PROCESS FOR THE MANUFACTURE OF OLIGONUCLEOTIDES

Description

[0001] The present invention relates to a process for the manufacture of oligonucleotides. Oligonucleotides and derivatives thereof are useful candidate drugs, for example, for cancer therapy.

[0002] The β-cyanoethyl protective group is commonly used as phosphorus protective group during synthesis of oligonucleotides in particular via the phosphoramidite approach. The deprotection of the cyanoethyl groups is one step in order to accede to the final product.

[0003] US patents 6,858,715 and 7,199,236 describe a process for deprotection of β-cyanoethyl protective groups wherein an amine, the conjugate acid of which has a pKa of from about 8 to about 11 must be used.
Eritja et al. Helv. Chim. Acta, Vol 83 (2000) p.1417-1423 disclose deprotection of β-cyanoethyl protected oligonucleotides with a 0.5M concentrated DBU solution in acetonitrile.

[0004] It has now been found, surprisingly, that even a strong base the conjugate acid of which has a pKa of greater than 11.5, for example, of about 12, may be used under certain conditions to bring about substantially complete deprotection e.g. of β-cyanoethyl protective group while substantially avoiding formation of cyanoethyl adducts to nucleobases, in particular thymidine.

[0005] The invention concerns in consequence a process for manufacturing an oligonucleotide which comprises removing β-cyanoethyl protective groups from a protected oligonucleotide attached to a solid support, wherein said removing comprises contacting the protected oligonucleotide in a column having inlet and outlet openings with from 2 to 60 column volumes of a solution of 1,8-Diazabicyclo[5.4.0]undec-7-ene (DBU) in a solvent which comprises or consists essentially of a halogenated compound or a cyanoalkyl compound, and wherein the concentration of the DBU in the solution is less than 0.5 mole/liter.

[0006] It has been found, surprisingly, that the process according to the invention allows for particularly efficient deprotection of β-cyanoethyl protectedoligonucleotides, with high selectivity and yield. Undesirable side-reactions during deprotection can be substantially avoided.

[0007] The concentration of the amine in the solution is higher than 0 mole/liter. It is preferably equal to or higher than 0.03 moles/liter. The concentration of the amine in the solution is often lower than or equal to 0.4, preferably lower than or equal to 0.3 moles/liter, more preferably, lower than or equal to 0.25 moles/liter. Such preferred concentration can be, for example lower than or equal to 0.15 moles/liter or lower than or equal to 0.1 moles/liter. An amine concentration of about 0.05 moles/liter gives good results.

[0008] The total amount of the amine which is contacted with the protected oligonucleotide can vary. In one embodiment this amount is such that the molar ratio between the amine and the β-cyanoethyl protective groups which are to be removed is equal to or greater than 1.

[0009] In another embodiment this amount is such that the total amount of amine which is contacted with the protected oligonucleotide is such that the molar ratio between the amine and the β-cyanoethyl protective groups which are to be removed is equal to or greater than 0.01 and equal to or lower than 0.9, preferably about 0.1.

[0010] The term "oligonucleotide", in the frame of the present invention, denotes in particular an oligomer of nucleoside monomeric units comprising sugar units connected to nucleobases, said nucleoside monomeric units being connected by intemucleotide bonds. An "internucleotide bond" refers in particular to a chemical linkage between two nucleoside moieties, such as the phosphodiester linkage typically present in nucleic acids found in nature, or other linkages typically present in synthetic nucleic acids and nucleic acid analogues. Such internucleotide bond may for example include a phospho or phosphite group, and may include linkages where one or more oxygen atoms of the phospho or phosphite group are either modified with a substituent or replaced with another atom, e.g., a sulfur atom, or the nitrogen atom of a mono- or di-alkyl amino group. Typical internucleotide bonds are diesters of phosphoric acid or its derivatives, for example phosphates, thiophosphates, dithiophosphate, phosphoramidates, thio phosphoramidates.

