FLUORESCENT DYE, PREPARATION METHOD THEREFOR, AND USE THEREOF

Abstract

 A fluorescent dye, as well as a preparation method and uses thereof, wherein the fluorescent dye is sensitive and specific to viscosity and has low background fluorescence; it can also be used as a fluorescent activated and lighted probe used for fluorescent labeling, quantification or monitoring of protein, enzymes or nucleic acid.

Description

Technical Field

[0001] The present invention relates to the technical field of fluorescent dye, and particularly relates to a fluorescent dye with viscosity responsiveness and low background fluorescence, as well as a preparation method and uses thereof.

Background

[0002] Molecular rotors are a kind of dyes the fluorescence intensity of which changes with microenvironment viscosity. After excitation of molecular rotors, conformation of molecules is twisted and TICT (twisted intramolecular charge transfer) is formed, wherein the excited energy are mainly released in a non-radiative form; when the molecules are in a microenvironment of comparatively large viscosity or rigidity, the twisted molecular conformation will be restricted for this kind of molecules, and the excited energy of dye will be mainly released in the form of radioluminescence, namely, the fluorescence property of molecules is activated. It is important that the fluorescence intensity of this kind of molecules changes with the microenvironment viscosity, so that the viscosity change of the microenvironment is displayed in real time, in situ and in a sensitive and visual manner.

[0003] At present, besides the field of viscosity detection, the twisted conformation based on restrictions of the molecular rotors is also widely used for constructing a fluorescent activated probe, for example, after the combination of molecular rotors with BSA, the conformation of molecules is restricted by protein, and the fluorescence is lit up, but the excited energy of the dye that is not combined with protein is still dissipated in a non-radiative form, thereby detecting and quantifying the protein in real time. For another example, Thiazole Orange is in a state of fluorescence quenching before it is combined with DNA or RNA, and the molecular conformation is restricted after it is combined with DNA or RNA, as a result of which the fluorescence is activated, so Thiazole Orange is widely used for the detection and tracing of DNA and RNA; molecular rotors such as Malachite Green are coated with antibodies so as to limit the conformation changes of the molecules and are used for protein-activated fluorescence imaging; DHBI is combined with an adapter so as to construct fluorescent protein simulators for RNA tracing; for another example, the combination with amyloid protein can restrict the conformation changes of molecules, and can be used for the detection, research and so on of Alzheimer's disease.

[0004] However, current molecular rotors generally have the disadvantage of high fluorescence background, namely, the fluorescent intensity of molecular rotors in a free state is comparatively high, and thus can hardly be used for the sample detection and labeling with a small sample size, complicated components and low abundance of objects to be measured, such as endogenous proteins, nucleic acid, metabolites and so on in biological samples, so the development of a kind of molecular rotors with low background fluorescence can further expand the use of current molecular rotors.

Summary of the Invention

[0005] The object of the present invention is to provide a fluorescent dye with viscosity responsiveness and low background fluorescence.

[0006] For one aspect, the present invention provides a fluorescent dye, wherein the fluorescent dye is shown as Formula (I),

wherein:

D- is HO- or N(X₁)( X₂)-, X₁ and X₂ are respectively and independently selected from hydrogen, alkyl and modified alkyl; and X₁ and X₂ are optionally interconnected, and form a lipid heterocyclic ring with N atoms;

R is selected from cyano group, carboxy, amide group, ester group, sulfoxide group, sulphone group, sulfonic ester group or sulfonamido group; Ar₁ and Ar₂ are respectively and independently selected from arylene and sub-heteroaryle; wherein hydrogen atoms in Ar₁ and Ar₂ being optionally, respectively and independently substituted by halogen atoms, hydroxyl group, aldehyde group, carboxyl group, ester group, amide group, cyano group, sulfonic acid group, phosphoric acid group, amino group, primary amino group, secondary amino group, alkyl or modified alkyl;

X₁ and X₂ optionally and independently form a lipid heterocyclic ring with Ar₁;

wherein: the "alkyl" is respectively and independently C₁-C₁₀ straight or branched alkyl; optionally, the "alkyl group" is C₁-C₇ straight or branched alkyl; optionally, the "alkyl group" is C₁-C₅ straight or branched alkyl; optionally, the "alkyl group" is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tertiary butyl, sec-butyl, n-amyl, 1-methyl butyl, 2-methyl butyl, 3-methyl butyl, isoamyl, 1-ethyl propyl, neoamyl, n-hexyl, 1-methyl amyl, 2-methyl amyl, 3-methyl amyl, isohesyl, 1,1-dimethyl butyl, 2,2-dimethyl butyl, 3,3-dimethyl butyl, 1,2-dimethyl butyl, 1,3-dimethyl butyl, 2,3-dimethyl butyl, 2-ethyl butyl, n-heptyl, 2-methyl hexyl, 3-methyl hexyl, 2,2-dimethyl amyl, 3,3 dimethyl amyl, 2,3-dimethyl amyl, 2,4-dimethyl amyl, 3-ethyl amyl or 2,2,3-methyl butyl;

the "modified alkyl" is respectively and independently a group obtained by replacing any carbon atom in alkyl with one or more groups of halogen atom, -OH, -CO-, -O-, -CN, -S-, -SO₂-, -(S=O)-, azido, primary amino group, secondary amino group, tertiary amino group, and quaternary ammonium base, and the modified alkyl has 1-10 carbon atoms, wherein the carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond;

the replacement of carbon atoms refers to that carbon atoms or the carbon atoms and hydrogen atoms thereon together are replaced by a corresponding group;

the "halogen atom" is respectively and independently F, Cl, Br or I;

the "lipid heterocyclic ring" is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic lipid heterocyclic ring containing one or more heteroatoms of N, O, S or Si on the ring, and the lipid heterocyclic ring is -S-, -SO- or -SO₂- when there are S atoms on the ring; the lipid heterocyclic ring is optionally substituted by a halogen atom, an alkyl, an aryl or a modified alkyl;

the "arylene" is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic subaromatic group;

the "sub-heteroaryle" is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic sub-heteroaromatic group containing one or more heteroatoms of N, O, S or Si on the ring;

the "ester group" is R'(C=O)OR" group;

the "amide group" is R'CONR"R‴ group;

the "sulfonic acid group" is R'SO₃H group;

the "sulfonic ester group" is R'SO₂OR" group;

the "sulfonamido group" is R'SO₂NR"R‴ group;

the "phosphoric acid group" is R'OP(=O)(OH)₂ group;

the "sulphone group" is R'SO₂R" group;

the "sulfoxide group" is R'SOR" group;

the "primary amino group" is R'NH₂ group;

the "secondary amino group" is R'NHR" group;

the "tertiary amino group" is R'NR"R‴ group;

the "quaternary ammonium base" is R'R"R‴RʺʺN⁺ group;

each R', R", R‴, R"" respectively and independently being single bond, hydrogen, alkyl, alkylene, modified alkyl or modified alkylene;

the "alkylene" is C₁-C₁₀ straight or branched alkylene; optionally, it is C₁-C₇ straight or branched alkylene; optionally, it is C₁-C₅ straight or branched alkylene;

the "modified alkylene" is a group obtained by replacing any carbon atom in C₁-C₁₀ (preferably C₁-C₆) alkylene with a group selected from -O-, -OH, -CO-, -CS-, and -(S=O)-;

optionally, the "modified alkylene" is a group containing one or more groups selected from -OH, -O-, ethylene glycol unit (-(CH₂CH₂O)_n-), monosaccharide unit, -O-CO-, -NH-CO-, -SO₂-O-, -SO-, Me₂N-, Et₂N-, -S-S-, -CH=CH-, F, Cl, Br, I, cyano group; and

optionally, Ar₁ and Ar₂ respectively and independently are structures selected from the following Formulae (II-1) to (11-22):

[0007] Optionally, the compound represented by Formula (I) is selected from the compounds below:

[0008] A second aspect of the present invention is to provide a method of preparing the afore-mentioned fluorescent dye, including a step of aldol condensation reaction between a compound of Formula (a) and a compound of Formula (b).

