FELINE CALICIVIRUS VACCINE

Abstract

 The present invention relates to a new feline capsid protein, to live attenuated feline calicivirus comprising that capsid protein, to live recombinant carrier viruses and live attenuated hybrid feline calicivirus comprising that capsid protein, to vaccines comprising such live attenuated feline caliciviruses, live recombinant carrier viruses and live attenuated hybrid feline calicivirus, and to methods for the preparation of such viruses.

Description

[0001] The present invention relates to a new feline calicivirus capsid protein, to live attenuated feline calicivirus comprising that capsid protein, to live recombinant carrier viruses and live attenuated hybrid feline calicivirus comprising that capsid protein, to vaccines comprising such live attenuated feline caliciviruses, live recombinant carrier viruses and live attenuated hybrid feline calicivirus, and to methods for the preparation of such viruses.

[0002] Feline calicivirus (FCV) is a single-stranded positive-sense RNA virus that belongs to the genus Vesivirus in the family Calicivirus. The virus is highly contagious and causes upper respiratory tract disease (URD) and oral ulceration in felines. The virus is also associated with chronic gingivitis and stomatitis. More recently, a virulent systemic feline calicivirus commonly referred to as VS-FCV emerged that causes high mortality, edematous and ulcerative skin lesions and jaundice.

[0003] Transmission of FCV is largely by contact with nasal or oral secretions (Scherk, M. A. et al., Journal of Feline Medicine and Surgery (2013) 15, Supplementary File).

[0004] The genome and genomic organization of the calicivirus family is well-known in the art. A general overview is i.a. published by Clarke, J. et al. (Inf. Diseases 181 (Suppl. 2): S309-316 (2000)). The first complete genome sequence of a feline calicivirus was published already in 1992 (Carter, M. J. et al., Virology 190: 443-448 (1992)), and in later years the complete genome sequences of many more feline caliciviruses have been published (i.a. by Oka, T. et al., GenomeA, May/June 2013, vol. 1, issue 3, e00349-13, Genomea.asm.org) and are available through i.a. Genbank.

[0005] The genome of FCV comprises only three open reading frames; ORF 1, 2 and 3. ORF1 encodes a large non-structural polyprotein. ORF3, a short 3'-terminal ORF, encodes a minor protein that is thought to be involved in encapsidation of genomic RNA.

[0006] ORF 2 is the open reading frame that encodes the FCV capsid protein. It is known that the capsid protein is the protein that triggers protective immune response in the host. Thus, the capsid protein is the target protein for the development of vaccines for the protection of felines against FCV infection.

[0007] FCV strains comprise only one serotype and predominantly one serogroup worldwide. However, there is a considerable genetic, and thus antigenic, variation between strains. This high level of antigenic variation makes it difficult to obtain a broad protection in felines against FCV: although vaccination with a homologous strain is very efficient, the level of cross-protection of one strain against another strain is quite variable. (Coyne C.P. et al., J. Virol. 86: 11356-11367 (2012)).

[0008] At this moment, modified live and inactivated vaccines are available and they are usually administered systemically. Originally, vaccines used to be single vaccines, mostly based on strain FCV F9 or FCV 255. However, they all suffer from the problem identified above: the lack of broad cross-protection.

[0009] Currently, this problem is to a certain extent circumvented, at least partially, by administering bivalent vaccines that comprise two different FCV strains such as FCV 431 and FCV G1.

[0010] Such (inactivated) bivalent vaccines are currently commercially available both in the USA and in Europe. (Poulet H, et al., Vaccine 26: 3647-3654 (2008), Chengjin Huang et al., Journal of Feline Medicine and Surgery February 12: 129-137 (2010)).

[0011] An alternative for live attenuated and inactivated vaccines was developed by McCabe V. J. et al. who constructed a live attenuated recombinant carrier virus (LARCV), in this case a myxomavirus, expressing the FCV capsid protein and successfully administered this recombinant myxomavirus as an LARCV vaccine to felines.

[0012] Such recombinant myxoma-carrier based vaccines have the advantage that the carrier is attenuated, does not replicate in felines and only carries the FCV ORF that encodes the FCV capsid protein. Therefore, there is no shedding of FCV or the carrier virus into the environment after vaccination.

[0013] Another example of a live attenuated recombinant carrier virus expressing the FCV capsid protein is the Feline Herpesvirus carrier as described by Yokoyama, N. et al. (J. Vet. Med. Sci. 60:717-723 (1998)). This carrier was also used in the vaccination of felines against FCV.

[0014] However, a live attenuated FCV vaccine or recombinant carrier based vaccine that is both safe and shows a broad level of cross-protection has not been developed yet.

[0015] It is an objective of the present invention to provide FCV vaccines that are safe and still show a broad level of cross-protection.

[0016] It was surprisingly found that a hitherto unknown FCV stain exists of which the capsid protein shows a remarkably broad spectrum of cross-protection against many FCV field strains. An example of the capsid protein of a representative of this strain is depicted in SEQ ID NO: 34. The representative of this novel FCV strain of which the capsid protein sequence is shown in SEQ ID NO: 34 is further referred to as FCV strain Kalem Crouch.

[0017] Table 1 shows the cross-neutralising properties of antiserum raised against the novel FCV strain according to the invention with 31 other FCV strains. The log₁₀ reduction in virus titre is shown. A reduction in titre of >1.5 log₁₀ is considered significant.

[0018] As follows from this table, antiserum raised against the novel FCV strain Kalem Crouch surprisingly neutralises 26 out of the 31 FCV strains tested.A comparisson was made to the commonly used F9 strain. As can be seen in table 1 , it is seen that antiserum raised against F9 only show a significant reduction of titer for 3 out of 22 FCV strains tested.

[0019] The amino acid sequence of the capsid protein of this new FCV strain has been compared with the known amino acid sequence of 24 other FCV capsid proteins and it can be concluded that the sequence differs quite significantly from the known FCV capsid proteins. As can be seen from figure 5, the overall sequence identity between the capsid protein of the new strain and that of known FCV strains is around 87%. In addition, several unique amino acids of the new capsid protein are identified K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, P637. In addition, the sequence KLEYEN of amino acid 448-453, and GVISD of amino acid 490-494 are also unique.

[0020] It will be understood that, for the amino acid sequence of SEQ ID NO: 34 and the DNA encoding the protein, minor natural variations may exist between individual representatives of this strain. First of all, at the nucleotide level, there is the so-called "wobble in the second and third base" explaining that nucleotide changes may occur that remain unnoticed in the amino acid sequence they encode: e.g. triplets TTA, TTG, TCA, TCT, TCG and TCC all encode Leucine. In addition, there may be minor variations at the nucleotide level between representatives of FCV that may lead to minor variations in amino acid sequence. These variations can be reflected by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. Amino acid substitutions which do not essentially alter biological and immunological activities, have been described, e.g. by Neurath et al. in "The Proteins" Academic Press New York (1979). Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, inter alia, Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (see Dayhof, M.D., Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington D.C., 1978, vol. 5, suppl. 3). Other amino acid substitutions include Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science, 227, 1435-1441, 1985) and determining the functional similarity between identical proteins. Such amino acid substitutions of the exemplary embodiments of this invention, as well as variations having deletions and/or insertions are within the scope of the invention as long as the resulting proteins retain their immune reactivity. This explains why an FCV capsid protein according to the invention, when isolated from different field isolates, may have an identity level of about 90%, while still representing a protein with a comparable immunological cross-reactivity.

[0021] Thus, a first embodiment of the present invention relates to a feline calicivirus capsid protein that has a sequence identity of at least 90% with the amino acid sequence as given in SEQ ID NO: 34.

[0022] Optionally the capsid protein has a sequence identity of at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% with the amino acid sequence as given in SEQ ID NO: 34 in increasing order of preference.

[0023] Another embodiment of the present invention and/or embodiments thereof relates to a live attenuated FCV comprising a capsid protein that has a sequence identity of at least 90% with the amino acid sequence as given in SEQ ID NO: 34.

[0024] Another embodiment of the present invention and/or embodiments thereof relates to a live attenuated FCV comprising a capsid protein according to the present invention and/or any embodiment thereof.

[0025] Optionally the FCV has a capsid protein has a sequence identity of at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% with the amino acid sequence as given in SEQ ID NO: 34 in increasing order of preference.

[0026] In addition, the present invention relates to a feline calicivirus capsid protein that comprises at least one of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, P637. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one or more of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, P637. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one, two, three, four, five or more of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, P637.

[0027] In addition, the present invention relates to a feline calicivirus capsid protein that comprises at least one of the following amino acids 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, or S546. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one or more of the following amino acids 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, or S546. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one, two, three, four, five or more of the following amino acids 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, or S546.