[0011] The term "nucleoside" is understood to denote in particular a compound consisting of a nucleobase connected to a sugar. Sugars include, but are not limited to, furanose ring such as ribose, 2'-deoxyribose and non-furanose ring such as cyclohexenyl, anhydrohexitol, morpholino. The modifications, substitutions and positions indicated hereinafter of the sugar included in the nucleoside are discussed with reference to a furanose ring, but the same modifications and positions also apply to analogous positions of other sugar rings. The sugar may be additionally modified. As non limitative examples of the modifications of the sugar mention can be notably made of modifications at e.g. the 2'-or 3'-position, in particular 2'-position of a furanosyl sugar ring including for instance hydrogen; hydroxy; alkoxy such as methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy, phenoxy; azido; amino; alkylamino; fluoro; chloro and bromo; 2'-4'- and 3'-4'-linked furanosyl sugar ring modifications, modifications in the furanosyl sugar ring including for instance substitutions for ring 4'-O by S, CH₂, NR, CHF or CF₂.

[0012] The term "nucleobase" is understood to denote in particular a nitrogen-containing heterocyclic moiety capable of pairing with a, in particular complementary, nucleobase or nucleobase analog. Typical nucleobases are the naturally occurring nucleobases including the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U), and modified nucleobases including other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Other potentially suitable bases include universal bases, hydrophobic bases, promiscuous bases and size-expanded bases.

[0013] In the process according to the invention, the solvent often comprises a halogenated compound, such as a chloroalkane comprising 1 or 2 carbon atoms such as methylene chloride or 1,2-dichloroethane. Methylene chloride is preferred as chloro solvent.

[0014] A solvent comprising a cyanoalkyl compound is preferred. Acetonitrile is preferred as cyanoalkyl compound.

[0015] A solvent consisting essentially of aforesaid compounds is preferred. More particularly, the solvent consists preferably of acetonitrile.

[0016] Internucleotide bond protected by certain β-eliminating phosphorus- protecting groups (Rt) used in the present invention may be represented in the following formula I

wherein each X and Y are independently O, S or NR;

wherein R_t is -CH₂-CH₂-C≡N

[0017] In certain embodiments of the process according to the invention, the protected oligonucleotide is contacted with the amine for a reaction time of at least 200 minutes. The reaction time is preferably from 240 to 600 minutes, and more preferably from 300 to 400 minutes. A reaction time of about 360 minutes has given good results.

[0018] Reaction time is typically understood to denote the period of time during which the protected oligonucleotide is contacted with the amine solution.

[0019] In another, preferred embodiment, the reaction time is less than 200 min., typically less than or equal to 100 minutes, more preferably less than or equal to 30 minutes. A reaction time equal to or less than 20 minutes is more particularly preferred, a reaction time equal to or less than 15 minutes is most particularly preferred. In this preferred embodiment, the reaction time is typically more than or equal to 3 minutes, more preferably more than or equal to 6 minutes.

[0020] It has been found, surprisingly, that it is possible to achieve very efficient deprotection also with low reaction times.

[0021] In the different embodiments of the process according to the invention, the removal is generally carried out at a temperature of from 0 to 80°C preferably from 10 to 60°C. A temperature of about 20 to 30°C has given good results.

[0022] In the process according to the invention, the protected oligonucleotide can be obtained for example by solution-phase or, preferably, solid phase coupling of protected nucleotides. Coupling techniques providing protected oligonucleotides as described above are known per se.

[0023] In the different embodiments of the process according to the invention, the protected oligonucleotide is preferably attached to a solid support. "Solid support" denotes in particular any particle, bead, or surface upon which synthesis of an oligonucleotide occurs. Solid supports which can be used in the different embodiments of the process according to the invention are selected for example from inorganic supports and organic supports. Inorganic supports are preferably selected from silica gel and controlled pore glass (CPG). Organic supports are preferably selected from highly crosslinked polystyrene, Tentagel (grafted copolymers consisting of a low crosslinked polystyrene matrix on which polyethylene glycol (PEG or POE) is grafted), polyvinylacetate (PVA), Poros-a copolymer of polystyrene/divinyl benzene, aminopolyethyleneglycol and cellulose. The solid support is more preferably selected from highly crosslinked polystyrene. The protected oligonucleotide can be attached to the solid support by means of a linkage. Linkages are known in the art as chemical moieties comprising a covalent bond or a chain of atoms that covalently attach a solid support to a nucleoside, nucleotide or oligonucleotide. Commercially available are so called "standard solid supports" carrying a nucleoside that has been pre-attached via a linker. This nucleoside will become the 3'- or 5'- terminal residue of the final oligonucleotide after the cleavage and deprotection step. Suitable linkers which can be used in this embodiment of the invention are for example succinyl, carbonate, carbamate. The succinyl linker is most preferred. The Standard solid supports do carry the 3'- or 5'- terminal nucleoside.