[0009] A third aspect of the present invention is to provide uses of the afore-mentioned fluorescent dye in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

[0010] A fourth aspect of the present invention is to provide uses of the afore-mentioned fluorescent dye in preparing reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0011] A fifth aspect of the present invention is to provide a fluorescent activated and lighted probe, comprising the afore-mentioned fluorescent dye.

[0012] A sixth aspect of the present invention is to provide uses of the afore-mentioned fluorescent activated and lighted probe in protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

[0013] A seventh aspect of the present invention is to provide uses of the afore-mentioned fluorescent activated and lighted probe in preparing reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

[0014] The fluorescent dye of the present invention can be used for measuring viscosity of samples, such as for the tests of micro-viscosity. According to the embodiments of another aspect, the obtained fluorescent dye can be specifically combined with corresponding antibody, aptamer or amyloid, or bound to the protein tag or enzyme via a ligand or inhibitor, thereby obtaining a series of fluorescent activated and lighted probes used for fluorescent labeling, quantification or monitoring of protein, enzymes or nucleic acids.

Description of Drawings

[0015] 

Fig. 1 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-3 (1 × 10^-5M);

Fig. 2 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-3 (1 × 10^-5M);

Fig. 3 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-4 (1 × 10^-5 M);

Fig. 4 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-4 (1 × 10^-5 M);

Fig. 5 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor 111-28 (1 × 10^-5 M);

Fig. 6 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor 111-28 (1×10^-5 M);

Fig. 7 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor 111-34 (1 × 10^-5 M);

Fig. 8 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor 111-34 (1 × 10^-5 M);

Fig. 9 is a diagram showing the fluorescence background contrast of molecular rotors III-11 and 111-36 (1 × 10^-6 M) in PBS;

Fig. 10 is a diagram showing the fluorescence background contrast of molecular rotors 111-34 and 111-37 (1×10^-6 M) in PBS;

Fig. 11 is a diagram showing the fluorescence background contrast of molecular rotors 111-31, 111-32, 111-33 and 111-38 (1 × 10^-6 M) in PBS;

Fig. 12 is a diagram showing the fluorescence background contrast of molecular rotors III-3 and 111-39 (1 × 10^-6 M) in PBS;

Fig. 13 is a diagram showing the fluorescence background contrast of molecular rotors 111-21 and 111-40 (1 × 10^-6M) in PBS;

Fig. 14 is a diagram showing the fluorescence background contrast of molecular rotors III-28, III-29, III-30 and 111-41 (1 × 10^-6M) in PBS;

Fig. 15 is a diagram showing the fluorescence background contrast of molecular rotors III-3 and 111-42 (1 × 10^-6 M) in PBS;

Fig. 16 is a diagram showing the fluorescence background contrast of molecular rotors III-3 and 111-43 (1 × 10^-6 M) in PBS;

Fig. 17 is the application of molecular rotors III-3, III-4, III-6, III-7, III-8, III-18, III-21 in labeling intracellular RNA aptamers, wherein A are cells expressing the target RNA aptamers, and B are cells not expressing the target RNA aptamers;

Fig. 18 is the application of molecular rotors III-3, III-43 in labeling intracellular mRNA.

Specific implementation

[0016] 

[0017] To a stirring solution of p-dimethylaminobenzaldehyde (0.35 g, 2.3 mmol) and 4-cyano-benzeneacetonitrile (0.4 g, 2.8 mmol) in 20 mL methanol, 2 drops of piperidine were added. After stirring at ambient temperature for 2 h, the mixture was cool to room temperature. A large amount of precipitate was appeared. Then the precipitate was obtained by filtration and washed with cold EtOH three times. The orange solid was obtained after dried under vacuum (0.60 g, yield 95%). ¹H NMR (400 MHz, DMSO-d₆): δ= 3.05 (s, 6 H), 6.83 (d, J = 9.2 Hz, 2 H,), 7.84-7.94 (m, 6 H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C₁₈H₁₆O₃ [M+H]⁺: 274.1344. Found: 274.1345.

Example 2:

[0018] 

[0019] With reference to the synthetic method of compound III-1(0.34 , yield 89%).¹H NMR (400 MHz, DMSO-d₆): δ= 1.23 (t, J=7.60 Hz, 6H), 3.05 (t, J=7.60 Hz, 4H), 6.84 (d, J = 9.2 Hz, 2 H,), 7.84-7.95 (m, 6 H), 8.09 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C₂₀H₂₀O₃ [M+H]⁺: 302.1657. Found: 302.1658.

Example 3:

[0020] 

[0021] With reference to the synthetic method of compound III-1 (0.33 g, yield 95%). ¹H NMR (400 MHz, DMSO-d₆): δ= 7.96 (s, 1H), 7.85 (d, J = 16.0 Hz, 6H), 6.81 (d, J = 8.0 Hz, 2H), 4.77 (s, 1H), 3.55 (d, J = 28.0 Hz, 4H), 3.04 (s, 1H). HRMS (ESI-TOF): Calcd. For C₁₉H₁₈N₃O [M+H]⁺: 304.1450. Found: 304.1451.

Example 4:

[0022] 

[0023] To stirring solution of compound III-3 (0.61 g, 2.0 mmol) and TEA (0.25 g, 2.2 mmol) in 40 mL dried DCM, 4-tosyl chloride (0.38 g, 2.0 mmol)in 10 mL DCM was added slowly under 0 °C. The resulting mixture was stirred under Ar atomo and was permitted to warm to room temperature. After complete the reaction, the mixture was quenched by 2 mL of water. The reaction mixture was extracted three times and the organic phase was dried with anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was used in the next step without purified.

[0024] To a stirring solution of the residue in 20 mL CH₃CN, 1 ml MeNH2 was added under Ar atmosphere. The mixture was heated to refluxed overnight. Upon completing the reaction, the reaction mixture was cooled to room temperature and the organic liquid was removed under reduce pressure. Then the residue was dissolved in 50 mL DCM and the organic phase was washed with water and brine (2 × 100 ml). Upon drying over anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford orangered solid. (0.54g, 82%). ¹H NMR (400 MHz, CDCl₃): δ= 7.88 (d, J = 9.0 Hz, 2H), 7.74 - 7.65 (m, 4H), 7.48 (s, 1H), 6.73 (d, J = 9.1 Hz, 2H), 3.60 - 3.55 (m, 2H), 3.08 (s, 3H), 2.57 - 2.52 (m, 2H), 2.34 (s, 6H). HRMS (ESI-TOF): Calcd. For C₂₁H₂₃N₄ [M+H]⁺: 331.1923. Found: 331.1925.