[0028] In addition, the present invention relates to a feline calicivirus capsid protein that comprises at least one of the following amino acids L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, or I525. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one or more of the following amino acids L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, or 1525. Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises at least one, two, three, four, five or more of the following amino acids L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, or I525.

[0029] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids K90, M91, and M101.

[0030] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acid 1318.

[0031] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids L391, A392, V393, Q397, S398, K399, and N405.

[0032] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids T427, T432, S439, S440, D441, E446, K448, L449, E452, and N453.

[0033] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids G485, G490, and 1492.

[0034] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids N517, S518, E519, and 1526.

[0035] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids S546.

[0036] Suitably the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids S635, F636, and P637.

[0037] It is expressly envisioned for the feline calicivirus capsid protein according to the invention and/or embodiments thereof to comprise combinations of the above indicated groups of amino acids. For example the feline calicivirus capsid protein according to the invention and/or embodiments there of comprises the following amino acids L391, A392, V393, Q397, S398, K399, N405 and 1318. Another example relates to a feline calicivirus capsid protein according to the invention and/or embodiments there of that comprises the following amino acids N517, S518, E519, 1525 and S546.

[0038] In addition, the present invention relates to a feline calicivirus capsid protein wherein amino acids 448-453 are KLEYEN and/or wherein amino acid 490-494 are GVISD. Suitably the present invention relates to a feline calicivirus capsid protein wherein amino acids 448-453 are KLEYEN and amino acid 490-494 are GVISD. Suitably a feline calicivirus capsid protein wherein amino acids 448-453 are KLEYEN and/or wherein amino acid 490-494 are GVISD also comprises at least one of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T476, T432, S439, S440, D441, E446, G485, N517, S517, E519, 1525, S546, S635, F636, or P637.

[0039] Another embodiment of the present invention and/or embodiments thereof relates to a live attenuated FCV comprising a capsid protein that has a sequence identity of at least 90% with the amino acid sequence as given in SEQ ID NO: 34 and at least one of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, P637.

[0040] A capsid protein or the region encoding the capsid protein according to the invention such as ORF2 or a fragment thereof may be used in several ways in the preparation of vaccines for the protection of felines against FCV.

[0041] A DNA fragment comprising the region encoding a capsid protein according to the invention and/or embodiments thereof may e.g. be used for the preparation of non-FCV recombinant carrier viruses comprising the capsid protein according to the invention and/or embodiments thereof. It may also be used for the preparation of hybrid FCV, as described below.

[0042] Thus, a third embodiment of the present invention relates to a DNA fragment characterized in that it comprises a region encoding a capsid protein according to the invention and/or embodiments thereof.

[0043] In cases where a recombinant carrier is used as a carrier for a DNA fragment comprising the region encoding a capsid protein according to the invention and/or embodiments thereof, the expression of the capsid protein would usually be obtained by placing the DNA fragment comprising the region encoding a capsid protein according to the invention and/or embodiments thereof under the control of a suitable heterologous promoter.

[0044] A suitable promoter is a promoter that is capable of driving the transcription of a coding region that is located downstream of the promoter in the host cell; in this case a eukaryotic, more specific a feline cell. A large number of suitable promoters for the expression of the FCV capsid protein are known in the art, which are recognized for their efficient level of expression. Such promoters include classic promoters such as the (human) cytomegalovirus immediate early promoter (Sun-Young Lee et al., Journal of Biomedical Science 6: 8-17 (1999), Seed, B. et al., Nature 329, 840-842, 1987; Fynan, E.F. et al., PNAS 90, 11478-11482,1993; Ulmer, J.B. et al., Science 259, 1745-1748, 1993), the Human Cytomegalovirus enhancer-promoter (Donofrio G., et al., Clinical and Vaccine Immunology 13: 1246-1254, (2006)), the Mouse Cytomegalovirus immediate early (MCMVie1) promoter, the Mouse Cytomegalovirus early (MCMVe1) promoter, SV40 immediate early promoter (Sprague J. et al., J. Virology 45, 773 ,1983), the SV-40 promoter (Berman, P.W. et al., Science, 222, 524-527, 1983), the metallothionein promoter (Brinster, R.L. et al., Nature 296, 39-42, 1982), the heat shock promoter (Voellmy et al., Proc. Natl. Acad. Sci. USA, 82, 4949-53, 1985), the major late promoter of Ad2, the β-actin promoter (Tang et al., Nature 356, 152-154, 1992) and the CAG promoter. (Miyazaki, J; Takaki, S; Araki, K; Tashiro, F; Tominaga, A; Takatsu, K; Yamamura, K., Gene 79 (2): 269-277 (1989), and Niwa, H; Yamamura, K; Miyazaki, J., Gene 108 (2): 193-199 (1991)).

[0045] Suitably the region encoding the capsid protein is placed under the control of a suitable promoter.

[0046] The DNA fragment comprising a region encoding a capsid protein according to the invention and/or embodiments thereof may e.g. be a plasmid. This plasmid may be in a circular or linear form. Given the broad protection provided by the capsid protein according to the invention and/or embodiments thereof, it is attractive to use the region encoding the capsid protein according to the invention and/or embodiments thereof in a live recombinant carrier virus.

[0047] Such live attenuated recombinant carrier viruses (LARCVs) are recombinant viruses capable of infecting a host animal, in this case a feline species, and carrying a foreign gene, in this case the region encoding the capsid protein according to the invention and/or embodiments thereof, under the control of a suitable promoter.

[0048] LARCVs and their uses have been reviewed i.a. by Souza, A.P.D. et al., in Braz. J. Med. Biol. Res, 38: 509-522 (2005). Examples of such live recombinant carrier viruses are: poxviruses (i.a. vaccinia virus), adenoviruses, herpesviruses, myxomaviruses and more recently alphaviruses.

[0049] Thus, a fourth embodiment of the present invention relates to live attenuated recombinant carrier viruses (LARCV) comprising the region encoding the capsid protein according to the invention, under the control of a promoter.

[0050] An example of such an attenuated live recombinant carrier virus is provided by McCabe et al who describe the use of myxomavirus as LARCV for the capsid protein of FCV strain F9 (vide supra).

[0051] Another example of a live attenuated recombinant carrier virus expressing the FCV capsid protein is the Feline Herpesvirus carrier expressing the FCV capsid protein such as described by Yokoyama, N. et al., (vide supra).

[0052] Suitably the live attenuated recombinant carrier virus is a myxomavirus or a Feline Herpesvirus.

[0053] Another embodiment of the present invention and/or embodiments thereof relates to a live attenuated recombinant carrier virus according to the invention and/or embodiments thereof, for use in the protection of felines against infection with FCV.

[0054] The capsid protein and its coding region may also allow another approach for the protection of felines against FCV. This approach relates to a hybrid FCV.

[0055] It is known in the art that live attenuated vaccines exist for the protection of felines against FCV infection. An example of such a live attenuated FCV is FCV strain F9, known to provide a safe live vaccine when administered systemically. However, as mentioned above, FCV strains in general and also the F9 strain do not provide broad cross-protection against infection of felines with other FCV strains.

[0056] It was now surprisingly found, that hybrid FCV strains that comprise a region encoding a capsid protein according to the invention and/or embodiments thereof and an ORF1 from an attenuated FCV provide both a high level of safety and a broad cross-protection.

[0057] Another embodiment relates to a live attenuated hybrid FCV, characterised in that said FCV comprises a region encoding a capsid protein according to the invention and/or embodiments thereof and comprises a region encoding an attenuation from open reading frame 1 (ORF1) from an attenuated FCV.

[0058] Suitably the live attenuated hybrid FCV of the present invention and/or embodiments thereof comprises an open reading frame 2 (ORF2) encoding a capsid protein according to the invention and/or embodiments thereof and comprises an open reading frame 1 (ORF1) from an attenuated FCV.

[0059] Methods for the construction of hybrid caliciviruses are well-known in the art. For feline calicivirus, Neill et al. described capsid protein domain exchanges between distinct FCV strains (Neill, D. J. et al., J. Virol 74:1079-1084 (2000)). Further methods for the recovery of recombinant viruses from cells after transfection of cRNA or cDNA constructs were already described in 2002 by Thumfart J. O. and Meyers G. (J. Virol. 76: 6398-6407 (2002)). Aubry, F. et al., have recently described even faster methods to generate single-stranded positive-sense RNA viruses using subgenomic amplicons (J. Gen. Virol 95:2462-2467 (2014)).

[0060] Attenuated viruses may e.g. be obtained by growing the viruses according to the invention and/or embodiments thereof in the presence of a mutagenic agent, followed by selection of virus that shows a decrease in progeny level and/or in replication speed. Many such agents are known in the art.

[0061] Another frequently used method for attenuation is serial in vitro passage. During this process, viruses get adapted to the cell line used for the serial passage. As a consequence, they behave attenuated when subsequently administered to the natural host again as a vaccine.