[0024] Solid supports without the 3'- or 5'- nucleoside pre-attached, namely the "universal" solid supports are also known in the art and commercially available. Those supports do not have the intended 3'- or 5'- terminal nucleoside attached. Rather, the corresponding terminal nucleoside or residue is added in the first cycle, generating an undesired phosphate or thiophosphate linkage between this nucleoside and the universal support. This approach requires that the undesired phosphate or thiophosphate linkage to be removed during the cleavage and/or deprotection step. Typical examples of the "universal" solid support are shown in scheme 1.

Universal Support Type 1

[0025] 

Universal Support Type 2

[0026] It has been found, surprisingly, that the process according to the invention allows for selectively deprotecting phosphorus protecting groups without cleaving the oligonucleotide from the support.

[0027] In the process of the invention, the solid support containing the protected oligonucleotide is contained in a column having inlet and outlet openings. According to this embodiment, the amine is contacted with the protected oligonucleotide by passing the amine solution through the said column. Preferably, the process is automated using a commercially available automated synthesizer, programmed to deliver the amine in a solvent through one of the delivery lines of the synthesizer.

[0028] The amine solution is passed through the column in an amount of 2 to 60 column volumes, most preferably in an amount of at least 5 column volumes to at most 60 column volumes.

[0029] In a particular embodiment, the process according to the invention comprises the following steps

(a) a protected oligonucleotide attached to a solid support is synthesized by solid-phase coupling technique;

(b) the protected olignucleotide is subjected to deprotection of the phosphorus protecting groups as described herein;

(c) the oligonucleotide attached to the support is optionally treated to reduce its amine content;

(d) the oligonucleotide is cleaved from the support.

[0030] Step (c) can be for example a washing operation, for example with the solvents described herein, in particular acetonitrile.
Step (d) is suitably selected from a treatment with a protic base solution or a nucleophilic base solution. Examples of suitable bases are selected from aqueous ammonia, methylamine and ammonia/methylamine mixtures.

[0031] In the process according to the invention, the amine used is DBU (1,8-diazabicyclo[5.4.0]undec-7-ene).

[0032] In a most preferred embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU, preferably in a concentration as described above in a solvent comprising acetonitrile. In this embodiment, the reaction time is preferably as described above.

[0033] The different embodiments of the process according to the invention can be applied, for example, to the synthesis of oligonucleotides selected from DNA, RNA, BNA, UNA and derivatives thereof. LNA, ENA are typical examples of BNA. Examples of certain oligonucleotides can be defined as in the formula in col .2 1.1- col. 3 1.15 of US 6,456,628.

[0034] DNA denotes in particular a polymer of deoxyribonucleic acid units, RNA denotes in particular a polymer of ribonucleic acid units, BNA's denotes in particular a polymer of bicyclic nucleic acids, LNA denotes in particular a polymer of locked nucleic acid units, ENA denotes in particular a polymer of 2'-O,4'-C-ethylene bridged nucleic acid and UNA's denotes in particular a polymer of unlocked nucleic acids.

[0035] As other non limitative examples of naturally occurring nucleobases useful in the present invention, can be mentioned adenine, guanine, cytosine, uracil, and thymine. As non limitative examples of non-naturally occurring and rare naturally occurring nucleobases can be mentioned xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halo uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo uracil), 4-thiouracil, 8-halo, oxa, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine.

[0036] Suitable nucleobase protecting groups are known to persons skilled in the art such as benzoyl, isobutyryl, acetyl, phenoxyacetyl, aryloxyacetyl, phthaloyl, 2-(4-nitro-phenyl)ethyl, pent-4-enoyl, dimethylformamidine (dmf), dialkylformamidine, and dialkylacetamidine.

[0037] Suitable 5'-hydroxyl protection groups include, but are not limited to trityl groups, preferably a dimethoxytrityl group (DMTr) or a monomethoxytrityl group (MMTr). Other suitable 5'-protection groups include, but are not limited to tert-butyl dimethylsilyl (TBDMS), levulinyl, benzoyl, fluorenemethoxycarbonyl (FMOC), 9-phenylthioxanthen-9-yl (S-pixyl).