Example 5:

[0025] 

[0026] To a stirring solution of 3,5-difluoro-4-hydroxybenzaldehyde (0.32 g, 2.0 mmol) and 4-cyano-benzeneacetonitrile (0.35 g, 2.4 mmol) in 40 mL anhydrous EtOH, 2 drops of piperidine were added. After stirring at ambient temperature for 2 h, the mixture was cool to room temperature. A large amount of precipitate was appeared. Then the precipitate was obtained by filtration and washed with cold EtOH three times. The orange solid was obtained after dried under vacuum. ¹H NMR (400 MHz, CDCl₃): δ= 7.80 (d, J = 9.0 Hz, 2H), 7.74 - 7.66 (m, 4H), 7.48 (s, 1H). HRMS (ESI-TOF): Calcd. For C₁₆H₉F₂N₂O [M+H]⁺: 283.0683. Found: 283.0684.

Example 6:

[0027] 

[0028] To a stirring solution of N-methyl-N-(2-hydroxyethyl)amino (2.6 g, 35 mmol) and 5- chloro-pyrazine-2-carbaldehyde (0.50 g, 3.5 mmol) in 20 mL dry CH₃CN, K₂CO₃(0.71 g, 5.3 mmol) was added in one portion. The mixture was heated to reflux under Ar atmosphere. The mixture was heated to refluxed for 24 h. Upon completing the reaction, the reaction mixture was cooled to room temperature and the organic liquid was removed under reduce pressure. Then the residue was dissolved in 100 mL DCM and the organic phase was washed with water and brine (2 × 100 ml). Upon drying over anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound. (0.48 g, 76%)_∘ ¹H NMR(400 MHz, CDCl₃): δ 9.88 (s, 1H), 8.62 (d, J = 1.2 Hz, 1H), 8.14 (d, J = 1.1 Hz, 1H), 3.92 (m, 2H), 3.88 - 3.83 (m, 2H), 3.28 (s, 3H). HRMS (ESI-TOF): Calcd. For C₈H₁₂N₃O₂ [M+H]⁺: 182.1. Found: 182.1.

[0029] With reference to the synthetic method of compound III-1 (0.36 g, 96%)_∘ ¹H NMR (400 MHz, CDCl₃): δ 8.39 (s, 1H), 8.30 (s, 1H), 7.80 (d, J = 8.5 Hz, 2H), 7.72 (d, J = 8.4 Hz, 2H), 7.51 (s, 1H), 3.93 (t, J = 4.9 Hz, 2H), 3.88 - 3.83 (m, 2H), 3.29 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₇H1₆N₅O [M+H]⁺: 306.1355. Found: 306.1357.

Example 7:

[0030] 

[0031] With reference to the synthetic method of compound III-4, (0.21 g, 67%) _∘ ¹H NMR (400 MHz, DMSO-d₆): δ 8.37 (d, J = 5.2 Hz, 2H), 8.06 (s, 1H), 8.00 - 7.85 (m, 4H), 3.77 (t, J = 6.5 Hz, 2H), 3.20 (s, 3H), 2.56 (m, 2H), 2.23 (s, 6H). HRMS (ESI-TOF): Calcd. For C₁₉H₂₁N₆ [M+H]⁺: 333.1828. Found: 333.1829.

Example 8:

[0032] 

[0033] With reference to the synthetic method of Compound 5-(N-methyl-N-(2-hydroxyethyl)amino) pyrazine-2-carbaldehyde: (0.45 g, 68%) _∘ ¹H NMR (400 MHz, CDCl₃): δ =9.69 (s, 1H), 8.43 (d, J = 2.1 Hz, 1H), 7.86 (dd, J = 9.0, 2.3 Hz, 1H), 6.56 (d, J = 9.1 Hz, 1H), 3.86 - 3.79 (m, 4H), 3.15 (s, 3H). HRMS (ESI-TOF): Calcd. For C₉H₁₃O₂N₂ [M+H]⁺: 181.1. Found: 181.1.

[0034] With reference to the synthetic method of compound III-1, (0.39 g, 89%) _∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.54 (d, J = 4.0 Hz, 1H), 8.30 (dd, J = 9.3, 2.5 Hz, 1H), 8.03 (s, 1H), 7.92 (d, J = 8.0 Hz, 2H), 7.85 (d, J = 8.0 Hz, 2H), 6.84 (d, J = 8.0 Hz, 1H), 4.77 (t, J = 5.4 Hz, 1H), 3.67 (t, J = 5.3 Hz, 2H), 3.60 (q, J = 5.4 Hz, 2H), 3.15 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₈H₂₇N₄O [M+H]⁺: 305.1402. Found: 305.1401.

Example 9:

[0035] 

[0036] With reference to the synthetic method of compound III-4, (0.31 g,92%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.55 (d, J = 4.0 Hz, 1H), 8.31 (dd, J = 9.3, 2.5 Hz, 1H), 8.05 (s, 1H), 7.93 (d, J = 8.0 Hz, 2H), 7.84 (d, J = 8.0 Hz, 2H), 6.85 (d, J = 8.0 Hz, 1H), 4.78 (t, J = 5.4 Hz, 1H), 3.67 (t, J = 5.3 Hz, 2H), 3.60 (q, J = 5.4 Hz, 2H) , 3.17 (t, J = 8.0 Hz, 4H) , 1.17 (t, J = 8.0 Hz, 6H). HRMS (ESI-TOF): Calcd. For C₂₂H₂₆N₅ [M+H]⁺: 360.2188. Found: 360.2187.

Example 10:

4-(N,N-dimethylamino)- pyrazine-6-carbaldehyde

[0037] 

[0038] With reference to the synthetic method of compound III-4, (0.31 g, 49%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 9.86 (d, J = 0.6 Hz, 1H), 8.17 (d, J = 2.9 Hz, 1H), 7.83 (d, J = 8.9 Hz, 1H), 6.94 (dd, J = 8.8, 2.9 Hz, 1H), 3.10 (s, 6H). HRMS (ESI-TOF): Calcd. For C₈H₁₁N₂O [M+H]⁺: 151.1. Found: 151.1.

[0039] With reference to the synthetic method of compound III-1, (0.36 g, 96%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 9.86 (d, J = 0.6 Hz, 1H), 8.26 (s, 1H), 8.17 (d, J = 2.9 Hz, 1H), 7.83 (d, J = 8.9 Hz, 1H), 7.46 (m, 4H), 6.94 (dd, J = 8.8, 2.9 Hz, 1H), 3.10 (s, 6H). HRMS (ESI-TOF): Calcd. For C₁₇H₁₅N₄ [M+H]⁺: 275.1297. Found: 275.1298.

Example 11:

[0040] 

[0041] With reference to the synthetic method of compound III-4, (0.42 g, 72%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 9.89 (s, 1H), 8.73 (s, 2H), 3.64 (t, J = 8.9 Hz, 2H), 3.45 (t, J = 8.8 Hz, 2H), 3.10 (s, 3H). HRMS (ESI-TOF): Calcd. For C₈H₁₂N₃O [M+H]⁺: 182.1. Found: 182.1.

[0042] With reference to the synthetic method of compound III-1, (0.36 g, 96%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 8.26 (s, 1H), 8.73 (s, 2H), 7.64 (m, 4H), 3.64 (t, J = 8.9 Hz, 2H), 3.44 (t, J = 8.8 Hz, 2H), 3.11 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₇H₁₆N₅O [M+H]⁺: 306.1355. Found: 306.1356.