[0062] Still another way of obtaining attenuated viruses is to subject them to growth under temperatures deviating from the temperature of their natural habitat. Selection methods for temperature sensitive mutants (Ts-mutants) are well-known in the art. Such methods comprise growing viruses in the presence of a mutagen followed by growth at a sub-optimal temperature and at the optimal temperature, titration of progeny virus on cell layers and visual selection of those plaques that grow slower at the optimal temperature. Such small plaques comprise slow-growing and thus desired live attenuated viruses.

[0063] A more direct and predictable method for the generation of attenuated single-stranded positive-sense RNA viruses is e.g. described by Weeks, S. A. et al., in the J. of Biol. Chem., 287: 31618-31622 (2014).

[0064] Optionally, the skilled person would use a region encoding an attenuation from open reading frame 1 (ORF1) or the ORF1 from already available attenuated FCV strains. A well-known example of such a live attenuated virus is FCV strain F9.

[0065] Kalunda et al. AJVR (1975) 36:353-356 described the properties of the strain FCV-F9 as a vaccine. See also Bittle, et al., Ibid. (1976) 37:275-278.

[0066] Suitably the invention and/or embodiments thereof relate to a live attenuated hybrid FCV according to the invention that comprises a region encoding an attenuation from open reading frame 1 (ORF1) or an open reading frame 1 (ORF1) that is obtained from FCV strain F9.

[0067] In the Example-section, a method for the preparation of a hybrid FCV according to the invention and/or embodiments thereof as described above is described in detail.

[0068] Again another embodiment of the present invention relates to live attenuated hybrid FCV according to the invention and/or embodiments thereof, for use in the protection of felines against infection with FCV.

[0069] Mammalian cells, suitable for the cultivation of live recombinant carrier viruses are known in the art. Such cells are the cells that support the growth of the known LARCVs, such as poxviruses, adenoviruses, herpesviruses, myxomaviruses and more recently alphaviruses.

[0070] Attenuated recombinant myxoma-based carrier virus expressing the FCV capsid protein may e.g. be grown on RK13 cells. Attenuated recombinant Feline Herpesvirus- based carrier virus expressing the FCV capsid may e.g. be grown on Crandell-Rees feline kidney (CRFK) cells.

[0071] Equally, cells suitable for the cultivation of live attenuated FCV and live attenuated hybrid FCV are known in the art. The most common cells for growing FCV are CRFK cells.

[0072] Thus, again another embodiment of the present invention relates to a cell culture comprising a live attenuated FCV according to the invention and/or embodiments thereof, a LRCV according to the invention or a live attenuated hybrid FCV according to the invention.

[0073] As indicated above, the FCV capsid protein according to the invention and/or embodiments thereof provides a broad level of cross-protection against a variety of different FCV strains.

[0074] For this reason, live attenuated FCVs according to the invention and/or embodiments thereof, live recombinant carrier viruses according to the invention and/or embodiments thereof and live attenuated hybrid FCVs according to the invention and/or embodiments thereof provide a very suitable basis for vaccines for the protection of felines against FCV.

[0075] Thus, still another embodiment of the present invention relates to vaccines for the protection of felines against FCV, wherein such vaccines comprises a live attenuated FCV according to the invention and/or embodiments thereof and a pharmaceutically acceptable carrier, and/or a live attenuated recombinant carrier virus according to the invention and/or embodiments thereof and a pharmaceutically acceptable carrier and/or a live attenuated hybrid FCV according to the invention and/or embodiments thereof and a pharmaceutically acceptable carrier.

[0076] Protection in this respect should be interpreted in a broad sense: protection of felines against FCV is considered to comprise vaccination in order to prevent the disease, vaccination to diminish the signs of the disease and therapeutic vaccination after the disease is diagnosed.

[0077] Examples of pharmaceutically acceptable carriers that are suitable for use in a vaccine for use according to the invention are sterile water, saline, aqueous buffers such as PBS and the like. In addition a vaccine according to the invention may comprise other additives such as stabilizers and/or anti-oxidants.

[0078] As mentioned above, the virulence of FCV isolated from the field is relatively high: feline calicivirus infection is a cause of upper respiratory tract infection and when a virulent FCV is administered oropharyngeal it causes pyrexia, oculo-nasal discharge, gingivo-stomatitis, glossitis, weight loss and poor body condition. The virulent systemic form of FCV causes pyrexia, vasculitis, oedema, ulcerative lesions on limbs, jaundice and death. (There is sporadic information that even the vaccine strain of FCV F9 when administered oropharyngeally does cause gingivo-stomatitis).

[0079] A live attenuated virus as defined herein is a virus that has a decreased level of virulence when compared to virus isolated from the field. Vaccination with a live attenuated virus, a live attenuated hybrid virus or LRCV according to the invention and/or embodiments thereof at least reduces the severity of infection (reduction in the clinical signs and symptoms) in terms of duration of pyrexia, oral ulcers, weight loss and/or days virus excreted, when compared to infection of non-vaccinated animals with a wild-type FCV.

[0080] Usually, live attenuated FCV, LRCV and live attenuated hybrid FCV based vaccines may be used without the addition of adjuvants. Nevertheless, if so required, an adjuvant may be included in the vaccine.

[0081] An adjuvant is an immune stimulatory substance boosting the immune response of the host in a nonspecific manner. The adjuvant may be a hydrophilic adjuvant, e.g. aluminum hydroxide or aluminum phosphate, or a hydrophobic adjuvant, e.g. a mineral oil based adjuvant.

[0082] Live attenuated FCV, LRCV and live attenuated hybrid FCV based vaccines according to the invention and/or embodiments thereof may comprise a stabilizer. A stabilizer may be added to a vaccine according to the invention and/or embodiments thereof e.g. to protect it from degradation, to enhance the shelf-life, or to improve freeze-drying efficiency. Useful stabilizers are i.a. SPGA (Bovarnik et al., 1950, J. Bacteriology, vol. 59, p. 509), skimmed milk, gelatin, bovine serum albumin, carbohydrates e.g. sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, lactoses, proteins such as albumin or casein or degradation products thereof, and buffers, such as alkali metal phosphates. To reconstitute a freeze-dried composition, it is suspended in a physiologically acceptable diluent. Such a diluent may e.g. be as simple as sterile water, or a physiological salt solution. In a more complex form the freeze-dried vaccine may be suspended in an emulsion e.g. as described in EP 1,140,152.

[0083] The dosing scheme for the application of a vaccine according to the invention and/or embodiments thereof to the target organism may be the application of single or multiple doses and in such an amount as will be immunologically effective.

[0084] What constitutes an "immunogenically effective amount" for a vaccine according to the invention that is based upon a virus according to the invention and/or embodiments thereof is dependent on the desired effect. The term "immunogenically effective amount" as used herein relates to the amount of live attenuated FCV, live attenuated carrier virus or live attenuated hybrid FCV according to the invention that is necessary to induce an immune response in felines to the extent that it decreases the pathological effects caused by infection with a wild-type FCV virus, when compared to the pathological effects caused by infection with a wild-type FCV in non-immunized felines.

[0085] It is well within the capacity of the skilled person to determine whether a treatment is "immunologically effective", for instance by administering an experimental challenge infection to vaccinated animals and next determining a target animal's clinical signs of disease, serological parameters or by measuring re-isolation of the pathogen, followed by comparison of these findings with those observed after challenge of non-vaccinated felines.

[0086] The amount of virus administered will depend on the route of administration, possibly the presence of an adjuvant and the moment of administration.

[0087] A preferred amount of a live vaccine comprising a live attenuated FCV or live attenuated hybrid virus according to the invention and/or embodiments thereof is expressed for instance as Tissue Culture Infectious Dose (TCID₅₀). For instance for such a live attenuated virus a dose range between 10² and 10⁸ TCID₅₀ per animal dose may advantageously be used; preferably a range between 10⁴ and 10⁶ TCID₅₀ is used.

[0088] A preferred amount of a live recombinant carrier virus based upon myxomavirus in a vaccine would be in the range of 10⁴ - 10⁸ plaque-forming units (PFU).

[0089] A preferred amount of a live recombinant carrier virus based upon Feline Herpesvirus in a vaccine would also be in the range of 10⁴ - 10⁸ plaque-forming units (PFU).

[0090] Several ways of administration may be applied, all known in the art. Vaccines according to the invention are preferably administered to felines via injection, preferably intramuscular injection. The protocol for the administration can be optimized in accordance with standard FCV or live recombinant carrier virus vaccination practice.

