis, glioblastoma multiforme, glioma, increased intraocular pressure, glaucoma,
cannabis use disorders, Tourette's syndrome, dystonia, multiple sclerosis, inflammatory
bowel disorders, arthritis, dermatitis, Rheumatoid arthritis, systemic lupus erythematosus,
anti-inflammatory, anticonvulsant, anti-psychotic, anti-oxidant, neuroprotective,
anti-cancer, immunomodulatory effects, peripheral neuropathic pain, neuropathic pain
associated with post-herpetic neuralgia, diabetic neuropathy, shingles, burns, actinic
keratosis, oral cavity sores and ulcers, post-episiotomy pain, psoriasis, pruritis,
contact dermatitis, eczema, bullous dermatitis herpetiformis, exfoliative dermatitis,
mycosis fungoides, pemphigus, severe erythema multiforme (e.g., Stevens-Johnson syndrome),
seborrheic dermatitis, ankylosing spondylitis, psoriatic arthritis, Reiter's syndrome,
gout, chondrocalcinosis, joint pain secondary to dysmenorrhea, fibromyalgia, musculoskeletal
pain, neuropathic-postoperative complications, polymyositis, acute nonspecific tenosynovitis,
bursitis, epicondylitis, post-traumatic osteoarthritis, synovitis, and juvenile rheumatoid
arthritis.
652. The method of clause 651 wherein the compound is administered by a route selected
from the group consisting of: transdermal, topical, oral, buccal, sublingual, intra-venous,
intramuscular, vaginal, rectal, ocular, nasal and follicular.
653. The method of clause 652, wherein said glycosylated cannabinoid, and/or an acetylated
cannabinoid, and/or a mixture of both are glycosylated cannabinoid, and/or acetylated
in vivo.
REFERENCES
[0303] The following references are hereby incorporated in their entirety by reference:
[1] I von Ossowski, M R Mulvey, P A Leco, A Borys and P C Loewen, J. Bacteriol. 1991,
173(2):514.
[2] Behera, A., Behera, A., Mishra, S. C., Swain, S. K., & Author, C. (2003). Cannabinoid
glycosides: In vitro production of a new class of cannabinoids with improved physicochemical
properties. Proc. Intl. Soc. Mag. Reson. Med (Vol. 14).
[3] Holland, M. L., Lau, D. T. T., Allen, J. D., & Arnold, J. C. (2009). The multidrug
transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids. British Journal
of Pharmacology, 152(5), 815-824. https://doi.org/10.1038/sj.bjp.0707467
[4] Ivanchenco. M., Vejlupkova. Z., Quatrano. R.S., Fowler. J. E. (2000) Maize ROP7 GTPase
contains a unique, CaaX box-independent plasma membrane targeting signal. The Plant
Journal, (24)1, 79-90.
[5] James M. Rini and Jeffrey D. Esko. Glycosyltransferases and Glycan-Processing Enzymes.
In: Essentials of Glycobiology [Internet]. 3rd edition. https://www.ncbi.nlm.nih.gov/books/NBK310274/?report=reader
[6] Marks, M. D., Tian, L., Wenger, J. P., Omburo, S. N., Soto-Fuentes, W., He, J., ...
Dixon, R. A. (2009). Identification of candidate genes affecting Δ9-tetrahydrocannabinol
biosynthesis in Cannabis sativa. Journal of Experimental Botany, 60(13), 3715-3726.
https://doi.org/10.1093/jxb/erp210
[7] Nagaya, S., Kawamura, K., Shinmyo, A., & Kato, K. (2010). The HSP terminator of arabidopsis
thaliana increases gene expression in plant cells Plant and Cell Physiology, 51(2),
328-332. https://doi.org/10.1093/pcp/pcp188
[8] Norambuena, L., Marchant, L., Berninsone, P., Hirschberg, C. B., Silva, H., & Orellana,
A. (2002). Transport of UDP-galactose in plants. Identification and functional characterization
of AtUTr1, an Arabidopsis thaliana UDP-galactose/UDP-glucose transporter. Journal
of Biological Chemistry, 277(36), 32923-32929. https://doi.org/10.1074/jbc.M204081200
[9] Onofri, C., De Meijer, E. P. M., & Mandolino, G. (2015). Sequence heterogeneity of
cannabidiolic- and tetrahydrocannabinolic acid-synthase in Cannabis sativa L. and
its relationship with chemical phenotype. Phytochemistry, 116(1), 57-68. https://doi.org/10.1016/j.phytochem.2015.03.006
[9] Priest, D. M., Ambrose, S. J., Vaistij, F. E., Elias, L., Higgins, G. S., Ross, A.
R. S., . Bowles, D. J. (2006). Use of the glucosyltransferase UGT71B6 to disturb abscisic
acid homeostasis in Arabidopsis thaliana. Plant Journal, 46(3), 492-502. https://doi.org/1111/j.1365-313X.2006.02701.x
[10] Siritunga, D., and Sayre, R. T. (2003). Generation of cyanogen-free transgenic cassava.