Example 12:

[0043] 

[0044] With reference to the synthetic method of compound III-4, (0.42 g, 72%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 9.98 (s, 1H), 8.21 (s, 2H), 3.64 (t, J = 8.9 Hz, 2H), 3.44 (t, J = 8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C₈H₁₂N₃O₂ [M+H]⁺: 182.1. Found: 182.1.

4-(1-cyano-2-(5-((2-hydroxyethyl)(methyl)amino)pyrimidin-2-yl)vinyl)benzonitr ile1:

[0045] 

[0046] With reference to the synthetic method of compound III-1, (0.56 g, 89%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4 H), 3.64 (t, J = 8.9 Hz, 2H), 3.44 (t, J = 8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₇H₁₆N₅O [M+H]⁺: 306.1. Found: 306.1.

[0047] With reference to the synthetic method of compound III-4, (0.36 g, 96%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4 H), 3.77 (t, J = 6.5 Hz, 2H), 3.20 (s, 3H), 2.56 (m, 2H), 2.23 (s, 6H). HRMS (ESI-TOF): Calcd. For C₁₉H₂₁ N₆ [M+H]⁺: 333.1828. Found: 333.1829.

Example 13:

5-cyano-2-acetonitrile-pyridine:

[0048] 

[0049] To a stirring solution of 2-(bromomethyl)-benzonitrile (0.50 g, 2.5 mmol) in 50 mL THF, 10 ml NaCN aqueous solution (2 M) was added. The mixture was reflexed for 12 h under Ar atmosphere. Upon cooling to room temperature, the reaction mixture was extracted with DCM (3 × 100 ml). The organic phase was washed with water and brine (2 × 100 ml). Upon drying over anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound. (0.19 g, 56%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ=8.78 (s, 1H), 7.95 (m, 1H), 7.56 (m, 1H), 4.01 (s, 2H). HRMS (ESI-TOF): Calcd. For C₈H₆N₃ [M+H]⁺: 144.1. Found: 144.1.

Compound III-13:

[0050] 

[0051] With reference to the synthetic method of compound III-1, (0.45 g, 95%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ=8.78 (s, 1H), 8.21 (s, 1H), 7.94 (m, 1H), 7.86 (d, J=8.0 Hz, 2H), 7.57 (m, 1H), 6.80 (d, J=8.0 Hz, 2H), 3.64 (t, J = 8.9 Hz, 2H), 3.44 (t, J = 8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C1₈H₁₇N₄O [M+H]⁺: 305.1402. Found: 305.1403.

Example 14:

5-cyano-2-acetonitrile-pyrazine:

[0052] 

[0053] To a stirring solution of 2-(5-chloropyrazin-2-yl)acetonitrile (0.32 g, 2.0 mmol) in dry 30 mL DMSO, CuCN (0.93 g, 10.0 mmol) was added in one portation. The mixture was heated for 12 h under Ar atmosphere. Upon cooling to room temperature, the reaction mixture was poured into 100 mL water, then extracted with DCM (4 × 50 ml). The organic phase was washed with water and brine (2 × 100 ml). Upon drying over anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound (0.20 g, 69%). ¹H NMR (400 MHz, DMSO-d₆): δ=8.60 (s, 1H), 8.48 (s, 1H), 3.92 (s, 2H). HRMS (ESI-TOF): Calcd. For C₇H₅N₄ [M+H]⁺: 145.1. Found: 145.1.

[0054] With reference to the synthetic method of compound III-1, (0.25 g, 91%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ=8.60 (s, 1H), 8.48 (s, 1H), 8.11 (s, 1 H), 7.81 (d, J=8.2 Hz, 2H), 6.84 (d, J=8.2 Hz, 2H), 3.60 (t, J=9.2 Hz, 2H), 3.46 (t, J=9.2 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₇H₁₆N₅O [M+H]⁺: 306.1355. Found: 306.1354. Example 15:

[0055] With reference to the synthetic method of compound III-1, , (0.25 g, 91%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.22 (s, 1H), 8.00 (d, J = 9.1 Hz, 1H), 7.77 - 7.69 (m, 1H), 7.43 - 7.34 (m, 1H), 6.88 (d, J = 9.1 Hz, 1H), 4.81 (t, J = 5.2 Hz, 1H), 3.31 - 3.25 (m, 4H), 2.66-2.63 (m, 4H), 1.89-1.81 (m, 4H). HRMS (ESI-TOF): Calcd. For C₂₂H₂₀N₃ [M+H]⁺: 326.1657. Found: 326.1658.

Example 16:

[0056] 

[0057] With reference to the synthetic method of compound III-1, (0.29 g, 94%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.11 (2H, d, J =10.4Hz), 7.99 (3H, dd, J =8.6, 3.0Hz), 7.54 (1H, dd, J =8.0, 8.0Hz), 7.44 (1H, dd, J =8.0, 8.0Hz),6.88 (2H, d, J =9.2Hz), 4.82 (1H, bt, t, J =5.2Hz), 3.01-3.08 (m, 2H), 3,53-3.60 (m, 2H), 2.89 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₉H₁₆N₃ [M+H]⁺: 286.1344. Found: 286.1345.

Compound 17:

6-(methylamino)benzo[b]thiophene-2- carbaldehyde:

[0058] 

[0059] 6-(methylamino)benzo[b]thiophene-2- carbaldehyde (0.42 g, 1.7 mmol), 40% aqueous N,N-Dimethylethylamin solution (1g, 8.9 mmol), CuI (13.9 mg, 0.073 mmol), K₃PO₄ • H₂O (155.4 mg, 0.73 mmol), 1 mL 33% aqueous methylamine solution and stirring bar was sealed in a screwed tube and stirred at 60 °C for 12 h. upon cooling to room temperature, the mixture was poured into 50 mL water. The organic layer was separated and the aqueous layer was extracted with DCM (3 × 100 ml). Combined the organic phase and dried over anhydrous Na₂SO₄ and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound(0.23 g, 68%).¹H NMR (400 MHz, DMSO-d₆): δ =9.92 (1H, s), 8.14 (1H, s), 7.82 (1H, d, J =9.1Hz), 7.18 (1H, d, J =2.1Hz), 7.01 (1H, dd, J =9.1, 2.3Hz), 3.05 (3H, s). HRMS (ESI-TOF): Calcd. For C₁₀H₁₀NOS [M+H]⁺: 192.0. Found: 192.0.

[0060] With reference to the synthetic method of compound III-1, (0.29 g, 94%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.45 (s, 1H), 7.92 (d, J = 8.6 Hz, 2H), 7.85 (d, J = 8.3 Hz, 3H), 7.73 (dd, J = 8.6, 3.9 Hz, 1H), 7.21 (d, J = 1.9 Hz, 1H), 7.21 (d, J = 1.9 Hz, 1H), 6.96 (dd, J = 9.1, 2.3 Hz, 1H), 3.05 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₉H₁₄N₃S [M+H]⁺: 360.1171. Found: 360.1173.

Example 18:

6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2- carbaldehyde:

[0061] 

[0062] With reference to the synthetic method of compound 6-(methylamino)benzo[b]thiophene-2- carbaldehyde, (0.54 g, 79%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ= 9.91 (s, 1 H), 8.14(s, 1 H), 7.81 (d, J=5.2 Hz, 1 H), 7.17 (d, J=2.0 Hz, 1 H), 7.01 (dd, J=2.0, 8.8 Hz, 1 H), 4.76 (t, J=5.6 Hz, 1 H), 3.58 (t, J=4.2 Hz, 2 H), 3.52 (t, J=4.2 Hz, 2 H), 3.04 (s, 3 H). HRMS (ESI-TOF):m/z Calcd. For C₁₂H₁₄NO₂S, [M+H]⁺: 235.1. Found 236.1.