[0091] Domesticated felines are usually vaccinated against several diseases. For reasons of ease of administration, and also for economic reasons, it is desirable to administer several vaccines at the same time, preferably as a combination vaccine. Such combination vaccines would then comprise a live attenuated FCV according to the invention and/or embodiments thereof and/or a live attenuated hybrid FCV according to the invention and/or embodiments thereof and/or a live recombinant carrier virus according to the invention and/or embodiments thereof, and in addition to this at least one other feline-pathogenic microorganism or feline-pathogenic virus and/or at least one other immunogenic component and/or genetic material encoding said other immunogenic component of said feline-pathogenic microorganism or feline-pathogenic virus.

[0092] Thus a preferred form of this embodiment relates to vaccines for the protection of felines against FCV, wherein such vaccines comprise a live attenuated FCV according to the invention and a pharmaceutically acceptable carrier, and/or a live Recombinant Carrier Virus according to the invention and a pharmaceutically acceptable carrier and/or a live attenuated hybrid FCV according to the invention and a pharmaceutically acceptable carrier, and at least one other feline-pathogenic microorganism or feline-pathogenic virus and/or at least one other immunogenic component and/or genetic material encoding said other immunogenic component of said feline-pathogenic microorganism or feline-pathogenic virus.

[0093] In a more preferred form of this embodiment, the at least one other feline-pathogenic microorganism or cat-pathogenic virus is selected from the group consisting of feline panleucopenia virus, Chlamydia psittaci, Bordetella bronchiseptica, feline parvovirus, rabies virus and feline herpes virus.

[0094] In the Examples section, a detailed example is provided of the construction of a live attenuated hybrid FCV according to the invention. Basically, the method comprises the step of assembling a first and a second amplicon, each comprising a part of the full length viral genome, preferably using overlap extension, resulting in an amplicon that comprises the full length viral genome.

[0095] Suitably, the first FCV amplicon comprises the full ORF1 region and an adjacent 5'-part of the ORF2 region of an attenuated FCV and the second FCV amplicon comprises a 3'-part of the ORF1 region and the full adjacent ORF2//ORF3 region wherein the ORF2 is an ORF2 encoding an FCV capsid protein according to the invention and/or embodiments thereof.

[0096] There thus exists an overlapping region spanning a 5'-part of the ORF1 region and a 3'-part of the ORF2 region that is present in both amplicons. This would allow for assembly of the first and second amplicon through overlap extension.

[0097] Therefore, still another embodiment relates to methods for obtaining a live attenuated hybrid FCV according to the invention that comprise the steps of:

a. Preparation of a first FCV amplicon comprising the full ORF1 region and an adjacent 5'-part of the ORF2 region of an attenuated FCV,

b. Preparation of a second FCV amplicon comprising a 3'-part of the ORF1 region and the full adjacent ORF2//ORF3 region wherein the ORF2 is an ORF2 according to the invention,

c. Assembly of the first and second amplicon using overlap extension,

d. Generation of infectious FCV,

e. Infection of susceptible cells with the infectious FCV,

f. Recovery of infectious progeny FCV

Legend to the figures.

[0098] 

Figure 1: amplicons covering 5349 bp from the 5' end of the FCV genome, or 2422 and 2416 bp from the 3' end of the FCV F9 and Kalem Crouch genomes respectively were amplified with PCR from FCV cDNA

Figure 2: full-length overlap extension assemblies of FCV F9 (SEQ ID NO: 60), Kalem Crouch (SEQ ID NO: 59), FK (SEQ ID NO: 62) and KF (SEQ ID NO: 61) were generated and resolved on a 1% agarose gel. FCV F9 and Kalem Crouch were made from their respective 5' and 3' amplicons as controls to demonstrate correct design of overlap

Figure 3: full-length recombinant FK and KF FCV DNA was amplified with PCR and resolved on a 1% agarose gel.

Figure 4: an example of the typical CPE (cytopathic effect) of FCV in CrFK cells infected with FCV Kalem Crouch.

Figure 5: Alignment of FCV Kalem Crouch (SEQ ID NO: 34) and F9 (SEQ ID NO: 35) capsid protein sequence to published FCV sequences (SEQ ID NO: 36-58). Numbering of the amino acids is on nucleotide level.

Figure 6: Sequence alignment of the FCV F9 (SEQ ID NO: 59) and Kalem Crouch strains (SEQ ID NO: 60) to recombinant FCV FK (SEQ ID NO: 61) and KF strains. (SEQ ID NO: 62).

Figure 7: Alignment of FCV Kalem Crouch (SEQ ID NO: 34) and F9 (SEQ ID NO: 35) capsid protein sequence to published FCV sequences (SEQ ID NO: 36-58). Numbering of the amino acids is on amino acid level.

Figure 8: Map of the p22m-GFP plasmid with the mutation in the NcoI site of the MCS indicated.

Figure 9: Comparison of the p22m-GFP and p22m-4a constructs derived from p22-GFP plasmid.

Figure 10: A diagram of the whole MR24-Kalem Crouch clone genome with a highlighted pMCPK insert.

Examples:

Example 1:

[0099] Hyper-immune sera raised in cats to strains FCV F9 and Kalem Crouch were used to determine the neutralisation index of the several FCV strains. The experiment is performed as described in section 8 below. The data is shown in table 1. It becomes clear from the table that serum raised against Kalem Crouch has a broad cross protection against many other FCV strains. For serum against Kalem Crouch a significant Log₁₀ reduction (i.e. >1.5) is seen against 16 out of 31 FCV strains. Table 1 also shows that the cross-protection of the normally used F9 strain is much less. Serum raised against F9 shows a significant Log₁₀ reduction (i.e. >1.5) for 3 out of 22 FCV strains. It should be noted that the 2 FCV strains that are neutralized or at least significantly reduced by the F9 serum, 3809, 6420, CV-21, are F9-like viruses. Thus not only provides Kalem Crouch cross-protection for many more FCV strains than F9 does, it also provides cross-protection for non-F9 strains.

Example 2

[0100] Construction of hybrid FCV-clones.

1. Cell culture

[0101] All cell lines were maintained in tissue culture flasks at 37°C, 5% CO₂.

[0102] Crandell-Rees Feline kidney (CrFK) cells were grown in medium M6B8 supplemented with 5% Foetal Bovine Serum, 0.15% Sodium bicarbonate, 2 mM L-Glutamine, 100 U/ml of Penicillin, 10 µg/ml of Streptomycin and 2 µg/ml of Fungizone.

[0103] BsRT7 cells were maintained in medium DMEM supplemented with 5% Foetal Bovine Serum, 2 mM L-Glutamine, 1 mM Sodium Pyruvate and 1 mg/ml Geneticin (G418). Geneticin was removed at cell seeding prior to transfection.

2. Virus Isolation

[0104] Oro-pharyngeal/ nasal swabs were collected from cats and transported in medium M6B8. The swabs were vortexed briefly and the virus suspension inoculated onto confluent CrFK cells and incubated at 37°C with 5% CO₂ until CPE specific to FCV was observed. Infected flasks were freeze thawed to lyse cells, clarified to remove cellular debris and stored as aliquots at -70°C.

3. Growth of FCV

[0105] An appropriate dilution of virus was adsorbed to infect a confluent CrFK monolayer. Cells were incubated at 37°C, 5% CO₂ until CPE specific to FCV was observed. Infected flasks were freeze thawed to lyse cells, clarified to remove cellular debris and stored as aliquots at -70°C.

4. RNA Isolation

[0106] Clarified viral suspension was centrifuged at 131500 x g, 4°C using a SW28 rotor for approximately 16 hours. RNA was extracted from the resulting pellet using an RNeasy^® Miniprep Kit (Qiagen, Hilden, Germany). RNA was eluted in 50 µl RNase free water, aliquoted and stored at -70°C until use.

5. cDNA Synthesis

[0107] FCV RNA was used as a template for cDNA synthesis. cDNA was synthesised using an INVITROGEN Superscript II^® kit (Carlsbad, CA) and primers Fr2F (SEQ ID NO: 32) and Fr4R (SEQ ID NO: 33).

6. Virus Titration

[0108] Serial tenfold dilution of the virus (100 µl/well, 5 wells per dilution) in growth medium was used to infect a confluent monolayer of CrFK cells in 96 well plates. Infected CrFK cells were incubated at 37°C, 5% CO₂ for up to 5 days and examined for CPE specific for FCV. The number of wells in which CPE was present was recorded and titres were calculated using Reed Muench method. Titres were expressed as TCID₅₀/ml.

7. Preparation of FCV Antibodies

[0109] Antibodies to FCV strains were raised in cats. Each treatment group consisted of 3 cats housed separately. Cats were either infected by the oro-pharyngeal route or by subcutaneous injections. Cats were hyperimmunized with a second dose of the virus by the oro-phryngeal route. Plasma was collected from cats three weeks post second inoculation.