[0038] Suitable 2'-protecting groups used in RNA synthesis include, but are not limited to 2'-O-protecting groups: tert-butyl dimethylsilyl (TBDMS), 9-phenylxanthen-9-yl (Px), 9-phenylthioxanthen-9-yl (SPx), 1- [(2-chloro-4methyl)pheny]-4-methoxypiperidin-4-yl (Ctmp), 1- (2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp), [2-(methylthio)phenyl]thiomethyl (MTPM), bis-(Acetoxyethyloxy)methylester (ACE), (1-methyl-l-methoxyethyl)(MME),methoxy(ethoxymethyl( MEM), p-nitrophenylethylsylfonyl (NPES), p-cyanophenylethylsylfonyl (CPES), carbomethoxyethylsulfonyl (CEMS), TriisopropylsilylOxyMethyl (TOM) and 2' silyl-containing thiocarbonate protecting group.

[0039] In the process according to the invention, the protected oligonucleotide generally contains β-cyanoethyl protected phosphate and/or β-cyanoethyl protected phosphorthioate and/or β-cyanoethyl protected phosphordithioate and/or β-cyanoethyl protected phosphoramidate and/or β- cyanoethyl protected thiophosphoramidate bonds

[0040] In the preferred different embodiments of the process according to the invention, the protected oligonucleotide generally contains β-cyanoethyl protected phosphate and/or β-cyanoethyl protected phosphorthioate bonds.

[0041] In the following, some especially preferred specific embodiments of the process of the present invention are given.

[0042] In another specific embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above wherein the oligonucleotide is RNA and is attached to a solid support. The RNA is preferably 2'-0-TBDMS or 2'-O-alkyl RNA. The solvent preferably is acetonitrile.

[0043] In still another specific embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above, wherein the oligonucleotide is LNA and is attached to a solid support. The LNA preferably comprises 2'-O,4'- C-methylene-β-D-ribofuranosyl nucleotides. The solvent preferably is acetonitrile.

[0044] In still another specific embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above, wherein the oligonucleotide is BNA and is attached to a solid support. The BNA preferably comprises 2'-O,4' C-bridged nucleotides. The solvent preferably is acetonitrile.

[0045] In still another specific embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above, wherein the oligonucleotide is ENA and is attached to a solid support. The ENA preferably comprises 2'-O,4'- C-ethylene-bridged nucleotides. The solvent preferably is acetonitrile.

[0046] In still another specific embodiment, the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above, wherein the oligonucleotide is UNA and is attached to a solid support. The UNA preferably comprises 2', 3'- seco RNA nucleotides. The solvent preferably is acetonitrile.

[0047] Yet another specific embodiment of the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU a concentration as described above, wherein the oligonucleotide is attached to a solid support, wherein the supported oligonucleotide is present in a column, and the solution of the base is passed through the column. In this embodiment, the solvent preferably is acetonitrile. Preferably, the process is performed while continuously circulating the amine solution through the column.

[0048] A further specific embodiment of the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above, wherein the oligonucleotide is attached to a solid support, as described above, in particular a polystyrene support. The preferred solvent is acetonitrile.

[0049] Another specific embodiment of the invention concerns a process for manufacturing an oligonucleotide which comprises at least a step of removing β-cyanoethyl protective groups from a protected oligonucleotide wherein said removing comprises contacting the protected oligonucleotide with DBU in a concentration as described above wherein the oligonucleotide is attached to a solid support, the oligonucleotide comprises β-cyanoethyl protected groups selected from the group consisting of β-cyanoethyl protected phosphate, β-cyanoethyl protected phosphorthioate, β-cyanoethyl protected phosphordithioate, β-cyanoethyl protected phosphoramidate, β-cyanoethyl protected thiophosphoramidate or 2 or more thereof. The solvent preferably is acetonitrile.

[0050] Advantages of the process of the present invention include effective removal of β-cyanoethyl protective groups. It allows the treatment of oligonucleotides attached to a solid support without causing cleavage of them from the support.

[0051] The examples here after are intended to illustrate the invention without however limiting it.