[0063] With reference to the synthetic method of compound III-1, (0.21 g, 95%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ= 8.45 (s, 1H), 7.92 (d, J = 8.6 Hz, 2H), 7.85 (d, J = 8.3 Hz, 3H), 7.73 (dd, J = 8.6, 3.9 Hz, 1H), 7.21 (d, J = 1.9 Hz, 1H), 7.21 (d, J = 1.9 Hz, 1H), 6.96 (dd, J = 9.1, 2.3 Hz, 1H), 3.63 - 3.57 (m, 2H), 3.52 (t, J = 5.7 Hz, 2H), 3.05 (s, 3H). HRMS (ESI-TOF): Calcd. For C₂₁H₁₉N₃OS [M+H]⁺: 360.1171. Found: 360.1173.

Example 19:

5-(N,N-dimethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde :

[0064] 

[0065] With reference to the synthetic method of compound 6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2- carbaldehyde, (0.54 g, 79%)_∘ ¹H NMR(400 MHz, DMSO-d₆): δ= 9.66 (s, 1 H), 8.05 (s, 1 H), 6.30 (s, 1 H), 4.88 (bt, 1 H), 3.07 (s, 6 H). HRMS (ESI-TOF): m/z Calcd. For C₉H₁₂NOS₂ [M+H]⁺: 214.0; found 214.0.

[0066] With reference to the synthetic method of compound III-1, (0.31 g, 90%) _∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.34 (s, 1H), 7.86 (d, J = 8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J = 8.0Hz, 2H), 6.32 (s, 1H), 4.88 (t, J = 4.0 Hz, 1H), 3.08 (s, 6H). HRMS (ESI-TOF): Calcd. For C₁₈H₁₄N₃S₂ [M+H]⁺: 336.0629. Found: 336.0630.

Example 20:

5-(N,N-diethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde:

[0067] 

[0068] With reference to the synthetic method of compound 5-(N,N-dimethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde, (0.44 g, 75%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ= 9.78 (s, 1 H), 8.09 (s, 1 H), 6.30 (s, 1 H), 4.87 (bt, 1 H), 3.27 (t, J=8.4 Hz, 4 H), 1.26 (t, J=8.4 Hz, 4 H). HRMS (ESI-TOF): m/z Calcd. For C₉H₁₂NOS₂ [M+H]⁺: 214.0; found 214.0.

[0069] With reference to the synthetic method of compound III-1, (0.31 g, 90%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.34 (s, 1H), 7.86 (d, J = 8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J = 8.0Hz, 2H), 6.32 (s, 1H), 4.88 (t, J = 4.0 Hz, 1H), 3.27 (t, J=8.4 Hz, 4 H), 1.26 (t, J=8.4 Hz, 4 H). HRMS (ESI-TOF): Calcd. For C₂₀H₁₈N₃S₂ [M+H]⁺: 364.0942. Found: 364.0943.

Example 21:

5-((2-hydroxyethyl)(methyl)amino)-thieno[3,2-b]thiophene-2-carbaldehyde:

[0070] 

[0071] With reference to the synthetic method of compound 6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2- carbaldehyde, (0.44 g, 75%)_∘ ¹H NMR(400 MHz, DMSO-d₆): δ= 9.66 (s, 1 H), 8.05 (s, 1 H), 6.30 (s, 1 H), 4.88 (bt, 1 H), 3.64 (t, J =5.6 Hz, 2 H), 3.44 (t, J =5.6 Hz, 2 H), 3.07 (s, 3 H). HRMS (ESI-TOF): m/z Calcd. For C₁₀H₁₂NO₂S₂ [M+H]⁺: 241.0; found 242.0.

[0072] With reference to the synthetic method of compound III-1, (0.31 g, 90%) _∘ ¹H NMR (400 MHz, DMSO-d₆): δ 8.34 (s, 1H), 7.86 (d, J = 8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J = 8.0Hz, 2H), 6.32 (s, 1H), 4.88 (t, J = 4.0 Hz, 1H), 3.65 (q, J = 5.5 Hz, 2H), 3.44 (t, J = 5.5 Hz, 2H), 3.34 (s, 1H), 3.08 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₉H₁₆N₃OS₂ [M+H]⁺: 366.0735. Found: 366.0736.

Example 22:

[0073] 

[0074] With reference to the synthetic method of compound III-1, (0.31 g, 90%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ= 3.04 (s, 6 H), 6.82 (d, J = 9.2 Hz, 2 H,), 7.59(d, J=9.1 Hz, 2H), 7.84-7.94 (m, 6 H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C₂₄H₁₉O₃ [M+H]⁺: 350.1657. Found: 350.1656.

Example 23:

[0075] 

[0076] With reference to the synthetic method of compound III-1: ¹H NMR (400 MHz, DMSO-d₆): δ= 3.02 (s, 6 H), 6.72 (d, J = 8.0 Hz, 2 H,), 7.24(d, J=4.0 Hz, 1H), 7.49(d, J=8.8 Hz, 2 H), 7.55(d, J=8.0 Hz, 1 H), 7.69(d, J=8.8 Hz, 2 H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C₂₂H₁₈N₃S [M+H]⁺: 356.1221. Found: 356.1220.

Example 24:

[0077] 

[0078] With reference to the synthetic method of compound III-1, and compound 1 (With reference to the synthetic method of Chem. Commun. 2011, 47, 985-987.): ¹H NMR (400 MHz, DMSO-d₆): δ= 3.63 (m, 16 H), 3.77(m, 4H), 6.76(d, J = 8.8 Hz, 2 H,), 7.38(d, J=4.0 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.59(d, J=8.8 Hz, 2H), 7.72(m, 4H), 8.28(s, 1H). HRMS (ESI-TOF): Calcd. For C₃₀H₃₂O₃N₄S [M+H]⁺: 530.2114. Found: 530.2115.

Example 25:

[0079] 

[0080] With reference to the synthetic method of compound III-1, and compound 2 (With reference to the synthetic method of J. Org. Chem. 2008, 73, 6587-6594.): ¹H NMR (400 MHz, DMSO-d₆): δ= 1.23(t, J=7.2 Hz, 6H), 3.35(m, J=7.2 Hz, 4 H), 5.78(d, J=4.0 Hz, 1H), 6.92(d, J=4.0 Hz, 1H), 7.12(d, J=4.0 Hz, 1 H), 7.49(d, J=8.8 Hz, 2 H),7.56(d, J=4.0 Hz, 1H), 7.69(d, J=8.8 Hz, 2H), 8.28(s, 1H). HRMS (ESI-TOF): Calcd. For C₃₀H₃₂O₃N₄S [M+H]⁺: 390.1099. Found: 390.1097.

Example 26:

[0081] 

[0082] With reference to the synthetic method of compound III-1, ¹H NMR (400 MHz, DMSO-d₆): δ= 3.30(s, 6 H), 5.71(d, J=4.0 Hz, 1H), 6.93(d, J=4.0 Hz, 1H), 7.15(d, J=4.0 Hz, 1 H), 7.47(d, J=8.8 Hz, 2 H), 7.56(d, J=4.0 Hz, 1H), 7.64(d, J=8.8 Hz, 2H), 8.28(s, 1H). HRMS (ESI-TOF): Calcd. For C₂₀H₁₇O₂N₂S₂ [M+H]⁺: 381.0731. Found: 381.0730.