8. Virus neutralisation assay

[0110] Serial dilution of the viruses were mixed with an equal volume of a constant amount of plasma dilution or growth medium and incubated for 1 hour at 37°C. The virus or virus serum mixture was inoculated on confluent CrFK cells (5 wells per dilution) in a 96 well plate. Plates were incubated at 37°C, 5% CO₂ for 5 days. The neutralisation index was determined by calculating the difference in the titer observed.

9. Design of primers to generate overlapping DNA amplicons from FCV cDNA

[0111] The PCR reactions to generate an amplicon covering 5349 bp from the 5' of the FCV genome were performed using the Phusion polymerase (NEB, Ipswich, MA) with oligonucleotide primer pair FKP1F (SEQ ID NO: 5) and FKP1R (SEQ ID NO: 6), and the PCR conditions described in Table 4. Similarly, PCR reactions to generate an amplicon covering the 2422 bp from the 3' end of FCV F9 and 2416 bp from the 3' end of FCV Kalem Crouch were also performed using the Phusion polymerase (NEB, Ipswich, MA) with oligonucleotide primer pair FKP2F (SEQ ID NO: 7) and FKP2R (SEQ ID NO: 8) using the Phusion polymerase (NEB, Ipswich, MA), and the PCR conditions described in Table 5.

10. Purification of DNA from PCR reactions

[0112] All amplified DNA was purified using QIAquick^® PCR Purification Kit (Qiagen, Hilden, Germany) using two column washes. The concentration and purity of eluted DNA was determined using a Nanodrop instrument (Thermo Scientific, Waltham, MA).

11. Combining of FCV amplicons to generate full length FCV

[0113] An equimolar mix was made with 0.1, 0.25, or 0.5 pmol of each FCV amplicons generated as described in methods section 9, and purified as described in methods section 10. A sufficient amount of such a mix, typically 5µL, was used as template for the overlap extension PCR described in Table 6, using the Phusion polymerase (NEB, Ipswich, MA).

12. Generation of full length infectious FCV DNA

[0114] A sufficient amount of cDNA reaction, prepared as described in section 5 above, or overlap extension PCR reaction, prepared as described in section 11, typically between 1 and 5µL, was used as template to generate full length infectious FCV DNA. Th Phusion polymerase (NEB, Ipswich, MA) was used together with oligonucleotide primer pairs MBL 446 (SEQ ID NO: 1) and MBL 447 (SEQ ID NO: 2) or FCVT7f (SEQ ID NO: 3) and FCVpAr (SEQ ID NO: 4), and the PCR conditions described in Tables 7 and 8 respectively.

13. Transfection of full length infectious FCV DNA into BsRT7 cells

[0115] BsRT7 cells, cultured as described in section 1 to approximately 50-70% confluence in 24 well plates, were transfected with full length infectious FCV DNA generated as described in section 12 using the INVITROGEN^® Lipofectamine^® 3000. Typically 3µg of DNA was used per well. Cells were incubated with the DNA-lipofectamine complex for up to 72 hours.

14. Infection of CrFK cells with lysate from transfected BsRT7 cells

[0116] Transfected BsRT7 cells were lysed by freeze-thawing. The cell-lysate was used to infect a confluent monolayer of CrFK cells.

15. Immunofluorescence staining of FCV

[0117] CrFK cells infected with FCV were fixed with methanol and washed with PBS. Fixed cells were incubated sequentially with a polyclonal anti FCV serum and anti-Cat FITC antibody conjugate or a mouse monoclonal antibody NCL-1G9 (Leica Microsystems, UK) and antimouse FITC antibody conjugate. Fluorescence was observed using a DM1L microscope (Leica Microsystems, UK) with the I3 filter.

16. Sequence analysis of FCV

[0118] Full length FCV DNA was made from cDNA using the oligonucleotide primers MBL 446 (SEQ ID NO: 1) and MBL 447 (SEQ ID NO: 2) together with the Phusion polymerase (NEB, Ipswich, MA) and PCR conditions described in Table 4. The resulting full length FCV DNA was purified as described in methods section 11 and sequenced using any combination of oligonucleotide primers from Table 3. DNA samples were sequenced by GATC-biotech, UK. 30-100 ng/µl of plasmid or 10-50 ng/µl of PCR product were sent with 10 pmol/µl of sequencing primer.

Table 1 PCR primers to generate full length infectious FCV DNA.

Name	Legacy	Sequence 5' to 3'
SEQ ID 1	MBL 446
SEQ ID 2	MBL 447
SEQ ID 3	FCVT7f
SEQ ID 4	FCVT7r

Table 2 PCR primers used to generate FCV amplicons.

Name	Legacy	Sequence
SEQ ID 5	FKP1F	GTAAAAGAAATTTGAGACAATGTCTCAAACTCTGAGCTTCGTGC
SEQ ID 6	FKP1R
SEQ ID 7	FKP2F
SEQ ID 8	FKP2R	TTTTTTTTTTTTCCCTGGGGTTAGGCGCAGGTGCGG

Table 3 PCR primers for sequencing the full length of the recombinant FCV genome.

Name	Legacy	Sequence
SEQ ID 9	Seg2F	CTTGGTACCGAGCTGTAAAAGAAATTTGAGACAATG
SEQ ID 10	SCJ1R	TGAGCTGTTCTTTGCACA
SEQ ID 11	MBL 228	CTCCTTGAAAGAGTTGGTGTG
SEQ ID 12	MBL 234	CTATGGTGCATTCGGTGATG
SEQ ID 13	MBL 230	GCGACAACTCTTGTATCAGG
SEQ ID 14	MBL 233	GACATGCTTGAGAACAAGGG
SEQ ID 15	Seg3F	GAACTACCCGCCAATC
SEQ ID 16	Seg2R	GAGCCCAGGCCAAAT
SEQ ID 17	MBL 344	GATCGGTCGACGAGCTCTTCTCTCTCTTAGG
SEQ ID 18	MBL 220	GTATGACGTAACAAAGCCTG
SEQ ID 19	MBL 221	GGAAATTGGCAACCCAAGGC
SEQ ID 20	MBL 222	GCTGTAAAAGTGTCCTCTGG
SEQ ID 21	Seg4F	CACTGTGATGTGTTCGAAG
SEQ ID 22	Seg3R	TATTTAAGCACGTTAGCG
SEQ ID 23	SCJ7F	CATCTTATGTCAGATACTGA
SEQ ID 24	SCJ8F	TTTTCTTTTGTTGGTGTCTC
SEQ ID 25	Seg4R	CGAGCGGCCGCCACTGTGCCCTGGGGTTAGGCGC
SEQ ID 26	SCJ2F	GGGAGATGAGAAGCTTCG
SEQ ID 27	SCJ3F	GCCCAAACTATGAAACAAG
SEQ ID 28	SCJ4F	AACGCCATTGGATCTGTAAC
SEQ ID 29	SCJ6F	ATTGAACCAATCGATCCTGA
SEQ ID 30	SCJ5R	TCAGGATCGATTGGTTCAAT
SEQ ID 31	MBL 341	TTCCAGGTACCTCCGGAAGGAGTTCTGGGTAG
SEQ ID 32	Fr2F
SEQ ID 33	Fr4R	GGCAACTAGAAGGCACAGCCCTGGGGTTAGGCGC

Table 4 PCR conditions to generate an amplicon of FCV covering 5349 bp from the 5' end.

PCR mix		PCR program
Mix components	Volumes (µL)	Step	Time	Temperature (0C)
NF water	31.0
5X PCR buffer	10.0	Initial denaturation	30 sec	98.0
dNTP mix (10mM)	1.0	Number of cycles: 35
F primer, SEQ ID 9 (10µM)	1.0	Start of cycle
R primer, SEQ ID 10 (10µM)	1.0	Denaturation	10 sec	98.0
DMSO (final conc. 9%)	4.5	Annealing	10 sec	69.0
Polymerase	0.5	Extension	1 min 30 sec	72.0
Template (cDNA)	1.0	End of cycle
		Final extension	5 min	72.0
Final volume	50.0	Storage	indefinitely	4.0

Table 5 PCR conditions to generate an amplicon of FCV covering up to 2422 bp from the 3' end.

PCR mix		PCR program
Mix components	Volumes (uL)	Step	Time	Temperature (0C)
NF water	31.0
5X PCR buffer	10.0	Initial denaturation	30 sec	98.0
dNTP mix (10mM)	1.0	Number of cycles: 35
F primer, SEQ ID 11 (10µM)	1.0	Start of cycle
R primer, SEQ ID 12 (10µM)	1.0	Denaturation	10 sec	98.0
DMSO (final conc. 9%)	4.5	Annealing	10 sec	69.0
Polymerase	0.5	Extension	45 sec	72.0
Template (cDNA)	1.0	End of cycle
		Final extension	5 min	72.0
Final volume	50.0	Storage	indefinitely	4.0

Table 6 PCR conditions to carry out an overlap extension PCR that combines FCV amplicons to generate full length FCV DNA template.