EXAMPLES

[0052] In these examples and throughout this specification the abbreviations employed are defined as follows:

CNET adduct means N³-cyanoethyl modified thymidine resulting from the reaction with acrylonitrile generated during removal of the 2-cyanoethyl protecting group from the P-centers of the synthesized oligonucleotide, FL35 means Fineline 35 column, CT means contact time, CV means column volumes. Example 1 :

Synthesis of fully modified 5'-d(TCGTCGTTTTGTCGTTTTGTCGTT)-3'

Phosphorothioate 24 -mer

[0053] The synthesis of the above sequence (SEQ ID NO:1) was performed on a AKTA 100 synthesizer using a FL35 column at 3 mmol synthesis scale, using the cyanoethyl phosphoramidites obtained from ChemGenes (and ThermoFisher) and GE Primer support loaded at 200 umoles per gram. At the end of synthesis the terminal 5'-O-protecting group 4,4-dimethoxytrityl (DMTr) was removed while oligonucleotide product was still attached to the solid support, prior to the amine wash. Amine wash was performed using 0.05M solution of DBU (1,8- Diazabicyclo[5.4.0]undec-7-en) in acetonitrile for at least 200 min, using 10- 60 column volumes (CV) of the decyanoethylating reagent. Subsequently, decyanoethylated oligonucleotide product was removed from the synthesis column and treated with concentrated aqueous ammonia (∼30% solution in water) at 55°C for 16-24 hrs and analyzed by analytical ion exchange HPLC and LC/MS (Figures 1 and 2).
Examples 2, 3, 4 and 5: Synthesis of modified 24 mer wherein all intemucleotide bonds are phosphorothioate linkages 5'-d(TCGTCGTTTTGTCGTTTTGTCGTT)-3' (SEQ ID NO:1)

General procedure

[0054] The synthesis of the phosphorothioate of SEQ ID NO:1 was performed on an ÅKTA 100 synthesizer using a FL35 column at 3 mmol synthesis scale using commercially available phosphoramidites and GE Primer support having a loading of 206 µmol/g. At the end of the synthesis on solid support, the terminal 5'-O-4,4-dimethoxytrityl (DMTr) protecting group was removed on column by treatment with dichloroacetic acid. The solid support was then dried and repacked portionwise into 1.2 ml fixed columns (0.05 mmol scale) or 6.3 ml fixed columns (0.25 mmol scale) for a study of decyanoethylations using various concentrations ofDBU (1,8-Diazabicyclo[5.4.0]undec-7-en) solution at various contact times, using various column volumes (CV) of the decyanoethylating reagent. In the comparative example, no contacting with DBU was carried out. Data are summarized in Table 1. For all examples, the decyanoethylated oligonucleotide product was treated with concentrated aqueous ammonia (∼30% wt solution in water) at 55°C for 16 hrs and analyzed by analytical RP-HPLC and LC/MS.

Table 1.

Example	Scale (mmol)	DBU in ACN [M]	CT [min] (a)	Amount in CV (b)	HPLC results	LC MS results
2	0.05	0.05 M	360	60	Figure 3	Figure 4
3 (Comparative)	0.05	-	-	-	Figure 5	Figure 6
4	0.25	0.2 M	15	5	Figure 7	-
5	0.25	0.05 M	360	30	Figure 8	-

(a) CT = contact time; (b) CV = column volumes

[0055] HPLC and LC-MS data are shown in figures 3 and 4. SEQ ID NO:1 is eluting at 27.174 min, the CNET adduct is eluting at 28.464 min. SEQ ID NO:1 has a theoretical MW 7698 Da; the CNET adduct has theoretical MW of 7751 Da.
Examples 6 and 7 : Synthesis of modified 15-mer, wherein all intemucleotide bonds are phosphorothioate linkages 5'-CcA ttG Tca CaC tCC-3' (upper case LNA, lower case DNA) (SEQ ID NO:2)