Example 27:

[0083] 

[0084] With reference to the synthetic method of compound III-1, and compound 4 (With reference to the synthetic method of Heterocycles, 1997, 46, 489-501.) ¹H NMR (400 MHz, CDCl₃): δ 2.07 (m, 4H), 3.33 (t, J=6.6 Hz, 4H),4.2(s, 3 H), 5.70 (d, J=4.4 Hz, 1H), 6.92 (d, J=4.0 Hz, 1H), 7.15 (d, J=4.0 Hz, 1H),7.43(d, J=8.2 Hz, 2 H), 7.51(d, J=8.2 Hz, 2 H), 7.57 (d, J=4.0 Hz, 1H),8.10(s, 1H). HRMS (ESI-TOF): Calcd. For C₂₃H₂₁O₂N₂S₂ [M+H]⁺: 421.1044. Found: 521.1042.

Example 28:

[0085] 

[0086] With reference to the synthetic method of compound III-1, and compound 5 (With reference to the synthetic method of WO2018014821). ¹H-NMR(400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44(t, 2H, J=4.80 Hz), 3.02(s, 3H)_∘ HRMS (ESI-TOF): Calcd. For C₂₁H₁₆ON₃S₃. [M+H]⁺: 422.0455. Found: 422.0456.

Example 29:

[0087] 

[0088] With reference to the synthetic method of compound III-1, and compound 6 (With reference to the synthetic method of WO2018014821)_∘ ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H) 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H), 3.56 (q, J=4.0 Hz, 2H),3.01 (s, 6H), 1.21 (t, J=4.0 Hz, 3H). HRMS (ESI-TOF): Calcd. For C₂₂H₁₉O₂N₂S₃. [M+H]⁺: 439.0609. Found: 439.0610.

Example 30:

[0089] 

[0090] With reference to the synthetic method of compound III-1, and compound 7(With reference to the synthetic method of WO 2014048547)_∘ ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H), 3.10 (s, 3H), 3.01 (s, 6H). HRMS (ESI-TOF): Calcd. For C₂₁H₁₇O₁N₂S₄. [M+H]⁺: 429.0024. Found: 429.0026.

Example 31:

[0091] 

[0092] With reference to the synthetic method of compound III-1, and compound 9 (With reference to the synthetic method of J. Chem. Pharm. Res., 2012, 4, 1661-1669.)_∘ ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H), 3.14 (s, 3H), 3.01 (s, 6H). HRMS (ESI-TOF): Calcd. For C₂₂H₂₃O₂N₂S₃Si. [M+H]⁺: 471.0691. Found: 471.0690.

Example 32:

[0093] 

[0094] With reference to the synthetic method of compound III-1.¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H) , 3.77 (t, 2H, J=4.80 Hz), 3.41(t, 2H, J=4.80 Hz), 3.00 (s, 3H). HRMS (ESI-TOF): Calcd. For C₂₂H₂₄O₃N₃S₃Si. [M+H]⁺: 502.0749. Found: 502.0752.

Example 33:

[0095] 

[0096] With reference to the synthetic method of compound III-1. ¹H-NMR (400 MHz, CDCl₃): δ=7.89 (s, 1 H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.18 (s, 1 H), 6.96 (d, 2 H, J=5.6 Hz), 3.85(t, 2H, J=4.80 Hz), 3.46(t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6 H). Calcd. For C₂₃H₂₂ON₃S₂Si. [M+H]⁺: 448.0974. Found: 448.0972. Example 34:

[0097] With reference to the synthetic method of compound III-1. ¹H-NMR (400 MHz, CDCl₃): δ=7.83 (s, 1 H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.11 (s, 1 H), 3.85(t, 2H, J=4.80 Hz), 3.46(t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.46 (s, 6 H). HRMS (ESI-TOF): Calcd. For C₂₄H₂₄O₂N₃S₂ [M+H]⁺:450.1310. Found: 450.1311.

Example 35:

[0098] 

[0099] With reference to the synthetic method of (K. T. Arun et. al. J. Phys. Chem. A. 2005, 109, 5571-5578.) ¹H-NMR (400 MHz, CDCl3): δ=10.01 (s, 1 H), 7.89 (s, 1 H), 7.18 (s, 1 H), 6.96 (d, 2 H, J=5.6 Hz), 3.52-3.65 (m, 20H), 3.37 (s, 3 H), 2.97 (s, 3 H). HRMS (ESI-TOF): Calcd. For C₂₄H₂₂ON₃S₂Si. [M+H]⁺:432.1204. Found: 432.1203. Calcd. For C₂₄H₃₆O₆N₁S₂. [M+H]⁺: 497.3. Found: 497.3.

Compound III-35:

[0100] With reference to the synthetic method of compound III-1_∘ ¹H-NMR (400 MHz, CDCl₃): δ=7.89 (s, 1 H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.18 (s, 1 H), 6.96 (d, 2 H, J=5.6 Hz), 3.52-3.65 (m, 20H), 3.37 (s, 3 H), 2.97 (s, 3 H). HRMS (ESI-TOF): Calcd. For C₃₃H₃₉O₅N₃S₂. [M+H]⁺: 622.2409. Found: 622.2409.

Control Example 1:

[0101] 

[0102] With reference to the synthetic method of compound III-1, (0.25 g, 91%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ = 8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4 H), 3.64 (t, J = 8.9 Hz, 2H), 3.44 (t, J = 8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₆H₁₇N₄O₄S [M+H]⁺: 361.0971. Found: 361.0970

Control Example 2:

[0103] 

[0104] With reference to the synthetic method of compound III-1, (0.39 g, 91%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =7.83 (s, 1 H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.11 (s, 1 H), 3.85(t, 2H, J=4.80 Hz), 3.46(t, 2H, J=4.80 Hz), 3.05(s, 3H), 1.46(s, 6 H). HRMS (ESI-TOF): Calcd. For C₂₃H₂₃N₂O₄S₃ [M+H]⁺: 487.0820. Found: 487.0821.

Control Example 3:

[0105] 

[0106] With reference to the synthetic method of compound III-1, and compound 11 (With reference to the synthetic method of CN 106349105.)0 ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 7.24 (s, 1H) , 3.78 (t, 2H, J=4.80 Hz), 3.44(t, 2H, J=4.80 Hz), 3.01 (s, 3H). HRMS (ESI-TOF): Calcd. For C₂₂H₂₃O₄N₂S₃Si. [M+H]⁺: 503.0589. Found: 203.0588.

Control Example 4:

[0107] 

[0108] With reference to the synthetic method of compound III-1. ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.84 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.49(d, J=8.8 Hz, 2 H), 3.78 (t, 2H, J=4.80 Hz), 3.44(t, 2H, J=4.80 Hz), 3.01 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₈H₁₉O₄N₂S. [M+H]⁺: 359.1066. Found: 359.1065.