PCR mix		PCR program
Mix components	Volumes (µL)	Step	Time	Temperature (0C)
NF water	29.0
5X PCR buffer	10.0	Initial denaturation	30 sec	98.0
dNTP mix (10mM)	1.0	Number of cycles: 35
F primer (none)	-	Start of cycle
R primer (none)	-	Denaturation	10 sec	98.0
DMSO (final conc. 9%)	4.5	Annealing	-	-
Polymerase	0.5	Extension	3 min	72.0
Template (cDNA)	5.0	End of cycle
		Final extension	5 min	72.0
Final volume	50.0	Storage	indefinitely	4.0

Table 7 PCR conditions to amplify full length FCV DNA from cDNA and add a 5' T7 promoter and 3' polyA tract.

PCR mix		PCR program
Mix components	Volumes (µL)	Step	Time	Temperature (0C)
NF water	34.0
5X PCR buffer	10.0	Initial denaturation	30 sec	98.0
dNTP mix (10mM)	1.0	Number of cycles: 35
F primer, SEQ ID 1 (10µM)	1.0	Start of cycle
R primer, SEQ ID 2 (10µM)	1.0	Denaturation	10 sec	98.0
DMSO (final conc. 3%)	1.5	Annealing	30 sec	51.0
Polymerase	0.5	Extension	4 min	72.0
Template (cDNA)	1.0	End of cycle
		Final extension	5 min	72.0
Final volume	50.0	Storage	indefinitely	4.0

Table 8 PCR conditions to amplify full length FCV DNA from overlap extension PCR template material and add a 5' T7 promoter and 3' polyA tract.

PCR mix		PCR program
Mix components	Volumes (µL)	Step	Time	Temperature (0C)
NF water	31.0
5X PCR buffer	10.0	Initial denaturation	30 sec	98.0
dNTP mix (10mM)	1.0	Number of cycles: 35
F primer, SEQ ID 3 (10µM)	1.0	Start of cycle
R primer, SEQ ID 4 (10µM)	1.0	Denaturation	10 sec	98.0
DMSO (final conc. 9%)	4.5	Annealing	-	-
Polymerase	0.5	Extension	3 min	72.0
Template (cDNA)	1.0	End of cycle
		Final extension	5 min	72.0
Final volume	50.0	Storage	indefinitely	4.0

2. Preparation of Myxo-Kalem Crouch construct

[0119] The pMCPK (processed portion of the major capsid protein of the Kalem Crouch FCV isolate) was cloned using the BamHI and XhoI sites on the p22m-GFP (a derivative of p22-GFP) plasmid MCS (multiple cloning site). See figure 8.

[0120] To avoid adding extra C-terminal AAs (amino acids) to pMCPK, translation from the start codon in the NcoI site of the MCS in p22-GFP was removed by introducing a point mutation (CCATGG->CCATCG, Figure 1). Site directed mutagenesis was used to mutate the p22-GFP plasmid using the following primers:-

p22sdmF: 5'-CATCGATCGATGTCGACGGATCCA-3' SEQ ID NO: 63

p22sdmR: 5'-GTGCATCCGTCGACATCGATCGATG-3' SEQ ID NO: 64

PCR program: 30"@98°C,20x[10"@98°C, 10"@58.3°C, 2'@72°C], 5'@72°C, ∞@4°C, and the Phusion polymerase (NEB, cat: M0530L).

[0121] Template p22-GFP plasmid was removed from the reaction with DpnI digestion prior to transformation into XL10 gold E.coli (cat: 200315). Several of the resulting E.Coli colonies were picked to set up miniprep cultures that were screened by digesting the extracted plasmid DNA (QiaPrep Spin Miniprep kit, cat: 27104) with NcoI. On a 1% agarose gel, a unique band corresponding to linearized plasmid indicated successful mutation (as the only remaining NcoI site in the p22m-GFP plasmid is present upstream of the GFP gene). A 342bp fragment, in addition to linearized plasmid after digestion, indicated the presence of two NcoI sites and therefore intact p22-GFP plasmid. Sequencing was subsequently used to confirm the mutation.

[0122] Insert pMCPK was made using PCR, with primers:-

(KApBamHIF:
5'TCGAGGATCCGCCACCATGGCCGATGATGGATCGGTGACAACCCC-3', SEQ ID NO: 65

KpXhoInR:
5'-TCGACTCGAGTCATAATTTAGTCATAGAACTCCTAATATTAGAGGC-3' SEQ ID NO: 66,

which include a start codon in a Kozac sequence at the 5' end of pMCPK. The PCR program used was: 30"@98°C,35x[10"@98°C, 10"@55°C, 40"@72°C], 5'@72°C, ∞@4°C, while the template was cDNA prepared from total RNA isolated from CRFK cells infected with Kalem Crouch FCV. After confirming correct amplicon size on a 1% agarose gel, the insert DNA in the PCR reaction was purified (Qiagen PCR clean-up kit) and digested with BamHI and XhoI parallel with the p22m-GFP plasmid. Upon ligation, this procedure results in the replacement of the GFP insert and 5' and 3' RHDV repeat flanks with pMCPK (Figure 2). The digested insert and plasmid DNA were loaded on a 1% agarose gel and bands of 1664bp (insert) and 4031bp (plasmid backbone) were excised and purified using the StrataPrep DNA Gel extraction kit (cat: 400766). The backbone and insert were ligated overnight at 4°C, and 2uL of this ligation was subsequently transformed into XL10 gold E.coli (cat: 200315). Miniprep cultures were set up and the extracted DNA was screened by digesting with both BamHI and XhoI. The identity of the insert was confirmed using the same PCR reaction that generated the pMCPK insert (see above), and subsequently sequencing. Construct p22m-4a was chosen for use in subsequent steps.

[0123] 50uL of MR24 material diluted in 1mL M6B8 + 5% FBS media was applied to a 6cm dish with ~80% confluent RK13 cells over 5h prior to washing away all unabsorbed MR-24 virus, supplementing with an additional 3mL of the same media, and transfecting with ~4.5ug of p22m-4a plasmid using Lipofectamine 3000. After ~17h, part of the cells were harvested by gentle scraping and saved together with the media. The remaining half of cells on the plate were fixed (100% EtOH), and stained for immunofluoresence with FCV-antisera followed by with FITC-labelled anti-cat antibody, to confirm expression of pMCPK. Stained cells indicated enhanced pMCPK expression and the possible recombination between p22m-4a and MR-24 to give MR-24-Kalem Crouch, since control cells transfected with p22m-4a alone, or infected with MR-24 alone, did not stain (see Figure 10 for a diagram of the recombinant MR24-Kalem Crouch virus).

[0124] Enrichment of MR-24-Kalem Crouch recombinant myxoma virus was carried out through successive rounds of titration, immunofluoresence detection of expressed pMCPK, and dilution of enriched samples. Briefly, a series of 96-well tissue culture dishes seeded with RK-13 cells were infected with virus from the infection/transfection at a range of dilutions. After 3 days, all the 96-well dishes were frozen and retained as the first round stocks. A second series of RK-13 seeded 96-well dishes were then infected with material from the first round stocks (5-10 µl from each well). After 2-3 days these duplicate dishes were fixed with ice cold methanol and stained first with a cat anti-FCV polyclonal antiserum and then a goat anti-feline IgG FITC labelled second antibody. Wells containing fluorescing foci of infection were identified and the corresponding wells on the first round stock dishes taken, then diluted and used to infect a second series of 96-well dishes, which became the second round stocks. This procedure was repeated until virus stocks contained majority recombinant virus. The final purification was achieved by three rounds of single focus isolation. The three best staining clones (i.e. B8, A9, and A10) were expanded, and clone A9 was used to in further experiments to determine clonal purity (i.e. lack of wild-type MR24 growing in the background) and insert (i.e. pMCPK) sequence stability. MR24-Kalem Crouch was passed 5 times in RK13 cells by inoculating each time at 0.001 MOI.

[0125] To determine the stability of the pMCPK insert, MR24-Kalem Crouch DNA from pass 1 and MR24-Kalem Crouch DNA from pass 5 were compared. No mutations were detected in either p22m-4a vs MR24-Kalem Crouch-passl, or MR24-Kalem Crouch-pass1 vs MR-24-Kalem Crouch-pass5, indicating that the pMCPK in p22m-4a recombined successfully with MR24 and remained stable over 5 passages of the virus.

[0126] Taken together, these experiments show that the processed major capsid protein of FCV Kalem Crouch (pMCPK) has been inserted into, and is expressed from, the MGF site of the MR24-Kalem Crouch clone A9.