[0056] The synthesis of the phosphorothioate of the SEQ ID NO:2 was carried out using a FL35 column at 3.6 mmol scale on an Akta 100 synthesizer and using GE Primer support and commercially available phosphoramidite monomers. At the end of the synthesis, the terminal 5'-O- 4,4-dimethoxytrityl (DMTr) protecting group was removed while the oligonucleotide product was still attached to the solid support. The solid support was then dried and repacked portionwise into 1.2 ml fixed columns (0.05 mmol scale) or 6.3 ml fixed columns (0.25 mmol scale) for a study of decyanoethylation using various concentrations of DBU (1,8-Diazabicyclo[5.4.0]undec-7-en) solutions at various contact times, using various column volumes (CV) of the decyanoethylating reagent. In the comparative example, no contacting with DBU was carried out. Data are summarized in Table 2. For all examples, the de-cyanoethylated oligonucleotide product was treated with concentrated aqueous ammonia (∼30% solution in water) at 55°C for 16 hrs and analyzed by analytical RP-HPLC and LC/MS. In LC-MS data are shown in figure 9. SEQ ID NO:2 and the CNET adduct are eluting at the same time. Identification and quantification of both compounds was performed by LC/MS. SEQ ID NO:2 has a theoretical MW of 4967 Da; the CNET adduct has theoretical MW of 5020 Da.

[0057] The decyanoethylation treatments were also extended to the 1 mmol scale with favorable results (data not shown).

Table 2

Example	Scale (mmol)	DBU in ACN [M]	CT [min] (a)	Amount in CV (b)	LC-MS results
					data	SEQ ID NO:2 (c)	CNET adduct (c)
6 (Comparative)	0.05	-	-	-	Figure 9	86.53	4.39
7	0.05	0.03	6	2	Figure 10	88.94	0.16

(a) CT = contact time; (b) CV = column volumes (c) % of the total surface of the peak

Examples 8, 9, 10 and 11 : Synthesis of modified 24 mer wherein all internucleotide bonds are phosphorothioate linkages 5'-d(TCGTCGTTTTGTCGTTTTGTCGTT)-3' (SEQ ID NO:1)

[0058] The synthesis of the phosphorothioate of SEQ ID NO:1 was carried out on two different universal supports (Universal Support Type 1 and 2 (Scheme 1)) using a 6.3 mL fixed column and an Åkta 100 synthesizer and commercially available phosphoramidite monomers at scale of 0.215 and 0.156 mmol, respectively. The use of universal supports necessitates an additional coupling for the incorporation of the first nucleoside at the 3' end. At the end of the synthesis, the terminal 5'-O- 4,4-dimethoxytrityl (DMTr) protecting group was removed while the oligonucleotide product was still attached to the solid support. The support was dried under vacuum and part of the support was repacked into 1.2 mL fixed columns (0.043 & 0.025 mmol scale, respectively) for a study of decyanoethylation using various concentrations of DBU (1,8-Diazabicyclo[5.4.0]undec-7-en) solutions at various contact times, using various column volumes (CV) of the decyanoethylating reagent. In the comparative example, no contacting with DBU was carried out. Data are summarized in Table 3. For all examples, the de-cyanoethylated oligonucleotide product was treated with concentrated aqueous ammonia (∼30% solution in water) according to the condition suggested by the manufacture of the supports and analyzed by analytical RP-HPLC.

Table 3.

Example	Scale (mmol)	Universal support type	DBU in ACN [M]	CT [min] (a)	Amount in CV (b)	HPLC results
8 (Comparative)	0.043	1	-	-	-	Figure 11
9	0.043	1	0.2 M	30	10	Figure 12
10 (Comparative)	0.025	2	-	0	-	Figure 13
11	0.025	2	0.2 M	30	10	Figure 14

(a) CT = contact time; (b) CV = column volumes SEQ ID NO:1 is eluting at 26.388 min, the CNET adduct is eluting at 27.661 min, as shown in figure 11.

The examples show that the process according to the invention allows for efficient and selective deprotection of phosphorus-protecting groups even with very low concentration of base. In particular, formation of undesired CNET adducts can be substantially avoided.

SEQUENCE LISTING

[0059] 

<110> Girindus America Inc

<120> Process for the manufacture of oligonucleotides

<130> GIR 2008/01

<150> US 61/047524
<151> 2008-04-24

<160> 2

<170> PatentIn version 3.3

<210> 1
<211> 24
<212> DNA
<213> artificial sequence

<220> Feature:
<223> Synthetic Sequence

<400> 1
tcgtcgtttt gtcgttttgt cgtt       24

<210> 2
<211> 15
<212> DNA
<213> artificial sequence

<220> Feature:
<223> Synthetic sequence

<220> Feature:
<221> modified_base
<222> (1)..(1)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl cytosine