Control Example 5:

[0109] 

[0110] With reference to the synthetic method of compound III-1. ¹H-NMR (400 MHz, DMSO-d₆): δ= 8.34 (s, 1H), 7.59 (d, J = 8.0 Hz, 2H), 7.81 (s, 1H), 7.49(d, J = 8.0Hz, 2H), 6.32 (s, 1H), 4.88 (t, J = 4.0 Hz, 1H), 3.65 (q, J = 5.5 Hz, 2H), 3.44 (t, J = 5.5 Hz, 2H), 3.34 (s, 1H), 3.08 (s, 3H). HRMS (ESI-TOF): Calcd. For C₁₈H₁₇O₄N₂S₃. [M+H]⁺: 421.0350. Found: 421.0351.

Control Example 6:

[0111] 

[0112] With reference to the synthetic method of compound III-1. ¹H-NMR (400 MHz, DMSO-d₆): δ= 7.85 (s, 1H), 7.59(d, J=8.8 Hz, 2H), 7.47(d, J=8.8 Hz, 2 H), 7.24 (s, 1H), 3.79 (t, 2H, J=4.80 Hz), 3.43(t, 2H, J=4.80 Hz), 3.01(s, 3H)_∘ HRMS (ESI-TOF): Calcd. For C₂₀H₁₇O₄N₂S₄. [M+H]⁺: 477.0071. Found: 477.0070.

Control Example 7:

[0113] 

[0114] With reference to the synthetic method of compound III-1, (0.25 g, 91%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.22 (s, 1H), 8.00 (d, J = 9.1 Hz, 1H), 7.77 - 7.69 (m, 1H), 7.43 - 734 (m, 1H), 6.88 (d, J = 9.1 Hz, 1H), 4.81 (t, J = 5.2 Hz, 1H), 3.64 - 3.52 (m, 3H), 3.09 (s, 1H). LR-HRMS (ESI-TOF): Calcd. For C₁₉H₁₈N₃O₂ [M+H]⁺: 320.1399. Found: 320.1397.

Control Example 8:

[0115] 

[0116] With reference to the synthetic method of compound III-1, (0.29 g, 94%)_∘ ¹H NMR (400 MHz, DMSO-d₆): δ =8.11 (2H, d, J =10.4Hz), 7.99 (3H, dd, J =8.6, 3.0Hz), 7.54 (1H, dd, J =8.0, 8.0Hz), 7.44 (1H, dd, J =8.0, 8.0Hz),6.88 (2H, d, J =9.2Hz), 4.82 (1H, bt, t, J =5.2Hz), 3.60 (2H, t, J =5.2Hz), 3.56 (2H, t, J =5.2Hz), 3.09 (3H, s). LR-HRMS (ESI-TOF): Calcd. For C₁₉H₁₈N₃OS [M+H]⁺: 336.1171. Found: 336.1170.

Test Example 1.

[0117] The fluorescent dyes (molecular rotors) prepared in Examples 1-35 were dissolved in DMSO with a concentration of 1× 10^-2 M each, and each master batch was added to glycerol and methanol respectively, mixed well, and a solution with a final concentration of 1 × 10-5 M each was prepared. According to the different fluorescent dyes, the fluorescence emission pattern of each fluorescent dye was detected under the same conditions using the maximum excitation wavelength of each fluorescent dye in turn, and the results are shown in Table 1, indicating that the fluorescent dyes of the present invention are sensitive to changes in viscosity.

Table 1

Compound	Emission (nm)	Glycerol / methanol fluorescence intensity ratio
III-1	530	990
III-2	530	870
III-3	530	1025
III-4	521	892
III-5	525	1028
III-6	490	1148
III-7	485	977
III-8	495	1168
III-9	490	920
III-10	520	1620
III-11	470	869
III-12	542	855
III-13	545	752
III-14	550	785
III-15	561	1011
III-16	555	491
III-17	587	828
III-18	595	978
III-19	620	991
III-20	620	836
III-21	620	544
III-22	650	989
III-23	661	687
III-24	662	596
III-25	678	783
III-26	676	368
III-27	678	486
III-28	662	559
III-29	665	684
III-30	660	756
III-31	687	624
III-32	690	817
III-33	705	691
III-34	689	489
III-35	690	710

Test Example 2:

[0118] Add molecular rotors III-3, III-4, 111-28 and 111-34 to a diethanol-glycerol mixed solution to prepare a solution with a final concentration of 1 × 10^-5 M, conduct excitation at 480 nm, and the fluorescence emission spectra at different viscosity conditions are shown as Figs. 1, 3, 5 and 7, wherein molecular rotors of the same concentration have gradually increasing fluorescence intensity at different viscosity conditions, which indicates that the fluorescence intensity of molecular rotors increases following the increasing fluorescence of environmental viscosity, and that the relationship between the fluorescence intensity log and the solvent intensity log satisfies the Huffman equation and has a fine linear relation as shown in Figs. 2, 4, 6, 8, proving that that molecular rotors are sensitive to viscosity and can be used for viscosity tests of unknown samples.

Test Example 3:

[0119] Add molecular rotors III-11 and III-36; 111-34 and III-37; III-31, III-32, 111-33 and III-38; III-3 and III-39; 111-21 and III-40; III-28, III-29, 111-30 and III-41; III-3 and III-42; III-3 and 111-43 to a PBS solution to prepare a solution with a final concentration of 1 × 10^-6 M, conduct excitation respectively at the maximum excitation of each compound so as to detect their fluorescence intensities in PBS, and normalize each sample with the strongest fluorescence in each group as 100, as shown respectively in Fig. 9, Fig. 10, Fig. 11, Fig. 12, Fig. 13, Fig. 14, Fig. 15 and Fig. 16. According to the results, compared with the molecular rotors with sulfonic acid group substitution and the rotors without substitution on the aromatic ring of the electron withdrawing group, the molecular rotors with cyano group, ester group, sulfoxide, sulphone, sulfonamido substitutions on the aromatic ring of the electron withdrawing group in the present application have lower background fluorescence.

Test Example 4:

[0120] Compounds III-3, III-4, III-6, III-7, III-8, III-18, 111-21 and RNA aptamer (Sequence 10: F30-8Pepper-5 RNA aptamer sequence

are specifically bound, and the compound fluorescence after binding is noticeably activated and emits bright fluorescence when being excited by excitation light with an appropriate wavelength, see Table 2 for the optical properties after binding; the compounds can also bind to this aptamer in cells, and cells transcribing the RNA aptamer have bright fluorescence, as shown in Fig. 17A, and cells not expressing the RNA aptamer has no fluorescence, as shown in Fig. 17B, indicating that dyes of this series can be used for nucleic acid labeling.

Table 2

Name	Ex/nm	Em/nm	ε (M-1 cm-1)	QY (-)	Activation Multiple	Kd (nM)
III-7	443	485	49100	0.42	691	8.0
III-6	435	497	54700	0.57	16601	6.7
III-8	458	508	42500	0.30	9091	27.0
III-4	458	514	44100	0.45	4748	12.0
III-3	485	530	65300	0.66	3595	3.5
III-18	515	599	54400	0.43	708	18.0
III-21	577	620	10000	0.58	12600	6.1

[0121] Note: the fluorescence quantum yield was measured by the relative method with Rhodamine 6G as the standard (QY =0.94).