Results

1. Isolation and growth of FCV Kalem Crouch

[0127] Feline Calicivirus (FCV) strain Kalem Crouch was isolated from a swab taken during an FCV outbreak in Jersey in December 2010. The swab originated from a neutered male, 2 years 6 months, named Kalem Crouch and was collected by New Era Veterinary Surgery, St Saviour, Jersey. The swab was vortexed briefly and the virus suspension inoculated onto confluent CrFK cells and incubated at 37°C with 5% CO₂ until CPE specific to FCV was observed. The infected flask was freeze thawed to lyse cells, clarified to remove cellular debris and stored at -70°C. The titer of the virus was 10^6.91 TCID₅₀/ml.

[0128] The nucleotide sequence of the isolate was determined. The sequence is annotated in SEQ ID NO: 60.

[0129] The amino acid sequence of the capsid protein was aligned with other FCV sequences available in the public domain. The sequence alignment is annotated in figure 5 and 7.

2. Generating recombinant FCV virus

2.1. Preparation of FCV amplicons

[0130] FCV F9 or Kalem Crouch cDNA, made as described in methods section 5, was used as template in PCR reactions with the Phusion polymerase (NEB, Ipswich, MA), oligonucleotide primer pair FKP1F (SEQ ID NO: 9) and FKP1R (SEQ ID NO: 10), and the conditions described in Table 4 to generate an amplicon covering 5349 bp from the 5' end of FCV genome. Similarly, the oligonucleotide primer pair FKP2F (SEQ ID NO: 11) and FKP2R (SEQ ID NO: 12) and the PCR conditions described in Table 5 were used to generate amplicons covering 2422 bp from the 3' end of FCV F9 and 2416 bp from the 3' end of FCV Kalem Crouch. These amplicons and 5µL of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, MA) were resolved by carrying out electrophoresis in 1 x TBE buffer (Sigma-Aldrich, St. Louis, MO) at 120V over 1h. Bands of the expected size are shown in Figure 1.

2.2. Assembly of FCV amplicons using overlap extension PCR

[0131] The FCV amplicons generated in results section 2 were purified using the QIAquick^® PCR Purification Kit (Qiagen, Hilden, Germany). These amplicons were used to make hybrid viruses: Hybrid virus FK comprises the Kalem Crouch capsid in the F9 background and hybrid virus KF comprises the F9 capsid in the Kalem Crouch background.

[0132] To make FCV FK and KF template DNA, equimolar mixtures containing between 0.1 and 0.5 pmol of each amplicon were made with either FCV F9 5' end and FCV Kalem Crouch 3' end amplicons, or FCV Kalem Crouch 5' end and FCV F9 3' end amplicons. These mixtures were used as templates in overlap extension PCR reactions with conditions described in Table 6. The expected sizes of the assembled FK and KF DNA amplicons were 7685 and 7702 bp respectively. The assembled DNA in these samples and 5µL of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, MA) were resolved by carrying out electrophoresis in 1 x TBE buffer (Sigma-Aldrich, St. Louis, MO) at 120V over 1h. The resulting assembled DNA of F9, Kalem Crouch, FK, and KF is shown in Figure 2.

2.3. Generation of infectious FCV virus

[0133] Infectious FCV FK or KF DNA was made using the Phusion polymerase (NEB, Ipswich, MA) and the oligonucleotide primer pair FCVT7f (SEQ ID NO: 3) and FCVpAr (SEQ ID NO: 4) with the PCR conditions described in Table 8. The expected sizes of infectious FCV FK and KF DNA are 7728 and 7737 bp respectively. The infectious FCV DNA in these samples and 5µL of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, MA) were resolved by carrying out electrophoresis in 1 x TBE buffer (Sigma-Aldrich, St. Louis, MO) at 120V over 1h. The full length infectious DNA of FK and KF is shown in Figure 3 parts A and B respectively.

2.4. Recovery of infectious FCV virus

[0134] Infectious FCV FK and KF DNA was purified from full-length the full length PCR reactions using the QIAquick^® PCR Purification Kit (Qiagen, Hilden, Germany), and transfected onto 50-90% confluent BsRT7 cells growing on a 24-well plate using the Invitrogen^® Lipofectamine^® 3000 Reagent (Carlsbad, CA) as described in methods section 13. Transfected BsRT7 cells were incubated with transfection complexes under normal growth conditions for 24-72 h prior to lysis by freeze-thawing. BsRT7 lysate from each well was then applied to a well growing CrFK cells to confluency between 50 and 100%. CrFK cells grown in the presence of BsRT7 cell lysate were incubated under normal growth conditions, as described in methods section 1. The presence of a virus was typically detected by the formation of plaques in the monolayer of CrFK cells, similar to those shown in Figure 4.

2.5. Sequence of FCV FK and KF viruses.

[0135] The recombinant FCV viruses were sequenced.

[0136] These sequences have been compared with the sequences of FCV F9 and Kalem Crouch in figure 6. The recombinant FK virus is denoted SEQ ID NO: 61 and comprises the Kalem Crouch capsid. The recombinant KF virus is denoted SEQ ID NO: 62 and comprises the F9 capsid.

2.6 Efficacy of Myxo-Kalem Crouch construct in cats

Experimental design:

[0137] Fifteen domestic short hair cats between 8-11 weeks of age were divided into two groups. A group of 10 cats vaccinated subcutaneously, twice, three weeks apart with recombinant Myxo-Kalem Crouch construct described above (pass 5) (10^6.23 TCID₅₀ per dose) and a group of 5 control cats. Four weeks post second vaccination, cats were swabbed and two of the control unvaccinated cats were challenged intra-nasally with virulent FCV strain Kalem Crouch (10^4.0 TCID₅₀ per cat) and mixed with the rest of the cats for contact challenge. All cats were swabbed daily from day 1 post challenge to day 17 post challenge. Clinical observations, including body weights and temperatures were recorded. The clinical findings were scored as below, see table 8. (An anti-pyretic was administered to alleviate the pyrexia and suffering. In a previous experiment, it was proved that administration of an antipyretic had no effect on virus excretion)

Table 8: Overview of scoring of clinical sign

Clinical sign	Score
Mild malaise (MA+)	1
Pronounced malaise (Ma++)	2
Ulcers present (regardless of number or size)	1
Lameness/limping (regardless of number of affected lin	2
Virus shedding	1
Pyrexia (temperature above ≥39.5°C)	1
Antipyretic administered to alleviate pyrexia and suffer (administered when temperature is above 40°C)	10 (per administration)
Weight loss compared to previous day	1

Results:

[0138] Cats were devoid of antibodies prior to vaccination (Day -1). A strong sero-conversion was not observed in cats post vaccination (Day 48). A strong sero-conversion was observed in cats post challenge (Day 66).

Table 9: Titer of antibodies

		F9-specific virus neutralising antibodies			Kalem Crouch-specific virus neutralising antibodies
Cat Id	Group	Day -1	Day 48	Day 66	Day -1	Day 48	Day 66
6346	1	≤ 4	≤ 4	170	≤ 4	≤ 4	256
7229	1	≤ 4	≤ 4	102	≤ 4	≤ 4	386
4297	1	≤ 4	13	323	≤ 4	≤ 4	406
5530	1	≤ 4	16	412	≤ 4	≤ 4	4871
8817	1	≤ 5	≤ 6	1176	≤ 4	≤ 4	256
9449	1	≤ 4	≤ 4	61	≤ 4	≤ 4	406
6644	1	≤ 4	≤ 4	82	≤ 4	≤ 4	215
0498	1	≤ 5	≤ 4	128	≤ 4	≤ 4	724
0566	1	≤ 4	≤ 4	395	≤ 4	≤ 4	304
6622	1	≤ 4	≤ 4	64	≤ 4	≤ 4	64
2987	2	≤ 4	≤ 4	62	≤ 4	≤ 4	4096
6446	2	≤ 4	≤ 4	181	≤ 4	≤ 4	329
3854	2	≤ 4	≤ 4	1080	≤ 4	≤ 4	5270
8741	2	≤ 5	≤ 4	304	≤ 4	≤ 4	724
5139	2	≤ 5	≤ 4	512	≤ 4	≤ 4	1337

[0139] Virus could not be isolated from the cats at the beginning of the experiment or on the day prior to challenge Virus could be isolated from all cats of groups 1 and 2, clinical signs associated with FCV were observed in cats belonging to both groups indicating a substantial challenge.