<220> Feature:
<221> misc_feature
<222> (1)..(1)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified_base
<222> (3)..(3)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl adenosine

<220> Feature:
<221> misc_feature
<222> (3)..(3)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified_base
<222> (6)..(6)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl guanosine

<220> Feature:
<221> misc_feature
<222> (6)..(7)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified base
<222> (7)..(7)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl thymine

<220> Feature:
<221> modified_base
<222> (10)..(10)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl cytosine

<220> Feature:
<221> misc_feature
<222> (10)..(10)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified_base
<222> (12)..(12)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl cytosine

<220> Feature:
<221> misc_feature
<222> (12)..(12)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified_base
<222> (14)..(14)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl cytosine

<220> Feature:
<221> misc_feature
<222> (14)..(15)
<223> n is a, c, g, t or u

<220> Feature:
<221> modified_base
<222> (15)..(15)
<223> 2'-O,4'-C-methylene-beta-D-ribofuranosyl cytosine

<400> 2
ncnttnncan antnn       15

Claims

1. A process for manufacturing an oligonucleotide which comprises removing β-cyanoethyl protective groups from a protected oligonucleotide attached to a solid support, wherein said removing comprises contacting the protected oligonucleotide in a column having inlet and outlet openings with from 2 to 60 column volumes of a solution of 1,8-Diazabicyclo[5.4.0]undec-7-ene (DBU) in a solvent which comprises or consists essentially of a halogenated compound or a cyanoalkyl compound, and wherein the concentration of the DBU in the solution is less than 0.5 mole/liter.

2. The process according to claim 1, wherein the concentration of the amine in the solution is from 0.03 to 0.25 mole/liter.

3. The process according to claim 1 or 2, wherein the solvent comprises or consists essentially of acetonitrile.

4. The process according to any one of claims 1 to 3 wherein the oligonucleotide is contacted with the DBU solution for a reaction time of from 3 to 360 minutes.

5. The process according to claim 4, wherein the reaction time is less than 30 minutes.

6. The process according to any one of claims 1 to 5 wherein the removal is carried out at a temperature of from 10°C to 60°C.

7. The process according to any one of claims 1 to 6 wherein the total amount of DBU which is contacted with the protected oligonucleotide is such that the molar ratio between the DBU and the β-cyanoethyl protective groups which are to be removed is equal to or greater than 1.

8. The process according to any one of claims 1 to 6 wherein the total amount of DBU which is contacted with the protected oligonucleotide is such that the molar ratio between the DBU and the β-cyanoethyl protective groups which are to be removed during deprotection is equal to or greater than 0.01 and equal to or lower than 0.9, preferably about 0.1.

9. The process according to any one of claims 1 to 8 wherein the oligonucleotide is selected from DNA, RNA, BNA, UNA and derivatives thereof.

10. The process according to claim 9 wherein the oligonucleotide is selected from BNA and derivatives thereof.

11. The process according to claim 10 wherein the oligonucleotide is selected from LNA, ENA and derivatives thereof.

Ansprüche

1. Verfahren zum Herstellen eines Oligonukleotids, welches Entfernen von β-Cyanoethyl-Schutzgruppen von einem geschützten Oligonukleotid, gebunden an einen festen Träger, umfasst, wobei das Entfernen Inkontaktbringen des geschützten Oligonukleotids in einer Säule mit Einlass- und Auslassöffnungen mit von 2 bis 60 Säulenvolumina einer Lösung von 1,8-Diazabicyclo[5.4.0]undec-7-en (DBU) in einem Lösungsmittel umfasst, welches eine halogenierte Verbindung oder eine Cyanoalkyl-Verbindung umfasst oder im Wesentlichen daraus besteht und wobei die Konzentration des DBU in der Lösung weniger als 0,5 Mol/Liter beträgt.

2. Verfahren gemäß Anspruch 1, wobei die Konzentration des Amins in der Lösung von 0,03 bis 0,25 Mol/Liter beträgt.

3. Verfahren gemäß Anspruch 1 oder 2, wobei das Lösungsmittel Acetonitril umfasst oder im Wesentlichen daraus besteht.

4. Verfahren gemäß einem der Ansprüche 1 bis 3, wobei das Oligonukleotid für eine Reaktionszeit von 3 bis 360 Minuten in Kontakt mit der DBU-Lösung gebracht wird.