Planta 217, 367-373. doi: 10.1007/s00425-003-1005-8
[11] Sparkes, I. A., Runions, J., Kearns, A., & Hawes, C. (2006). Rapid, transient expression
of fluorescent fusion proteins in tobacco plants and generation of stably transformed
plants. Nature Protocols, 1(4), 2019-2025. https://doi.org/10.1038/nprot.2006.286
[13] Taura, F., Morimoto, S., & Shoyama, Y. (1996). Purification and characterization of
cannabidiolic-acid synthase from Cannabis sativa L. Biochemical analysis of a novel
enzyme that catalyzes the oxidocyclization of. Journal of Biological Chemistry, 271(29),
17411-17416. https://doi.org/10.1074/JBC.271.29.17411
[14] Taura, F., Sirikantaramas, S., Shoyama Y, Yoshikai K, Shoyama Y, Morimoto S.(2007)
Cannabidiolic-acid synthase, the chemotype-determining enzyme in the fiber-type Cannabis
sativa. Febbs letters, 581(16), 2929-34. DOI:10.1016/j.febslet.2007.05.043
[15] Yoo, S. D., Cho, Y. H., & Sheen, J. (2007). Arabidopsis mesophyll protoplasts: A versatile
cell system for transient gene expression analysis. Nature Protocols, 2(7), 1565-1572.
https://doi.org/10.1038/nprot.2007.199
[16] Matsui, T., Matsuura, H., Sawada, K., Takita, E., Kinjo, S., Takenami, S., ... Kato,
K. (2012). High level expression of transgenes by use of 5'-untranslated region of
the Arabidopsis thaliana arabinogalactan-protein 21 gene in dicotyledons. Plant Biotechnology,
29(3), 319-322. https://doi.org/10.5511/plantbiotechnology.12.0322a
[17] Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bioassays
with tobacco tissue culture. Physiol. Plant. 15, 473-497. doi: 10.1111/ j.1399-3054.1962.tb08052.x
[18] Zipp, et al., Cannabinoid glycosides: In v itro production of a new class of cannabinoids
with improved physicochemical properties. bioRxiv preprint doi: http://dx.doi.org/10.1101/104349
[19] Mohamed, E. A., T. Iwaki, I. Munir, M. Tamoi, S. Shigeoka, and A. Wadano. 2003. Overexpression
of bacterial catalase in tomato leaf chloroplasts enhances photo-oxidative stress
tolerance. Plant Cell Environ. 26:2037-2046.
[20] Akhtar, M.T., 2013, Doctoral Thesis, Leiden University. Cannabinoids and zebrafish.
2013-05-22. http://hdl.handle.net/1887/20899
[21] Sayed Farag. Cannabinoids production in Cannabis sativa L.: An in vitro approach.
Thesis January 2014. DOI: 10.17877/DE290R-16298
[21] K, Watanabe, et al., Cytochrome P450 enzymes involved in the metabolism of tetrahydrocannabinols
and cannabinol by human hepatic microsomes. Life Sciences. Volume 80, Issue 15, 20
March 2007, Pages 1415-1419
[22] Flores-Sanchez IJ. et al., Elicitation studies in cell suspension cultures of Cannabis
sativa L. J Biotechnol. 2009 Aug 20;143(2):157-68. doi: 10.1016/j.jbiotec.
[23] Stephen M. Stout & Nina M. Cimino (2013) Exogenous cannabinoids as substrates, inhibitors,
and inducers of human drug metabolizing enzymes: a systematic review, Drug Metabolism
Reviews, 46:1, 86-95, DOI: 10.3109/03602532.2013.849268
[24] Andre CM, Hausman J-F, Guerriero G. Cannabis sativa: The Plant of the Thousand and
One Molecules. Frontiers in Plant Science. 2016;7:19. doi:10.3389/fpls.2016.00019.
[25] Mahlberg Pl. et a;., Accumulation of Cannabinoids in Glandular Trichomes of Cannabis
(Cannabaceae). Journal of Industrial Hemp 9(1):15-36 · June 2004 with 273 Reads DOI:
10.1300/J237v09n01_04.
[25] Katalin S., et al., Mini Rev Med Chem. 2017;17(13):1223-1291. doi: 10.2174/1389557516666161004162133.
[26] Sirikantaramas S., et al., Tetrahydrocannabinolic Acid Synthase, the Enzyme Controlling
Marijuana Psychoactivity, is Secreted into the Storage Cavity of the Glandular Trichomes.
Plant and Cell Physiology, Volume 46, Issue 9, 1 September 2005, Pages 1578-1582,
https://doi.org/10.1093/pcp/pci166.
[26] Schilmiller AL, Last RL, Pichersky E (2008) Harnessing plant trichome biochemistry
for the production of useful compounds. Plant Journal 54: 702-711.
[27] Matias-Hernandez, L. et al. AaMYB1 and its orthologue AtMYB61 affect terpene metabolism
and trichome development in Artemisia annua and Arabidopsis thaliana. Plant J.
[28] Ahmad, M., Hirz, M., Pichler, H., & Schwab, H. (2014). Protein expression in Pichia
pastoris: Recent achievements and perspectives for heterologous protein production.
Applied Microbiology and Biotechnology, 98(12), 5301-5317..
[29] Cregg, J. M., Cereghino, J. L., Shi, J., & Higgins, D. R. (2000). Recombinant Protein
Expression in Pichia pastoris. Molecular Biotechnology, 16(1), 23-52..
[30] Ellis, S. B., Brust, P. F., Koutz, P. J., Waters, A. N. N. F., Harpold, M. M., Gingeras,
T. R., & Al, E. E. T. (1985). Isolation of Alcohol Oxidase and Two Other Methanol
Regulatable Genes from the Yeast Pichia pastoris, 5(5), 1111-1121.
[31] Santos, R. B., Abranches, R, Fischer, R., Sack, M., & Holland, T. (2016). Putting
the Spotlight Back on Plant Suspension Cultures. Frontiers in Plant Science, 7(March),
1-12..
[32] Nagata, T., Nemoto, Y., and Hasezawa, S. (1992). Tobacco BY-2 cell line as the "HeLa"
cell in the cell biology of higher plants. Int. Rev. Cytol. 132, 1-30. doi: 10.1016/S0074-7696(08)62452-3
SEQUENCE LISTINGS