Table 10: Clinical scores

Cat Identity	Group / Treatment	Pyrexia score	Antipyretic score	Clinical score	Body weight	Days virus excreted	Total
9449	1 Vaccinated	1	0	16	6	8	31
8817		0	0	10	6	15	31
0498		6	10	17	4	13	50
4297		0	0	11	6	14	31
6346		0	0	10	5	13	28
0566		3	0	11	6	14	34
6644		1	0	12	4	14	31
5530		10	20	13	6	12	61
6622		1	0	12	2	16	31
7229		0	0	9	4	10	23
2987	2 Challenge control	8	10	10	6	13	47
6446		5	10	16	4	14	49
3854		11	20	19	7	10	67
5139		4	10	14	3	10	41
8741		7	0	14	5	16	42

Table 11: clinical signs per group:

Group	Pyrexia score		Antipyretic score		Clinical score
	Mean	Median	Mean	Median	Mean	Median
1	2.20	1.00	3.00	0.00	12.10	11.50
2	7.0	7.0	10.00	10.00	14.60	14.00

	Body weight		Days virus excreted		Total score
	Mean	Median	Mean	Median	Mean	Median
1	4.90	5.50	12.90	13.50	35.10	31.00
2	5.00	5.00	12.6	13.0	49.20	47.00

[0140] A Kruskal-Wallis non parametric test on the data showed statistically significant difference between the vaccinated cats and control cats for total score (P = 0.037) and pyrexia score (P = 0.020) indicating that the Myxo-Kalem Crouch construct was able to induce immunity against FCV challenge infection (reduction in the clinical scores in cats post challenge).

Experimental design

2.7 Study to raise hyperimmune serum to FK and KF hybrid viruses of FCV.

[0141] The study comprised six domestic short haired cats between 229 and 432 days of age. These were split into two groups of 3 cats with a relatively even split of toms between groups. Each group was housed separately After acclimatization, cats belonging to group 1 were inoculated subcutaneously with 10^4.6 TCID₅₀/dose of FCV strain FK. Cats belonging to group 2 were inoculated subcutaneously with 10^4.6 TCID₅₀/dose of FCV strain KF.

[0142] All cats then received a second dose of the same virus at 10⁵ TCID₅₀/dose intranasally two weeks later (day 14). Serum was collected three weeks post second inoculation.

[0143] Serum was heat inactivated and a virus neutralisation test carried out. Virus neutralisation was assessed by a reduction of virus-induced cytopathic effect (CPE) on CrFK cells. Five-fold replicates of 32-316 TCID₅₀ of virus were mixed with an equal volume of serial dilutions of sera (commencing at 1:4). Virus/sera mixtures were then incubated for at least 60min at 37°C. 100 µl of the virus-serum mixtures were then added to 96-well tissue culture dishes seeded with CrFK cells in 100 µl growth medium. Incubation was continued for 5 days. The VN titer is expressed as the inverse of the highest serum dilution at which virus-induced CPE was completely absent.

Results

[0144] 

Table 12: VN titers post first inoculation (s.c.)

Vaccine	Cat number	Anti F9	Anti Kalem Crouch	Anti KF	Anti FK
FK	8086	≥39	>64	NT	>64
	7978	16	>64	NT	>64
	5466	≤6	≤6	NT	≤6
KF	2274	23	≤6	>64	NT
	9915	46	≤6	>64	NT
	8394	23	≤6	>64	NT

NT: Not Tested

Table 13: VN titers post second inoculation (i.n.)

vaccine	Cat number	Anti F9	Anti Kalem Crouch	Anti KF	Anti FK
FK	8086	56	724	2896	16394
	7978	21	215	334	2580
	5466	64	645	1625	19484
KF	2274	54	≤6	1505	≤ 5
	9915	1024	≤6	50935	73
	8394	512	≤6	50935	40

[0145] The data shows that recombinant viruses FK and KF are immunogenic in cats. The antibodies developed in the cats were functional (neutralizing). The cross reactivity of the antibodies showed a hierarchy similar to the hierarchy observed between FCV strain F9 and FCV strain Kalem Crouch such that inoculation of cats with hybrid strain KF (F9 capsid) induced virus neutralising antibodies against strains F9 but not against strain Kalem Crouch whilst inoculation with hybrid strain FK (Kalem Crouch capsid) resulted in the induction of virus neutralising antibodies against both strains F9 and Kalem Crouch.

2.8 Neutralisation index

[0146] Hyper-immune sera raised in cats to strains FCV F9 and Kalem Crouch were used to determine the neutralisation index of the recombinant FCV strains FK and KF. The data is shown in table 7.

[0147] It becomes clear from the table that FCV strain FK is indeed neutralized strongly by anti-FCV Kalem Crouch hyperimmune serum whereas FCV strain KF is indeed neutralized strongly by anti-FCV F9 hyperimmune serum.

Table 14 Neutralising Index of the FCV F9 and Kalem Crouch anti-sera to recombinant FCV FK and KF.

FCV sample	Neutralising ability of anti-FCV F9 hyperimmune serum	Neutralising ability of anti-FCV Kalem Crouch hyperimmune serum	Virus titre (log10/ml)
FCV FK hybrid	0.34	6.67	6.67
FCV KF hybrid	3.33	2.67	7
FCV F9 X+2	3.17	1.83	7.5
FCV Kalem Crouch #4063	1	5.5	5.5

[0148] Table 14 and the data obtained from sera generated from FK and KF inoculated cats (Table 13) demonstrate that there is a one way hierarchy to virus neutralisation. F9 and KF (F9 capsid) antisera do not neutralise Kalem Crouch or FK (Kalem Crouch capsid) viruses efficiently while the serum from cats vaccinated with Kalem Crouch and FK (Calem Crouch capsid) neutralise self and also neutralise F9 and KF (F9 capsid) viruses significantly.

Claims

1. A feline calicivirus (FCV) capsid protein having a sequence identity of at least 90% with the amino acid sequence as given in SEQ ID NO: 34 and that comprises at least one of the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, I525, S546, S635, F636, or P637.

2. A feline calicivirus (FCV) capsid protein according to claim 1 wherein the capsid protein comprises the following amino acids K90, M91, M101, 1318, L391, A392, V393, Q397, S398, K399, N405, T427, T432, S439, S440, D441, E446, K448, L449, E452, N453, G485, G490, 1492, N517, S518, E519, 1525, S546, S635, F636, and P637.

3. A live attenuated FCV comprising a capsid protein according to claim 1 or 2.

4. A DNA fragment characterised in that it comprises a region encoding a capsid protein according to claim 1 or 2.

5. A DNA fragment according to claim 4, characterised in that the region encoding the capsid protein is placed under the control of a suitable promoter.

6. A live attenuated recombinant carrier virus (LARCV), characterised in that said carrier virus comprises a region encoding a feline calicivirus (FCV) capsid protein according to claim 1 or 2, under the control of a suitable promoter.

7. A live attenuated recombinant carrier virus according to claim 6, characterised in that the LRCV is a myxomavirus or a Feline Herpesvirus.

8. A live attenuated recombinant carrier virus according to claim 6 or 7, for use in the protection of felines against FCV.

9. A live attenuated hybrid FCV, characterised in that said FCV comprises an open reading frame 2 (ORF2) encoding a capsid protein according to claim 1 or 2 or a DNA fragment according to claim 4 and comprises an open reading frame 1 (ORF1) from an attenuated FCV.

10. A live attenuated hybrid FCV according to claim 9, characterised in that said FCV comprises an ORF1 from FCV strain F9.

11. A live attenuated hybrid FCV according to claim 9 or 10, for use in the protection of felines against FCV.

12. A cell culture comprising a live attenuated FCV according to claim 3, a LARCV according to claims 6 or 7, or a live attenuated hybrid FCV according to claim 9 or 10.

13. A vaccine for the protection of felines against FCV, characterised in that said vaccine comprises a live attenuated FCV according to claim 3 and/or a live recombinant carrier virus according to claim 6 or 7 and/or a live attenuated hybrid FCV according to claim 9 or 10, and a pharmaceutically acceptable carrier.

14. A vaccine according to claim 13, characterized in that said vaccine comprises at least one other feline-pathogenic microorganism or feline-pathogenic virus and/or at least one other immunogenic component and/or genetic material encoding said other immunogenic component of said feline-pathogenic microorganism or feline-pathogenic virus, preferably wherein said at least one other feline-pathogenic microorganism or feline-pathogenic virus is selected from the group consisting of feline panleucopenia virus, Chlamydia psittaci, Bordetella bronchiseptica, feline parvovirus, rabies virus and feline herpes virus.

15. Method for obtaining a live attenuated hybrid FCV according to claim 9 comprising the steps of:

a. Preparation of a first FCV amplicon comprising the full ORF1 region and an adjacent 5'-part of the ORF2 region of an attenuated FCV,

b. Preparation of a second FCV amplicon comprising a 3'-part of the ORF1 region and the full adjacent ORF2//ORF3 region wherein the ORF2 is an ORF2 encoding an FCV capsid protein according to claim 1 or 2,

c. Assembly of the first and second amplicon using overlap extension,

d. Generation of infectious FCV,

e. Infection of susceptible cells with the infectious FCV,

f. Recovery of infectious progeny FCV.

Drawing