Test Example 5:

[0122] A stable cell line (293T/17 cell line) was constructed by fusing the skeleton protein mRNA with the aptamer (ACTB-4Pepper RNA aptamer sequence AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUGUGCAAGGCCGGCUUCGCGGGCGACGAUGCCCCCCGGGCCGUCUUCCCCUCCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAUGGUGGGCAUGGGUCAGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCCUCACCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGACAUGGAGAAAAUCUGGCACCACACCUUCUACAAUGAGCUGCGUGUGGCUCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUGAACCCCAAGGCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCCCAGCCAUGUACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGGCCGUACCACUGGCAUCGUGAUGGACUCCGGUGACGGGGUCACCCACACUGUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCGUCUGGACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGAGCGCGGCUACAGCUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGACAUUAAGGAGAAGCUGUGCUACGUCGCCCUGGACUUCGAGCAAGAGAUGGCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCCUGACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGCACUCUUCCAGCCUUCCUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAAACUACCUUCAACUCCAUCAUGAAGUGUGACGUGGACAUCCGCAAAGACCUGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAU UGCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUGAAGAUCAAGAUCAUUGCUCCUCCUGAGCGCAAGUACUCCGUGUGGAUCGGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAGCAGAUGUGGAUCAGCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUGCUUCUAGCACUCGCUAGAGCAUGGUUAAGCUUCCCACGGAGGAUCCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCUUCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGGAUCCU CCGUGGG), and, under the conditions of conventional mammalian cell culture (37°C, 5% carbon dioxide, 100% relative humidity), the cells were digested after the cell line and control cells (293T/17) grew to a cell confluence of 90%, and were centrifuged at 800 rpm, and then the cells were re-suspended with PBS containing 0.2 µM of III-3 and 0.2 µM of 111-43 molecules, and were incubated for 5 minutes before flow detection, see Fig. 18 for the detection results; the III-3 molecular rotors could specifically mark the mRNA of skeleton protein in cell lines expressing target RNA, and there was no obvious background fluorescence (as shown in Fig. 18a), while the background fluorescence of 111-43 molecules was higher than III-3, and it was unclear whether ACTB was expressed (see Fig.18b).

Claims

1. A fluorescent dye, the structural formula of which is shown as Formula (I),

wherein:

D- is HO- or N(X₁)(X₂)-, X₁ and X₂ are respectively and independently selected from hydrogen, alkyl and modified alkyl; and X₁ and X₂ are optionally interconnected, and form a lipid heterocyclic ring with N atoms;

R is selected from cyano group, carboxy, amide group, ester group, sulfoxide group, sulphone group, sulfonic ester group or sulfonamido group;

Ar₁ and Ar₂ are respectively and independently selected from arylene and sub-heteroaryle; wherein hydrogen atoms in Ar₁ and Ar₂ being optionally, respectively and independently substituted by halogen atoms, hydroxyl group, aldehyde group, carboxyl group, ester group, amide group, cyano group, sulfonic acid group, phosphoric acid group, amino group, primary amino group, secondary amino group, alkyl or modified alkyl;

X₁ and X₂ optionally and independently form a lipid heterocyclic ring with Ar₁;

wherein: the "alkyl" is respectively and independently C₁-C₁₀ straight or branched alkyl; optionally, the "alkyl group" is C₁-C₇ straight or branched alkyl; optionally, the "alkyl group" is C₁-C₅ straight or branched alkyl; optionally, the "alkyl group" is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tertiary butyl, sec-butyl, n-amyl, 1-methyl butyl, 2-methyl butyl, 3-methyl butyl, isoamyl, 1-ethyl propyl, neoamyl, n-hexyl, 1-methyl amyl, 2-methyl amyl, 3-methyl amyl, isohesyl, 1,1-dimethyl butyl, 2,2-dimethyl butyl, 3,3-dimethyl butyl, 1,2-dimethyl butyl, 1,3-dimethyl butyl, 2,3-dimethyl butyl, 2-ethyl butyl, n-heptyl, 2-methyl hexyl, 3-methyl hexyl, 2,2-dimethyl amyl, 3,3 dimethyl amyl, 2,3-dimethyl amyl, 2,4-dimethyl amyl, 3-ethyl amyl or 2,2,3-methyl butyl;

the "modified alkyl" is respectively and independently a group obtained by replacing any carbon atom in alkyl with one or more groups of halogen atom, -OH, -CO-, -O-, -CN, -S-, -SO₂-, -(S=O)-, azido, primary amino group, secondary amino group, tertiary amino group, and quaternary ammonium base, and the modified alkyl has 1-10 carbon atoms, wherein the carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond;

the replacement of carbon atoms refers to that carbon atoms or the carbon atoms and hydrogen atoms thereon together are replaced by a corresponding group;

the "halogen atom" is respectively and independently F, Cl, Br or I;

the "lipid heterocyclic ring" is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic lipid heterocyclic ring containing one or more heteroatoms of N, O, S or Si on the ring, and the lipid heterocyclic ring is -S-, -SO- or -SO₂- when there are S atoms on the ring; the lipid heterocyclic ring is optionally substituted by a halogen atom, an alkyl, an aryl or a modified alkyl;

the "arylene" is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic subaromatic group;

the "sub-heteroaryle" is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic sub-heteroaromatic group containing one or more heteroatoms of N, O, S or Si on the ring;

the "ester group" is R'(C=O)OR" group;

the "amide group" is R'CONR"R‴ group;

the "sulfonic acid group" is R'SO₃H group;

the "sulfonic ester group" is R'SO₂OR" group;

the "sulfonamido group" is R'SO₂NR"R‴ group;

the "phosphoric acid group" is R'OP(=O)(OH)₂ group;

the "sulphone group" is R'SO₂R" group;

the "sulfoxide group" is R'SOR" group;

the "primary amino group" is R'NH₂ group;

the "secondary amino group" is R'NHR" group;

the "tertiary amino group" is R'NR"R‴ group;

the "quaternary ammonium base" is R'R"R‴R""N⁺ group;

each R', R", R‴, Rʺʺ respectively and independently being single bond, hydrogen, alkyl, alkylene, modified alkyl or modified alkylene;

the "alkylene" is C₁-C₁₀ straight or branched alkylene; optionally, it is C₁-C₇ straight or branched alkylene; optionally, it is C₁-C₅ straight or branched alkylene; and

the "modified alkylene" is a group obtained by replacing any carbon atom in C₁-C₁₀ (preferably C₁-C₆) alkylene with a group selected from -O-, -OH, -CO-, -CS-, and -(S=O)-.

2. The fluorescent dye according to claim 1, wherein
the "modified alkylene" is a group containing one or more groups selected from -OH, -O-, ethylene glycol unit, monosaccharide unit, -O-CO-, -NH-CO-, -SO₂-O-, -SO-, Me₂N-, Et₂N-, -S-S-, -CH=CH-, F, Cl, Br, I, and cyano group.

3. The fluorescent dye according to claim 1 or 2, wherein Ar₁ and Ar₂ respectively and independently are structures selected from the following Formulae (II-1) to (11-22):

4. The fluorescent dye according to any one of claims 1 to 3, wherein the compound represented by Formula (I) is selected from the compounds below:

5. A method of preparing the fluorescent dye according to any one of claims 1 to 4, including a step of aldol condensation reaction between a compound of Formula (a) and a compound of Formula (b),

6. Uses of the fluorescent dye according to any one of claims 1 to 4 in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

7. Uses of the fluorescent dye according to any one of claims 1 to 4 in preparing reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

8. A fluorescent activated and lighted probe, comprising the fluorescent dye according to any one of claims 1 to 4.

9. Uses of the fluorescent activated and lighted probe according to claim 8 in protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

10. Uses of the fluorescent activated and lighted probe according to claim 8 in preparing reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

Drawing