5. Verfahren gemäß Anspruch 4, wobei die Reaktionszeit weniger als 30 Minuten beträgt.

6. Verfahren gemäß einem der Ansprüche 1 bis 5, wobei die Entfernung bei einer Temperatur von 10°C bis 60°C ausgeführt wird.

7. Verfahren gemäß einem der Ansprüche 1 bis 6, wobei die Gesamtmenge von DBU, welche in Kontakt mit dem geschützten Oligonukleotid gebracht wird, derart ist, dass das Molverhältnis zwischen dem DBU und den β-Cyanoethyl-Schutzgruppen, welche entfernt werden sollen, gleich oder größer als 1 ist.

8. Verfahren gemäß einem der Ansprüche 1 bis 6, wobei die Gesamtmenge von DBU, welche in Kontakt mit dem geschützten Oligonukleotid gebracht wird, derart ist, dass das Molverhältnis zwischen dem DBU und den β-Cyanoethyl-Schutzgruppen, welche während der Entschützung entfernt werden sollen, gleich oder größer als 0,01 und gleich oder kleiner als 0,9, vorzugsweise etwa 0,1, ist.

9. Verfahren gemäß einem der Ansprüche 1 bis 8, wobei das Oligonukleotid aus DNA, RNA, BNA, UNA und Abkömmlingen davon ausgewählt ist.

10. Verfahren gemäß Anspruch 9, wobei das Oligonukleotid aus BNA und Abkömmlingen davon ausgewählt ist.

11. Verfahren gemäß Anspruch 10, wobei das Oligonukleotid aus LNA, ENA und Abkömmlingen davon ausgewählt ist.

Revendications

1. Procédé pour la fabrication d'un oligonucléotide qui comprend le retrait de groupes protecteurs de β-cyanoéthyle à partir d'un oligonucléotide protégé attaché à un support solide, dans lequel ledit retrait comprend la mise en contact de l'oligonucléotide protégé dans une colonne possédant des ouvertures d'entrée et de sortie avec de 2 à 60 volumes de colonne d'une solution de 1,8-diazabicyclo[5.4.0]undéc-7-ène (DBU) dans un solvant qui comprend ou est constitué essentiellement d'un composé halogéné ou d'un composé de cyanoalkyle et dans lequel la concentration du DBU dans la solution est inférieure à 0,5 mole/litre.

2. Procédé selon la revendication 1, dans lequel la concentration de l'amine dans la solution est de 0,03 à 0,25 mole/litre.

3. Procédé selon la revendication 1 ou 2, dans lequel le solvant comprend ou est constitué essentiellement d'acétonitrile.

4. Procédé selon l'une quelconque des revendications 1 à 3, dans lequel l'oligonucléotide est mis en contact avec la solution de DBU pendant un temps de réaction de 3 à 360 minutes.

5. Procédé selon la revendication 4, dans lequel le temps de réaction est inférieur à 30 minutes.

6. Procédé selon l'une quelconque des revendications 1 à 5, dans lequel le retrait est réalisé à une température de 10°C à 60°C.

7. Procédé selon l'une quelconque des revendications 1 à 6, dans lequel la quantité totale du DBU qui est mis en contact avec l'oligonucléotide protégé est telle que le rapport molaire entre le DBU et les groupes protecteurs de β-cyanoéthyle qui sont à retirer est supérieur ou égal à 1.

8. Procédé selon l'une quelconque des revendications 1 à 6, dans lequel la quantité totale du DBU qui est mis en contact avec l'oligonucléotide protégé est telle que le rapport molaire entre le DBU et les groupes protecteurs de β-cyanoéthyle qui sont à retirer durant la déprotection est supérieur ou égal à 0,01 et inférieur ou égal à 0,9, de préférence environ 0,1.

9. Procédé selon l'une quelconque des revendications 1 à 8, dans lequel l'oligonucléotide est choisi parmi un ADN, un ARN, un BNA, un UNA et leurs dérivés.

10. Procédé selon la revendication 9, dans lequel l'oligonucléotide est choisi parmi un BNA et ses dérivés.

11. Procédé selon la revendication 10, dans lequel l'oligonucléotide est choisi parmi un LNA, un ENA et leurs dérivés.

Drawing